Molecular Characterization of Pneumococcal Surface Protein A (PspA), Serotype Distribution and Antibiotic Susceptibility of Streptococcus pneumoniae Strains Isolated from Pakistan

Molecular Characterization of Pneumococcal Surface Protein A (PspA), Serotype Distribution and... Infect Dis Ther (2018) 7:277–289 https://doi.org/10.1007/s40121-018-0195-0 ORIGINAL RESEARCH Molecular Characterization of Pneumococcal Surface Protein A (PspA), Serotype Distribution and Antibiotic Susceptibility of Streptococcus pneumoniae Strains Isolated from Pakistan . . . Faidad Khan Mohsin Ahmad Khan Nadeem Ahmed . . . Muhammad Islam Khan Hamid Bashir Saad Tahir Ahmad Usman Zafar Received: January 3, 2018 / Published online: March 9, 2018 The Author(s) 2018. This article is an open access publication female)] had undergone no antibiotic treatment ABSTRACT in at least the past 3 months and had no vac- cination history. We investigated the serotype Introduction: Pakistan has one of the highest distribution, antibiotic susceptibility, preva- burdens of pneumococcal diseases in the world, lence of the PspA family and its active domain’s but unfortunately studies in this demanding fusion, expression and antigenicity. research area are limited in the region. Pneu- Results: Our finding shows that serotype 19F is mococcal surface protein A (PspA) is the next the most prevalent (23.6%) followed by 18B generation pneumococcal vaccine candidate as (15.78%) (non-vaccine type) in all isolated the protein locates on the Streptococcus pneu- pneumococcal strains. All strains were suscep- moniae surface. Its gene, pspA, might be encoded tible to chloramphenicol and linezolid, while by all pneumococci, and the protein has proven 80% were resistant to gentamycin. Genotyping immunogenicity. The molecular characteriza- revealed that * 80% (N = 31/38) of pneumo- tion of PspA, pneumococcal serotype distribu- coccal strains produce PspA belonging to family tion and antibiotic susceptibility are important 2 and clade 3. We further selected three active for regional diversity studies. domains of PspA (family 2 and clade 3) by in Methods: In this study, we examined 38 pneu- silico analysis, merged together into a fusion mococcal isolates from pneumococcal diseased gene for expression study, and its antigenicity (pneumonia/meningitis) patients blood or was analyzed by Western blotting. cerebrospinal fluid. There were no specific Conclusion: Serotypes 19F and 18B (non-vac- inclusion or exclusion criteria, but all the indi- cine type) are the most prevalent in the Pak- viduals [ages 1 month to 12 years (male/ istani pneumococcal isolates. The PspA family 2 Enhanced content To view enhanced content for this proteins produced by Pakistani pneumococcal article go to https://doi.org/10.6084/m9.figshare. isolates have high sequence homologies with each other and differ from those produced by Electronic supplementary material The online strains isolated in the rest of the world. The version of this article (https://doi.org/10.1007/s40121- PspA fusion peptide had a proven antigenic 018-0195-0) contains supplementary material, which is response in western blotting, with no consid- available to authorized users. erable correlation among pneumococcal ser- otypes, antibiotic susceptibility and PspA F. Khan (&)  M. A. Khan  N. Ahmed M. I. Khan  H. Bashir  S. Tahir  A. U. Zafar family/clade distribution. Centre of Excellence in Molecular Biology, University of the Punjab, Lahore, Pakistan e-mail: faidadkhan@cemb.edu.pk 278 Infect Dis Ther (2018) 7:277–289 Keywords: Antibiotic susceptibility; vaccines might be useful against PD [9, 10]. Pneumococcal surface protein A; Serotype; Pneumococcal peptide-based vaccines utilize Streptococcus pneumoniae the most immunogenic pneumococcal protein antigens, such as pneumococcal surface protein A (PspA), pneumococcal surface protein C INTRODUCTION (PspC), pneumolysin (Ply) and pneumococcal surface adhesin A (PsaA), and many others have Streptococcus pneumoniae (pneumococcus) causes shown immunogenicity and protection against pneumonia, otitis media and other invasive lethal challenge with pneumococcus in animal diseases such as bacteremia and meningitis, models [8]. collectively called pneumococcal diseases (PD). The pneumococcal surface protein A (PspA) Pneumococcus plays a major role in the mor- is a surface-exposed protein and one of the bidity and mortality of children as well as the candidates for inclusion in the next generation elderly worldwide [1]. It is estimated of pneumococcal vaccines as the protein locates that * 14.5 million cases of PD occur each year, on the surface of all pneumococci and is causing the deaths of * 1 million children \ immunogenic. For example, PspA interferes 5 years of age [2]. The increasing antibiotic with the fixation of complement C3b and also resistance of S. pneumoniae worldwide is another binds human lactoferrin, which interferes with concern for the treatment of PD [3]. There are its protective role [11, 12]. All studied pneu- more than 90 known pneumococcal serotypes, mococcal strains carry the gene pspA, which but most PDs are produced by a few types [4]. encodes for the protein PspA [13]. When the Vaccines against these serotypes, which gener- mature PspA protein was injected in an animal ate immunity against the capsular polysaccha- model, anti-PspA antibodies were detected [14]. ride, have reduced the burden of pneumococcal Molecular studies of the PspA protein have been diseases in some countries [5]. Pneumococcal classically carried out using serotype 2, strain polysaccharide vaccines (PSVs) protect against Rx1. The protein (PspA) has five domains, numerous serotypes. However, PSV does not including (1) an N-terminus signal peptide, (2) generate isotype switching and memory B cell alpha-helical domain, (3) proline-rich region, induction, as it is a T-cell-independent (4) choline-binding domain consisting of 20 immunogen, thus leading to temporary pro- amino acid repeats and (5) C-terminus tail. PspA tection, and it is only recommended for the utilizes its choline-binding domain to anchor elderly population [6]. To solve this problem, onto the pneumococcal cell surface via lipotei- pneumococcal conjugate vaccines (PCVs) were choic acids and its alpha-helical domain to bind developed, including a carrier-peptide, diph- to the surface of host cells via a still unknown theria toxoid (CRM-197), which mediates the receptor. Based on the sequence (clade-defining T-cell response. PCVs initiate memory B cell region) of the alpha-helical region, PspA can be production, resulting in robust immunity in classified into three families, from 1 to 3, and infants [7]. PCVs cause an active immune further subdivided into six clades (clades 1–6) response and protect against the most prevalent [15]. serotypes, but new approaches are needed Pakistan, a country located in South Asia, has because of the phenomenon of serotype the third most pneumococcal diseases in the replacement post-vaccination, cost and pro- world, especially ‘pneumococcal pneumonia,’ duction complications [8, 9]. Therefore, the which makes it an ideal location to begin development of more effective vaccines against exploring pneumococcal serotypes and antibi- pneumococcus with low production costs but otic susceptibility [16]. In this pilot study, we having a broader spectrum is warranted. The sought to characterize the prevalence of PspA key is to develop a vaccine that protects against from Pakistani pneumococcal isolates and all known pneumococcal serotypes and new identify the most prevalent family and clade. strains as they emerge. Some research groups have recently demonstrated that peptide-based Infect Dis Ther (2018) 7:277–289 279 were further confirmed as S. pneumoniae using a METHODS PCR procedure that targeted the lytA gene [20]. Pneumococcal strain serotyping was done by Compliance with Ethics Guidelines the quellung reaction using the SSI Pneu- motest kit (Statens Serum Institut, Denmark) The current study (both the study and collec- [21]. tion of specimens) was approved by the Advanced Studies and Research Board of the Antibiotic Susceptibility Testing University of the Punjab, Lahore, Pakistan (D/ 4439-ACAD), and sample collection from patients was approved by the Institutional Antibiotic susceptibility tests were carried out TM Review Board (IRB)/Ethics Committee of the using antimicrobial disks (Oxoid , UK) fol- Children’s Hospital and the Institute of Child lowing the EUCAST recommendations [22]. Antibiotics were selected according to common Health, Lahore, Pakistan (CH.AD251). Speci- mens were collected (according to recom- prescriptions in Pakistani hospitals and inclu- ded: ampicillin (25 lg), amikacin (30 lg), mended and approved procedures) from those patients or children whose parents or guardians amoxycillin (25 lg), co-amoxiclav (amoxi- cillin/clavulanic acid) (30 lg), cefotaxime agreed to participate in this study; it was speci- fied that biologic material would only be uti- (30 lg), ceftriaxone (30 lg), cefuroxime (30 lg), lized for research purposes. It was further cephalexin (30 lg), chloramphenicol (30 lg), clarified that all procedures performed in stud- fusidic acid (10 lg), gentamycin (30 lg), line- ies involving human participants were in zolid (30 lg), teicoplanin (30 lg) and van- accordance with the ethical standards of the comycin (30 lg). institutional and/or national research commit- tee and with the 1964 Helsinki Declaration and DNA Extraction and Amplification its later amendments or comparable ethical of the pspA Gene standards. Informed consent was obtained from all individual participants included in the Streptococcus pneumoniae genomic DNA was study. extracted from an overnight culture grown on Todd-Hewitt broth with 0.5% yeast extract TM Streptococcus Pneumoniae Isolation (Oxoid , UK) incubated at 37 C with a 5% and Identification of Serotypes CO atmosphere using a DNA extraction kit TM (Invitrogen , USA) following the manufac- turer’s instructions. The pspA gene was identi- In this study, we examined suspected pneumo- coccal disease (pneumonia and meningitis) fied and amplified by PCR in a 25-ll reaction volume containing 2.5 mM MgCl , 1X Taq DNA patient’s blood or cerebrospinal fluid (CSF) [17], and N = 38 specimens were confirmed positive polymerase buffer, 2 mM (each) deoxynucle- for pneumococci. All the individuals (aged oside triphosphates (dNTPs), 1 lM of each pri- 1 month to 12 years, male/female, from 2014 to mer (SKH2 and LSM12) (Table 1), 2.5 U of Taq TM 2015) were newly admitted to the hospital and DNA polymerase (Invitrogen , USA) and had undergone no antibiotic treatment in at 25–30 ng/ll pneumococcal genomic DNA tem- least the last 3 months and had no vaccination plate. To specifically amplify the pspA gene belonging to the different families, the follow- history. There were no specific inclusion or exclusion criteria. ing pairs of primers were utilized: LSM12 and SKH63 (family 1), LSM12 and SKH52 (family 2) Streptococcus pneumoniae isolates were iden- tified with standard methods including sensi- and SKH41 and SKH42 (family 3) (Table 1)[15]. The following PCR conditions were used: an tivity to optochin, bile salt solubility, catalase negativity, alpha-hemolysis and the agglutina- initial denaturing step at 95 C for 3 min, 30 TM TM tion method using the BBL Pneumoslide cycles of 95 C for 1 min, 62 C for 1 min and Test (catalog no. 240840) [18, 19]. The isolates 72 C for 2 min, followed by a final extension at 280 Infect Dis Ther (2018) 7:277–289 Table 1 Sets of PCR primers used in the study for identification of lytA, PspA and family distribution of the PspA gene 0 0 Primer name Sequence 5 –3 lytA forward CAACCGTACAGAATGAAGCGG lytA reverse TTATTCGTGCAATACTCGTGCG SKH2 CCACATACCGTTTTCTTGTTTCCAGCC LSM12 CCGGATCCAGCGTGCCTATCTTAGGGGCTGGTT SKH52 TGGGGGTGGAGTTTCTTCTTCATCT SKH63 TTTCTGGCTCATYAACTGCTTTC SKH41 CGCACAGACTTAACAGATGAAC SKH42 CTTGTCCATCAACTTCATCC TM 72 C for 10 min. All PCR products obtained commercially available DNAstar software and from pneumococcal strains encoding family 2 by protein homology modeling [25]. were purified and sequenced using GenScript (GenScript USA, Inc.) as well as the core facility In-silico Determination of Immunogenic of the Centre of Applied Molecular Biology, Sites Lahore, Pakistan using PspA gene-specific fam- ily 2 forward and reverse primers. DNA The physicochemical properties of the amino sequences were assembled using NCBI BLAST acids are considered key to calculating antigenic online. The clade distributions were found by sites and the occurrence frequencies in experi- the clade-defining region (CDR) occurring in mental segmental epitopes. These predictions the PspA protein. were based on methods published by Kolaskar and Tongaonkar, Margalit and Spouge and Evolutionary and Phylogenetic Analysis Jameson and Wolf [26–28]. The experiments 0 0 showed that the N - and C -terminus protein The PspA protein and its DNA sequences were regions are mostly solvent accessible and observed using the MEGA-6 and ClustalW2 unstructured, and an alpha-helical domain is tools for evolutionary and phylogenetic analysis the receptor-binding site; thus, we selected with each other and with the online NCBI these regions of the PspA peptide sequence [29]. databank PspA depository [23, 24]. The PspA Antibody responses to such protein regions are sequencing data were analyzed according to likely to be recognized by antibodies raised known geographical regions available on online against the native protein. The predicted anti- NCBI database. genic peptides were analyzed in silico, and three prominent sequences were selected for the cloning and expression and antigenic property THREE-DIMENSIONAL STRUCTURE analysis via Western blotting. OF PSPA FAMILY 2, CLADE 3 Active Domain Fusion, Cloning, The hypothetical 3D structure of PspA family 2, Expression and Western Blotting clade 3, was required to identify peptides that could have been exposed on the surface; we In-silico determined/selected sequences were therefore predicted the structure using the merged/fused together (189 base pairs; what we will call the fusion gene was synthesized using Infect Dis Ther (2018) 7:277–289 281 GenScript (GenScript, Inc., USA) and cloned in Serotype Distribution of S. Pneumoniae TM Strains pTrcHisA expression vector (Invitrogen , USA) for a pilot expression study in E. coli (Fig. 6). Fusion gene transformants were harvested and The prevalence of pneumococcal serotypes processed for intracellular expressing proteins. obtained with the quellung reaction was as Expression was checked with time course 1 mM/ follows: strains belonging to serotype 19F, mL IPTG induction from 0 to 16 h. Western 23.60%; serotype 18B strains (non-vaccine blotting was carried out using a nitrocellulose type), 15.78%; 23F, 13.15%; 14, 10.52%; 10A, membrane treated with a primary antibody 10.52%; 3, 5.26%; 18C, 5.26%; 6B, 5.26%; 23B, [goat polyclonal Anti-PspA (bf-19; catalog no. (non-vaccine type), 2.63%; 6C (non-vaccine sc17483)] using 1:500 dilution; secondary anti- type), 2.63%; 8, 2.63%; serotype 12F, 2.63% body, donkey anti-goat IgG-HRP (catalog no. (Fig. 2). No other serotypes or non-typeable sc2020), dilution 1:10,000. The nitrocellulose strains were observed in the isolated pneumo- membranes were treated with the chemilumi- coccal strains (N = 38). The prevalence of ser- nescent western blot detection method otypes included in PCV-7, PCV-10 or PCV-13 TM TM (Thermo Scientific SuperSignal West Pico were 57.89, 57.89 and 73.68%, respectively, Chemiluminescent Substrate, catalog no. while serotypes included in PPSV-23 repre- 34079) exposing the blot to the imaging system sented 89.47% of the experimental isolates (radiography) for 30 s to 3 min, and the results (Fig. 2). were retrieved on X-ray film [30]. Amplification of the pspA Gene and Molecular Typing of Its Different RESULTS Families and Clades Antibiotic Susceptibility of S. Pneumoniae As the pspA gene is encoded by all pneumo- Isolates coccal strains, we amplified it using PCR from genomic DNA of all strains. To further classify Susceptibility of isolated S. pneumoniae strains to the pspA gene in its different families, another 14 antibiotics commonly prescribing in Pak- set of PCR reactions was performed. These istani hospitals was evaluated. All isolated reactions utilized three different sets of family- pneumococcal strains were susceptible to chlo- specific primers and classified the pspA gene in ramphenicol and linezolid (MIC C 0.5–1 lg/ml family 1, 2 or 3. Our results demonstrated that each); they showed responses to ampicillin most strains (N = 31) encoded a pspA gene (60%, MIC C 0.06–1 lg/ml), amikacin (55%, belonging to family 2, whereas the remaining MIC C 1 lg/ml), amoxycillin (90%, isolates (N = 7) were classified in family 1, and MIC C 0.25–1.5 lg/ml), co-amoxiclav (66%, none were identified as family 3 (Fig. 3). These MIC C 0.06–0.12 lg/ml), cefotaxime (65%, results revealed that PspA family 2 is the most MIC C 0.06–0.25 lg/ml), ceftriaxone (60%, prevalent form (* 80%) of the PspA protein MIC C 0.06–0.5 lg/ml), cefuroxime (60%, among Pakistani pneumococcal isolates and MIC C 0.06–0.5 lg/ml), cephalexin (75%, therefore it was our focus. The pspA genes MIC C 1–2 lg/ml), fusidic acid (82%, belonging to family 2 were sequenced and dis- MIC C 0.12–1 lg/ml), teicoplanin (83%, tributed into their clades. All the sequences MIC C 0.03–0.12 lg/ml) and vancomycin (83%, corresponding to the pspA gene family 2 were MIC C 0.12–1 lg/mL), while 20% of strains submitted to the NCBI GenBank and are avail- presented resistance to gentamycin able online under accession numbers KP337453, (MIC C 4–8 lg/ml) (Fig. 1). KU961865, KY010667 and KU961866 through KU961894. 282 Infect Dis Ther (2018) 7:277–289 Fig. 1 Susceptibility testing of antibiotics. Strains prone to chloramphenicol and linezolid, while 20% of (N = 38) tested with antibiotics commonly prescribed in strains presented resistance to gentamycin Pakistani hospitals are shown on the X-axis following the TM Oxoid , UK and EUCAST recommendations. The susceptibility pattern showed that all the strains were Fig. 2 Percentage prevalence of pneumococcal serotypes samples, the exposure in PCV-7, PCV-10 and PCV-13 was isolated from pneumococcal patients (N = 38). Pneumo- 57.89, 57.89 and 73.68%, respectively, while serotypes coccal strains were serotyped by quellung reaction using included in PPSV23 comprised 89.47% the SSI Pneumotest kit (Statens Serum Institut, Den- mark). Serotype 19F was the leading type (23.60%), followed by 18B (15.78%). In the given number of Multiple Alignments and Phylogenetic N = 1 represented clade 4. The phylogenetic Analysis analyses showed that the PspA from a pneu- mococcal strain isolated in China (FJ663048.1) appears to be an ancestor of the Pakistani PspA Nucleotide sequences of pspA genes and their family 2 protein (Fig. 4). Thus, whereas the PspA amino acid sequences were examined with proteins produced by strains worldwide appear ClustalW2 and MEGA-6 software. Gene to be similar, our studies established high PspA sequences obtained from Pakistani pneumo- sequence homologies among Pakistani isolates, coccal isolates were compared against the PspA different from those produced in other regions native protein. Our analyses demonstrated that of the world. PspAs of N = 30 were the clade 3 genotype and Infect Dis Ther (2018) 7:277–289 283 Fig. 3 PCR amplification of the pspA gene. In 2% agarose genes (strain ID; FP017 and FP019). Lane 1 represents a gel, lane M shows the 1-kb DNA marker; 2, 3 and 5 show negative control pspA family 2 genes (strain ID; FP015, FP016 and FP018), while lanes 4 and 6 correspond to pspA family 1 Fig. 4 The evolutionary history was inferred using the maximum composite likelihood method and are in the neighbor-joining method. The optimal tree with the sum units of the number of base substitutions per site. All of branch length = 15.14 is shown. The tree is drawn to positions containing gaps and missing data were elimi- scale, with branch lengths in the same units as those of the nated. Evolutionary analyses were conducted in MEGA6 evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the 284 Infect Dis Ther (2018) 7:277–289 The DNA sequencing result showed that the THREE-DIMENSIONAL STRUCTURE fusion sequence is consistent with the designed AND ANTIGENIC SITE one and with a correct open reading frame. The DETERMINATION recombinant pTrcHisA vector containing the fusion gene was successfully transformed into Since we were interested in finding PspA- competent E. coli for the pilot expression study derivative antigenic peptides, our next study and induced by 1 mM/ml IPTG. The SDS-PAGE predicted the 3D structures of PspA, utilizing and western blotting of bacterium lysate (pro- TM the DNAstar software. Based on the predicted cessed with B-PER reagents) showed that the motifs, we selected a 3D structure of PspA fam- fusion peptide was successfully expressed. After ily 2 to further identify the antigenic epitopes 3 h induction, the fusion peptide reached the that were most exposed. Three different meth- maximum in the time optimization test, ods, the (1) Kolaskar and Tongaonkar, (2) Mar- although it was not expressed at 0 h induction. galit and Spouge and (3) Jameson and Wolf, In western blotting, anti-PspA antibodies were utilized to identify these epitopes. We responded against this proposed fusion peptide selected three peptides in the PspA family 2 like they did for the whole PspA protein (Fig. 7). protein based on their characteristics, i.e., location, surface exposure, antigenicity, disor- dered ratio and hydrophilicity (Fig. 5). These DISCUSSION peptides were analyzed in silico, and their properties are shown in Table 2. The selected Antibiotics play a crucial role in the proper 0 0 peptides were primarily based on the N - and C - treatment of pneumococcal infections [31]. To terminus regions and an alpha-helical domain the best of our knowledge, no studies showing of PspA. It was proposed that the PspA native the antibiotic-resistant profiles in the Lahore, protein is likely to be recognized by antibodies Pakistan area are available. In the present study, raised against any of these three selected we found that all isolated pneumococcal strains peptides. were susceptible to chloramphenicol and line- zolid, while strains susceptible to gentamycin represented 20% of all cases (Fig. 1). The overall Peptides Fusion, Expression and Western resistance of isolated pneumococcal strains to Blotting antibiotics in the Lahore, Pakistan hospital is low compared with other studies in other geo- The selected three PspA family 2 segments were graphical regions. There is no direct association fused together into a fusion gene by the head- between susceptibility to antibiotics and ser- to-tail method and cloned in an expression TM otypes. These data provide a baseline for the vector pTrcHisA (Invitrogen , USA) (Fig. 6). pneumococcal serotypes responsible for IPD TM Fig. 5 DNAstar was used to predict the 3D structure and hydrophilicity in silico. Finally, they were merged of PspA. a THe Kolaskar and Tongaonkar, b Margalit and together into a fusion peptide Spouge and c Jameson and Wolf methods were followed for peptide selection based on the exposure, antigenicity Infect Dis Ther (2018) 7:277–289 285 Table 2 In-silico analysis and physicochemical properties of selected PspA-derivative peptides Serial no. Antigenic determinant Length Antigenicity Surface Hydrophilicity 1 YRNPSDHAKKLAEA 14 1.22 0.79 0.87 2 VPEQSELAETKKKA 14 1.26 0.71 0.99 3 KLLDSLDPEGKTQD 14 2.42 0.79 0.95 Fig. 6 Fusion gene (189 base pairs) cloned in expression vector pTrcHisA and its potentially expressed peptide Fig. 7 X-ray film radiography image (exposed for 3 min) antibodies [donkey anti-goat IgG-HRP (catalog no. of western blotting for PspA-fusion peptides * 10 kDa. sc2020)]; 0–3 h was the 1 mM/ml IPTG induction time Western blotting was carried out using nitrocellulose membranes treated with primary [goat polyclonal Anti- PspA (bf-19; catalog no. sc17483)] and secondary cases and susceptibility or resistance to antibi- and lack of awareness among the people in otics in Pakistan. Pakistan, reduce its value. These are important Pakistan introduced PCV-7 in 2006 through issues for overall vaccine coverage in the the generous support of the Global Alliance for country. Vaccines and Immunizations (GAVI), and PCV- Our current study showed that most strains 10 was being used in the country by 2013. belonged to a serotype targeted by PCV13 However, the limited availability in hospitals (* 73%), PCV7 (* 57.89%) or PCV10 286 Infect Dis Ther (2018) 7:277–289 (* 57.89%). This information is important While it is essential to define which PspA given that most pneumococcal strains were family 2 fragment shows antigenicity within isolated from PD cases from infants younger the same family, for this we will need to have than 12 months of age and most of them would longer fragments or include a macromolecular be protected if vaccinated with PCV13. How- carrier. This could be a promising immuniza- ever, PPSV23 has * 89.47% exposure in the tion strategy. Pakistani population according to our data. In general, our results showed that the PspA These data show that targeting PPSV23 to a family 2 fusion peptide might be able to large proportion of PD in the region is promis- enhance the level of cross-reactivity in-vivo and ing. An important and dangerous issue is that will achieve cross-reactivity and have a broader the 18B (non-vaccine type), 23B (non-vaccine effect. Moreover, future studies should also type) and 6C (non-vaccine type) serotypes are evaluate whether the protective ability of the also circulating in the Pakistani population antibodies correlates with the cross-reactivity (Fig. 2). The serotype distribution differs from a data presented in this work. Our results will previous report shown by another group in the help future research regarding PspA-based pep- country [32]. This comparison might be related tide vaccines with broad specificity and to temporal and regional differences and the coverage. potential circulation of outbreak strains. The Previous studies have publicized that PspA work presented in this article is based on the families and clades are independent of ser- most prevalent form of PD, pneumococcal otypes. Pneumococci of different serotypes pneumonia, with a few meningitis episodes. could be identified as the same PspA fam- Data should therefore be interpreted keeping ily/clade, and the same serotype could be iden- these important differences in mind. tified in different families and/or clades [34–38]. The PspA-based vaccine for S. pneumoniae is Our data supported that every isolated pneu- an area requiring continuous investigation and mococcal strain encoded a pspA gene, its family development. Studies have shown that PspA has and clade is independent of the serotype, and the potential for development into a human there is no correlation with antibiotic suscepti- PspA-based peptide vaccine [33]. Reports avail- bility (supplementary data provided). Thus, a able from the USA, Canada, France, Spain, PspA-based pneumococcal vaccine would have Sweden, Australia, Japan and China have the potential to reduce the burden of PD in the described that PspA family 2 is the most com- area, possibly worldwide, with the advantage of mon among pneumococci [34–38]. The char- avoiding the serotype replacement or shift acterization of PspA presented in this study observed with other pneumococcal vaccines. demonstrated that most pneumococcal strains isolated in Pakistan carried pspA genes, encod- LIMITATIONS OF THE CURRENT ing the PspA protein belonging to family 2. A more extensive study might be required to draw STUDY complete conclusions. Our group will continue this study, especially quantitatively and in the The data presented, pneumococcal serotypes 18B, 23B and 6C (non-vaccine types), which are other geographical areas of the country. Various research groups have worked on not included in the current approved pneumo- coccal vaccine, but they are circulating in some different fragments of PspA and are claiming the antibodies are inducible [39, 40]. Western ratio. It might be possible that some other non- vaccine types are also present in the region. blot analysis revealed that there was strong recognition of the PspA fusion peptide. These Pneumococcal surface protein A family 2 is most prevalent in Pakistani pneumococcal iso- results confirm that, among the PspA fragments analyzed in the literature [39, 40], our retrieved lates. For this, a more extensive study is required PspA family 2 segments would be the most to reach definite conclusions. The PspA fusion peptide certainly revealed antigenic recognition suitable for the induction of broad reactivity, and this will be an even more effective strategy. Infect Dis Ther (2018) 7:277–289 287 in Western blotting, but it must be analyzed in the Punjab, Lahore, Pakistan (D/4439-ACAD), an animal model for immunogenetic study. and sample collection from patients was approved by the Institutional Review Board (IRB)/Ethics Committee of the Children’s CONCLUSION Hospital and Institute of Child Health, Lahore, Pakistan (CH.AD251). Specimens were collected The present introductory study reported that (according to the recommended andapproved serotypes 19F and 18B (non-vaccine type) are procedure) from these patients or children the most prevalent serotypes isolated from PD whose parents or guardians, agreed to partici- cases in Pakistan. The prevalent PspA proteins pate in this study. It was specified that biologic produced by Pakistani isolates belong to family material would only be utilized for research 2 and clade 3. They have high sequence purposes. It is further clarified that all proce- homologies with each other and are different dures performed in studies involving human from those produced by strains isolated in the participants were in accordance with the ethical rest of the world. The PspA fusion peptide standards of the institutional and/or national showed a positive antigenic response on Wes- research committee and with the 1964 Helsinki tern blotting (Fig. 7), which will be further Declaration and its later amendments or com- characterized in the recommended assays and parable ethical standards. Informed consent was an animal model (in vivo). obtained from all individual participants inclu- ded in the study. All subjects provided written informed consent to participate in this study. An independent ethics committee or institu- ACKNOWLEDGEMENTS tional review board reviewed the study protocol and amendments. We thank the Ethics Committee of the Chil- dren’s Hospital Lahore for providing permission Thanking Patients. All the authors thank to collect pneumococcal samples. the patients and their families/guardians. Funding. We acknowledge the sup- Data Availability. The data produced or port/funding from the Higher Education Com- evaluated during the current study and more mission (HEC) of Pakistan for the doctoral information about the data are available from the thesis (grant 2BM1-227). No funding or spon- corresponding author on reasonable request. sorship was received for the publication of this article. Open Access. This article is distributed under the terms of the Creative Commons Authorship. All authors meet the criteria of Attribution-NonCommercial 4.0 International the International Committee of Medical Journal License (http://creativecommons.org/licenses/ Editors (ICMJE) for authorship for this manu- by-nc/4.0/), which permits any noncommer- script, take responsibility for the integrity of the cial use, distribution, and reproduction in any work as a whole, and have given final approval medium, provided you give appropriate credit for the version to be published. to the original author(s) and the source, provide a link to the Creative Commons license, and Disclosures. Faidad Khan, Mohsin Ahmad indicate if changes were made. Khan, Nadeem Ahmed, Muhammad Islam Khan, Hamid Bashir, Saad Tahir and Ahmad Usman Zafar having nothing to disclose. REFERENCES Compliance with Ethics Guidelines. The current study (both the study and collection of 1. Tan TQ. Pediatric invasive pneumococcal disease in specimens) was approved by the Advanced the United States in the era of pneumococcal Studies and Research Board of the University of 288 Infect Dis Ther (2018) 7:277–289 conjugate vaccines. Clin Microbiol Rev. 14. Ferreira DM, Darrieux M, Silva DA, et al. Charac- 2012;25(3):409–19. terization of protective mucosal and systemic immune responses elicited by pneumococcal sur- 2. O’Brien KL, Wolfson LJ, Watt JP, et al. Burden of face protein PspA and PspC nasal vaccines against a disease caused by Streptococcus pneumoniae in chil- respiratory pneumococcal challenge in mice. Clin dren younger than 5 years: global estimates. Lancet. Vaccine Immunol. 2009;16(5):636–45. 2009;374(9693):893–902. 15. Hollingshead SK, Becker R, Briles DE. Diversity of 3. Bogaert D, de Groot R, Hermans P. Streptococcus PspA: mosaic genes and evidence for past recom- pneumoniae colonisation: the key to pneumococcal bination in Streptococcus pneumoniae. Infect Immun. disease. Lancet Infect Dis. 2004;4(3):144–54. 2000;68(10):5889–900. 4. Calix JJ, Nahm MH. A new pneumococcal serotype, 16. Owais A, Tikmani SS, Sultana S, et al. Incidence of 11E, has a variably inactivated wcjE gene. J Infect pneumonia, bacteremia, and invasive pneumococ- Dis. 2010;202(1):29–38. cal disease in Pakistani children. Trop Med Int Health. 2010;15(9):1029–36. 5. An Q, Hernandez A, Prejean J, German EJ, 17. Nagaraj S, Kalal BS, Manoharan A, Shet A. Strepto- Thompson H, Hall HI. Geographic differences in coccus pneumoniae serotype prevalence and antibi- HIV infection among Hispanics or Latinos—46 otic resistance among young children with invasive states and Puerto Rico, 2010. MMWR Morb Mortal pneumococcal disease: experience from a tertiary Wkly Rep. 2012;61:805–10. care center in South India. Germs. 2017;7(2):78. 6. Defrance T, Taillardet M, Genestier L. T cell-inde- 18. Castillo D, Harcourt B, Hatcher C, Jackson M, Katz pendent B cell memory. Curr Opin Immunol. L, Mair R. Identification and characterization of 2011;23(3):330–6. Streptococcus pneumoniae. Laboratory methods for the diagnosis of meningitis caused by neisseria 7. Rennels MB, Edwards KM, Keyserling HL, et al. meningitidis, Streptococcus pneumoniae, and hae- Safety and immunogenicity of heptavalent pneu- mophilus influenzae. 2011:73–86. mococcal vaccine conjugated to CRM197 in United States infants. Pediatrics. 1998;101(4):604–11. 19. Chan WW, Lovgren M, Tyrrell GJ. Utility of the pneumoslide test in identification of Streptococcus 8. Darrieux M, Goulart C, Briles D, Leite LC. Current status and perspectives on protein-based pneumo- pneumoniae in blood cultures and its relation to coccal vaccines. Crit Rev Microbiol. capsular serotype. J Clin Microbiol. 2015;41(2):190–200. 2009;47(5):1559–61. 9. Weinberger DM, Malley R, Lipsitch M. Serotype 20. Seki M, Yamashita Y, Torigoe H, Tsuda H, Sato S, replacement in disease after pneumococcal vacci- Maeno M. Loop-mediated isothermal amplification nation. Lancet. 2011;378(9807):1962–73. method targeting the lytA gene for detection of Streptococcus pneumoniae. J Clin Microbiol. 10. Mann B, Thornton J, Heath R, et al. Broadly pro- 2005;43(4):1581–6. tective protein-based pneumococcal vaccine com- posed of pneumolysin toxoid-CbpA peptide 21. Slotved H-C, Kaltoft M, Skovsted I, Kerrn M, recombinant fusion protein. J Infect Dis. Espersen F. Simple, rapid latex agglutination test for 2014;209(7):1116–25. serotyping of pneumococci (Pneumotest-Latex). J Clin Microbiol. 2004;42(6):2518–22. 11. Hakansson A, Roche H, Mirza S, McDaniel LS, Brooks-Walter A, Briles DE. Characterization of 22. Matuschek E, Brown DF, Kahlmeter G. Develop- binding of human lactoferrin to pneumococcal ment of the EUCAST disk diffusion antimicrobial surface protein A. Infect Immun. susceptibility testing method and its implementa- 2001;69(5):3372–81. tion in routine microbiology laboratories. Clin Microbiol Infect. 2014;20(4):O255–66. 12. Tu AH, Fulgham RL, McCrory MA, Briles DE, Szalai AJ. Pneumococcal surface protein A inhibits com- 23. Li KB. ClustalW-MPI: clustalW analysis using dis- plement activation by Streptococcus pneumoniae. tributed and parallel computing. Bioinformatics. Infect Immun. 1999;67(9):4720–4. 2003;19(12):1585–6. 13. Crain MJ, Waltman WD 2nd, Turner JS, et al. 24. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis Pneumococcal surface protein A (PspA) is serologi- version 6.0. Mol Biol Evol. 2013;30(12):2725–9. cally highly variable and is expressed by all clini- cally important capsular serotypes of Streptococcus pneumoniae. Infect Immun. 1990;58(10):3293–9. Infect Dis Ther (2018) 7:277–289 289 25. Schwede T, Kopp J, Guex N, Peitsch MC. SWISS- 34. Hollingshead SK, Baril L, Ferro S, et al. Pneumo- MODEL: an automated protein homology-model- coccal surface protein A (PspA) family distribution ing server. Nucleic Acids Res. 2003;31(13):3381–5. among clinical isolates from adults over 50 years of age collected in seven countries. J Med Microbiol. 26. Jameson B, Wolf H. The antigenic index: a novel 2006;55(Pt 2):215–21. algorithm for predicting antigenic determinants. Comput Appl Biosci CABIOS. 1988;4(1):181–6. 35. Hotomi M, Togawa A, Kono M, et al. PspA family distribution, antimicrobial resistance and serotype 27. Kolaskar AS, Tongaonkar PC. A semi-empirical of Streptococcus pneumoniae isolated from upper method for prediction of antigenic determinants respiratory tract infections in Japan. PLoS ONE. on protein antigens. FEBS Lett. 2013;8(3):e58124. 1990;276(1–2):172–4. 36. Pimenta FC, Ribeiro-Dias F, Brandileone MC, Miyaji 28. Margalit H, Spouge JL, Cornette JL, Cease KB, Delisi EN, Leite LC, Sgambatti de Andrade AL. Genetic C, Berzofsky JA. Prediction of immunodominant diversity of PspA types among nasopharyngeal iso- helper T cell antigenic sites from the primary lates collected during an ongoing surveillance study of children in Brazil. J Clin Microbiol. sequence. J Immunol. 1987;138(7):2213–29. 2006;44(8):2838–43. 29. Faraggi E, Xue B, Zhou Y. Improving the prediction accuracy of residue solvent accessibility and real- 37. Qian J, Yao K, Xue L, et al. Diversity of pneumo- value backbone torsion angles of proteins by gui- coccal surface protein A (PspA) and relation to ded-learning through a two-layer neural network. sequence typing in Streptococcus pneumoniae causing Proteins. 2009;74(4):847–56. invasive disease in Chinese children. Eur J Clin Microbiol Infect Dis. 2012;31(3):217–23. 30. Dawson NJ, Biggar KK, Storey KB. Characterization of fructose-1, 6-bisphosphate aldolase during 38. Rolo D, Ardanuy C, Fleites A, Martin R, Linares J. anoxia in the tolerant turtle, Trachemys scripta Diversity of pneumococcal surface protein A (PspA) elegans: an assessment of enzyme activity, expres- among prevalent clones in Spain. BMC Microbiol. sion and structure. PLoS ONE. 2013;8(7):e68830. 2009;9:80. 31. Song JH, Jung SI, Ko KS, et al. High prevalence of 39. Moreno AT, Oliveira MLS, Ferreira DM, et al. antimicrobial resistance among clinical Streptococ- Immunization of mice with single PspA fragments cus pneumoniae isolates in Asia (an ANSORP study). induces antibodies capable of mediating comple- Antimicrob Agents Chemother. 2004;48(6):2101–7. ment deposition on different pneumococcal strains and cross-protection. Clin Vaccine Immunol. 32. Mastro T, Spika J, Facklam R, et al. Antimicrobial 2010;17(3):439–46. resistance of pneumococci in children with acute lower respiratory tract infection in Pakistan. Lancet. 40. Darrieux M, Moreno AT, Ferreira DM, et al. Recog- 1991;337(8734):156–9. nition of pneumococcal isolates by antisera raised against PspA fragments from different clades. J Med 33. Briles DE, Hollingshead S, Brooks-Walter A, et al. Microbiol. 2008;57(3):273–8. The potential to use PspA and other pneumococcal proteins to elicit protection against pneumococcal infection. Vaccine. 2000;18(16):1707–11. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Infectious Diseases and Therapy Springer Journals

Molecular Characterization of Pneumococcal Surface Protein A (PspA), Serotype Distribution and Antibiotic Susceptibility of Streptococcus pneumoniae Strains Isolated from Pakistan

Free
13 pages

Loading next page...
 
/lp/springer_journal/molecular-characterization-of-pneumococcal-surface-protein-a-pspa-eMV3XhelhK
Publisher
Springer Healthcare
Copyright
Copyright © 2018 by The Author(s)
Subject
Medicine & Public Health; Internal Medicine; Infectious Diseases
ISSN
2193-8229
eISSN
2193-6382
D.O.I.
10.1007/s40121-018-0195-0
Publisher site
See Article on Publisher Site

Abstract

Infect Dis Ther (2018) 7:277–289 https://doi.org/10.1007/s40121-018-0195-0 ORIGINAL RESEARCH Molecular Characterization of Pneumococcal Surface Protein A (PspA), Serotype Distribution and Antibiotic Susceptibility of Streptococcus pneumoniae Strains Isolated from Pakistan . . . Faidad Khan Mohsin Ahmad Khan Nadeem Ahmed . . . Muhammad Islam Khan Hamid Bashir Saad Tahir Ahmad Usman Zafar Received: January 3, 2018 / Published online: March 9, 2018 The Author(s) 2018. This article is an open access publication female)] had undergone no antibiotic treatment ABSTRACT in at least the past 3 months and had no vac- cination history. We investigated the serotype Introduction: Pakistan has one of the highest distribution, antibiotic susceptibility, preva- burdens of pneumococcal diseases in the world, lence of the PspA family and its active domain’s but unfortunately studies in this demanding fusion, expression and antigenicity. research area are limited in the region. Pneu- Results: Our finding shows that serotype 19F is mococcal surface protein A (PspA) is the next the most prevalent (23.6%) followed by 18B generation pneumococcal vaccine candidate as (15.78%) (non-vaccine type) in all isolated the protein locates on the Streptococcus pneu- pneumococcal strains. All strains were suscep- moniae surface. Its gene, pspA, might be encoded tible to chloramphenicol and linezolid, while by all pneumococci, and the protein has proven 80% were resistant to gentamycin. Genotyping immunogenicity. The molecular characteriza- revealed that * 80% (N = 31/38) of pneumo- tion of PspA, pneumococcal serotype distribu- coccal strains produce PspA belonging to family tion and antibiotic susceptibility are important 2 and clade 3. We further selected three active for regional diversity studies. domains of PspA (family 2 and clade 3) by in Methods: In this study, we examined 38 pneu- silico analysis, merged together into a fusion mococcal isolates from pneumococcal diseased gene for expression study, and its antigenicity (pneumonia/meningitis) patients blood or was analyzed by Western blotting. cerebrospinal fluid. There were no specific Conclusion: Serotypes 19F and 18B (non-vac- inclusion or exclusion criteria, but all the indi- cine type) are the most prevalent in the Pak- viduals [ages 1 month to 12 years (male/ istani pneumococcal isolates. The PspA family 2 Enhanced content To view enhanced content for this proteins produced by Pakistani pneumococcal article go to https://doi.org/10.6084/m9.figshare. isolates have high sequence homologies with each other and differ from those produced by Electronic supplementary material The online strains isolated in the rest of the world. The version of this article (https://doi.org/10.1007/s40121- PspA fusion peptide had a proven antigenic 018-0195-0) contains supplementary material, which is response in western blotting, with no consid- available to authorized users. erable correlation among pneumococcal ser- otypes, antibiotic susceptibility and PspA F. Khan (&)  M. A. Khan  N. Ahmed M. I. Khan  H. Bashir  S. Tahir  A. U. Zafar family/clade distribution. Centre of Excellence in Molecular Biology, University of the Punjab, Lahore, Pakistan e-mail: faidadkhan@cemb.edu.pk 278 Infect Dis Ther (2018) 7:277–289 Keywords: Antibiotic susceptibility; vaccines might be useful against PD [9, 10]. Pneumococcal surface protein A; Serotype; Pneumococcal peptide-based vaccines utilize Streptococcus pneumoniae the most immunogenic pneumococcal protein antigens, such as pneumococcal surface protein A (PspA), pneumococcal surface protein C INTRODUCTION (PspC), pneumolysin (Ply) and pneumococcal surface adhesin A (PsaA), and many others have Streptococcus pneumoniae (pneumococcus) causes shown immunogenicity and protection against pneumonia, otitis media and other invasive lethal challenge with pneumococcus in animal diseases such as bacteremia and meningitis, models [8]. collectively called pneumococcal diseases (PD). The pneumococcal surface protein A (PspA) Pneumococcus plays a major role in the mor- is a surface-exposed protein and one of the bidity and mortality of children as well as the candidates for inclusion in the next generation elderly worldwide [1]. It is estimated of pneumococcal vaccines as the protein locates that * 14.5 million cases of PD occur each year, on the surface of all pneumococci and is causing the deaths of * 1 million children \ immunogenic. For example, PspA interferes 5 years of age [2]. The increasing antibiotic with the fixation of complement C3b and also resistance of S. pneumoniae worldwide is another binds human lactoferrin, which interferes with concern for the treatment of PD [3]. There are its protective role [11, 12]. All studied pneu- more than 90 known pneumococcal serotypes, mococcal strains carry the gene pspA, which but most PDs are produced by a few types [4]. encodes for the protein PspA [13]. When the Vaccines against these serotypes, which gener- mature PspA protein was injected in an animal ate immunity against the capsular polysaccha- model, anti-PspA antibodies were detected [14]. ride, have reduced the burden of pneumococcal Molecular studies of the PspA protein have been diseases in some countries [5]. Pneumococcal classically carried out using serotype 2, strain polysaccharide vaccines (PSVs) protect against Rx1. The protein (PspA) has five domains, numerous serotypes. However, PSV does not including (1) an N-terminus signal peptide, (2) generate isotype switching and memory B cell alpha-helical domain, (3) proline-rich region, induction, as it is a T-cell-independent (4) choline-binding domain consisting of 20 immunogen, thus leading to temporary pro- amino acid repeats and (5) C-terminus tail. PspA tection, and it is only recommended for the utilizes its choline-binding domain to anchor elderly population [6]. To solve this problem, onto the pneumococcal cell surface via lipotei- pneumococcal conjugate vaccines (PCVs) were choic acids and its alpha-helical domain to bind developed, including a carrier-peptide, diph- to the surface of host cells via a still unknown theria toxoid (CRM-197), which mediates the receptor. Based on the sequence (clade-defining T-cell response. PCVs initiate memory B cell region) of the alpha-helical region, PspA can be production, resulting in robust immunity in classified into three families, from 1 to 3, and infants [7]. PCVs cause an active immune further subdivided into six clades (clades 1–6) response and protect against the most prevalent [15]. serotypes, but new approaches are needed Pakistan, a country located in South Asia, has because of the phenomenon of serotype the third most pneumococcal diseases in the replacement post-vaccination, cost and pro- world, especially ‘pneumococcal pneumonia,’ duction complications [8, 9]. Therefore, the which makes it an ideal location to begin development of more effective vaccines against exploring pneumococcal serotypes and antibi- pneumococcus with low production costs but otic susceptibility [16]. In this pilot study, we having a broader spectrum is warranted. The sought to characterize the prevalence of PspA key is to develop a vaccine that protects against from Pakistani pneumococcal isolates and all known pneumococcal serotypes and new identify the most prevalent family and clade. strains as they emerge. Some research groups have recently demonstrated that peptide-based Infect Dis Ther (2018) 7:277–289 279 were further confirmed as S. pneumoniae using a METHODS PCR procedure that targeted the lytA gene [20]. Pneumococcal strain serotyping was done by Compliance with Ethics Guidelines the quellung reaction using the SSI Pneu- motest kit (Statens Serum Institut, Denmark) The current study (both the study and collec- [21]. tion of specimens) was approved by the Advanced Studies and Research Board of the Antibiotic Susceptibility Testing University of the Punjab, Lahore, Pakistan (D/ 4439-ACAD), and sample collection from patients was approved by the Institutional Antibiotic susceptibility tests were carried out TM Review Board (IRB)/Ethics Committee of the using antimicrobial disks (Oxoid , UK) fol- Children’s Hospital and the Institute of Child lowing the EUCAST recommendations [22]. Antibiotics were selected according to common Health, Lahore, Pakistan (CH.AD251). Speci- mens were collected (according to recom- prescriptions in Pakistani hospitals and inclu- ded: ampicillin (25 lg), amikacin (30 lg), mended and approved procedures) from those patients or children whose parents or guardians amoxycillin (25 lg), co-amoxiclav (amoxi- cillin/clavulanic acid) (30 lg), cefotaxime agreed to participate in this study; it was speci- fied that biologic material would only be uti- (30 lg), ceftriaxone (30 lg), cefuroxime (30 lg), lized for research purposes. It was further cephalexin (30 lg), chloramphenicol (30 lg), clarified that all procedures performed in stud- fusidic acid (10 lg), gentamycin (30 lg), line- ies involving human participants were in zolid (30 lg), teicoplanin (30 lg) and van- accordance with the ethical standards of the comycin (30 lg). institutional and/or national research commit- tee and with the 1964 Helsinki Declaration and DNA Extraction and Amplification its later amendments or comparable ethical of the pspA Gene standards. Informed consent was obtained from all individual participants included in the Streptococcus pneumoniae genomic DNA was study. extracted from an overnight culture grown on Todd-Hewitt broth with 0.5% yeast extract TM Streptococcus Pneumoniae Isolation (Oxoid , UK) incubated at 37 C with a 5% and Identification of Serotypes CO atmosphere using a DNA extraction kit TM (Invitrogen , USA) following the manufac- turer’s instructions. The pspA gene was identi- In this study, we examined suspected pneumo- coccal disease (pneumonia and meningitis) fied and amplified by PCR in a 25-ll reaction volume containing 2.5 mM MgCl , 1X Taq DNA patient’s blood or cerebrospinal fluid (CSF) [17], and N = 38 specimens were confirmed positive polymerase buffer, 2 mM (each) deoxynucle- for pneumococci. All the individuals (aged oside triphosphates (dNTPs), 1 lM of each pri- 1 month to 12 years, male/female, from 2014 to mer (SKH2 and LSM12) (Table 1), 2.5 U of Taq TM 2015) were newly admitted to the hospital and DNA polymerase (Invitrogen , USA) and had undergone no antibiotic treatment in at 25–30 ng/ll pneumococcal genomic DNA tem- least the last 3 months and had no vaccination plate. To specifically amplify the pspA gene belonging to the different families, the follow- history. There were no specific inclusion or exclusion criteria. ing pairs of primers were utilized: LSM12 and SKH63 (family 1), LSM12 and SKH52 (family 2) Streptococcus pneumoniae isolates were iden- tified with standard methods including sensi- and SKH41 and SKH42 (family 3) (Table 1)[15]. The following PCR conditions were used: an tivity to optochin, bile salt solubility, catalase negativity, alpha-hemolysis and the agglutina- initial denaturing step at 95 C for 3 min, 30 TM TM tion method using the BBL Pneumoslide cycles of 95 C for 1 min, 62 C for 1 min and Test (catalog no. 240840) [18, 19]. The isolates 72 C for 2 min, followed by a final extension at 280 Infect Dis Ther (2018) 7:277–289 Table 1 Sets of PCR primers used in the study for identification of lytA, PspA and family distribution of the PspA gene 0 0 Primer name Sequence 5 –3 lytA forward CAACCGTACAGAATGAAGCGG lytA reverse TTATTCGTGCAATACTCGTGCG SKH2 CCACATACCGTTTTCTTGTTTCCAGCC LSM12 CCGGATCCAGCGTGCCTATCTTAGGGGCTGGTT SKH52 TGGGGGTGGAGTTTCTTCTTCATCT SKH63 TTTCTGGCTCATYAACTGCTTTC SKH41 CGCACAGACTTAACAGATGAAC SKH42 CTTGTCCATCAACTTCATCC TM 72 C for 10 min. All PCR products obtained commercially available DNAstar software and from pneumococcal strains encoding family 2 by protein homology modeling [25]. were purified and sequenced using GenScript (GenScript USA, Inc.) as well as the core facility In-silico Determination of Immunogenic of the Centre of Applied Molecular Biology, Sites Lahore, Pakistan using PspA gene-specific fam- ily 2 forward and reverse primers. DNA The physicochemical properties of the amino sequences were assembled using NCBI BLAST acids are considered key to calculating antigenic online. The clade distributions were found by sites and the occurrence frequencies in experi- the clade-defining region (CDR) occurring in mental segmental epitopes. These predictions the PspA protein. were based on methods published by Kolaskar and Tongaonkar, Margalit and Spouge and Evolutionary and Phylogenetic Analysis Jameson and Wolf [26–28]. The experiments 0 0 showed that the N - and C -terminus protein The PspA protein and its DNA sequences were regions are mostly solvent accessible and observed using the MEGA-6 and ClustalW2 unstructured, and an alpha-helical domain is tools for evolutionary and phylogenetic analysis the receptor-binding site; thus, we selected with each other and with the online NCBI these regions of the PspA peptide sequence [29]. databank PspA depository [23, 24]. The PspA Antibody responses to such protein regions are sequencing data were analyzed according to likely to be recognized by antibodies raised known geographical regions available on online against the native protein. The predicted anti- NCBI database. genic peptides were analyzed in silico, and three prominent sequences were selected for the cloning and expression and antigenic property THREE-DIMENSIONAL STRUCTURE analysis via Western blotting. OF PSPA FAMILY 2, CLADE 3 Active Domain Fusion, Cloning, The hypothetical 3D structure of PspA family 2, Expression and Western Blotting clade 3, was required to identify peptides that could have been exposed on the surface; we In-silico determined/selected sequences were therefore predicted the structure using the merged/fused together (189 base pairs; what we will call the fusion gene was synthesized using Infect Dis Ther (2018) 7:277–289 281 GenScript (GenScript, Inc., USA) and cloned in Serotype Distribution of S. Pneumoniae TM Strains pTrcHisA expression vector (Invitrogen , USA) for a pilot expression study in E. coli (Fig. 6). Fusion gene transformants were harvested and The prevalence of pneumococcal serotypes processed for intracellular expressing proteins. obtained with the quellung reaction was as Expression was checked with time course 1 mM/ follows: strains belonging to serotype 19F, mL IPTG induction from 0 to 16 h. Western 23.60%; serotype 18B strains (non-vaccine blotting was carried out using a nitrocellulose type), 15.78%; 23F, 13.15%; 14, 10.52%; 10A, membrane treated with a primary antibody 10.52%; 3, 5.26%; 18C, 5.26%; 6B, 5.26%; 23B, [goat polyclonal Anti-PspA (bf-19; catalog no. (non-vaccine type), 2.63%; 6C (non-vaccine sc17483)] using 1:500 dilution; secondary anti- type), 2.63%; 8, 2.63%; serotype 12F, 2.63% body, donkey anti-goat IgG-HRP (catalog no. (Fig. 2). No other serotypes or non-typeable sc2020), dilution 1:10,000. The nitrocellulose strains were observed in the isolated pneumo- membranes were treated with the chemilumi- coccal strains (N = 38). The prevalence of ser- nescent western blot detection method otypes included in PCV-7, PCV-10 or PCV-13 TM TM (Thermo Scientific SuperSignal West Pico were 57.89, 57.89 and 73.68%, respectively, Chemiluminescent Substrate, catalog no. while serotypes included in PPSV-23 repre- 34079) exposing the blot to the imaging system sented 89.47% of the experimental isolates (radiography) for 30 s to 3 min, and the results (Fig. 2). were retrieved on X-ray film [30]. Amplification of the pspA Gene and Molecular Typing of Its Different RESULTS Families and Clades Antibiotic Susceptibility of S. Pneumoniae As the pspA gene is encoded by all pneumo- Isolates coccal strains, we amplified it using PCR from genomic DNA of all strains. To further classify Susceptibility of isolated S. pneumoniae strains to the pspA gene in its different families, another 14 antibiotics commonly prescribing in Pak- set of PCR reactions was performed. These istani hospitals was evaluated. All isolated reactions utilized three different sets of family- pneumococcal strains were susceptible to chlo- specific primers and classified the pspA gene in ramphenicol and linezolid (MIC C 0.5–1 lg/ml family 1, 2 or 3. Our results demonstrated that each); they showed responses to ampicillin most strains (N = 31) encoded a pspA gene (60%, MIC C 0.06–1 lg/ml), amikacin (55%, belonging to family 2, whereas the remaining MIC C 1 lg/ml), amoxycillin (90%, isolates (N = 7) were classified in family 1, and MIC C 0.25–1.5 lg/ml), co-amoxiclav (66%, none were identified as family 3 (Fig. 3). These MIC C 0.06–0.12 lg/ml), cefotaxime (65%, results revealed that PspA family 2 is the most MIC C 0.06–0.25 lg/ml), ceftriaxone (60%, prevalent form (* 80%) of the PspA protein MIC C 0.06–0.5 lg/ml), cefuroxime (60%, among Pakistani pneumococcal isolates and MIC C 0.06–0.5 lg/ml), cephalexin (75%, therefore it was our focus. The pspA genes MIC C 1–2 lg/ml), fusidic acid (82%, belonging to family 2 were sequenced and dis- MIC C 0.12–1 lg/ml), teicoplanin (83%, tributed into their clades. All the sequences MIC C 0.03–0.12 lg/ml) and vancomycin (83%, corresponding to the pspA gene family 2 were MIC C 0.12–1 lg/mL), while 20% of strains submitted to the NCBI GenBank and are avail- presented resistance to gentamycin able online under accession numbers KP337453, (MIC C 4–8 lg/ml) (Fig. 1). KU961865, KY010667 and KU961866 through KU961894. 282 Infect Dis Ther (2018) 7:277–289 Fig. 1 Susceptibility testing of antibiotics. Strains prone to chloramphenicol and linezolid, while 20% of (N = 38) tested with antibiotics commonly prescribed in strains presented resistance to gentamycin Pakistani hospitals are shown on the X-axis following the TM Oxoid , UK and EUCAST recommendations. The susceptibility pattern showed that all the strains were Fig. 2 Percentage prevalence of pneumococcal serotypes samples, the exposure in PCV-7, PCV-10 and PCV-13 was isolated from pneumococcal patients (N = 38). Pneumo- 57.89, 57.89 and 73.68%, respectively, while serotypes coccal strains were serotyped by quellung reaction using included in PPSV23 comprised 89.47% the SSI Pneumotest kit (Statens Serum Institut, Den- mark). Serotype 19F was the leading type (23.60%), followed by 18B (15.78%). In the given number of Multiple Alignments and Phylogenetic N = 1 represented clade 4. The phylogenetic Analysis analyses showed that the PspA from a pneu- mococcal strain isolated in China (FJ663048.1) appears to be an ancestor of the Pakistani PspA Nucleotide sequences of pspA genes and their family 2 protein (Fig. 4). Thus, whereas the PspA amino acid sequences were examined with proteins produced by strains worldwide appear ClustalW2 and MEGA-6 software. Gene to be similar, our studies established high PspA sequences obtained from Pakistani pneumo- sequence homologies among Pakistani isolates, coccal isolates were compared against the PspA different from those produced in other regions native protein. Our analyses demonstrated that of the world. PspAs of N = 30 were the clade 3 genotype and Infect Dis Ther (2018) 7:277–289 283 Fig. 3 PCR amplification of the pspA gene. In 2% agarose genes (strain ID; FP017 and FP019). Lane 1 represents a gel, lane M shows the 1-kb DNA marker; 2, 3 and 5 show negative control pspA family 2 genes (strain ID; FP015, FP016 and FP018), while lanes 4 and 6 correspond to pspA family 1 Fig. 4 The evolutionary history was inferred using the maximum composite likelihood method and are in the neighbor-joining method. The optimal tree with the sum units of the number of base substitutions per site. All of branch length = 15.14 is shown. The tree is drawn to positions containing gaps and missing data were elimi- scale, with branch lengths in the same units as those of the nated. Evolutionary analyses were conducted in MEGA6 evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the 284 Infect Dis Ther (2018) 7:277–289 The DNA sequencing result showed that the THREE-DIMENSIONAL STRUCTURE fusion sequence is consistent with the designed AND ANTIGENIC SITE one and with a correct open reading frame. The DETERMINATION recombinant pTrcHisA vector containing the fusion gene was successfully transformed into Since we were interested in finding PspA- competent E. coli for the pilot expression study derivative antigenic peptides, our next study and induced by 1 mM/ml IPTG. The SDS-PAGE predicted the 3D structures of PspA, utilizing and western blotting of bacterium lysate (pro- TM the DNAstar software. Based on the predicted cessed with B-PER reagents) showed that the motifs, we selected a 3D structure of PspA fam- fusion peptide was successfully expressed. After ily 2 to further identify the antigenic epitopes 3 h induction, the fusion peptide reached the that were most exposed. Three different meth- maximum in the time optimization test, ods, the (1) Kolaskar and Tongaonkar, (2) Mar- although it was not expressed at 0 h induction. galit and Spouge and (3) Jameson and Wolf, In western blotting, anti-PspA antibodies were utilized to identify these epitopes. We responded against this proposed fusion peptide selected three peptides in the PspA family 2 like they did for the whole PspA protein (Fig. 7). protein based on their characteristics, i.e., location, surface exposure, antigenicity, disor- dered ratio and hydrophilicity (Fig. 5). These DISCUSSION peptides were analyzed in silico, and their properties are shown in Table 2. The selected Antibiotics play a crucial role in the proper 0 0 peptides were primarily based on the N - and C - treatment of pneumococcal infections [31]. To terminus regions and an alpha-helical domain the best of our knowledge, no studies showing of PspA. It was proposed that the PspA native the antibiotic-resistant profiles in the Lahore, protein is likely to be recognized by antibodies Pakistan area are available. In the present study, raised against any of these three selected we found that all isolated pneumococcal strains peptides. were susceptible to chloramphenicol and line- zolid, while strains susceptible to gentamycin represented 20% of all cases (Fig. 1). The overall Peptides Fusion, Expression and Western resistance of isolated pneumococcal strains to Blotting antibiotics in the Lahore, Pakistan hospital is low compared with other studies in other geo- The selected three PspA family 2 segments were graphical regions. There is no direct association fused together into a fusion gene by the head- between susceptibility to antibiotics and ser- to-tail method and cloned in an expression TM otypes. These data provide a baseline for the vector pTrcHisA (Invitrogen , USA) (Fig. 6). pneumococcal serotypes responsible for IPD TM Fig. 5 DNAstar was used to predict the 3D structure and hydrophilicity in silico. Finally, they were merged of PspA. a THe Kolaskar and Tongaonkar, b Margalit and together into a fusion peptide Spouge and c Jameson and Wolf methods were followed for peptide selection based on the exposure, antigenicity Infect Dis Ther (2018) 7:277–289 285 Table 2 In-silico analysis and physicochemical properties of selected PspA-derivative peptides Serial no. Antigenic determinant Length Antigenicity Surface Hydrophilicity 1 YRNPSDHAKKLAEA 14 1.22 0.79 0.87 2 VPEQSELAETKKKA 14 1.26 0.71 0.99 3 KLLDSLDPEGKTQD 14 2.42 0.79 0.95 Fig. 6 Fusion gene (189 base pairs) cloned in expression vector pTrcHisA and its potentially expressed peptide Fig. 7 X-ray film radiography image (exposed for 3 min) antibodies [donkey anti-goat IgG-HRP (catalog no. of western blotting for PspA-fusion peptides * 10 kDa. sc2020)]; 0–3 h was the 1 mM/ml IPTG induction time Western blotting was carried out using nitrocellulose membranes treated with primary [goat polyclonal Anti- PspA (bf-19; catalog no. sc17483)] and secondary cases and susceptibility or resistance to antibi- and lack of awareness among the people in otics in Pakistan. Pakistan, reduce its value. These are important Pakistan introduced PCV-7 in 2006 through issues for overall vaccine coverage in the the generous support of the Global Alliance for country. Vaccines and Immunizations (GAVI), and PCV- Our current study showed that most strains 10 was being used in the country by 2013. belonged to a serotype targeted by PCV13 However, the limited availability in hospitals (* 73%), PCV7 (* 57.89%) or PCV10 286 Infect Dis Ther (2018) 7:277–289 (* 57.89%). This information is important While it is essential to define which PspA given that most pneumococcal strains were family 2 fragment shows antigenicity within isolated from PD cases from infants younger the same family, for this we will need to have than 12 months of age and most of them would longer fragments or include a macromolecular be protected if vaccinated with PCV13. How- carrier. This could be a promising immuniza- ever, PPSV23 has * 89.47% exposure in the tion strategy. Pakistani population according to our data. In general, our results showed that the PspA These data show that targeting PPSV23 to a family 2 fusion peptide might be able to large proportion of PD in the region is promis- enhance the level of cross-reactivity in-vivo and ing. An important and dangerous issue is that will achieve cross-reactivity and have a broader the 18B (non-vaccine type), 23B (non-vaccine effect. Moreover, future studies should also type) and 6C (non-vaccine type) serotypes are evaluate whether the protective ability of the also circulating in the Pakistani population antibodies correlates with the cross-reactivity (Fig. 2). The serotype distribution differs from a data presented in this work. Our results will previous report shown by another group in the help future research regarding PspA-based pep- country [32]. This comparison might be related tide vaccines with broad specificity and to temporal and regional differences and the coverage. potential circulation of outbreak strains. The Previous studies have publicized that PspA work presented in this article is based on the families and clades are independent of ser- most prevalent form of PD, pneumococcal otypes. Pneumococci of different serotypes pneumonia, with a few meningitis episodes. could be identified as the same PspA fam- Data should therefore be interpreted keeping ily/clade, and the same serotype could be iden- these important differences in mind. tified in different families and/or clades [34–38]. The PspA-based vaccine for S. pneumoniae is Our data supported that every isolated pneu- an area requiring continuous investigation and mococcal strain encoded a pspA gene, its family development. Studies have shown that PspA has and clade is independent of the serotype, and the potential for development into a human there is no correlation with antibiotic suscepti- PspA-based peptide vaccine [33]. Reports avail- bility (supplementary data provided). Thus, a able from the USA, Canada, France, Spain, PspA-based pneumococcal vaccine would have Sweden, Australia, Japan and China have the potential to reduce the burden of PD in the described that PspA family 2 is the most com- area, possibly worldwide, with the advantage of mon among pneumococci [34–38]. The char- avoiding the serotype replacement or shift acterization of PspA presented in this study observed with other pneumococcal vaccines. demonstrated that most pneumococcal strains isolated in Pakistan carried pspA genes, encod- LIMITATIONS OF THE CURRENT ing the PspA protein belonging to family 2. A more extensive study might be required to draw STUDY complete conclusions. Our group will continue this study, especially quantitatively and in the The data presented, pneumococcal serotypes 18B, 23B and 6C (non-vaccine types), which are other geographical areas of the country. Various research groups have worked on not included in the current approved pneumo- coccal vaccine, but they are circulating in some different fragments of PspA and are claiming the antibodies are inducible [39, 40]. Western ratio. It might be possible that some other non- vaccine types are also present in the region. blot analysis revealed that there was strong recognition of the PspA fusion peptide. These Pneumococcal surface protein A family 2 is most prevalent in Pakistani pneumococcal iso- results confirm that, among the PspA fragments analyzed in the literature [39, 40], our retrieved lates. For this, a more extensive study is required PspA family 2 segments would be the most to reach definite conclusions. The PspA fusion peptide certainly revealed antigenic recognition suitable for the induction of broad reactivity, and this will be an even more effective strategy. Infect Dis Ther (2018) 7:277–289 287 in Western blotting, but it must be analyzed in the Punjab, Lahore, Pakistan (D/4439-ACAD), an animal model for immunogenetic study. and sample collection from patients was approved by the Institutional Review Board (IRB)/Ethics Committee of the Children’s CONCLUSION Hospital and Institute of Child Health, Lahore, Pakistan (CH.AD251). Specimens were collected The present introductory study reported that (according to the recommended andapproved serotypes 19F and 18B (non-vaccine type) are procedure) from these patients or children the most prevalent serotypes isolated from PD whose parents or guardians, agreed to partici- cases in Pakistan. The prevalent PspA proteins pate in this study. It was specified that biologic produced by Pakistani isolates belong to family material would only be utilized for research 2 and clade 3. They have high sequence purposes. It is further clarified that all proce- homologies with each other and are different dures performed in studies involving human from those produced by strains isolated in the participants were in accordance with the ethical rest of the world. The PspA fusion peptide standards of the institutional and/or national showed a positive antigenic response on Wes- research committee and with the 1964 Helsinki tern blotting (Fig. 7), which will be further Declaration and its later amendments or com- characterized in the recommended assays and parable ethical standards. Informed consent was an animal model (in vivo). obtained from all individual participants inclu- ded in the study. All subjects provided written informed consent to participate in this study. An independent ethics committee or institu- ACKNOWLEDGEMENTS tional review board reviewed the study protocol and amendments. We thank the Ethics Committee of the Chil- dren’s Hospital Lahore for providing permission Thanking Patients. All the authors thank to collect pneumococcal samples. the patients and their families/guardians. Funding. We acknowledge the sup- Data Availability. The data produced or port/funding from the Higher Education Com- evaluated during the current study and more mission (HEC) of Pakistan for the doctoral information about the data are available from the thesis (grant 2BM1-227). No funding or spon- corresponding author on reasonable request. sorship was received for the publication of this article. Open Access. This article is distributed under the terms of the Creative Commons Authorship. All authors meet the criteria of Attribution-NonCommercial 4.0 International the International Committee of Medical Journal License (http://creativecommons.org/licenses/ Editors (ICMJE) for authorship for this manu- by-nc/4.0/), which permits any noncommer- script, take responsibility for the integrity of the cial use, distribution, and reproduction in any work as a whole, and have given final approval medium, provided you give appropriate credit for the version to be published. to the original author(s) and the source, provide a link to the Creative Commons license, and Disclosures. Faidad Khan, Mohsin Ahmad indicate if changes were made. Khan, Nadeem Ahmed, Muhammad Islam Khan, Hamid Bashir, Saad Tahir and Ahmad Usman Zafar having nothing to disclose. REFERENCES Compliance with Ethics Guidelines. The current study (both the study and collection of 1. Tan TQ. Pediatric invasive pneumococcal disease in specimens) was approved by the Advanced the United States in the era of pneumococcal Studies and Research Board of the University of 288 Infect Dis Ther (2018) 7:277–289 conjugate vaccines. Clin Microbiol Rev. 14. Ferreira DM, Darrieux M, Silva DA, et al. Charac- 2012;25(3):409–19. terization of protective mucosal and systemic immune responses elicited by pneumococcal sur- 2. O’Brien KL, Wolfson LJ, Watt JP, et al. Burden of face protein PspA and PspC nasal vaccines against a disease caused by Streptococcus pneumoniae in chil- respiratory pneumococcal challenge in mice. Clin dren younger than 5 years: global estimates. Lancet. Vaccine Immunol. 2009;16(5):636–45. 2009;374(9693):893–902. 15. Hollingshead SK, Becker R, Briles DE. Diversity of 3. Bogaert D, de Groot R, Hermans P. Streptococcus PspA: mosaic genes and evidence for past recom- pneumoniae colonisation: the key to pneumococcal bination in Streptococcus pneumoniae. Infect Immun. disease. Lancet Infect Dis. 2004;4(3):144–54. 2000;68(10):5889–900. 4. Calix JJ, Nahm MH. A new pneumococcal serotype, 16. Owais A, Tikmani SS, Sultana S, et al. Incidence of 11E, has a variably inactivated wcjE gene. J Infect pneumonia, bacteremia, and invasive pneumococ- Dis. 2010;202(1):29–38. cal disease in Pakistani children. Trop Med Int Health. 2010;15(9):1029–36. 5. An Q, Hernandez A, Prejean J, German EJ, 17. Nagaraj S, Kalal BS, Manoharan A, Shet A. Strepto- Thompson H, Hall HI. Geographic differences in coccus pneumoniae serotype prevalence and antibi- HIV infection among Hispanics or Latinos—46 otic resistance among young children with invasive states and Puerto Rico, 2010. MMWR Morb Mortal pneumococcal disease: experience from a tertiary Wkly Rep. 2012;61:805–10. care center in South India. Germs. 2017;7(2):78. 6. Defrance T, Taillardet M, Genestier L. T cell-inde- 18. Castillo D, Harcourt B, Hatcher C, Jackson M, Katz pendent B cell memory. Curr Opin Immunol. L, Mair R. Identification and characterization of 2011;23(3):330–6. Streptococcus pneumoniae. Laboratory methods for the diagnosis of meningitis caused by neisseria 7. Rennels MB, Edwards KM, Keyserling HL, et al. meningitidis, Streptococcus pneumoniae, and hae- Safety and immunogenicity of heptavalent pneu- mophilus influenzae. 2011:73–86. mococcal vaccine conjugated to CRM197 in United States infants. Pediatrics. 1998;101(4):604–11. 19. Chan WW, Lovgren M, Tyrrell GJ. Utility of the pneumoslide test in identification of Streptococcus 8. Darrieux M, Goulart C, Briles D, Leite LC. Current status and perspectives on protein-based pneumo- pneumoniae in blood cultures and its relation to coccal vaccines. Crit Rev Microbiol. capsular serotype. J Clin Microbiol. 2015;41(2):190–200. 2009;47(5):1559–61. 9. Weinberger DM, Malley R, Lipsitch M. Serotype 20. Seki M, Yamashita Y, Torigoe H, Tsuda H, Sato S, replacement in disease after pneumococcal vacci- Maeno M. Loop-mediated isothermal amplification nation. Lancet. 2011;378(9807):1962–73. method targeting the lytA gene for detection of Streptococcus pneumoniae. J Clin Microbiol. 10. Mann B, Thornton J, Heath R, et al. Broadly pro- 2005;43(4):1581–6. tective protein-based pneumococcal vaccine com- posed of pneumolysin toxoid-CbpA peptide 21. Slotved H-C, Kaltoft M, Skovsted I, Kerrn M, recombinant fusion protein. J Infect Dis. Espersen F. Simple, rapid latex agglutination test for 2014;209(7):1116–25. serotyping of pneumococci (Pneumotest-Latex). J Clin Microbiol. 2004;42(6):2518–22. 11. Hakansson A, Roche H, Mirza S, McDaniel LS, Brooks-Walter A, Briles DE. Characterization of 22. Matuschek E, Brown DF, Kahlmeter G. Develop- binding of human lactoferrin to pneumococcal ment of the EUCAST disk diffusion antimicrobial surface protein A. Infect Immun. susceptibility testing method and its implementa- 2001;69(5):3372–81. tion in routine microbiology laboratories. Clin Microbiol Infect. 2014;20(4):O255–66. 12. Tu AH, Fulgham RL, McCrory MA, Briles DE, Szalai AJ. Pneumococcal surface protein A inhibits com- 23. Li KB. ClustalW-MPI: clustalW analysis using dis- plement activation by Streptococcus pneumoniae. tributed and parallel computing. Bioinformatics. Infect Immun. 1999;67(9):4720–4. 2003;19(12):1585–6. 13. Crain MJ, Waltman WD 2nd, Turner JS, et al. 24. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis Pneumococcal surface protein A (PspA) is serologi- version 6.0. Mol Biol Evol. 2013;30(12):2725–9. cally highly variable and is expressed by all clini- cally important capsular serotypes of Streptococcus pneumoniae. Infect Immun. 1990;58(10):3293–9. Infect Dis Ther (2018) 7:277–289 289 25. Schwede T, Kopp J, Guex N, Peitsch MC. SWISS- 34. Hollingshead SK, Baril L, Ferro S, et al. Pneumo- MODEL: an automated protein homology-model- coccal surface protein A (PspA) family distribution ing server. Nucleic Acids Res. 2003;31(13):3381–5. among clinical isolates from adults over 50 years of age collected in seven countries. J Med Microbiol. 26. Jameson B, Wolf H. The antigenic index: a novel 2006;55(Pt 2):215–21. algorithm for predicting antigenic determinants. Comput Appl Biosci CABIOS. 1988;4(1):181–6. 35. Hotomi M, Togawa A, Kono M, et al. PspA family distribution, antimicrobial resistance and serotype 27. Kolaskar AS, Tongaonkar PC. A semi-empirical of Streptococcus pneumoniae isolated from upper method for prediction of antigenic determinants respiratory tract infections in Japan. PLoS ONE. on protein antigens. FEBS Lett. 2013;8(3):e58124. 1990;276(1–2):172–4. 36. Pimenta FC, Ribeiro-Dias F, Brandileone MC, Miyaji 28. Margalit H, Spouge JL, Cornette JL, Cease KB, Delisi EN, Leite LC, Sgambatti de Andrade AL. Genetic C, Berzofsky JA. Prediction of immunodominant diversity of PspA types among nasopharyngeal iso- helper T cell antigenic sites from the primary lates collected during an ongoing surveillance study of children in Brazil. J Clin Microbiol. sequence. J Immunol. 1987;138(7):2213–29. 2006;44(8):2838–43. 29. Faraggi E, Xue B, Zhou Y. Improving the prediction accuracy of residue solvent accessibility and real- 37. Qian J, Yao K, Xue L, et al. Diversity of pneumo- value backbone torsion angles of proteins by gui- coccal surface protein A (PspA) and relation to ded-learning through a two-layer neural network. sequence typing in Streptococcus pneumoniae causing Proteins. 2009;74(4):847–56. invasive disease in Chinese children. Eur J Clin Microbiol Infect Dis. 2012;31(3):217–23. 30. Dawson NJ, Biggar KK, Storey KB. Characterization of fructose-1, 6-bisphosphate aldolase during 38. Rolo D, Ardanuy C, Fleites A, Martin R, Linares J. anoxia in the tolerant turtle, Trachemys scripta Diversity of pneumococcal surface protein A (PspA) elegans: an assessment of enzyme activity, expres- among prevalent clones in Spain. BMC Microbiol. sion and structure. PLoS ONE. 2013;8(7):e68830. 2009;9:80. 31. Song JH, Jung SI, Ko KS, et al. High prevalence of 39. Moreno AT, Oliveira MLS, Ferreira DM, et al. antimicrobial resistance among clinical Streptococ- Immunization of mice with single PspA fragments cus pneumoniae isolates in Asia (an ANSORP study). induces antibodies capable of mediating comple- Antimicrob Agents Chemother. 2004;48(6):2101–7. ment deposition on different pneumococcal strains and cross-protection. Clin Vaccine Immunol. 32. Mastro T, Spika J, Facklam R, et al. Antimicrobial 2010;17(3):439–46. resistance of pneumococci in children with acute lower respiratory tract infection in Pakistan. Lancet. 40. Darrieux M, Moreno AT, Ferreira DM, et al. Recog- 1991;337(8734):156–9. nition of pneumococcal isolates by antisera raised against PspA fragments from different clades. J Med 33. Briles DE, Hollingshead S, Brooks-Walter A, et al. Microbiol. 2008;57(3):273–8. The potential to use PspA and other pneumococcal proteins to elicit protection against pneumococcal infection. Vaccine. 2000;18(16):1707–11.

Journal

Infectious Diseases and TherapySpringer Journals

Published: Mar 9, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off