Mosquito arbovirus survey in selected areas of Kenya: detection of insect-specific virus

Mosquito arbovirus survey in selected areas of Kenya: detection of insect-specific virus Background: Many arboviral outbreaks have occurred in various locations in Kenya. Entomological surveys are suitable methods for revealing information about circulating arboviruses before human outbreaks are recognized. Therefore, mosquitoes were collected in Kenya to determine the distribution of arboviruses. Methods: Various species of mosquitoes were sampled from January to July 2012 using several collection methods. Mosquito homogenates were directly tested by reverse transcription-polymerase chain reaction (RT-PCR) using various arbovirus-targeted primer pairs. Results: We collected 12,569 mosquitoes. Although no human-related arboviruses were detected, Culex flavivirus (CxFV), an insect-specific arbovirus, was detected in 54 pools of 324 Culex quinquefasciatus individuals collected during the rainy season. Of these 54 positive pools, 96.3% (52/54) of the mosquitoes were collected in Busia, on the border of western Kenya and Uganda. The remaining two CxFV-positive pools were collected in Mombasa and Kakamega, far from Busia. Phylogenetic analysis revealed minimal genetic diversity among the CxFVs collected in Mombasa, Kakamega, and Busia, even though these cities are in geographically different regions. Additionally, CxFV was detected in one mosquito pool collected in Mombasa during the dry season. In addition to Culex mosquitoes, Aedes (Stegomyia) and Anopheles mosquitoes were also positive for the Flavivirus genus. Cell fusing agent virus was detected in one pool of Aedes aegypti. Mosquito flavivirus was detected in three pools of Anopheles gambiae s.l. collected in the dry and rainy seasons. Conclusions: Although no mosquitoes were positive for human-related arbovirus, insect-specific viruses were detected in various species of mosquitoes. The heterogeneity observed in the number of CxFVs in Culex mosquitoes in different locations in Kenya suggests that the abundance of human-related viruses might differ depending on the abundance of insect-specific viruses. We may have underestimated the circulation of any human-related arbovirus in Kenya, and the collection of larger samples may allow for determination of the presence of human-related arboviruses. Keywords: Arbovirus, Insect-specific virus, Culex flavivirus, Aedes mosquito, Culex mosquito, Anopheles mosquito, Busia, Kakamega, Mombasa, Kenya * Correspondence: hanako@med.u-ryukyu.ac.jp Department of Vector Ecology and Environment, Institute of Tropical Medicine, Nagasaki University, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan Department of Bacteriology, Graduate School of Medicine, University of the Ryukyus, 207 Uehara, Nishiharacho, Okinawa 903-0125, Japan Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 2 of 15 Background might be considered a factor for the emergence of arbo- Emergence and re-emergence of vector-borne diseases virus, though the function of insect-specific viruses are crucial public health problems worldwide [1, 2]. In remains unclear. Assessing the potential for arbovirus out- Kenya, many sporadic outbreaks have been reported in breaks at the local level can be facilitated by identifying all geographically different areas [3]. For example, an out- patterns of relationships, including triangular relationships break of dengue (DEN) fever occurred in the coastal (human-vector-arbovirus environment), in each area [24]. towns of Malindi and Kilifi in 1982 [4], and in 1992– Moreover, entomological baseline data may contribute to 1993, an outbreak of yellow fever (YF) occurred in Rift estimations of disease risk and allow precautionary mea- Valley Province [5]. There were outbreaks of Rift Valley sures to be taken against virus activity. In this study, we fever (RVF) in 1997 and 2006 [6–8], and an outbreak of mainly selected collection sites where other researchers chikungunya (CHIK) fever occurred in 2004 in the had previously found or suspected arbovirus activity. For coastal area of Kenya [9, 10]. In Uganda, an epidemic of example, border areas are suspected to be areas of poten- o’nyong’nyong (ONN) started in early 1959 and spread tial arbovirus infection because busy transportation hubs to Kenya [11, 12]. may provide many opportunities for human-vector In general, febrile diseases caused by viruses are still contact [25]. Although the presence of arboviruses has not confused with non-viral diseases, such as malaria [2]. yet been reported in some indigenous forests in Kenya, Moreover, cases can remain unnoticed because some many species of mosquitoes can serve as bridge vectors of arboviral infections are mild and self-limiting during the arboviruses, easily spreading sylvatic arboviruses such as early stage. Therefore, the number of human arboviral sylvatic YF and sylvatic DENV from forests to human cases might be much higher than has been reported. environments in these areas in Kenya [26]. We suspected Even in the absence of clinical outbreaks, historic sero- that arboviruses were silently circulating, without out- surveys in Kenya can provide important clues about cir- break detection. Therefore, an active survey was under- culating arboviruses in various environments [13]. For taken in border areas, including coastal boundaries and instance, Mease et al. in [14] assessed the prevalence of indigenous forests. The aim of this study was to obtain IgG against yellow fever virus (YFV), West Nile virus data regarding the presence of arboviruses in mosquitoes (WNV), dengue virus (DENV), and chikungunya virus in selected areas of Kenya. Our additional goal was to (CHIKV) using serum samples from healthy Kenyans. recognize the main vector species of arboviruses. According to their data, 46.6% of the people in all study areas had antibodies against at least one of these arbovi- Methods ruses [14]. As historic serosurveys in Kenya have docu- Study areas mented several arboviruses in geographically different Mosquito sampling was performed in eastern (Mombasa areas [15], a large epidemic of arbovirus can occur any- and Kwale) and western (Kakamega and Busia) Kenya, where at any time because, as demonstrated recently, which included a variety of areas, such as urban coastal many factors such as demographic, geographic environ- border, land border, and rural areas next to a forest where mental and climate change factors can complicate and there is suspected arbovirus activity (Fig. 1). The sampling worsen the situation [16]. Many studies have revealed was conducted in two different seasons: the rainy season that a threat of arboviral transmission is present and a season other than the rainy season; March to June throughout Kenya, regardless of the officially announced in Kenya generally constitutes the rainy season. We initi- reports of outbreaks [17, 18]. ated this study in January 2012, before the rainy season, Controlling arboviral diseases is difficult because of the which we conventionally termed the dry season. Between complex environment and ecology, including relationships January 18 and 26, 2012 (representing dry-season sam- among viruses, vectors, and humans [2, 16, 19]. Multiple pling), we conducted a preliminary survey only in eastern vector species are often involved in an arboviral disease, Kenya. Between May 9 and June 8, 2012 (representing and a single vector can also transmit several diseases. rainy-season sampling), we conducted the same survey in Moreover, primary vectors vary among geographical areas, both eastern and western Kenya. and the level of vector competence may also vary among species depending on each area [20]. Mosquitoes are ° ° known to carry not only human-related viruses but also Eastern Kenya: Mombasa (the center: 4 3.509′S; 39 40.363′E) insect-specific viruses, such as Culex flavivirus and Aedes This busy port town includes the urban coastal border flavivirus [21]. In addition, interactions between many with high levels of human activity. Dengue cases have types of viruses and many other organisms may affect been reported here for approximately the last 30 years vector competence inside the mosquito [22]. For example, [4]. We suspected that due to human activity, arboviral the presence of co-infection with insect-specific virus and mosquitoes can be easily transported outside this area. WNV has been reported [23]. In this case, co-infection Mosquitoes were collected in resident areas in the 2012 Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 3 of 15 Fig. 1 Map of study region. Location of mosquito sampling site in East Kenya; Kwale, Mombasa, and in West Kenya; Busia, Kakamega (Mukumu and Isecheno) ° ° dry season (from January 24 to January 26) and in the Western Kenya: Busia (the center: 0 27.914′N; 34 5.979′) 2012 rainy season (from May 15 to May 17). Busia is in the western land border (Kenya and Uganda) area, including a busy town with high human activity. ° ° Eastern Kenya: Kwale (the center: 4 10.525′S; 39 27.087′E) Serological surveys were conducted and revealed a high In this rural area, patches of indigenous forests (Shimba positive rate of antibodies against arboviruses in healthy Hills National Reserve) exist next to the residential area. residents [14]. In this area, many residents may have The edge of the indigenous forest can act as a border cross already suffered from arboviral diseases, with or without which arboviral mosquitoes can be transported from the for- symptoms. Transmission between humans and mosqui- est to the residential area. Mosquitoes were sampled from toes may have been underestimated due to the compli- houses in the 2012 dry season (from January 18 to January cated human activity. Mosquito surveillance can provide 20) and in the 2012 rainy season (from May 9 to May 12). other information to show the actual circulation of arbovi- ruses. Mosquitoes were collected from May 25 to May 27. Western Kenya: Kakamega (the center: 0°16.923′N; 34° 45.234′E) Mosquito sampling Kakamega forest has a remarkable diversity of insects, In each area, mosquitoes were collected for 3 consecu- birds and animals, which can serve as reservoir hosts of tive days from 13 selected houses within approximately arboviruses [27]. We selected two areas: one exactly next 0.5 km in each targeted area, except one area (for 4 to the indigenous forest (Isecheno), and another, a resi- consecutive days in Kwale in the rainy season). A dential area (Mukumu) along the main road in this region. systematic sampling method was applied for selecting The edge of the indigenous forest is considered to be a study houses in each targeted area [28]. For example, in ° ° dangerous border of arboviral activity, similar to Kwale. Kakamega, the main intersection (0 16.923′N; 34 45.234′ We suspect that the area is easily penetrable by arboviral E) on Kisumu-Kakamega Road was used as the starting mosquitoes from forests to residential areas and vice point for the systematic sampling of houses. From this versa. The main road is also regarded as a border, which point, we established 13 sampling points at 250-m inter- may encourage transmission of arboviruses. Mosquitoes vals. The nearest house from each point was then se- were collected in Mukumu from June 2 to June 4 and in lected. The house belongs to a large family (> 5 people), Isecheno from June 6 to June 8. and it was suggested because our study targets human- Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 4 of 15 related arboviruses. Another house was selected if the funestus, An. gambiae s.l., and Cx. quinquefasciatus were household head or guardian was not willing to partici- used. Moreover, both unfed and gravid mosquitoes were pate in the study. The same method was performed in combined for some pools of each species. Blood-fed other areas. Collection methods used the following traps: mosquitoes were excluded to prevent contamination of (i) CDC light traps, (ii) CDC gravid traps, and (iii) BG the virus contained in a blood meal, though we did sentinel traps. Additionally, indoor resting mosquito col- utilize blood-fed mosquitoes collected during the dry lection with hand aspirators was performed in all houses. season because of the small sample size. For the samples To use 20 traps effectively, we placed 2 types of traps collected during the rainy season, we concentrated on randomly within each of the 13 study houses. We detecting viruses in only female pools, excluding those intended to collect as many mosquitoes as possible be- that were blood-fed. cause arbovirus transmission is usually maintained at a Pooled specimens were placed in a 1.5-ml microcentri- low level in a mosquito population [29]. When the num- fuge tube with 300 μl of minimal essential medium (MEM) ber of mosquitoes collected was insufficient, the position (minimum essential medium containing 10% foetal bovine of the traps or type of traps was randomly changed. We serum, L-glutamine, penicillin, streptomycin, and ampho- used the most effective collection combination with tericin B). The mosquitoes were ground in MEM, and the positioning and type of traps at each study site. homogenate was centrifuged; 200 μlofthe supernatantwas In our study, the position of the traps depended on collected and kept at − 80 °C for future use (for cell cul- the structure of the house. CDC light traps were sus- ture). To maintain approximately 100 μl of the suspension, pended > 1.5 m above the ground inside and outside of 75 μl of lysis buffer was added. The homogenates were the houses but not near any other sources of artificial prepared using sterile, RNase-free utensils. light. CDC gravid traps were placed in a stable area somewhere inside or outside the house where nothing Total RNA extraction and virus identification by reverse could upset the medium in the pan, for example, under transcription-PCR eaves. BG sentinel traps were placed in the house with Total RNA was extracted from each pool of mosquitoes enough space or outside of the house. CDC light traps using an extraction kit (SV Total RNA Isolation System, were operated from dusk to dawn, whereas other traps Promega, Tokyo, Japan) according to the manufacturer’s were operated for 3–4 days continuously. Resting mos- instructions. RNA was eluted in 50 μl of sterile distilled quito collection was performed using oral aspirators by water. Reverse transcription reactions were performed to three persons in all rooms of the selected houses in the synthesize first-strand cDNA using RNA to cDNA EcoDry early morning for 15 min each day; this occurred during Premix (Random Hexamers) (Clontech Laboratories, Inc., all collection periods when the house was visited to re- Mountain View, CA, USA). The cDNA was amplified by move the mosquito-sampling bags from the traps. To PCR using an AccuPower PCR Premix Kit (Bioneer Co., prevent RNA degradation, the captured mosquitoes were Daejon, Korea) with virus-specific primers (Table 1), and kept alive during transfer to the laboratory. the products were evaluated by 1.5% agarose gel electro- phoresis. For all positive samples, products of the expected Mosquito identification size were extracted from the gel and were purified using a At the laboratory, the collected mosquitoes were killed MonoFas DNA Purification Kit (GL Sciences, Tokyo, at − 20 °C and placed on white filter paper in a Petri dish Japan). Purified amplicons were bidirectionally sequenced placed on a chill table and identified morphologically to using a BigDye Terminator version 3.1 Cycle Sequencing the species level under a stereoscopic microscope using Kit (Applied Biosystems, Foster City, CA, USA) and ana- published keys [30–33]. For accurate identification, lyzed with an ABI3130 Genetic Analyzer (Applied Biosys- Aedes aegypti, Culex quinquefasciatus, Anopheles funes- tems). Nucleic acid sequences were compared with those in tus,and An. rivulorum were confirmed by polymerase the GenBank database using the BLAST program. chain reaction (PCR) using specific primers (Table 1). The process was repeated for three universal primers for flavivirus (the main targets are DENV, YFV, and Mosquito processing WNV), two universal primers for alpha viruses (the A maximum of 30 individuals were pooled according to main targets are ONN virus and CHIKV) and single species, sex, physiological status, (i.e., unfed, blood fed, primer sets for RVFV (phlebovirus) (Table 1). For flavi- or gravid), and collection site and then were frozen in viruses and alpha viruses, we prepared multiple primer liquid nitrogen. For virus detection, we used all pools sets to detect not only a well-known virus but also novel collected during the dry season, with each category viruses. In the case of flavivirus detection, all pools were (male, unfed, fed and gravid) examined separately. In initially screened for flavivirus RNA by using universal contrast, for the pools collected during the rainy season, flavivirus primer sets cFD2 and MAMD, which target only unfed and gravid mosquito pools of Ae. aegypti, An. the non-structural protein 5 (NS5) gene. To identify Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 5 of 15 Table 1 Primers used to detect and to sequence arbovirus from mosquito pools in Kenya Target Primer name Nucleotide sequence Polarity Product (bp) Cycle condition Reference (5′ to 3′) Universal primers MAMD AACATGATGGGRAARAGRGARAA Forward 252 94°C, 2 min, 1 cycle; Scaramozzino et al. for flavivirus 94°C, 1 min, 53°C, (2001) [48] cFD2 GTGTCCCAGCCGGCGGTGTCATCAGC Reverse 1 min, 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Universal primers FLAVI-1 AATGTACGCTGATGACACAGCTGGCT Forward 854–863 94°C, 5 min, 1 cycle; Ayers et al.(2006) [49] for flavivirus GGGACAC 94°C, 1 min, 58°C, 1 min, 72°C, 90 s, FLAVI-2 TCCAGACCTTCAGCATGTCTTCTGTTGT Reverse 45 cycles; 72°C, CATCCA 10 min, 1 cycle Universal primers for YF-1 GGTCTCCTCTAACCTCTAG Forward 675 94°C, 2 min, 1 cycle; Tanaka et al. (1993) flavivirus (mainly YF) 94°C, 30 s, 53°C, 30 s, [50] YF-3 GAGTGGATGACCACGGAAGACATGC Reverse 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Universal primers for nsP1-S TAGAGCAGGAAATTGATCC Forward 354 94°C, 2 min, 1 cycle; Hasebe et al. (2002) alpha viruses (mainly 94°C, 30 s, 53°C, 30 s, [51] nsP1-C CTTTAATCGCCTGGTGGTA Reverse chikungunya and 72°C, 45 s, 35 cycles; o’nyong’nyong viruses) 72°C, 5 min, 1 cycle Universal primers for E1-S TACCCATTCATGTGGGG Forward 294 94°C, 2 min, 1 cycle; Hasebe et al. (2002) alpha viruses (mainly 94°C, 30 s, 53°C, 30 s, [51] E1-C GCCTTTGTACACCACGAT Reverse chikungunya and 72°C, 45 s, 35 cycles; o’nyong’nyong viruses) 72°C, 5 min, 1 cycle Rift Valley virus RVF009 CCAAATGACTACCAGTCAGC Forward 400–500 94°C, 2 min, 1 cycle; Jupp et al. (2000) 94°C, 30 s, 50°C, 30 s, [52] (modified) RVF007 GACAAATGAGTCTGGTAGCA Reverse 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Mosquito RNA marker Act-2F ATGGTCGGYATGGGNCAGAAGGACTC Forward 683 94°C, 2 min, 1 cycle; Staley et al. (2010) 94°C, 30 s, 54°C, 30 s, [53] Act-8R GATTCCATACCCAGGAAGGADGG Reverse 72°C, 45 s, 35 cycles; 72°C, 5 min, 1 cycle Culex quinquefaciatus ACEpip GGAAACAACGACGTATGTACT Forward 610 94°C, 5 min, 1 cycle; Kasai et al. (2008) [39] 94°C, 30 s, 54°C, 30 s, ACEquin CCTTCTTGAATGGCTGTGGCA Forward 274 72°C, 1 min, 35 cycles; 72°C, B1246s TGGAGCCTCCTCTTCACGG Reverse 5 min, 1 cycle Aedes aegypti 18SFHIN GTAAGCTTCCTTTGTACACACCGCCCGT Forward 550 97°C, 4 min, 1 cycle; Higa et al. (2010) [54] 96°C, 30 s, 48°C, 30 s, aeg.r1 TAACGGACACCGTTCTAGGCCCT Reverse 72°C, 2 min, 30 cycles; 72°C, 4 min, 1 cycle Anopheles funestus, UV TGTGAACTGCAGGACACAT Forward 94°C, 2 min, 1 cycle; Koekemoer et al. Anopheles rivulorum 94°C, 30 s, 45°C, 30 s, (2002) [55] FUN GCATCGATGGGTTAATCATG Reverse 505 72°C, 40 s, 30 cycles; 72°C, 5 min, 1 cycle RIV CAAGCCGTTCGACCCTGATT Reverse 411 Note: Each 25 μl reaction mixture contained. (Accupower TM PCR PreMix kit with 2 μl template, 15.2 μl sterile water, and 1.4 μl of 100 pmol/μl each of primers) human-related flaviviruses, such as DENV, YFV, and protein 1 (nsP1) and glycoprotein E1 (E1) were used for WNV, all pools were screened with primer sets YF-1 and amplification. YF-3. To generate a larger NS5 cDNA segment for The following inactivated viruses available in the sequencing, putative positive samples detected using laboratory were used as positive controls: DEN-1 previous primer sets (cFD2 and MAMD) were again (Hawaii strain), YFV (17D strain, attenuated live vaccine screened for flavivirus RNA using another universal strain), WNV (NY99 strain), CHIKV (S27 strain, African flavivirus primer set (FLAVI1 and FLAVI2) targeting the prototype), RVFV (Smithburn strain, attenuated live NS5 gene. Confirmed bands of approximately 860 bp vaccine strain) (All positive controls were kindly pro- were sequenced as described above. In the case of alpha vided by Dr. S Inoue). As a quality control for the detec- virus detection, primer sets (nsP1-S and nsP1-C; E1-S tion step, each cDNA was checked by PCR using the and E1-C) designed based on the genes non-structural mosquito β-actin primer. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 6 of 15 Calculation of infection rates using MEGA6 with the ClustalW method [35]. Phylogen- We calculated the minimum infection rate (MIR) of etic and molecular evolutionary analyses were conducted arboviruses in each mosquito species at each site using the by using the p-distance option with the neighbor-joining Poolscreen2 program [34]. MIRisexpressedasthenumber (NJ) method. Bootstrap analyses were performed with of pools infected per 1000 mosquitoes tested, and it assumes 1000 replicates. Representative flavivirus sequences were that only one mosquito is positive in a pool. To determine the used in the phylogenetic analysis as outgroup sequences. number of flavivirus-positive samples, the results using primer sets cFD2 and MAMD were employed. MIR was calculated Results when at least 100 mosquitoes were tested per species per site. Mosquito collection During the dry season in eastern Kenya (Table 2) Phylogenetic analysis In Kwale (January 18–20, 2012), we employed a cumula- For virus species identification, the collected sequences tive number of 39 trap sessions (per day per house) in were confirmed by an alignment search in gene databases 13 houses for 3 days (total numbers of each trap session Table 2 Summary of mosquitoes collected in the dry season in East Kenya Study site Kwale Mombasa Collection methods employed (number of trap sessions) As; 39, BG; 12, CDC; 15, GT; 12 As; 39, BG; 12, CDC; 15, GT; 12 Methods collected mosquitoes (number of trap sessions) As; 7, BG; 3, CDC; 10, GT; 6 As; 33, BG; 7, CDC; 14, GT; 12 Collection period January 18–20, 2012 (3 days) January 24–26, 2012 (3 days) Number of houses 13 houses 13 houses Species Physiological status No. collected Pools Positive pool No. collected Pools Positive pool Ae. aegypti Fed 2 1 0 Unfed 3 3 0 16 2 0 An. coustani Fed 1 1 0 An. funestus Fed 1 1 0 An. gambiae s.l. Fed 3 1 0 Unfed 8 1 1 2 1 1 An. longipulpis Fed 1 1 0 An. rivulorum Fed 4 1 0 Anopheles sp. Male 1 1 0 Cx. cinereus Gravid 1 1 0 Cx. decens Unfed 2 1 0 Gravid 4 1 0 Cx. quinquefasciatus Male 15 1 0 235 10 1 Fed 30 2 0 105 6 0 Unfed 19 1 0 375 13 0 Gravid 64 4 0 129 7 0 Cx. laticinctus Gravid 5 1 0 Cx. simpsoni Male 1 1 0 Unfed 2 1 0 Cx. univiittetus Unfed 2 1 0 Culex sp. Male 1 1 0 Unfed 1 1 0 3 1 0 Mansonia sp. Fed 2 1 0 Unfed 8 1 0 Others Male 2 Unfed 3 Total 179 26 1 872 44 2 Abbreviations of collection methods are As aspirator, BG: BG sentinel trap, CDC:CDC light trap, GT CDC gravid trap Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 7 of 15 per day per house were 12 BG sentinel, 15 CDC light, employed a cumulative number of 51 trap sessions (per and 12 CDC gravid trap sessions) and a cumulative day per house) in 13 houses for 3 days (total numbers of number of 39 aspirator catch sessions (per day per each trap sessions per day per house were 15 BG senti- house) in 13 houses for 3 days using a 3-person aspirator nel, 18 CDC light, and 18 CDC gravid trap sessions) and catch team in each house. We collected 179 mosquitoes a cumulative number of 39 aspirator catches (per day in the following subset of attempts: 3 BG sentinel trap per house) in 13 houses for 3 days using 3-person aspir- sessions, 10 CDC light trap sessions, 6 CDC gravid trap ator catch team in each house. We collected 2087 mos- sessions, and 7 aspirator catches. In Mombasa (January quitoes in the following subset of attempts: 13 BG 24–26, 2012), we collected 872 mosquitoes by the same sentinel trap sessions, 16 CDC light trap sessions, 15 cumulative number of trap sessions as in Kwale. The CDC gravid trap sessions, and 34 aspirator catches. In collection methods entailed 7 BG sentinel trap sessions, Kakamega (Isecheno) (June 6–8, 2012), we employed a 14 CDC light trap sessions, 12 CDC gravid trap sessions, cumulative number of 57 trap sessions (per day per and 33 aspirator catches. The total number of mosqui- house) in 13 houses for 3 days (total numbers of trap toes collected in Kwale and Mombasa was 1051. Of sessions per day per house were 15 BG sentinel, 21 CDC these mosquitoes, 796 (75.7%) were identified as females. light, and 21 CDC gravid trap sessions) and a cumulative For these samples collected during the dry season, all number of 39 aspirator catch sessions (per day per species were tested, including males of each species (70 house) in 13 houses for 3 days using a 3-person aspirator pools) (Table 2). Only five mosquitoes were not identi- catch team in each house. We collected 267 mosquitoes fied and were excluded. in the following subset of attempts: 8 BG sentinel trap sessions, 11 CDC light trap sessions, 17 CDC gravid trap During the rainy season in eastern and western Kenya sessions, and 20 aspirator catches. (Table 3) In total, we collected 11,518 mosquitoes at all sam- In Kwale (May 9–12, 2012), we employed a cumulative pling sites. Of these mosquitoes collected during the number of 57 trap sessions (per day per house) in 13 rainy season, 8663 (75.2%) were identified as female. houses for 4 days (total numbers of each trap session Only unfed and gravid female mosquitoes (414 pools) per day per house were 30 BG sentinel, 16 CDC light, were used for virus detection in samples collected dur- and 22 CDC gravid trap sessions) and a cumulative ing the rainy season (Table 4). The number of mosqui- number of 48 aspirator catches (per day per house) in toes collected in Kakamega (Isecheno) was one order of 13 houses for 4 days using a 3-person aspirator catch magnitude lower than that collected at the other study team in each house. We collected 2592 mosquitoes in sites. the following subset of attempts: 25 BG sentinel trap sessions, 11 CDC light trap sessions, 22 CDC gravid trap Arbovirus detection sessions, and 42 aspirator catches. In Mombasa (May Overall, 484 pools consisting of 7788 mosquitoes were 15–17, 2012), we employed a cumulative number of 42 tested. The selected species collected in both seasons for trap sessions (per day per house) in 13 houses for 3 days the detection of arbovirus were Ae. aegypti (41 pools), (total numbers of trap sessions were 13 BG sentinel An. funestus (8 pools), An. gambiae s.l. (47 pools), An. traps, 12 CDC light traps, and 17 CDC gravid traps) and rivulorum (5 pools), and Cx. quinquefasciatus (368 a cumulative number of 30 aspirator catch sessions (per pools). The following species of mosquitoes collected day per house) in 13 houses for 3 days using a 3-person during only the dry season from East Kenya were also aspirator catch team in each house. We collected 1974 used for detection: An. coustani (1 pool), An. longipalpis mosquitoes in the following subset of attempts: 12 BG (1 pool), Cx. cinereus (1 pool), Cx. decens (2 pools), Cx. sentinel trap sessions, 11 CDC light trap sessions, 17 laticinctus (1 pool), Cx. simpsoni (2 pool), Cx. univitta- CDC gravid trap sessions, and 28 aspirator catches. In tus (1 pool), Anopheles sp. (1 pool), Culex sp. (3 pools) Busia (May 25–27, 2012), we employed a cumulative and Mansonia sp. (2 pools). Although we collected 2 in- number of 45 trap sessions (per day per house) in 13 dividuals of Cx. decens (1 male and 1 female from Ise- houses for 3 days (total numbers of trap sessions were cheno), Cx. simpsoni (1 female from Busia), and Cx. 18 BG sentinel, 12 CDC light, and 15 CDC gravid trap univittatus (1 female from Busia) during the rainy sea- sessions) and a cumulative number of 36 aspirator catch son, we did not use these specimens for detection be- sessions (per day per house) in 13 houses for 3 days cause of their small sample numbers compared to all using 3-person aspirator catch team in each house. We other pools during the rainy season. collected 4598 mosquitoes in the following subset of at- tempts: 17 BG sentinel trap sessions, 12 CDC light trap Human-related arboviruses from all mosquitoes sessions, 15 CDC gravid trap sessions, and 36 aspirator All pools were negative for human-related arboviruses, catches. In Kakamega (Mukumu) (June 2–4, 2012), we such as DENV, YFV, WNV, ONN, and CHINV. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 8 of 15 Table 3 Summary of mosquitoes collected in the rainy season in East and West Kenya Study area East Kenya East Kenya West Kenya West Kenya West Kenya Study site Kwale Mombasa Busia Kakamega (Mukumu) Kakamega (Isecheno) Collection methods employed As; 48, BG; 30, CDC; 16, GT; 22 As; 30, BG; 13, CDC; 12, As; 36, BG; 18, CDC; 12, As; 39, BG; 15, CDC; 18, As; 39, BG; 15, CDC; 21, (number of trap sessions) GT; 17 GT; 15 GT; 18 GT; 21 Methods collected mosquitoes As; 42, BG; 25, CDC; 11, GT; 22 As; 28, BG; 12, CDC; 11, As; 36, BG; 17, CDC; 12, As; 34, BG; 13, CDC; 16, As; 20, BG; 8, CDC; 11, (number of trap sessions) GT; 17 GT; 15 GT; 15 GT; 17 Collection period (days) May 9–12, 2012 (4 days) May 15–17, 2012 (3 days) May 25–27, 2012 (3 days) June 2–4, 2012 (3 days) June 6–8, 2012 (3 days) Number of houses 13 houses 13 houses 13 houses 13 houses 13 houses Species Physiological No. Pool Positive pool No. Pool Positive pool No. Pool Positive pool No. Pool Positive pool No. Pool Positive pool status collected collected collected collected collected Aedes sp. Male 2 Unfed 3 2 1 1 Ae. aegypti Male 2 Unfed 11 8 0 49 14 1 48 0 3 3 0 2 2 0 Gravid 2 7 6 1 1 An. brumripes Unfed 1 2 An. funestus Male 3 Fed 5 Unfed 59 7 0 Gravid 2 An. gambiae s.l. Male 22 Fed 2 37 3 Unfed 18 3 0 402 34 1 3 4 0 3 3 0 Gravid 9 1 An. garnhami Fed 1 Unfed 6 An. parensis Unfed 1 An. rivulorum Unfed 4 3 0 Gravid 11 0 Anopheles sp. Male 1 Fed 2 Unfed 6 2 1 Gravid 1 Cx. decens Male 1 Gravid 1 Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 9 of 15 Table 3 Summary of mosquitoes collected in the rainy season in East and West Kenya (Continued) Study area East Kenya East Kenya West Kenya West Kenya West Kenya Cx .quinquefasciatus Male 355 540 1554 332 38 Fed 202 351 331 840 79 * *** ** Unfed 106 106 0 443 52 1 1243 113 52 472 46 1 53 7 0 Gravid 1867 554 906 431 79 Cx. simpsoni Unfed 1 Cx. univiittetus Unfed 1 Culex sp. Male 3 Fed 3 1 Unfed 4 2 1 0 Gravid 1 1 3 Lutzia Gravid 2 Others Male 2 Unfed 1 15 3 Gravid 1 Total 2592 117 0 1974 66 2 4598 165 53 2087 54 1 267 12 0 Note: We used only unfed and gravid mosquitoes for the pools to detect arboviruses. Unfed and gravid mosquitoes were separated into each category, but some of them were combined into one pool The pool comprised only gravid mosquitoes ** The pool comprised only unfed mosquitoes ***Pools consisted of unfed and gravid mosquitoes Abbreviations of “collection methods” are As aspirator, BG BG sentinel trap, CDC CDC light trap, GT CDC gravid trap Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 10 of 15 Table 4. Information of positive samples for insect specific arbovirus Places Season Species of No. of Physiological status No. pools No. positive MIR MIR Lower-upper Physiological status mosquito mosquitoes of used pools pools limits of positive pool Ae. aegypti mosquito pools Kwale Dry Ae. aegypti 3 Unfed 3 0 NA NA Kwale Rain Ae. aegypti 13 Unfed, gravid 8 0 NA NA Mombasa Dry Ae. aegypti 18 Fed, unfed 3 0 NA NA Mombasa Rain Ae. aegypti 56 Unfed, gravid 14 1 NA NA Female, gravid (♂; excluded) Busia Rain Ae. aegypti 10 Unfed, gravid 8 0 NA NA Kakamega Rain Ae. aegypti 4 Unfed, gravid 3 0 NA NA (Mukumu) Kakamega Rain Ae. aegypti 3 Unfed, gravid 2 0 NA NA (Isecheno) Cx. quinquefasciatus mosquito pools Kwale Dry Cx. 128 ♂, fed, unfed, 8 0 NA NA quinquefasciatus gravid Kwale Rain Cx. 1973 Unfed, gravid 106 0 NA NA quinquefasciatus (♂, fed; excluded) Mombasa Dry Cx. 844 ♂, fed, unfed, 36 1 1.18 0.07–5.75 ♂ quinquefasciatus gravid Mombasa Rain Cx. 997 Unfed, gravid 52 1 1.01 0.06–4.89 Female, gravid quinquefasciatus (♂, fed; excluded) Busia Rain Cx. 2149 Unfed, gravid 113 52 32.26 24.42–42.12 Female, unfed + quinquefasciatus (♂, fed; excluded) gravid Kakamega Rain Cx. 903 Unfed, gravid 46 1 1.11 0.06–5.37 Female, unfed (Mukumu) quinquefasciatus (♂, fed; excluded) Kakamega Rain Cx. 132 Unfed, gravid 7 0 NA NA (Isecheno) quinquefasciatus (♂, fed; excluded) An. gambiae mosquito pools Kwale Dry An. gambiae 11 Fed, unfed 2 1 NA NA Female, unfed Kwale Rain An. gambiae 18 Unfed, (fed; 3 0 NA NA excluded) Mombasa Dry An. gambiae 2 Unfed 1 1 NA NA Female, unfed Mombasa Rain An. gambiae00 0 NANA Busia Rain An. gambiae 411 Unfed, gravid 34 1 2.44 0.14–11.87 Female, unfed (♂, fed; excluded) Kakamega Rain An. gambiae 4 Unfed, gravid 4 0 NA NA (Mukumu) Kakamega Rain An. gambiae 3 Unfed (fed; 3 0 NA NA (Isecheno) excluded) Minimum infection rate Mosquito-related arboviruses from Culex quinquefasciatus we limited our analysis to female mosquitoes only, Busia Using the primer sets cFD2 and MAMD, PCR bands yielded the most positive pools (52 pools) followed by were observed for 54 female Cx. quinquefasciatus pools Bamburi (1 pool) and Mukumu (1 pool). during the rainy season and 1 male Cx. quinquefasciatus To generate a larger NS5 cDNA segment for sequen- pool during the dry season in Mombasa (Tables 2 and cing to be used in phylogenetic analyses, only pools that 3). The nucleotide sequences for positive PCR reactions were positive for flavivirus using the primer sets cFD2 amplified using the primer sets cFD2 and MAMD from and MAMD were amplified with the primer sets FLAVI1 all these pools were compared with the GenBank data- and FLAVI2. Bands of approximately 860 nt (597 nt was base (BLAST), and sequencing results of all samples used) were observed, and nucleotide sequencing was were 99% identical to the homologous region of Culex successful for 22 pools of Cx. quinquefasciatus (21 fe- flavivirus (CxFV) strain Uganda08 (GQ165808.1). When male pools and 1 male pool) among 55 pools (54 female Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 11 of 15 pools and 1 male pool). The genomic sequences ob- Other Cx. quinquefasciatus pools revealed only one tained using both primer sets (FLAVI1 and FLAVI2) positive pool, with an MIR of approximately 1.0 share similar nucleotide sequence identity (99%) with (Table 4). Furthermore, taking into account differences CxFV from Uganda (GenBank: GQ165808.1). This result in sampling efficiency among the study sites, seasons was the same as that using the primer sets cFD2 and and traps, the Cx. quinquefasciatus specimens collected MAMD. A phylogenetic tree was constructed with the in Busia showed a higher MIR (MIR = 32.26; 95% CI = NJ method using NS5 gene sequences of 22 CxFV 24.42–42.12) than those collected in Mombasa during strains by adding CxFV NS5 gene sequences from the rainy season (MIR = 1.01; 95% CI = 0.06–4.89) and Uganda (GenBank: GQ165808.1) and Guatemala (Gen- during the dry season (MIR = 1.18; 95% CI = 0.07–5.75), Bank: EU805806) obtained from BLAST. Additionally, and those collected in Kakamega during the rainy season NS5 gene sequences of human-related flaviviruses, such (MIR = 1.11; 95% CI = 0.06–5.37). CxFV was detected in as WNV (GenBank: DQ118127.1, GenBank: AF202541), Mombasa during the dry season in a male pool as well DNV (GenBank: AY099336.1, GenBank: AF326825.1, as in female pools; however, there were no positive GenBank: U87411.1), and Japanese encephalitis virus samples found in female pools during the dry season. (GenBank: M18370.1), were included as outgroup se- No differences in MIR were found between the dry and quences. The NS5 gene sequences of our samples from rainy seasons in Mombasa, even though the pools of Kenya clustered with CxFV NS5 gene sequences from male and fed mosquitoes collected in the rainy season Uganda and Guatemala. Although Busia, Kakamega, and were not tested. Because of the limited number of sam- Mombasa are in completely different regions of Kenya, ples, it is uncertain whether heterogeneity exists among the phylogenetic tree shows sequence similarity (Fig. 2). Ae. aegypti and An. gambiae MIRs. Mosquito-related arboviruses from Ae. aegypti and An. Discussion gambiae In this study in Kenya, we did not detect any human-related The PCR products using the primer sets FLAVI1 and arboviruses, and the main vector species of arboviruses were FLAVI2 for one pool of Ae. aegypti were shown to corres- not found. Instead, we did detect mosquito-specific arbovi- pond to cell-fusing agent virus (CFAV) (NC_001564.1, 96% ruses from many types of mosquitoes. In particular, high BLAST identity). In terms of An. gambiae s.l. pools, PCR prevalence of CxFV is Cx. quinquefasciatus was found in products using the same primer sets as above were ob- Busia, and this strain of CxFV is similar to one reported in served for three female pools, consisting of one pool from Uganda by Cook et al. [37, 38]. Additionally, a similar CxFV Kwale and one pool from Mombasa (both collected during was detected in each female pool from Mombasa and the dry season) and one pool from Busia (collected during Kakamega. These areas in Kenya are separated by great dis- the rainy season). The nucleotide sequencing results of the tances. Additional sampling in the area between Busia and two samples collected in Kwale and Mombasa were similar Kakamega in western Kenya and in the area between Kaka- to mosquito flavivirus sequences (KM088036.1 and mega and Mombasa in middle to eastern Kenya will likely KM088037.1, 99% BLAST identity) reported from Kenya. increase the precision of the data regarding CxFV preva- The sequence of the sample collected from one pool from lence and geographic variation in Kenya. At present, the Busia was moderately divergent from the other two, being consequences of this geographic variation in Kenya are not most similar a sequence of Anopheles flavivirus (KX148546. clear. Moreover, we detected CxFV in one male pool col- 1, 85% BLAST identity) reported from Liberia. According lected in Mombasa. This result suggests that vertical main- to Kuno et al., a viral species is defined as the same group tenance may be common, even though Mombasa is an area of viruses with > 84% nucleotide sequence identity among with a lower positive rate compared to Busia. them [36]. Our sequence analysis demonstrated slightly Although many studies have reported mosquito- higher nucleotide sequence identity than this cut-off. There- specific flavivirus detection in Culex and Aedes [39], fore, the viruses from An. gambiae s.l. collected in Busia there is little information about flaviviruses from anoph- represent a variant of the closely related Anopheles flavivi- eline mosquitoes, except for a few recent reports from rus. Thephylogeneticanalyses including arboviruses from Africa [40, 41]. In addition to Ae. aegypti, we also ob- Cx. quinquefasciatus are presented in Fig. 2. tained flavivirus sequences from An. gambiae s.l. Our phylogenetic data using flavivirus NS5 gene sequences Minimum infection rate (MIR) suggest that the sequences from Ae. aegypti are related Although our study sites were geographically limited, to CFAV and that the sequences from An. gambiae s.l. MIR for Cx. quinquefasciatus showed a heterogeneous are most closely related to mosquito flaviviruses distribution for this species among the selected sites. (KM088037.1 and KM088036.1) from An. gambiae s.l. in Busia was the region with the highest MIR among all West Africa and Kenya [40, 41]. Overall, reports of Cx. quinquefasciatus pools collected in Kenya (Table 4). mosquito-specific flaviviruses are increasing. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 12 of 15 Fig. 2 (See legend on next page.) Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 13 of 15 (See figure on previous page.) Fig. 2 Phylogenetic tree of the positive sequences based on the 597 nucleotides of the NS5 gene. The tree was constructed by employing the program MEGA 6, using the neighbor-joining method and distance-p model with 1000 bootstrap replicates. GenBank accession numbers are indi- cated in the parenthesis in the tree. Numbers on internal branches indicate bootstrap values for 1000 replicates. Our samples are marked with star (Cx. quinquefasciatus), with circle (Ae. aegypti), and with diamond shape (An. gambiae) Our results are based on partial sequences (NS5) of data for 2010, the virus with the highest positive rate flaviviruses directly detected in mosquitoes. However, was WNV (31% of 296 tested) followed by YFV (17% other regions of flavivirus nucleotide sequences (such as of 310 tested) and CHIV (11% of 298 tested) [45]. a region of NS3) were not determined, and there is a Moreover, there is an anecdotal report that the WNV possibility that these sequences differ. Thus, further se- infection rate might be higher than that reported be- quence information might be required, especially for a cause many infections are not obvious or are mild novel mosquito flavivirus, to establish the detailed taxo- among those who live on the border of Kenya and nomic status of arboviruses. None of the mosquitoes in Uganda, where this virus was first isolated in 1937 our samples were infected with human-related flavi- [46]. Regardless, the detection of human-related arbo- viruses, though the detection rate might have been viruses in mosquitoes is very difficult in the absence slightly higher if we had performed cell culture. Another of an outbreak. Our results, which indicate relatively limitation is the small sample size, and the number of high CxFV positivity among Cx. quinquefasciatus mosquito species was also small. Larger studies are mosquitoes in Busia, might support risk prediction needed to provide a more accurate view of the preva- for future patterns of epidemics of arboviral infection. lence of arboviruses. Onepreviousstudy reported apositiveassociationbe- Additionally, the abundance of Ae. aegypti, one of the tween insect-specific flaviviruses and human-related most effective arboviral vectors in the human environ- arboviruses, such as WNV [23]. Interestingly, Bolling ment, obtained was relatively smaller than we expected. et al. [47] identified early suppression of WNV infec- This mosquito is thought to have originated from Africa tion in Culex pipiens naturally infected with CxFV. and to have been introduced to other continents such as This suppression is one of the possible explanations Asia and South America through maritime trade [1]. for the lack of arbovirus detection, despite the high Because this mosquito can easily adapt to urban areas prevalence of CxFV in Cx. quinquefasciatus in our on these continents, DENV transmitted by Ae. aegypti study. Thus, it is important to determine whether has become a major threat to humans. In this study, mosquitoes infected with mosquito-specific flavi- there were no positive pools of arboviruses, including viruses are resistant or susceptible to infection with DEN and CHIK, among 107 female Ae. aegypti samples. other human-related flaviviruses. Future research on It is clear that this small sample size is insufficient. Add- these viruses and their potential interactions with itionally, due to this small sample size, the existence of other flaviviruses in arthropod vectors will provide another important vector, Aedes albopictus, cannot be important new insight into not only virological but determined, even though the distribution of this Asian- also public health aspects. based mosquito has already been extended throughout the world, including West and Central Africa [42, 43]. Conclusions Currently, this mosquito is not reported in Kenya. How- Insect-specific viruses were detected in various species ever, methods of collecting Aedes mosquitoes in Kenya of mosquitoes. In particular, the abundance of CxFV in remain an issue. We recognize that the effectiveness of Culex mosquitoes in Busia is higher than in other areas the BG sentinel trap is quite low in certain areas such as of Kenya. We suspect that this heterogeneity in various Africa [44], though we did not analyze the effectiveness areas of Kenya may reflect the heterogeneity of the of each trap. abundance of human-related virus vectors. These Here, we report the detection of CxFV from Cx. results, together with the absence of positive pools of quinquefasciatus,CFAV from Ae. aegypti,mosquito human-related arbovirus, can be used as a baseline for flavivirus from An. gambiae s.l., and a new virus from future studies of human arboviruses. Future efforts to An. gambiae s.l. However, we did not detect any ar- detect the circulation of arboviruses will help clarify the boviruses that are responsible for human disease. relationship between human-related arboviruses and Many individuals might be exposed to a considerable various arboviruses, including insect-specific viruses. risk of arbovirus infection in Kenya. Muyeku et al. re- Detection methods that are more sensitive, such as next- ported the seroprevalence of CHIKV, YFV, and WNV generation sequencing (NGS), will facilitate obtaining in children at a hospital in Busia. According to their real data about the presence of arboviruses. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 14 of 15 Abbreviations 2. Weaver SC, Reisen WK. Present and future arboviral threats. Antivir Res. CFAV: Cell-fusing agent virus; CHIKV: Chikungunya virus; CxFV: Culex flavivirus; 2010;85:328–45. DEN: Dengue; DENV: Dengue virus; MIR: Minimum infection rate; 3. Sutherland LJ, Cash AA, Huang YJ, Sang RC, Malhotra I, Moormann AM, et NJ: Neighbor-joining; ONN: O’nyong’nyong; PCR: Polymerase chain reaction; al. Serologic evidence of arboviral infections among humans in Kenya. Am J RVF: Rift Valley fever; WNV: West Nile virus; YF: Yellow fever; YFV: Yellow fever Trop Med Hyg. 2011;85:158–61. virus 4. Johnson BK, Ocheng D, Gichogo A, Okiro M, Libondo D, Kinyanjui P, et al. Epidemic dengue fever caused by dengue type 2 virus in Kenya: preliminary results of human virological and serological studies. East Afr Med J. 1982;59: Acknowledgements 781–4. We are deeply grateful to Dr. Kouichi Morita, Dr. Yoshio Ichinose, Dr. Masaaki Shimada, Dr. Charles Mwandawiro, Dr. Futoshi Hasebe, Dr. Shingo Inoue, Dr. 5. Sanders EJ, Marfin AA, Tukei PM, Kuria G, Ademba G, Agata NN, et al. First Kazuhiko Moji, Dr. Matilu Mwau, and Mr. Haruki Kazama for technical support recorded outbreak of yellow fever in Kenya, 1992-1993. I. Epidemiologic and Ms. Yukie Saito and Ms. Junko Sakemoto for providing administrative investigations. Am J Trop Med Hyg. 1998;59:644–9. support. Special thanks go to Mr. Matthew Munyao, Mr. Johnstone Muyodi, 6. Nguku PM, Sharif S, Mutonga D, Amwayi S, Omolo J, Mohammed O, et al. Ms. Jecinta Odeo Lumumba, Mr. James Omondi Kongere, Ms. Mercy An investigation of a major outbreak of Rift Valley fever in Kenya: 2006– Syombua Mwania, Ms. Scholastica Achieng Wagalla, and Dr. Yuki Takamatsu, 2007. Am J Trop Med Hyg. 2010;83(2 Suppl):05–13. who devoted themselves to the fieldwork and experiments. Finally, we wish 7. Woods CW, Karpati AM, Grein T, McCarthy N, Gaturuku P, Muchiri E, et al. An to express our gratitude to the residents of Kwale, Mombasa, Busia, and outbreak of Rift Valley fever in Northeastern Kenya, 1997-98. Emerg Infect Kakamega who participated in this study. Dis. 2002;8:138–44. 8. Crabtree M, Sang R, Lutomiah J, Richardson J, Miller B. Arbovirus surveillance of mosquitoes collected at sites of active Rift Valley fever virus transmission: Funding Kenya, 2006–2007. J Med Entomol. 2009;46(4):961–4. This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan; 9. Sergon K, Njuguna C, Kalani R, Ofula V, Onyango C, Konongoi LS, et al. Young Researcher Overseas Visits Program for Vitalizing Brain Circulation, Seroprevalence of chikungunya virus (CHIKV) infection on Lamu Island, MEXT, Japan; the Global COE program, MEXT, Japan; the Japan Initiative for Kenya, October 2004. Am J Trop Med Hyg. 2008;78:333–7. Global Network on Infectious Diseases (J-GRID), MEXT, Japan; and a Grant-in- 10. Charrel RN, De Lamballerie X, Raoult D. Chikungunya outbreaks - the Aid for Scientific Research from the Ministry of Health, Labour, and Welfare, globalization of vectorborne diseases. N Engl J Med. 2007;356:769–71. Japan, Nagasaki University Kenya Research Station NUITM-KEMRI Project. 11. Haddow AJ, Davies CW, Walter AJ. O’nyong-nyong fever: an epidemic virus disease in East Africa - introduction. Trans R Soc TropMed Hyg. 1960;54:517–22. 12. Williams MC, Woodall JP, Corbet PS, Gillett JD. O’nyong-nyong fever: an Availability of data and materials epidemic virus disease in East Africa. 8. Virus isolations from anopheles Raw data can be obtained from the corresponding author upon request. mosquitoes. Trans R Soc Trop Med Hyg. 1965;59:300–6. https://doi.org/10. 1016/0035-9203(65)90012-X. Authors’ contributions 13. Geser A, Henderson BE, Christensen S. A multipurpose serological survey in HI, YH, KF, and NM conceived and designed this study. SN helped design and Kenya. 2. Results of arbovirus serological tests. Bull World Health Organ. plan the study in Kenya. HI, YH, KF, and PA collected the field data, and HI, YH, 1970;43:539–52. and KF organized and conducted the laboratory work. HI and TN performed 14. Mease LE, Coldren RL, Musila LA, Prosser T, Ogolla F, Ofula VO, et al. the data analyses. HI drafted the first manuscript, and HI and NM finalized the Seroprevalence and distribution of arboviral infections among rural Kenyan manuscript. All authors have read and approved the final manuscript. adults: a cross-sectional study. Virol J. 2011;8:371. 15. Sang RC, Dunster LM. The growing threat of arbovirus transmission and Ethics approval and consent to participate outbreaks in Kenya: a review. East Afr Med J. 2001;78:655–61. All residents of the houses we visited to collect mosquitoes were informed 16. Weaver SC, Barrett AD. Transmission cycles, host range, evolution and about the study and agreed to participate. This study was approved by the emergence of arboviral disease. Nat Rev Microbiol. 2004;2:789–801. Ethics Committee of Kenya Medical Research Institute (KEMRI) (SSC No. 17. Lutomiah J, Bast J, Clark J, Richardson J, Yalwala S, Oullo D, et al. 2420), Kenya. Abundance, diversity, and distribution of mosquito vectors in selected ecological regions of Kenya: public health implications. J Vector Ecol. 2013; Consent for publication 38:134–42. This paper is published with the permission of the Director of KEMRI. 18. Labeaud AD, Sutherland LJ, Muiruri S, Muchiri EM, Gray LR, Zimmerman PA, et al. Arbovirus prevalence in mosquitoes, kenya. Emerg Infect Dis. 2011;17: Competing interests 233–41. The authors declare that they have no competing interests. 19. Gould EA, Higgs S. Impact of climate change and other factors on emerging arbovirus diseases. Trans R Soc Trop Med Hyg. 2009;103(2):109–21. 20. Vazeille M, Moutailler S, Coudrier D, Rousseaux C, Khun H, Huerre M, et al. Publisher’sNote Two chikungunya isolates from the outbreak of La Reunion (Indian Ocean) Springer Nature remains neutral with regard to jurisdictional claims in exhibit different patterns of infection in the mosquito, Aedes albopictus. published maps and institutional affiliations. PLoS One. 2007;2(11):e1168. Author details 21. Hoshino K, Isawa H, Tsuda Y, Sawabe K, Kobayashi M. Isolation and Department of Vector Ecology and Environment, Institute of Tropical characterization of a new insect flavivirus from Aedes albopictus and Aedes Medicine, Nagasaki University, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan. flavopictus mosquitoes in Japan. Virology. 2009;391:119–29. Department of Bacteriology, Graduate School of Medicine, University of the 22. Ciota AT, Kramer LD. Vector-virus interactions and transmission dynamics of Ryukyus, 207 Uehara, Nishiharacho, Okinawa 903-0125, Japan. NUITM-KEMRI West Nile virus. Viruses. 2013;5(12):3021–47. https://doi.org/10.3390/v5123021. Project, Kenya Medical Research Institute, Nairobi, Kenya. Eastern and 23. Newman CM, Cerutti F, Anderson TK, Hamer GL, Walker ED, Kitron UD, et al. Southern Africa Centre of International Parasite Control (ESACIPAC), Kenya Culex Flavivirus and west Nile virus mosquito coinfection and positive Medical Research Institute, Nairobi, Kenya. Department of Virology, Institute ecological association in Chicago, United States. Vector Borne Zoonotic Dis. of Tropical Medicine, Nagasaki University, Nagasaki, Japan. 2011;11:1099–105. 24. Gu W, Novak RJ. Short report: detection probability of arbovirus infection in Received: 15 January 2018 Accepted: 4 April 2018 mosquito populations. Am J Trop Med Hyg. 2004;71:636–8. 25. Weaver SC. Urbanization and geographic expansion of zoonotic arboviral diseases: mechanisms and potential strategies for prevention. Trends References Microbiol. 2013;21(8):360–3. 1. Gubler DJ. The global emergence/resurgence of arboviral diseases as public 26. Hanley KA, Monath TP, Weaver SC, Rossi SL, Richman RL, Vasilakis N. Fever health problems. Arch Med Res. 2002;33:330–42. versus fever: the role of host and vector susceptibility and interspecific Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 15 of 15 competition in shaping the current and future distributions of the sylvatic heminested reverse transcription–PCR assay for detection of flaviviruses cycles of dengue virus and yellow fever virus. Infect Genet Evol. 2013;19: targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol. 292–311. 2001;39:1922–7. https://doi.org/10.1128/JCM.39.5.1922-1927.2001. 27. Berens DG, Farwig N, Schaab G, Boehning-Gaese K. Exotic guavas are foci of 49. Ayers M, Adachi D, Johnson G, Andonova M, Drebot M, Tellier R. A single forest regeneration in Kenyan farmland. Biotropica. 2008;40:104–12. tube RT-PCR assay for the detection of mosquito-borne flaviviruses. J Virol Methods. 2006;135:235–9. https://doi.org/10.1016/j.jviromet.2006.03.009. 28. Southwood TRE, ECOLOGICAL METHODS second Edition 1977. 50. Tanaka M. Rapid identification of flavivirus using the polymerase chain 29. Gu W, Unnasch TR, Katholi CR, Lampman R, Novak RJ. Fundamental issues reaction. J Virol Methods. 1993;41:311–22. in mosquito surveillance for arboviral transmission. Trans R Soc Trop Med 51. Hasebe F, Parquet MC, Pandey BD, Mathenge EG, Morita K, Hyg. 2008;102:817–22. Balasubramaniam V, et al. Combined detection and genotyping of 30. Harbach RE. Pictorial keys to the genera of mosquitoes, subgenera of Culex chikungunya virus by a specific reverse transcription-polymerase chain and the species of Culex (Culex) occurring in southwestern Asia and Egypt, reaction. J Med Virol. 2002;67:370–4. https://doi.org/10.1002/jmv.10085. with a note on the subgeneric placement of Culex deserticola (Diptera: 52. Jupp PG, Grobbelaar AA, Leman PA, Kemp A, Dunton RF, Burkot TR, et al. Culicidae). Mosq Syst. 1985;17:83–107. Experimental detection of Rift Valley fever by reverse transcription– 31. Huang YM. A pictorial key to the mosquito genera of the world, including polymerase chain reaction assay in large samples of mosquitoes. J Med subgenera of Aedes and Ochlerotatus (Diptera: Culicidae). Ins Koreana. 2002; Entomol. 2000;37:467–71. https://doi.org/10.1603/0022-2585(2000)037[0467: 19:1–130. EDORVF]2.0.CO;2. 32. Reinert JF. Descriptions of Zavortinkius, a new subgenus of Aedes, and the 53. Staley M, Dorman KS, Bartholomay LC, Fernández-Salas I, Farfan-Ale JA, eleven included species from the Afrotropical region (Diptera: Culicidae). Loroño-Pino MA, et al. Universal primers for the amplification and sequence Contributions of the American Entomological Institute (Gainesville).1999; 31 analysis of actin-1 from diverse mosquito species. J Am Mosq Control Assoc. (2): 1–105. 2010;26:214–8. 33. Rueda LM. Pictorial keys for the identification of mosquitoes (Diptera:Culicidae) 54. Higa Y, Toma T, Tsuda Y, Miyagi IA. Multiplex PCR-based molecular associated with dengue virus transmission. Zootaxa. 2004;589:1–60. identification of five morphologically related, medically important subgenus 34. Biggerstaff BJ. PooledInfRate, version 3.0: a Microsoft excel add-in to Stegomyia mosquitoes from the genus Aedes(Diptera: Culicidae) found in compute prevalence estimates from pooled samples. Ft. Collins, CO: Centers the Ryukyu Archipelagon Japan. Jpn J Infect Dis. 2010;63:312–6. for Disease Control and Prevention; 2006. 55. Koekemoer LL, Kamau L, Hunt RH, Coetzee M. Cocktail polymerase chain 35. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary reaction assay to identify members of the Anopheles funestus (Diptera: genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24(8): Culicidae) group. Am J Trop Med Hyg. 2002;66:804–11. 1596–9. 36. Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N, Cropp CB. Phylogeny of the genus Flavivirus. J Virol. 1998;72:73–83. 37. Cook S, Moureau G, Harbach RE, Mukwaya L, Goodger K, Ssenfuka F, et al. Isolation of a novel species of flavivirus and a new strain of Culex flavivirus (Flaviviridae) from a natural mosquito population in Uganda. J Gen Virol. 2009;90:2669–78. 38. Mwangangi JM, Midega J, Kahindi S, Njoroge L, Nzovu J, Githure J, et al. Mosquito species abundance and diversity in Malindi, Kenya and their potential implication in pathogen transmission. Parasitol Res. 2012;110:61– 71. https://doi.org/10.1007/s00436-011-2449-6. 39. Kasai S, Komagata O, Tomita T, Sawabe K, Tsuda Y, Kurahashi H, et al. PCR- based identification of Culex pipiens complex collected in Japan. Jpn J Infect Dis. 2008;61:184–91. 40. Fauver JR, Grubaugh ND, Krajacich BJ, Weger-Lucarelli J, Lakin SM, Fakoli LS 3rd, et al. West African Anopheles gambiae mosquitoes harbor a taxonomically diverse virome including new insect-specific flaviviruses, mononegaviruses, and totiviruses. Virology. 2016;498:288e99. 41. Villinger J, Mbaya MK, Ouso D, Kipanga PN, Lutomiah J, Masiga DK. Arbovirus and insect-specific virus discovery in Kenya by novel six genera multiplex high resolution melting analysis. Mol Ecol Resour. 2017;17:466–80. https://doi.org/10.1111/1755-0998.12584. 42. Paupy C, Delatte H, Bagny L, Corbel V, Fontenille D. Aedes albopictus, an arbovirus vector: from the darkness to the light. Microbes Infect. 2009;11: 1177–85. 43. Kraemer MU, Sinka ME, Duda KA, Mylne AQ, Shearer FM, Barker CM, et al. The global distribution of the arbovirus vectors Aedes aegypti and Ae. albopictus. elife. 2015;4:e08347. 44. Sivagnaname N, Gunasekaran K. Need for an efficient adult trap for the surveillance of dengue vectors. Indian J Med Res. 2012;136:739–49. 45. Muyeku MI, Seroprevalence of chikungunya, yellow fever and West Nile viruses in children at the Alupe District Hospital in Western Kenya. http://erepository.uonbi.ac.ke/bitstream/handle/11295/3785/Muyeku_Seropr evalence%20of%20Chikungunya%2c%20Yellow%20fever%20and%20 West%20Nile%20Viruses%20in%20Children.pdf?sequence=1&isAllowed=y (2011). Accessed 5 Dec 2017. 46. Smithburn KC, Hughes TP, Burke AW, Paul JH. A neurotropic virus isolated from the blood of a native of Uganda. Am J Trop Med Hyg. 1940;20:471–3. 47. Bolling BG, Olea-Popelka FJ, Eisen L, Moore CG, Blair CD. Transmission dynamics of an insect-specific flavivirus in a naturally infected Culex pipiens laboratory colony and effects of co-infection on vector competence for West Nile virus. Virology. 2012;427:90–7. 48. Scaramozzino N, Crance JM, Jouan A, DeBriel DA, Stoll F, Garin D. Comparison of flavivirus universal primer pairs and development of a rapid, highly sensitive http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Tropical Medicine and Health Springer Journals

Mosquito arbovirus survey in selected areas of Kenya: detection of insect-specific virus

Free
15 pages

Loading next page...
 
/lp/springer_journal/mosquito-arbovirus-survey-in-selected-areas-of-kenya-detection-of-7w47OnLkFs
Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s)
Subject
Medicine & Public Health; Tropical Medicine; Infectious Diseases; Public Health; Vaccine
eISSN
1349-4147
D.O.I.
10.1186/s41182-018-0095-8
Publisher site
See Article on Publisher Site

Abstract

Background: Many arboviral outbreaks have occurred in various locations in Kenya. Entomological surveys are suitable methods for revealing information about circulating arboviruses before human outbreaks are recognized. Therefore, mosquitoes were collected in Kenya to determine the distribution of arboviruses. Methods: Various species of mosquitoes were sampled from January to July 2012 using several collection methods. Mosquito homogenates were directly tested by reverse transcription-polymerase chain reaction (RT-PCR) using various arbovirus-targeted primer pairs. Results: We collected 12,569 mosquitoes. Although no human-related arboviruses were detected, Culex flavivirus (CxFV), an insect-specific arbovirus, was detected in 54 pools of 324 Culex quinquefasciatus individuals collected during the rainy season. Of these 54 positive pools, 96.3% (52/54) of the mosquitoes were collected in Busia, on the border of western Kenya and Uganda. The remaining two CxFV-positive pools were collected in Mombasa and Kakamega, far from Busia. Phylogenetic analysis revealed minimal genetic diversity among the CxFVs collected in Mombasa, Kakamega, and Busia, even though these cities are in geographically different regions. Additionally, CxFV was detected in one mosquito pool collected in Mombasa during the dry season. In addition to Culex mosquitoes, Aedes (Stegomyia) and Anopheles mosquitoes were also positive for the Flavivirus genus. Cell fusing agent virus was detected in one pool of Aedes aegypti. Mosquito flavivirus was detected in three pools of Anopheles gambiae s.l. collected in the dry and rainy seasons. Conclusions: Although no mosquitoes were positive for human-related arbovirus, insect-specific viruses were detected in various species of mosquitoes. The heterogeneity observed in the number of CxFVs in Culex mosquitoes in different locations in Kenya suggests that the abundance of human-related viruses might differ depending on the abundance of insect-specific viruses. We may have underestimated the circulation of any human-related arbovirus in Kenya, and the collection of larger samples may allow for determination of the presence of human-related arboviruses. Keywords: Arbovirus, Insect-specific virus, Culex flavivirus, Aedes mosquito, Culex mosquito, Anopheles mosquito, Busia, Kakamega, Mombasa, Kenya * Correspondence: hanako@med.u-ryukyu.ac.jp Department of Vector Ecology and Environment, Institute of Tropical Medicine, Nagasaki University, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan Department of Bacteriology, Graduate School of Medicine, University of the Ryukyus, 207 Uehara, Nishiharacho, Okinawa 903-0125, Japan Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 2 of 15 Background might be considered a factor for the emergence of arbo- Emergence and re-emergence of vector-borne diseases virus, though the function of insect-specific viruses are crucial public health problems worldwide [1, 2]. In remains unclear. Assessing the potential for arbovirus out- Kenya, many sporadic outbreaks have been reported in breaks at the local level can be facilitated by identifying all geographically different areas [3]. For example, an out- patterns of relationships, including triangular relationships break of dengue (DEN) fever occurred in the coastal (human-vector-arbovirus environment), in each area [24]. towns of Malindi and Kilifi in 1982 [4], and in 1992– Moreover, entomological baseline data may contribute to 1993, an outbreak of yellow fever (YF) occurred in Rift estimations of disease risk and allow precautionary mea- Valley Province [5]. There were outbreaks of Rift Valley sures to be taken against virus activity. In this study, we fever (RVF) in 1997 and 2006 [6–8], and an outbreak of mainly selected collection sites where other researchers chikungunya (CHIK) fever occurred in 2004 in the had previously found or suspected arbovirus activity. For coastal area of Kenya [9, 10]. In Uganda, an epidemic of example, border areas are suspected to be areas of poten- o’nyong’nyong (ONN) started in early 1959 and spread tial arbovirus infection because busy transportation hubs to Kenya [11, 12]. may provide many opportunities for human-vector In general, febrile diseases caused by viruses are still contact [25]. Although the presence of arboviruses has not confused with non-viral diseases, such as malaria [2]. yet been reported in some indigenous forests in Kenya, Moreover, cases can remain unnoticed because some many species of mosquitoes can serve as bridge vectors of arboviral infections are mild and self-limiting during the arboviruses, easily spreading sylvatic arboviruses such as early stage. Therefore, the number of human arboviral sylvatic YF and sylvatic DENV from forests to human cases might be much higher than has been reported. environments in these areas in Kenya [26]. We suspected Even in the absence of clinical outbreaks, historic sero- that arboviruses were silently circulating, without out- surveys in Kenya can provide important clues about cir- break detection. Therefore, an active survey was under- culating arboviruses in various environments [13]. For taken in border areas, including coastal boundaries and instance, Mease et al. in [14] assessed the prevalence of indigenous forests. The aim of this study was to obtain IgG against yellow fever virus (YFV), West Nile virus data regarding the presence of arboviruses in mosquitoes (WNV), dengue virus (DENV), and chikungunya virus in selected areas of Kenya. Our additional goal was to (CHIKV) using serum samples from healthy Kenyans. recognize the main vector species of arboviruses. According to their data, 46.6% of the people in all study areas had antibodies against at least one of these arbovi- Methods ruses [14]. As historic serosurveys in Kenya have docu- Study areas mented several arboviruses in geographically different Mosquito sampling was performed in eastern (Mombasa areas [15], a large epidemic of arbovirus can occur any- and Kwale) and western (Kakamega and Busia) Kenya, where at any time because, as demonstrated recently, which included a variety of areas, such as urban coastal many factors such as demographic, geographic environ- border, land border, and rural areas next to a forest where mental and climate change factors can complicate and there is suspected arbovirus activity (Fig. 1). The sampling worsen the situation [16]. Many studies have revealed was conducted in two different seasons: the rainy season that a threat of arboviral transmission is present and a season other than the rainy season; March to June throughout Kenya, regardless of the officially announced in Kenya generally constitutes the rainy season. We initi- reports of outbreaks [17, 18]. ated this study in January 2012, before the rainy season, Controlling arboviral diseases is difficult because of the which we conventionally termed the dry season. Between complex environment and ecology, including relationships January 18 and 26, 2012 (representing dry-season sam- among viruses, vectors, and humans [2, 16, 19]. Multiple pling), we conducted a preliminary survey only in eastern vector species are often involved in an arboviral disease, Kenya. Between May 9 and June 8, 2012 (representing and a single vector can also transmit several diseases. rainy-season sampling), we conducted the same survey in Moreover, primary vectors vary among geographical areas, both eastern and western Kenya. and the level of vector competence may also vary among species depending on each area [20]. Mosquitoes are ° ° known to carry not only human-related viruses but also Eastern Kenya: Mombasa (the center: 4 3.509′S; 39 40.363′E) insect-specific viruses, such as Culex flavivirus and Aedes This busy port town includes the urban coastal border flavivirus [21]. In addition, interactions between many with high levels of human activity. Dengue cases have types of viruses and many other organisms may affect been reported here for approximately the last 30 years vector competence inside the mosquito [22]. For example, [4]. We suspected that due to human activity, arboviral the presence of co-infection with insect-specific virus and mosquitoes can be easily transported outside this area. WNV has been reported [23]. In this case, co-infection Mosquitoes were collected in resident areas in the 2012 Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 3 of 15 Fig. 1 Map of study region. Location of mosquito sampling site in East Kenya; Kwale, Mombasa, and in West Kenya; Busia, Kakamega (Mukumu and Isecheno) ° ° dry season (from January 24 to January 26) and in the Western Kenya: Busia (the center: 0 27.914′N; 34 5.979′) 2012 rainy season (from May 15 to May 17). Busia is in the western land border (Kenya and Uganda) area, including a busy town with high human activity. ° ° Eastern Kenya: Kwale (the center: 4 10.525′S; 39 27.087′E) Serological surveys were conducted and revealed a high In this rural area, patches of indigenous forests (Shimba positive rate of antibodies against arboviruses in healthy Hills National Reserve) exist next to the residential area. residents [14]. In this area, many residents may have The edge of the indigenous forest can act as a border cross already suffered from arboviral diseases, with or without which arboviral mosquitoes can be transported from the for- symptoms. Transmission between humans and mosqui- est to the residential area. Mosquitoes were sampled from toes may have been underestimated due to the compli- houses in the 2012 dry season (from January 18 to January cated human activity. Mosquito surveillance can provide 20) and in the 2012 rainy season (from May 9 to May 12). other information to show the actual circulation of arbovi- ruses. Mosquitoes were collected from May 25 to May 27. Western Kenya: Kakamega (the center: 0°16.923′N; 34° 45.234′E) Mosquito sampling Kakamega forest has a remarkable diversity of insects, In each area, mosquitoes were collected for 3 consecu- birds and animals, which can serve as reservoir hosts of tive days from 13 selected houses within approximately arboviruses [27]. We selected two areas: one exactly next 0.5 km in each targeted area, except one area (for 4 to the indigenous forest (Isecheno), and another, a resi- consecutive days in Kwale in the rainy season). A dential area (Mukumu) along the main road in this region. systematic sampling method was applied for selecting The edge of the indigenous forest is considered to be a study houses in each targeted area [28]. For example, in ° ° dangerous border of arboviral activity, similar to Kwale. Kakamega, the main intersection (0 16.923′N; 34 45.234′ We suspect that the area is easily penetrable by arboviral E) on Kisumu-Kakamega Road was used as the starting mosquitoes from forests to residential areas and vice point for the systematic sampling of houses. From this versa. The main road is also regarded as a border, which point, we established 13 sampling points at 250-m inter- may encourage transmission of arboviruses. Mosquitoes vals. The nearest house from each point was then se- were collected in Mukumu from June 2 to June 4 and in lected. The house belongs to a large family (> 5 people), Isecheno from June 6 to June 8. and it was suggested because our study targets human- Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 4 of 15 related arboviruses. Another house was selected if the funestus, An. gambiae s.l., and Cx. quinquefasciatus were household head or guardian was not willing to partici- used. Moreover, both unfed and gravid mosquitoes were pate in the study. The same method was performed in combined for some pools of each species. Blood-fed other areas. Collection methods used the following traps: mosquitoes were excluded to prevent contamination of (i) CDC light traps, (ii) CDC gravid traps, and (iii) BG the virus contained in a blood meal, though we did sentinel traps. Additionally, indoor resting mosquito col- utilize blood-fed mosquitoes collected during the dry lection with hand aspirators was performed in all houses. season because of the small sample size. For the samples To use 20 traps effectively, we placed 2 types of traps collected during the rainy season, we concentrated on randomly within each of the 13 study houses. We detecting viruses in only female pools, excluding those intended to collect as many mosquitoes as possible be- that were blood-fed. cause arbovirus transmission is usually maintained at a Pooled specimens were placed in a 1.5-ml microcentri- low level in a mosquito population [29]. When the num- fuge tube with 300 μl of minimal essential medium (MEM) ber of mosquitoes collected was insufficient, the position (minimum essential medium containing 10% foetal bovine of the traps or type of traps was randomly changed. We serum, L-glutamine, penicillin, streptomycin, and ampho- used the most effective collection combination with tericin B). The mosquitoes were ground in MEM, and the positioning and type of traps at each study site. homogenate was centrifuged; 200 μlofthe supernatantwas In our study, the position of the traps depended on collected and kept at − 80 °C for future use (for cell cul- the structure of the house. CDC light traps were sus- ture). To maintain approximately 100 μl of the suspension, pended > 1.5 m above the ground inside and outside of 75 μl of lysis buffer was added. The homogenates were the houses but not near any other sources of artificial prepared using sterile, RNase-free utensils. light. CDC gravid traps were placed in a stable area somewhere inside or outside the house where nothing Total RNA extraction and virus identification by reverse could upset the medium in the pan, for example, under transcription-PCR eaves. BG sentinel traps were placed in the house with Total RNA was extracted from each pool of mosquitoes enough space or outside of the house. CDC light traps using an extraction kit (SV Total RNA Isolation System, were operated from dusk to dawn, whereas other traps Promega, Tokyo, Japan) according to the manufacturer’s were operated for 3–4 days continuously. Resting mos- instructions. RNA was eluted in 50 μl of sterile distilled quito collection was performed using oral aspirators by water. Reverse transcription reactions were performed to three persons in all rooms of the selected houses in the synthesize first-strand cDNA using RNA to cDNA EcoDry early morning for 15 min each day; this occurred during Premix (Random Hexamers) (Clontech Laboratories, Inc., all collection periods when the house was visited to re- Mountain View, CA, USA). The cDNA was amplified by move the mosquito-sampling bags from the traps. To PCR using an AccuPower PCR Premix Kit (Bioneer Co., prevent RNA degradation, the captured mosquitoes were Daejon, Korea) with virus-specific primers (Table 1), and kept alive during transfer to the laboratory. the products were evaluated by 1.5% agarose gel electro- phoresis. For all positive samples, products of the expected Mosquito identification size were extracted from the gel and were purified using a At the laboratory, the collected mosquitoes were killed MonoFas DNA Purification Kit (GL Sciences, Tokyo, at − 20 °C and placed on white filter paper in a Petri dish Japan). Purified amplicons were bidirectionally sequenced placed on a chill table and identified morphologically to using a BigDye Terminator version 3.1 Cycle Sequencing the species level under a stereoscopic microscope using Kit (Applied Biosystems, Foster City, CA, USA) and ana- published keys [30–33]. For accurate identification, lyzed with an ABI3130 Genetic Analyzer (Applied Biosys- Aedes aegypti, Culex quinquefasciatus, Anopheles funes- tems). Nucleic acid sequences were compared with those in tus,and An. rivulorum were confirmed by polymerase the GenBank database using the BLAST program. chain reaction (PCR) using specific primers (Table 1). The process was repeated for three universal primers for flavivirus (the main targets are DENV, YFV, and Mosquito processing WNV), two universal primers for alpha viruses (the A maximum of 30 individuals were pooled according to main targets are ONN virus and CHIKV) and single species, sex, physiological status, (i.e., unfed, blood fed, primer sets for RVFV (phlebovirus) (Table 1). For flavi- or gravid), and collection site and then were frozen in viruses and alpha viruses, we prepared multiple primer liquid nitrogen. For virus detection, we used all pools sets to detect not only a well-known virus but also novel collected during the dry season, with each category viruses. In the case of flavivirus detection, all pools were (male, unfed, fed and gravid) examined separately. In initially screened for flavivirus RNA by using universal contrast, for the pools collected during the rainy season, flavivirus primer sets cFD2 and MAMD, which target only unfed and gravid mosquito pools of Ae. aegypti, An. the non-structural protein 5 (NS5) gene. To identify Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 5 of 15 Table 1 Primers used to detect and to sequence arbovirus from mosquito pools in Kenya Target Primer name Nucleotide sequence Polarity Product (bp) Cycle condition Reference (5′ to 3′) Universal primers MAMD AACATGATGGGRAARAGRGARAA Forward 252 94°C, 2 min, 1 cycle; Scaramozzino et al. for flavivirus 94°C, 1 min, 53°C, (2001) [48] cFD2 GTGTCCCAGCCGGCGGTGTCATCAGC Reverse 1 min, 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Universal primers FLAVI-1 AATGTACGCTGATGACACAGCTGGCT Forward 854–863 94°C, 5 min, 1 cycle; Ayers et al.(2006) [49] for flavivirus GGGACAC 94°C, 1 min, 58°C, 1 min, 72°C, 90 s, FLAVI-2 TCCAGACCTTCAGCATGTCTTCTGTTGT Reverse 45 cycles; 72°C, CATCCA 10 min, 1 cycle Universal primers for YF-1 GGTCTCCTCTAACCTCTAG Forward 675 94°C, 2 min, 1 cycle; Tanaka et al. (1993) flavivirus (mainly YF) 94°C, 30 s, 53°C, 30 s, [50] YF-3 GAGTGGATGACCACGGAAGACATGC Reverse 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Universal primers for nsP1-S TAGAGCAGGAAATTGATCC Forward 354 94°C, 2 min, 1 cycle; Hasebe et al. (2002) alpha viruses (mainly 94°C, 30 s, 53°C, 30 s, [51] nsP1-C CTTTAATCGCCTGGTGGTA Reverse chikungunya and 72°C, 45 s, 35 cycles; o’nyong’nyong viruses) 72°C, 5 min, 1 cycle Universal primers for E1-S TACCCATTCATGTGGGG Forward 294 94°C, 2 min, 1 cycle; Hasebe et al. (2002) alpha viruses (mainly 94°C, 30 s, 53°C, 30 s, [51] E1-C GCCTTTGTACACCACGAT Reverse chikungunya and 72°C, 45 s, 35 cycles; o’nyong’nyong viruses) 72°C, 5 min, 1 cycle Rift Valley virus RVF009 CCAAATGACTACCAGTCAGC Forward 400–500 94°C, 2 min, 1 cycle; Jupp et al. (2000) 94°C, 30 s, 50°C, 30 s, [52] (modified) RVF007 GACAAATGAGTCTGGTAGCA Reverse 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Mosquito RNA marker Act-2F ATGGTCGGYATGGGNCAGAAGGACTC Forward 683 94°C, 2 min, 1 cycle; Staley et al. (2010) 94°C, 30 s, 54°C, 30 s, [53] Act-8R GATTCCATACCCAGGAAGGADGG Reverse 72°C, 45 s, 35 cycles; 72°C, 5 min, 1 cycle Culex quinquefaciatus ACEpip GGAAACAACGACGTATGTACT Forward 610 94°C, 5 min, 1 cycle; Kasai et al. (2008) [39] 94°C, 30 s, 54°C, 30 s, ACEquin CCTTCTTGAATGGCTGTGGCA Forward 274 72°C, 1 min, 35 cycles; 72°C, B1246s TGGAGCCTCCTCTTCACGG Reverse 5 min, 1 cycle Aedes aegypti 18SFHIN GTAAGCTTCCTTTGTACACACCGCCCGT Forward 550 97°C, 4 min, 1 cycle; Higa et al. (2010) [54] 96°C, 30 s, 48°C, 30 s, aeg.r1 TAACGGACACCGTTCTAGGCCCT Reverse 72°C, 2 min, 30 cycles; 72°C, 4 min, 1 cycle Anopheles funestus, UV TGTGAACTGCAGGACACAT Forward 94°C, 2 min, 1 cycle; Koekemoer et al. Anopheles rivulorum 94°C, 30 s, 45°C, 30 s, (2002) [55] FUN GCATCGATGGGTTAATCATG Reverse 505 72°C, 40 s, 30 cycles; 72°C, 5 min, 1 cycle RIV CAAGCCGTTCGACCCTGATT Reverse 411 Note: Each 25 μl reaction mixture contained. (Accupower TM PCR PreMix kit with 2 μl template, 15.2 μl sterile water, and 1.4 μl of 100 pmol/μl each of primers) human-related flaviviruses, such as DENV, YFV, and protein 1 (nsP1) and glycoprotein E1 (E1) were used for WNV, all pools were screened with primer sets YF-1 and amplification. YF-3. To generate a larger NS5 cDNA segment for The following inactivated viruses available in the sequencing, putative positive samples detected using laboratory were used as positive controls: DEN-1 previous primer sets (cFD2 and MAMD) were again (Hawaii strain), YFV (17D strain, attenuated live vaccine screened for flavivirus RNA using another universal strain), WNV (NY99 strain), CHIKV (S27 strain, African flavivirus primer set (FLAVI1 and FLAVI2) targeting the prototype), RVFV (Smithburn strain, attenuated live NS5 gene. Confirmed bands of approximately 860 bp vaccine strain) (All positive controls were kindly pro- were sequenced as described above. In the case of alpha vided by Dr. S Inoue). As a quality control for the detec- virus detection, primer sets (nsP1-S and nsP1-C; E1-S tion step, each cDNA was checked by PCR using the and E1-C) designed based on the genes non-structural mosquito β-actin primer. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 6 of 15 Calculation of infection rates using MEGA6 with the ClustalW method [35]. Phylogen- We calculated the minimum infection rate (MIR) of etic and molecular evolutionary analyses were conducted arboviruses in each mosquito species at each site using the by using the p-distance option with the neighbor-joining Poolscreen2 program [34]. MIRisexpressedasthenumber (NJ) method. Bootstrap analyses were performed with of pools infected per 1000 mosquitoes tested, and it assumes 1000 replicates. Representative flavivirus sequences were that only one mosquito is positive in a pool. To determine the used in the phylogenetic analysis as outgroup sequences. number of flavivirus-positive samples, the results using primer sets cFD2 and MAMD were employed. MIR was calculated Results when at least 100 mosquitoes were tested per species per site. Mosquito collection During the dry season in eastern Kenya (Table 2) Phylogenetic analysis In Kwale (January 18–20, 2012), we employed a cumula- For virus species identification, the collected sequences tive number of 39 trap sessions (per day per house) in were confirmed by an alignment search in gene databases 13 houses for 3 days (total numbers of each trap session Table 2 Summary of mosquitoes collected in the dry season in East Kenya Study site Kwale Mombasa Collection methods employed (number of trap sessions) As; 39, BG; 12, CDC; 15, GT; 12 As; 39, BG; 12, CDC; 15, GT; 12 Methods collected mosquitoes (number of trap sessions) As; 7, BG; 3, CDC; 10, GT; 6 As; 33, BG; 7, CDC; 14, GT; 12 Collection period January 18–20, 2012 (3 days) January 24–26, 2012 (3 days) Number of houses 13 houses 13 houses Species Physiological status No. collected Pools Positive pool No. collected Pools Positive pool Ae. aegypti Fed 2 1 0 Unfed 3 3 0 16 2 0 An. coustani Fed 1 1 0 An. funestus Fed 1 1 0 An. gambiae s.l. Fed 3 1 0 Unfed 8 1 1 2 1 1 An. longipulpis Fed 1 1 0 An. rivulorum Fed 4 1 0 Anopheles sp. Male 1 1 0 Cx. cinereus Gravid 1 1 0 Cx. decens Unfed 2 1 0 Gravid 4 1 0 Cx. quinquefasciatus Male 15 1 0 235 10 1 Fed 30 2 0 105 6 0 Unfed 19 1 0 375 13 0 Gravid 64 4 0 129 7 0 Cx. laticinctus Gravid 5 1 0 Cx. simpsoni Male 1 1 0 Unfed 2 1 0 Cx. univiittetus Unfed 2 1 0 Culex sp. Male 1 1 0 Unfed 1 1 0 3 1 0 Mansonia sp. Fed 2 1 0 Unfed 8 1 0 Others Male 2 Unfed 3 Total 179 26 1 872 44 2 Abbreviations of collection methods are As aspirator, BG: BG sentinel trap, CDC:CDC light trap, GT CDC gravid trap Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 7 of 15 per day per house were 12 BG sentinel, 15 CDC light, employed a cumulative number of 51 trap sessions (per and 12 CDC gravid trap sessions) and a cumulative day per house) in 13 houses for 3 days (total numbers of number of 39 aspirator catch sessions (per day per each trap sessions per day per house were 15 BG senti- house) in 13 houses for 3 days using a 3-person aspirator nel, 18 CDC light, and 18 CDC gravid trap sessions) and catch team in each house. We collected 179 mosquitoes a cumulative number of 39 aspirator catches (per day in the following subset of attempts: 3 BG sentinel trap per house) in 13 houses for 3 days using 3-person aspir- sessions, 10 CDC light trap sessions, 6 CDC gravid trap ator catch team in each house. We collected 2087 mos- sessions, and 7 aspirator catches. In Mombasa (January quitoes in the following subset of attempts: 13 BG 24–26, 2012), we collected 872 mosquitoes by the same sentinel trap sessions, 16 CDC light trap sessions, 15 cumulative number of trap sessions as in Kwale. The CDC gravid trap sessions, and 34 aspirator catches. In collection methods entailed 7 BG sentinel trap sessions, Kakamega (Isecheno) (June 6–8, 2012), we employed a 14 CDC light trap sessions, 12 CDC gravid trap sessions, cumulative number of 57 trap sessions (per day per and 33 aspirator catches. The total number of mosqui- house) in 13 houses for 3 days (total numbers of trap toes collected in Kwale and Mombasa was 1051. Of sessions per day per house were 15 BG sentinel, 21 CDC these mosquitoes, 796 (75.7%) were identified as females. light, and 21 CDC gravid trap sessions) and a cumulative For these samples collected during the dry season, all number of 39 aspirator catch sessions (per day per species were tested, including males of each species (70 house) in 13 houses for 3 days using a 3-person aspirator pools) (Table 2). Only five mosquitoes were not identi- catch team in each house. We collected 267 mosquitoes fied and were excluded. in the following subset of attempts: 8 BG sentinel trap sessions, 11 CDC light trap sessions, 17 CDC gravid trap During the rainy season in eastern and western Kenya sessions, and 20 aspirator catches. (Table 3) In total, we collected 11,518 mosquitoes at all sam- In Kwale (May 9–12, 2012), we employed a cumulative pling sites. Of these mosquitoes collected during the number of 57 trap sessions (per day per house) in 13 rainy season, 8663 (75.2%) were identified as female. houses for 4 days (total numbers of each trap session Only unfed and gravid female mosquitoes (414 pools) per day per house were 30 BG sentinel, 16 CDC light, were used for virus detection in samples collected dur- and 22 CDC gravid trap sessions) and a cumulative ing the rainy season (Table 4). The number of mosqui- number of 48 aspirator catches (per day per house) in toes collected in Kakamega (Isecheno) was one order of 13 houses for 4 days using a 3-person aspirator catch magnitude lower than that collected at the other study team in each house. We collected 2592 mosquitoes in sites. the following subset of attempts: 25 BG sentinel trap sessions, 11 CDC light trap sessions, 22 CDC gravid trap Arbovirus detection sessions, and 42 aspirator catches. In Mombasa (May Overall, 484 pools consisting of 7788 mosquitoes were 15–17, 2012), we employed a cumulative number of 42 tested. The selected species collected in both seasons for trap sessions (per day per house) in 13 houses for 3 days the detection of arbovirus were Ae. aegypti (41 pools), (total numbers of trap sessions were 13 BG sentinel An. funestus (8 pools), An. gambiae s.l. (47 pools), An. traps, 12 CDC light traps, and 17 CDC gravid traps) and rivulorum (5 pools), and Cx. quinquefasciatus (368 a cumulative number of 30 aspirator catch sessions (per pools). The following species of mosquitoes collected day per house) in 13 houses for 3 days using a 3-person during only the dry season from East Kenya were also aspirator catch team in each house. We collected 1974 used for detection: An. coustani (1 pool), An. longipalpis mosquitoes in the following subset of attempts: 12 BG (1 pool), Cx. cinereus (1 pool), Cx. decens (2 pools), Cx. sentinel trap sessions, 11 CDC light trap sessions, 17 laticinctus (1 pool), Cx. simpsoni (2 pool), Cx. univitta- CDC gravid trap sessions, and 28 aspirator catches. In tus (1 pool), Anopheles sp. (1 pool), Culex sp. (3 pools) Busia (May 25–27, 2012), we employed a cumulative and Mansonia sp. (2 pools). Although we collected 2 in- number of 45 trap sessions (per day per house) in 13 dividuals of Cx. decens (1 male and 1 female from Ise- houses for 3 days (total numbers of trap sessions were cheno), Cx. simpsoni (1 female from Busia), and Cx. 18 BG sentinel, 12 CDC light, and 15 CDC gravid trap univittatus (1 female from Busia) during the rainy sea- sessions) and a cumulative number of 36 aspirator catch son, we did not use these specimens for detection be- sessions (per day per house) in 13 houses for 3 days cause of their small sample numbers compared to all using 3-person aspirator catch team in each house. We other pools during the rainy season. collected 4598 mosquitoes in the following subset of at- tempts: 17 BG sentinel trap sessions, 12 CDC light trap Human-related arboviruses from all mosquitoes sessions, 15 CDC gravid trap sessions, and 36 aspirator All pools were negative for human-related arboviruses, catches. In Kakamega (Mukumu) (June 2–4, 2012), we such as DENV, YFV, WNV, ONN, and CHINV. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 8 of 15 Table 3 Summary of mosquitoes collected in the rainy season in East and West Kenya Study area East Kenya East Kenya West Kenya West Kenya West Kenya Study site Kwale Mombasa Busia Kakamega (Mukumu) Kakamega (Isecheno) Collection methods employed As; 48, BG; 30, CDC; 16, GT; 22 As; 30, BG; 13, CDC; 12, As; 36, BG; 18, CDC; 12, As; 39, BG; 15, CDC; 18, As; 39, BG; 15, CDC; 21, (number of trap sessions) GT; 17 GT; 15 GT; 18 GT; 21 Methods collected mosquitoes As; 42, BG; 25, CDC; 11, GT; 22 As; 28, BG; 12, CDC; 11, As; 36, BG; 17, CDC; 12, As; 34, BG; 13, CDC; 16, As; 20, BG; 8, CDC; 11, (number of trap sessions) GT; 17 GT; 15 GT; 15 GT; 17 Collection period (days) May 9–12, 2012 (4 days) May 15–17, 2012 (3 days) May 25–27, 2012 (3 days) June 2–4, 2012 (3 days) June 6–8, 2012 (3 days) Number of houses 13 houses 13 houses 13 houses 13 houses 13 houses Species Physiological No. Pool Positive pool No. Pool Positive pool No. Pool Positive pool No. Pool Positive pool No. Pool Positive pool status collected collected collected collected collected Aedes sp. Male 2 Unfed 3 2 1 1 Ae. aegypti Male 2 Unfed 11 8 0 49 14 1 48 0 3 3 0 2 2 0 Gravid 2 7 6 1 1 An. brumripes Unfed 1 2 An. funestus Male 3 Fed 5 Unfed 59 7 0 Gravid 2 An. gambiae s.l. Male 22 Fed 2 37 3 Unfed 18 3 0 402 34 1 3 4 0 3 3 0 Gravid 9 1 An. garnhami Fed 1 Unfed 6 An. parensis Unfed 1 An. rivulorum Unfed 4 3 0 Gravid 11 0 Anopheles sp. Male 1 Fed 2 Unfed 6 2 1 Gravid 1 Cx. decens Male 1 Gravid 1 Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 9 of 15 Table 3 Summary of mosquitoes collected in the rainy season in East and West Kenya (Continued) Study area East Kenya East Kenya West Kenya West Kenya West Kenya Cx .quinquefasciatus Male 355 540 1554 332 38 Fed 202 351 331 840 79 * *** ** Unfed 106 106 0 443 52 1 1243 113 52 472 46 1 53 7 0 Gravid 1867 554 906 431 79 Cx. simpsoni Unfed 1 Cx. univiittetus Unfed 1 Culex sp. Male 3 Fed 3 1 Unfed 4 2 1 0 Gravid 1 1 3 Lutzia Gravid 2 Others Male 2 Unfed 1 15 3 Gravid 1 Total 2592 117 0 1974 66 2 4598 165 53 2087 54 1 267 12 0 Note: We used only unfed and gravid mosquitoes for the pools to detect arboviruses. Unfed and gravid mosquitoes were separated into each category, but some of them were combined into one pool The pool comprised only gravid mosquitoes ** The pool comprised only unfed mosquitoes ***Pools consisted of unfed and gravid mosquitoes Abbreviations of “collection methods” are As aspirator, BG BG sentinel trap, CDC CDC light trap, GT CDC gravid trap Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 10 of 15 Table 4. Information of positive samples for insect specific arbovirus Places Season Species of No. of Physiological status No. pools No. positive MIR MIR Lower-upper Physiological status mosquito mosquitoes of used pools pools limits of positive pool Ae. aegypti mosquito pools Kwale Dry Ae. aegypti 3 Unfed 3 0 NA NA Kwale Rain Ae. aegypti 13 Unfed, gravid 8 0 NA NA Mombasa Dry Ae. aegypti 18 Fed, unfed 3 0 NA NA Mombasa Rain Ae. aegypti 56 Unfed, gravid 14 1 NA NA Female, gravid (♂; excluded) Busia Rain Ae. aegypti 10 Unfed, gravid 8 0 NA NA Kakamega Rain Ae. aegypti 4 Unfed, gravid 3 0 NA NA (Mukumu) Kakamega Rain Ae. aegypti 3 Unfed, gravid 2 0 NA NA (Isecheno) Cx. quinquefasciatus mosquito pools Kwale Dry Cx. 128 ♂, fed, unfed, 8 0 NA NA quinquefasciatus gravid Kwale Rain Cx. 1973 Unfed, gravid 106 0 NA NA quinquefasciatus (♂, fed; excluded) Mombasa Dry Cx. 844 ♂, fed, unfed, 36 1 1.18 0.07–5.75 ♂ quinquefasciatus gravid Mombasa Rain Cx. 997 Unfed, gravid 52 1 1.01 0.06–4.89 Female, gravid quinquefasciatus (♂, fed; excluded) Busia Rain Cx. 2149 Unfed, gravid 113 52 32.26 24.42–42.12 Female, unfed + quinquefasciatus (♂, fed; excluded) gravid Kakamega Rain Cx. 903 Unfed, gravid 46 1 1.11 0.06–5.37 Female, unfed (Mukumu) quinquefasciatus (♂, fed; excluded) Kakamega Rain Cx. 132 Unfed, gravid 7 0 NA NA (Isecheno) quinquefasciatus (♂, fed; excluded) An. gambiae mosquito pools Kwale Dry An. gambiae 11 Fed, unfed 2 1 NA NA Female, unfed Kwale Rain An. gambiae 18 Unfed, (fed; 3 0 NA NA excluded) Mombasa Dry An. gambiae 2 Unfed 1 1 NA NA Female, unfed Mombasa Rain An. gambiae00 0 NANA Busia Rain An. gambiae 411 Unfed, gravid 34 1 2.44 0.14–11.87 Female, unfed (♂, fed; excluded) Kakamega Rain An. gambiae 4 Unfed, gravid 4 0 NA NA (Mukumu) Kakamega Rain An. gambiae 3 Unfed (fed; 3 0 NA NA (Isecheno) excluded) Minimum infection rate Mosquito-related arboviruses from Culex quinquefasciatus we limited our analysis to female mosquitoes only, Busia Using the primer sets cFD2 and MAMD, PCR bands yielded the most positive pools (52 pools) followed by were observed for 54 female Cx. quinquefasciatus pools Bamburi (1 pool) and Mukumu (1 pool). during the rainy season and 1 male Cx. quinquefasciatus To generate a larger NS5 cDNA segment for sequen- pool during the dry season in Mombasa (Tables 2 and cing to be used in phylogenetic analyses, only pools that 3). The nucleotide sequences for positive PCR reactions were positive for flavivirus using the primer sets cFD2 amplified using the primer sets cFD2 and MAMD from and MAMD were amplified with the primer sets FLAVI1 all these pools were compared with the GenBank data- and FLAVI2. Bands of approximately 860 nt (597 nt was base (BLAST), and sequencing results of all samples used) were observed, and nucleotide sequencing was were 99% identical to the homologous region of Culex successful for 22 pools of Cx. quinquefasciatus (21 fe- flavivirus (CxFV) strain Uganda08 (GQ165808.1). When male pools and 1 male pool) among 55 pools (54 female Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 11 of 15 pools and 1 male pool). The genomic sequences ob- Other Cx. quinquefasciatus pools revealed only one tained using both primer sets (FLAVI1 and FLAVI2) positive pool, with an MIR of approximately 1.0 share similar nucleotide sequence identity (99%) with (Table 4). Furthermore, taking into account differences CxFV from Uganda (GenBank: GQ165808.1). This result in sampling efficiency among the study sites, seasons was the same as that using the primer sets cFD2 and and traps, the Cx. quinquefasciatus specimens collected MAMD. A phylogenetic tree was constructed with the in Busia showed a higher MIR (MIR = 32.26; 95% CI = NJ method using NS5 gene sequences of 22 CxFV 24.42–42.12) than those collected in Mombasa during strains by adding CxFV NS5 gene sequences from the rainy season (MIR = 1.01; 95% CI = 0.06–4.89) and Uganda (GenBank: GQ165808.1) and Guatemala (Gen- during the dry season (MIR = 1.18; 95% CI = 0.07–5.75), Bank: EU805806) obtained from BLAST. Additionally, and those collected in Kakamega during the rainy season NS5 gene sequences of human-related flaviviruses, such (MIR = 1.11; 95% CI = 0.06–5.37). CxFV was detected in as WNV (GenBank: DQ118127.1, GenBank: AF202541), Mombasa during the dry season in a male pool as well DNV (GenBank: AY099336.1, GenBank: AF326825.1, as in female pools; however, there were no positive GenBank: U87411.1), and Japanese encephalitis virus samples found in female pools during the dry season. (GenBank: M18370.1), were included as outgroup se- No differences in MIR were found between the dry and quences. The NS5 gene sequences of our samples from rainy seasons in Mombasa, even though the pools of Kenya clustered with CxFV NS5 gene sequences from male and fed mosquitoes collected in the rainy season Uganda and Guatemala. Although Busia, Kakamega, and were not tested. Because of the limited number of sam- Mombasa are in completely different regions of Kenya, ples, it is uncertain whether heterogeneity exists among the phylogenetic tree shows sequence similarity (Fig. 2). Ae. aegypti and An. gambiae MIRs. Mosquito-related arboviruses from Ae. aegypti and An. Discussion gambiae In this study in Kenya, we did not detect any human-related The PCR products using the primer sets FLAVI1 and arboviruses, and the main vector species of arboviruses were FLAVI2 for one pool of Ae. aegypti were shown to corres- not found. Instead, we did detect mosquito-specific arbovi- pond to cell-fusing agent virus (CFAV) (NC_001564.1, 96% ruses from many types of mosquitoes. In particular, high BLAST identity). In terms of An. gambiae s.l. pools, PCR prevalence of CxFV is Cx. quinquefasciatus was found in products using the same primer sets as above were ob- Busia, and this strain of CxFV is similar to one reported in served for three female pools, consisting of one pool from Uganda by Cook et al. [37, 38]. Additionally, a similar CxFV Kwale and one pool from Mombasa (both collected during was detected in each female pool from Mombasa and the dry season) and one pool from Busia (collected during Kakamega. These areas in Kenya are separated by great dis- the rainy season). The nucleotide sequencing results of the tances. Additional sampling in the area between Busia and two samples collected in Kwale and Mombasa were similar Kakamega in western Kenya and in the area between Kaka- to mosquito flavivirus sequences (KM088036.1 and mega and Mombasa in middle to eastern Kenya will likely KM088037.1, 99% BLAST identity) reported from Kenya. increase the precision of the data regarding CxFV preva- The sequence of the sample collected from one pool from lence and geographic variation in Kenya. At present, the Busia was moderately divergent from the other two, being consequences of this geographic variation in Kenya are not most similar a sequence of Anopheles flavivirus (KX148546. clear. Moreover, we detected CxFV in one male pool col- 1, 85% BLAST identity) reported from Liberia. According lected in Mombasa. This result suggests that vertical main- to Kuno et al., a viral species is defined as the same group tenance may be common, even though Mombasa is an area of viruses with > 84% nucleotide sequence identity among with a lower positive rate compared to Busia. them [36]. Our sequence analysis demonstrated slightly Although many studies have reported mosquito- higher nucleotide sequence identity than this cut-off. There- specific flavivirus detection in Culex and Aedes [39], fore, the viruses from An. gambiae s.l. collected in Busia there is little information about flaviviruses from anoph- represent a variant of the closely related Anopheles flavivi- eline mosquitoes, except for a few recent reports from rus. Thephylogeneticanalyses including arboviruses from Africa [40, 41]. In addition to Ae. aegypti, we also ob- Cx. quinquefasciatus are presented in Fig. 2. tained flavivirus sequences from An. gambiae s.l. Our phylogenetic data using flavivirus NS5 gene sequences Minimum infection rate (MIR) suggest that the sequences from Ae. aegypti are related Although our study sites were geographically limited, to CFAV and that the sequences from An. gambiae s.l. MIR for Cx. quinquefasciatus showed a heterogeneous are most closely related to mosquito flaviviruses distribution for this species among the selected sites. (KM088037.1 and KM088036.1) from An. gambiae s.l. in Busia was the region with the highest MIR among all West Africa and Kenya [40, 41]. Overall, reports of Cx. quinquefasciatus pools collected in Kenya (Table 4). mosquito-specific flaviviruses are increasing. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 12 of 15 Fig. 2 (See legend on next page.) Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 13 of 15 (See figure on previous page.) Fig. 2 Phylogenetic tree of the positive sequences based on the 597 nucleotides of the NS5 gene. The tree was constructed by employing the program MEGA 6, using the neighbor-joining method and distance-p model with 1000 bootstrap replicates. GenBank accession numbers are indi- cated in the parenthesis in the tree. Numbers on internal branches indicate bootstrap values for 1000 replicates. Our samples are marked with star (Cx. quinquefasciatus), with circle (Ae. aegypti), and with diamond shape (An. gambiae) Our results are based on partial sequences (NS5) of data for 2010, the virus with the highest positive rate flaviviruses directly detected in mosquitoes. However, was WNV (31% of 296 tested) followed by YFV (17% other regions of flavivirus nucleotide sequences (such as of 310 tested) and CHIV (11% of 298 tested) [45]. a region of NS3) were not determined, and there is a Moreover, there is an anecdotal report that the WNV possibility that these sequences differ. Thus, further se- infection rate might be higher than that reported be- quence information might be required, especially for a cause many infections are not obvious or are mild novel mosquito flavivirus, to establish the detailed taxo- among those who live on the border of Kenya and nomic status of arboviruses. None of the mosquitoes in Uganda, where this virus was first isolated in 1937 our samples were infected with human-related flavi- [46]. Regardless, the detection of human-related arbo- viruses, though the detection rate might have been viruses in mosquitoes is very difficult in the absence slightly higher if we had performed cell culture. Another of an outbreak. Our results, which indicate relatively limitation is the small sample size, and the number of high CxFV positivity among Cx. quinquefasciatus mosquito species was also small. Larger studies are mosquitoes in Busia, might support risk prediction needed to provide a more accurate view of the preva- for future patterns of epidemics of arboviral infection. lence of arboviruses. Onepreviousstudy reported apositiveassociationbe- Additionally, the abundance of Ae. aegypti, one of the tween insect-specific flaviviruses and human-related most effective arboviral vectors in the human environ- arboviruses, such as WNV [23]. Interestingly, Bolling ment, obtained was relatively smaller than we expected. et al. [47] identified early suppression of WNV infec- This mosquito is thought to have originated from Africa tion in Culex pipiens naturally infected with CxFV. and to have been introduced to other continents such as This suppression is one of the possible explanations Asia and South America through maritime trade [1]. for the lack of arbovirus detection, despite the high Because this mosquito can easily adapt to urban areas prevalence of CxFV in Cx. quinquefasciatus in our on these continents, DENV transmitted by Ae. aegypti study. Thus, it is important to determine whether has become a major threat to humans. In this study, mosquitoes infected with mosquito-specific flavi- there were no positive pools of arboviruses, including viruses are resistant or susceptible to infection with DEN and CHIK, among 107 female Ae. aegypti samples. other human-related flaviviruses. Future research on It is clear that this small sample size is insufficient. Add- these viruses and their potential interactions with itionally, due to this small sample size, the existence of other flaviviruses in arthropod vectors will provide another important vector, Aedes albopictus, cannot be important new insight into not only virological but determined, even though the distribution of this Asian- also public health aspects. based mosquito has already been extended throughout the world, including West and Central Africa [42, 43]. Conclusions Currently, this mosquito is not reported in Kenya. How- Insect-specific viruses were detected in various species ever, methods of collecting Aedes mosquitoes in Kenya of mosquitoes. In particular, the abundance of CxFV in remain an issue. We recognize that the effectiveness of Culex mosquitoes in Busia is higher than in other areas the BG sentinel trap is quite low in certain areas such as of Kenya. We suspect that this heterogeneity in various Africa [44], though we did not analyze the effectiveness areas of Kenya may reflect the heterogeneity of the of each trap. abundance of human-related virus vectors. These Here, we report the detection of CxFV from Cx. results, together with the absence of positive pools of quinquefasciatus,CFAV from Ae. aegypti,mosquito human-related arbovirus, can be used as a baseline for flavivirus from An. gambiae s.l., and a new virus from future studies of human arboviruses. Future efforts to An. gambiae s.l. However, we did not detect any ar- detect the circulation of arboviruses will help clarify the boviruses that are responsible for human disease. relationship between human-related arboviruses and Many individuals might be exposed to a considerable various arboviruses, including insect-specific viruses. risk of arbovirus infection in Kenya. Muyeku et al. re- Detection methods that are more sensitive, such as next- ported the seroprevalence of CHIKV, YFV, and WNV generation sequencing (NGS), will facilitate obtaining in children at a hospital in Busia. According to their real data about the presence of arboviruses. Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 14 of 15 Abbreviations 2. Weaver SC, Reisen WK. Present and future arboviral threats. Antivir Res. CFAV: Cell-fusing agent virus; CHIKV: Chikungunya virus; CxFV: Culex flavivirus; 2010;85:328–45. DEN: Dengue; DENV: Dengue virus; MIR: Minimum infection rate; 3. Sutherland LJ, Cash AA, Huang YJ, Sang RC, Malhotra I, Moormann AM, et NJ: Neighbor-joining; ONN: O’nyong’nyong; PCR: Polymerase chain reaction; al. Serologic evidence of arboviral infections among humans in Kenya. Am J RVF: Rift Valley fever; WNV: West Nile virus; YF: Yellow fever; YFV: Yellow fever Trop Med Hyg. 2011;85:158–61. virus 4. Johnson BK, Ocheng D, Gichogo A, Okiro M, Libondo D, Kinyanjui P, et al. Epidemic dengue fever caused by dengue type 2 virus in Kenya: preliminary results of human virological and serological studies. East Afr Med J. 1982;59: Acknowledgements 781–4. We are deeply grateful to Dr. Kouichi Morita, Dr. Yoshio Ichinose, Dr. Masaaki Shimada, Dr. Charles Mwandawiro, Dr. Futoshi Hasebe, Dr. Shingo Inoue, Dr. 5. Sanders EJ, Marfin AA, Tukei PM, Kuria G, Ademba G, Agata NN, et al. First Kazuhiko Moji, Dr. Matilu Mwau, and Mr. Haruki Kazama for technical support recorded outbreak of yellow fever in Kenya, 1992-1993. I. Epidemiologic and Ms. Yukie Saito and Ms. Junko Sakemoto for providing administrative investigations. Am J Trop Med Hyg. 1998;59:644–9. support. Special thanks go to Mr. Matthew Munyao, Mr. Johnstone Muyodi, 6. Nguku PM, Sharif S, Mutonga D, Amwayi S, Omolo J, Mohammed O, et al. Ms. Jecinta Odeo Lumumba, Mr. James Omondi Kongere, Ms. Mercy An investigation of a major outbreak of Rift Valley fever in Kenya: 2006– Syombua Mwania, Ms. Scholastica Achieng Wagalla, and Dr. Yuki Takamatsu, 2007. Am J Trop Med Hyg. 2010;83(2 Suppl):05–13. who devoted themselves to the fieldwork and experiments. Finally, we wish 7. Woods CW, Karpati AM, Grein T, McCarthy N, Gaturuku P, Muchiri E, et al. An to express our gratitude to the residents of Kwale, Mombasa, Busia, and outbreak of Rift Valley fever in Northeastern Kenya, 1997-98. Emerg Infect Kakamega who participated in this study. Dis. 2002;8:138–44. 8. Crabtree M, Sang R, Lutomiah J, Richardson J, Miller B. Arbovirus surveillance of mosquitoes collected at sites of active Rift Valley fever virus transmission: Funding Kenya, 2006–2007. J Med Entomol. 2009;46(4):961–4. This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan; 9. Sergon K, Njuguna C, Kalani R, Ofula V, Onyango C, Konongoi LS, et al. Young Researcher Overseas Visits Program for Vitalizing Brain Circulation, Seroprevalence of chikungunya virus (CHIKV) infection on Lamu Island, MEXT, Japan; the Global COE program, MEXT, Japan; the Japan Initiative for Kenya, October 2004. Am J Trop Med Hyg. 2008;78:333–7. Global Network on Infectious Diseases (J-GRID), MEXT, Japan; and a Grant-in- 10. Charrel RN, De Lamballerie X, Raoult D. Chikungunya outbreaks - the Aid for Scientific Research from the Ministry of Health, Labour, and Welfare, globalization of vectorborne diseases. N Engl J Med. 2007;356:769–71. Japan, Nagasaki University Kenya Research Station NUITM-KEMRI Project. 11. Haddow AJ, Davies CW, Walter AJ. O’nyong-nyong fever: an epidemic virus disease in East Africa - introduction. Trans R Soc TropMed Hyg. 1960;54:517–22. 12. Williams MC, Woodall JP, Corbet PS, Gillett JD. O’nyong-nyong fever: an Availability of data and materials epidemic virus disease in East Africa. 8. Virus isolations from anopheles Raw data can be obtained from the corresponding author upon request. mosquitoes. Trans R Soc Trop Med Hyg. 1965;59:300–6. https://doi.org/10. 1016/0035-9203(65)90012-X. Authors’ contributions 13. Geser A, Henderson BE, Christensen S. A multipurpose serological survey in HI, YH, KF, and NM conceived and designed this study. SN helped design and Kenya. 2. Results of arbovirus serological tests. Bull World Health Organ. plan the study in Kenya. HI, YH, KF, and PA collected the field data, and HI, YH, 1970;43:539–52. and KF organized and conducted the laboratory work. HI and TN performed 14. Mease LE, Coldren RL, Musila LA, Prosser T, Ogolla F, Ofula VO, et al. the data analyses. HI drafted the first manuscript, and HI and NM finalized the Seroprevalence and distribution of arboviral infections among rural Kenyan manuscript. All authors have read and approved the final manuscript. adults: a cross-sectional study. Virol J. 2011;8:371. 15. Sang RC, Dunster LM. The growing threat of arbovirus transmission and Ethics approval and consent to participate outbreaks in Kenya: a review. East Afr Med J. 2001;78:655–61. All residents of the houses we visited to collect mosquitoes were informed 16. Weaver SC, Barrett AD. Transmission cycles, host range, evolution and about the study and agreed to participate. This study was approved by the emergence of arboviral disease. Nat Rev Microbiol. 2004;2:789–801. Ethics Committee of Kenya Medical Research Institute (KEMRI) (SSC No. 17. Lutomiah J, Bast J, Clark J, Richardson J, Yalwala S, Oullo D, et al. 2420), Kenya. Abundance, diversity, and distribution of mosquito vectors in selected ecological regions of Kenya: public health implications. J Vector Ecol. 2013; Consent for publication 38:134–42. This paper is published with the permission of the Director of KEMRI. 18. Labeaud AD, Sutherland LJ, Muiruri S, Muchiri EM, Gray LR, Zimmerman PA, et al. Arbovirus prevalence in mosquitoes, kenya. Emerg Infect Dis. 2011;17: Competing interests 233–41. The authors declare that they have no competing interests. 19. Gould EA, Higgs S. Impact of climate change and other factors on emerging arbovirus diseases. Trans R Soc Trop Med Hyg. 2009;103(2):109–21. 20. Vazeille M, Moutailler S, Coudrier D, Rousseaux C, Khun H, Huerre M, et al. Publisher’sNote Two chikungunya isolates from the outbreak of La Reunion (Indian Ocean) Springer Nature remains neutral with regard to jurisdictional claims in exhibit different patterns of infection in the mosquito, Aedes albopictus. published maps and institutional affiliations. PLoS One. 2007;2(11):e1168. Author details 21. Hoshino K, Isawa H, Tsuda Y, Sawabe K, Kobayashi M. Isolation and Department of Vector Ecology and Environment, Institute of Tropical characterization of a new insect flavivirus from Aedes albopictus and Aedes Medicine, Nagasaki University, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan. flavopictus mosquitoes in Japan. Virology. 2009;391:119–29. Department of Bacteriology, Graduate School of Medicine, University of the 22. Ciota AT, Kramer LD. Vector-virus interactions and transmission dynamics of Ryukyus, 207 Uehara, Nishiharacho, Okinawa 903-0125, Japan. NUITM-KEMRI West Nile virus. Viruses. 2013;5(12):3021–47. https://doi.org/10.3390/v5123021. Project, Kenya Medical Research Institute, Nairobi, Kenya. Eastern and 23. Newman CM, Cerutti F, Anderson TK, Hamer GL, Walker ED, Kitron UD, et al. Southern Africa Centre of International Parasite Control (ESACIPAC), Kenya Culex Flavivirus and west Nile virus mosquito coinfection and positive Medical Research Institute, Nairobi, Kenya. Department of Virology, Institute ecological association in Chicago, United States. Vector Borne Zoonotic Dis. of Tropical Medicine, Nagasaki University, Nagasaki, Japan. 2011;11:1099–105. 24. Gu W, Novak RJ. Short report: detection probability of arbovirus infection in Received: 15 January 2018 Accepted: 4 April 2018 mosquito populations. Am J Trop Med Hyg. 2004;71:636–8. 25. Weaver SC. Urbanization and geographic expansion of zoonotic arboviral diseases: mechanisms and potential strategies for prevention. Trends References Microbiol. 2013;21(8):360–3. 1. Gubler DJ. The global emergence/resurgence of arboviral diseases as public 26. Hanley KA, Monath TP, Weaver SC, Rossi SL, Richman RL, Vasilakis N. Fever health problems. Arch Med Res. 2002;33:330–42. versus fever: the role of host and vector susceptibility and interspecific Iwashita et al. Tropical Medicine and Health (2018) 46:19 Page 15 of 15 competition in shaping the current and future distributions of the sylvatic heminested reverse transcription–PCR assay for detection of flaviviruses cycles of dengue virus and yellow fever virus. Infect Genet Evol. 2013;19: targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol. 292–311. 2001;39:1922–7. https://doi.org/10.1128/JCM.39.5.1922-1927.2001. 27. Berens DG, Farwig N, Schaab G, Boehning-Gaese K. Exotic guavas are foci of 49. Ayers M, Adachi D, Johnson G, Andonova M, Drebot M, Tellier R. A single forest regeneration in Kenyan farmland. Biotropica. 2008;40:104–12. tube RT-PCR assay for the detection of mosquito-borne flaviviruses. J Virol Methods. 2006;135:235–9. https://doi.org/10.1016/j.jviromet.2006.03.009. 28. Southwood TRE, ECOLOGICAL METHODS second Edition 1977. 50. Tanaka M. Rapid identification of flavivirus using the polymerase chain 29. Gu W, Unnasch TR, Katholi CR, Lampman R, Novak RJ. Fundamental issues reaction. J Virol Methods. 1993;41:311–22. in mosquito surveillance for arboviral transmission. Trans R Soc Trop Med 51. Hasebe F, Parquet MC, Pandey BD, Mathenge EG, Morita K, Hyg. 2008;102:817–22. Balasubramaniam V, et al. Combined detection and genotyping of 30. Harbach RE. Pictorial keys to the genera of mosquitoes, subgenera of Culex chikungunya virus by a specific reverse transcription-polymerase chain and the species of Culex (Culex) occurring in southwestern Asia and Egypt, reaction. J Med Virol. 2002;67:370–4. https://doi.org/10.1002/jmv.10085. with a note on the subgeneric placement of Culex deserticola (Diptera: 52. Jupp PG, Grobbelaar AA, Leman PA, Kemp A, Dunton RF, Burkot TR, et al. Culicidae). Mosq Syst. 1985;17:83–107. Experimental detection of Rift Valley fever by reverse transcription– 31. Huang YM. A pictorial key to the mosquito genera of the world, including polymerase chain reaction assay in large samples of mosquitoes. J Med subgenera of Aedes and Ochlerotatus (Diptera: Culicidae). Ins Koreana. 2002; Entomol. 2000;37:467–71. https://doi.org/10.1603/0022-2585(2000)037[0467: 19:1–130. EDORVF]2.0.CO;2. 32. Reinert JF. Descriptions of Zavortinkius, a new subgenus of Aedes, and the 53. Staley M, Dorman KS, Bartholomay LC, Fernández-Salas I, Farfan-Ale JA, eleven included species from the Afrotropical region (Diptera: Culicidae). Loroño-Pino MA, et al. Universal primers for the amplification and sequence Contributions of the American Entomological Institute (Gainesville).1999; 31 analysis of actin-1 from diverse mosquito species. J Am Mosq Control Assoc. (2): 1–105. 2010;26:214–8. 33. Rueda LM. Pictorial keys for the identification of mosquitoes (Diptera:Culicidae) 54. Higa Y, Toma T, Tsuda Y, Miyagi IA. Multiplex PCR-based molecular associated with dengue virus transmission. Zootaxa. 2004;589:1–60. identification of five morphologically related, medically important subgenus 34. Biggerstaff BJ. PooledInfRate, version 3.0: a Microsoft excel add-in to Stegomyia mosquitoes from the genus Aedes(Diptera: Culicidae) found in compute prevalence estimates from pooled samples. Ft. Collins, CO: Centers the Ryukyu Archipelagon Japan. Jpn J Infect Dis. 2010;63:312–6. for Disease Control and Prevention; 2006. 55. Koekemoer LL, Kamau L, Hunt RH, Coetzee M. Cocktail polymerase chain 35. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary reaction assay to identify members of the Anopheles funestus (Diptera: genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24(8): Culicidae) group. Am J Trop Med Hyg. 2002;66:804–11. 1596–9. 36. Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N, Cropp CB. Phylogeny of the genus Flavivirus. J Virol. 1998;72:73–83. 37. Cook S, Moureau G, Harbach RE, Mukwaya L, Goodger K, Ssenfuka F, et al. Isolation of a novel species of flavivirus and a new strain of Culex flavivirus (Flaviviridae) from a natural mosquito population in Uganda. J Gen Virol. 2009;90:2669–78. 38. Mwangangi JM, Midega J, Kahindi S, Njoroge L, Nzovu J, Githure J, et al. Mosquito species abundance and diversity in Malindi, Kenya and their potential implication in pathogen transmission. Parasitol Res. 2012;110:61– 71. https://doi.org/10.1007/s00436-011-2449-6. 39. Kasai S, Komagata O, Tomita T, Sawabe K, Tsuda Y, Kurahashi H, et al. PCR- based identification of Culex pipiens complex collected in Japan. Jpn J Infect Dis. 2008;61:184–91. 40. Fauver JR, Grubaugh ND, Krajacich BJ, Weger-Lucarelli J, Lakin SM, Fakoli LS 3rd, et al. West African Anopheles gambiae mosquitoes harbor a taxonomically diverse virome including new insect-specific flaviviruses, mononegaviruses, and totiviruses. Virology. 2016;498:288e99. 41. Villinger J, Mbaya MK, Ouso D, Kipanga PN, Lutomiah J, Masiga DK. Arbovirus and insect-specific virus discovery in Kenya by novel six genera multiplex high resolution melting analysis. Mol Ecol Resour. 2017;17:466–80. https://doi.org/10.1111/1755-0998.12584. 42. Paupy C, Delatte H, Bagny L, Corbel V, Fontenille D. Aedes albopictus, an arbovirus vector: from the darkness to the light. Microbes Infect. 2009;11: 1177–85. 43. Kraemer MU, Sinka ME, Duda KA, Mylne AQ, Shearer FM, Barker CM, et al. The global distribution of the arbovirus vectors Aedes aegypti and Ae. albopictus. elife. 2015;4:e08347. 44. Sivagnaname N, Gunasekaran K. Need for an efficient adult trap for the surveillance of dengue vectors. Indian J Med Res. 2012;136:739–49. 45. Muyeku MI, Seroprevalence of chikungunya, yellow fever and West Nile viruses in children at the Alupe District Hospital in Western Kenya. http://erepository.uonbi.ac.ke/bitstream/handle/11295/3785/Muyeku_Seropr evalence%20of%20Chikungunya%2c%20Yellow%20fever%20and%20 West%20Nile%20Viruses%20in%20Children.pdf?sequence=1&isAllowed=y (2011). Accessed 5 Dec 2017. 46. Smithburn KC, Hughes TP, Burke AW, Paul JH. A neurotropic virus isolated from the blood of a native of Uganda. Am J Trop Med Hyg. 1940;20:471–3. 47. Bolling BG, Olea-Popelka FJ, Eisen L, Moore CG, Blair CD. Transmission dynamics of an insect-specific flavivirus in a naturally infected Culex pipiens laboratory colony and effects of co-infection on vector competence for West Nile virus. Virology. 2012;427:90–7. 48. Scaramozzino N, Crance JM, Jouan A, DeBriel DA, Stoll F, Garin D. Comparison of flavivirus universal primer pairs and development of a rapid, highly sensitive

Journal

Tropical Medicine and HealthSpringer Journals

Published: Jun 4, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off