Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

miR-381-3p knockdown improves intestinal epithelial proliferation and barrier function after intestinal ischemia/reperfusion injury by targeting nurr1

miR-381-3p knockdown improves intestinal epithelial proliferation and barrier function after... Impairment in gut barrier function induced by intestinal ischemia/reperfusion (I/R) injury is associated with high morbidity and mortality. Intestinal barrier function requires the tight coordination of epithelial migration, proliferation and differentiation. We previously observed that nuclear receptor-related protein 1 (nurr1)-mediated proliferative pathway was impaired in intestinal I/R injury. Here, we aimed to assess the effect of nurr1 on intestinal barrier function and to evaluate microRNA (miRNA)-nurr1-mediated restoration of intestinal barrier function in intestinal I/R injury. We induced an in vivo intestinal I/R injury mouse model by clamping and then releasing the superior mesenteric artery. We also performed an in vitro study in which we exposed Caco-2 and IEC-6 cells to hypoxia/reoxygenation (H/R) conditions to stimulate intestinal I/R injury. Our results demonstrated that nurr1 regulated intestinal epithelial development and barrier function after intestinal I/R injury. miR-381-3p, which directly suppressed nurr1 translation, was identified by microarray and bioinformatics analysis. miR-381-3p inhibition enhanced intestinal epithelial proliferation and barrier function in vitro and in vivo and also attenuated remote organ injury and improved survival. Importantly, nurr1 played an indispensable role in the protective effect of miR-381-3p inhibition. Collectively, these findings show that miR-381-3p inhibition mitigates intestinal I/R injury by enhancing nurr1-mediated intestinal epithelial proliferation and barrier function. This discovery may lead to the development of therapeutic interventions for intestinal I/R injury. Introduction bowel volvulus, abdominal aortic aneurysm surgery, 1–3 The damage sustained by ischemic intestinal tissue as a hemorrhagic shock and sepsis . Intestinal ischemia result of the activation of vicious cascades during the causes severe cellular damage that provokes epithelial restoration of blood flow is known as intestinal ischemia/ barrier dysfunction during reperfusion. Intestinal epithelial reperfusion (I/R) injury. Intestinal I/R injury is a common barrier loss leads to increases in permeability and bacterial 4,5 life-threatening complication observed in many clinical translocation . The resulting intestinal barrier dysfunc- conditions, such as mesenteric arterial thrombosis, small tion is a key factor in the aggravation of the deleterious complications of intestinal I/R, including systemic inflammatory response syndrome and multiple organ dysfunction syndrome (MODS) . Thus, therapeutic Correspondence: Xiaofeng Tian (txfdl@dmu.edu.cn) or Jihong Yao (yaojihong65@hotmail.com) restoration of intestinal barrier function, which requires Department of General Surgery, The Second Affiliated Hospital of Dalian the tight coordination of epithelial migration, proliferation Medical University, Dalian 116023, China Department of Pharmacology, Dalian Medical University, Dalian 116044, China Edited by S. Lavandero © The Author(s) 2018 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; Liu et al. Cell Death and Disease (2018) 9:411 Page 2 of 14 Fig. 1 (See legend on next page.) Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 3 of 14 Fig. 1 Nurr1 regulates intestinal restoration after I/R injury. a Mice were subjected to 45 min of intestinal ischemia followed by 0–16 h of reperfusion or sham surgery. I, ischemia; R, reperfusion; representative western blot showing nurr1 protein expression in the intestinal tissue lysates (n = 3 per group, **P < 0.01 versus sham group). b-i The mice were divided into the following four groups: a sham group, a sham + C-DIM12 group, an I/R group, and an I/R + C-DIM12 group (n = 8 per group). C-DIM12 (50 mg/kg) was orally gavaged at 4 h before surgery. The I/R times were 45/240 min, respectively. b and c Representative images of H&E-stained intestinal sections of mice from the above four groups. Intestinal injury was scored histopathologically (Chiu’s score) according to a scoring system. Scale bar = 100 μm. d and e Immunohistochemical staining for the Ki-67 antibody in intestinal tissues for proliferation analysis. Scale bar = 50 μm. f-h Representative western blot showing occludin and ZO-1 protein expression in the intestinal tissue lysates, n = 3 per group. i FITC-dextran intestinal epithelial paracellular permeability. j-n IEC-6 cells were transfected with plasmids encoding Nurr1 for 36 h and then incubated in hypoxic conditions for 6 h before being incubated in normoxic conditions for 6 h. j Representative western blot showing nurr1 protein expression, n = 3. k Immunofluorescence staining for the Ki-67 antibody in IEC-6 cells for proliferation analysis. Scale bar = 100 μm, n = 6. l-n Representative western blot showing occludin and ZO-1 protein expression, n = 3. o and p Caco-2 cells were infected with si-Nurr1 or its negative control (si-control) for 36 h and then exposed to hypoxic conditions for 12 h before being exposed to normoxic conditions 6 h. o Si-nurr1-induced changes in intestinal epithelial permeability, as measured by FITC-dextran permeability, n = 3. p The effect of si- Nurr1 on intestinal epithelial integrity was evaluated by TEER, n = 3. Data are representative of three independent experiments. *P < 0.05, **P < 0.01. The error bars describe the standard deviation and differentiation, is indispensable for intestinal I/R regulates epithelial proliferation and barrier function after injury. intestinal I/R injury. This study aimed to provide infor- It has been reported that several nuclear receptors mation regarding a potential strategy for the treatment of improved intestinal epithelial development and barrier intestinal I/R injury. 7–9 function after injury . Nuclear receptor-related protein 1 (nurr1), an orphan nuclear receptor, is a well-known Results transcription factor that participates in several cellular Nurr1 enhances intestinal epithelial regeneration and development processes, such as proliferation, differentia- barrier function after intestinal I/R injury 10,11 tion and apoptosis . We previously found that mod- Western blotting was used to assess nurr1 expression at ulating nurr1 expression improves epithelial proliferation different reperfusion time points after intestinal ischemia. after intestinal I/R injury . Increased epithelial cell pro- Intestinal nurr1 levels decreased significantly during the liferation contributes to enhance intestinal epithelial first 4 h after the onset of reperfusion and then progres- 13,14 barrier function . However, the effect of nurr1 on sively increased from 4–16 h after the onset of reperfusion, epithelial barrier function after intestinal I/R injury, as suggesting that nurr1 plays a critical role in regulating well as the mechanism by which nurr1 is modulated, intestinal I/R injury (Fig. 1a). To validate the effect of require further investigation. nurr1 in vivo, we administered the nurr1 activator C- Recent research regarding nurr1 has demonstrated that DIM12 to C57BL/6 mice. Compared with I/R group, its expression can be regulated by microRNAs (miRNAs) intestinal histological injury was dramatically attenuated in 15–17 in some diseases . miRNAs are a class of endogenous the I/R+ C-DIM12 group (Fig. 1b and c). Consistent with small non-coding RNAs of approximately 22 nucleotides these findings, regeneration levels, as reflected by the in length that negatively modulate gene expression by numbers of Ki-67-positive cells, were higher in the I/R + promoting mRNA degradation or inhibiting transcript C-DIM12 group than in the I/R group (Fig. 1d and e). 18,19 translation . A growing number of studies have shown Intestinal barrier functional restoration, a change reflected that miRNA modulation contributes to organ repair fol- by increases in occludin and ZO-1 protein expression lowing a variety of events, including myocardial or cere- (Fig. 1f–h) and decreases in the FITC-dextran paracellular 20,21 bral ischemic injury . However, miRNA-mediated gut permeability, occurred in conjunction with the enhance- epithelial restoration after intestinal I/R injury remains ment of epithelial regeneration (Fig. 1i). poorly understood. Based on the above findings regarding Furthermore, in vitro pcDNA-Nurr1 transfection the role of nurr1, we hypothesized that miRNA modula- (Fig. 1j) increased Ki-67-labeled IEC-6 cell proliferation in tion may improve intestinal epithelial proliferation and hypoxia/reoxygenation (H/R; Fig. 1k) and occludin and barrier function by targeting nurr1, thereby reducing ZO-1 protein expression (Fig. 1l–n). Conversely, RNAi- intestinal I/R injury. mediated Nurr1 knockdown decreased intestinal epithe- In this study, we investigated the regulatory role of lial barrier function, a change reflected by increases in nurr1 in epithelial barrier function after intestinal I/R FITC-dextran paracellular permeability (Fig. 1o) and injury. We performed microarray chip to identify the reductions in transepithelial electrical resistance (TEER; miRNAs that are differentially expressed between I/R- Fig. 1p) in Caco-2 cells. Consistent with the results of our injured intestinal tissues and normal tissues and further previous study , these results indicate that nurr1 screened miR-381-3p that targets nurr1. We speculate improves intestinal epithelial proliferation and barrier that miR-381-3p and nurr1 constitute an axis that function in I/R injury. Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 4 of 14 Fig. 2 miR-381-3p negatively regulates nurr1 expression. a The miR-381-3p target sequence in the nurr1 3ʹ-UTR is conserved across various species. b The WT nurr1 3ʹ-UTR and the MT nurr1 3ʹ-UTR in the luciferase constructs. BS, binding site. c Caco-2 cells were infected with miR-381 or miR-NC and WT nurr1 3ʹ-UTR or MT nurr1 3ʹ-UTR, n = 3. d-g Caco-2 or IEC-6 cells were transfected with the ant-381 or the ant-NC. d Representative western blot showing nurr1 protein expression in Caco-2 cells, n = 3. e qRT-PCR showing nurr1 mRNA expression in Caco-2 cells, n = 6. f Representative western blot showing nurr1 protein expression in IEC-6 cells, n = 3. g qRT-PCR showing nurr1 mRNA expression in IEC-6 cells, n = 6. *P < 0.05, **P < 0.01. The error bars describe the standard deviation miR-381-3p participates in regulating nurr1 expression whether endogenous nurr1 expression is regulated by To explore the molecular mechanism underlying the miR-381-3p modulation (Supplementary Figures 2a–c). effects of nurr1 down-regulation on H/R and I/R injury, miR-381-3p silencing up-regulated nurr1 protein levels we tested whether nurr1 is regulated by miRNA. Intestinal but had no effect on mRNA expression in Caco-2 cells samples derived from mice subjected to intestinal I/R (n (Fig. 2d, e). These data showed that miR-381-3p represses = 3) or sham surgery (n = 3) were collected and the nurr1 translation. Similar results were observed in the miRNA expression profiles were determined by a miRNA experiments involving IEC-6 cells (Fig. 2f, g). Taken microarray (GEO accession number: GSE83701). We together, these results indicate that miR-381-3p directly found that 57 miRNAs were up-regulated, and 74 miR- regulates nurr1 expression in the intestine. NAs were down-regulated (fold change ≥2, P < 0.05) in the I/R group compared with the sham group (Supple- miR-381-3p inhibition increases intestinal epithelial mentary Table 1). It is well known that miRNAs nega- proliferation and barrier function after H/R injury tively regulate the expression of specific genes by targeting We investigated the effect of miR-381-3p on intestinal their 3′-UTRs. Therefore, we used the miRNA prediction epithelial cells exposed to H/R injury and the involve- programs TargetScan (http://www.targetscan.org/) and ment of nurr1 signaling in this effect. miR-381-3p miRWalk (http://zmf.umm.uni-heidelberg.de/apps/zmf/ inhibition elevated Ki-67-labeled cell proliferation mirwalk) to determine that miR-381-3p, one of the 57 up- under H/R conditions (Fig. 3a). Consistently, miR-381- regulated miRNAs, targets nurr1. 3p inhibition also restored TEER value (Fig. 3b) and According to the bioinformatics analysis, the miR-381- attenuated the increases in FITC-dextran paracellular 3p binding sequences in the 3′-UTR of nurr1 are highly permeability (Fig. 3c) induced by H/R. Furthermore, conserved across several species, including humans, mice western blotting revealed that miR-381-3p inhibition and rats (Fig. 2a, Supplementary Figure 1). We used a ameliorated the nurr1 down-regulation and p21 up- dual-luciferase assay system to further validate that miR- regulation induced by H/R (Fig. 3d–f). Tight junction 381-3p targets the 3′-UTR of nurr1. As demonstrated in protein (occludin and ZO-1) expression was clearly Fig. 2b, the WT nurr1 3′-UTR exhibited low luciferase enhanced in the miR-381-3p inhibition group compared activity after miR-381-3p agomir (miR-381) transfection. with the negative control group under H/R conditions However, the mutated nurr1 3′-UTR abolished the inhi- (Fig. 3g, h). These data indicate that miR-381-3p inhi- bitory effect of miR-381 (Fig. 2c). We then explored bition increases intestinal epithelial proliferation and Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 5 of 14 Fig. 3 miR-381-3p inhibition promotes intestinal epithelial restoration after H/R injury. a Immunofluorescence staining for the Ki-67 antibody in IEC-6 cells for proliferation analysis. IEC-6 cells were infected with the ant-381 or the ant-NC for 36 h and then incubated under H/R conditions for 6/6 h, respectively. Scale bar = 100 μm, n = 6. b and c Caco-2 cells were transfected with the ant-381 or the ant-NC for 36 h and then exposed to hypoxic conditions for 12 h before being exposed to normoxic conditions for 6 h. b Effect of the ant-381 on TEER, n = 3. c Changes in FITC-dextran intestinal epithelial permeability in response to the ant-381, n = 3. d-h IEC-6 cells were infected with the ant-381 or the ant-NC for 36 h and then incubated under H/R conditions for 6/6 h, respectively. Representative western blot showing nurr1, p21, occludin, ZO-1 protein expression, n = 3. *P < 0.05, **P < 0.01. The error bars describe the standard deviation barrier function, and that the effect may be mediated by the knockdown of endogenous miR-381-3p restores epi- nurr1 signaling. thelial barrier function and improves survival rates in intestinal I/R injury. miR-381-3p knockdown improves intestinal epithelial restoration and survival after intestinal I/R injury in mice miR-381-3p inhibition improves epithelial proliferation To determine the role of miR-381-3p in the regulation and barrier function after intestinal I/R injury by targeting of the pathogenesis of intestinal I/R injury in vivo, we nurr1 knocked down miR-381-3p expression in mice using The above experiments showed that miR-381-3p inhi- LNA-381. As shown in Fig. 4a, LNA-381 dramatically bition improved intestinal epithelial restoration and up- attenuated the miR-381-3p up-regulation induced by regulated nurr1 expression. Thus, we explored whether intestinal I/R injury. Ki-67-labeled intestinal cell pro- nurr1 plays an important role in the protective effects of liferation was enforced in the presence of LNA-381 miR-381-3p inhibition. The ant-381 elevated Ki-67- (Fig. 4b, c). miR-381-3p knockdown reduced D-lactate labeled cell proliferation and TEER and inhibited FITC- levels (Fig. 4d) and FITC-dextran epithelial permeability dextran paracellular permeability after H/R (Fig. 5a–c, (Fig. 4e) to attenuate the effect of I/R on intestinal barrier groups 2 and 3). However, the protective effect of the ant- function. Intestinal histological injury was significantly 381 was abolished by the knockdown of nurr1 (Fig. 5a–c, mitigated after miR-381-3p silencing (Fig. 4f, g). Fur- groups 3 and 5). In addition, we also measured the thermore, LNA-381 preserved nurr1 expression and expression of p21, a downstream target of nurr1 ,to down-regulated p21 expression in mice subjected to explore the potential mechanisms underlying the effects intestinal I/R injury (Fig. 4h–j). Consequently, the of miR-318-3p inhibition. As anticipated, p21 levels were expression of the tight junction proteins occludin and markedly enhanced after H/R injury (Fig. 5f, groups 1 and ZO-1 was enhanced after treatment with LNA-381 2). The ant-381 up-regulated nurr1 expression and (Fig. 4k, l). In addition, we measured 24-h survival rates inhibited p21 expression (Fig. 5d–f, groups 2 and 3), to test the long-term protective effects of LNA-381 under whereas nurr1 silencing abolished the effect of the ant- I/R injury. As shown in Fig. 4m, the overall survival rate 381 on p21 expression under H/R conditions (Fig. 5f, was higher in the LNA-381 group than the LNA-NC groups 3 and 5). Additionally, the ant-381 preserved group. Collectively, these findings support the notion that occludin and ZO-1 expression after H/R; however, these Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 6 of 14 Fig. 4 miR-381-3p inhibition improves intestinal barrier restoration after I/R injury in mice. The mice were divided into the following four groups: a sham + LNA-NC group, a sham + LNA-381 group, an I/R + LNA-NC group, an I/R + LNA-381 group (n = 8 per group). LNA-381 or LNA-NC (2 mg/kg) was administered by caudal vein injection at 12 h before surgery. The I/R times were 45/240 min, respectively. a qRT-PCR showing miR-381- 3p expression, n = 8. b and c Immunohistochemical staining for the Ki-67 antibody in intestinal tissues for proliferation analysis. Scale bar = 50 μm, n = 6. d Serum D-lactate levels, n = 8. e FITC-dextran intestinal epithelial paracellular permeability, n = 8. f and g Representative images of H&E-stained intestinal sections of mice from the above four groups. Intestinal injury was scored histopathologically (Chiu’s score) according to a scoring system. Scale bar = 100 μm, n = 8. h-l Representative western blot showing nurr1, p21, occludin or ZO-1 protein expression in intestinal tissue, n = 3. m The survival rate of the mice, n = 15. *P < 0.05, **P < 0.01. The error bars describe the standard deviation Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 7 of 14 Fig. 5 miR-381-3p inhibition provides protective effects by targeting nurr1. a Immunofluorescence staining for the Ki-67 antibody in IEC-6 cells for proliferation analysis. IEC-6 cells were infected with si-Nurr1 or si-control, transfected with the ant-381 or the ant-NC, and then incubated in H/R conditions for 6/6 h, respectively. Scale bar = 100 μm, n = 6. b and c Caco-2 cells were co-transfected with ant-381, si-Nurr1 or the corresponding negative control, and then exposed to H/R conditions for 12/6 h, respectively. b Effect of the ant-381 on TEER, n = 3. c Effect of the ant-381 on FITC- dextran intestinal epithelial permeability, n = 3. d-h IEC-6 cells were co-transfected with ant-381, si-Nurr1 or the corresponding negative control, and then incubated in H/R for 6/6 h, respectively. Representative western blot showing nurr1, p21, occludin, ZO-1 protein expression, n = 3. *P < 0.05, **P < 0.01. The error bars describe the standard deviation effects were not observed in the nurr1-knockdown group results indicate that miR-381-3p knockdown amelio- (Fig. 5g, h). These findings suggest that miR-381-3p rates the remote hepatic and pulmonary damage inhibition exerts its protective effects on intestinal I/R induced by intestinal I/R. injury by modulating nurr1 expression. miR-381-3p, nurr1 and tight junction protein expression in miR-381-3p knockdown attenuates mesenteric I/R-induced the ischemic intestine of clinical patients remote organ injury To investigate the clinical relevance of miR-381-3p in Intestinal I/R is invariably followed by remote organ intestinal I/R injury, we measured the expression of miR- injury, which plays a critical role in prognosis . 381-3p and associated genes in ischemic intestinal tissues Therefore, liver and lung tissue injury was examined to and normal tissues from clinical patients. Intestinal evaluate the protective effect of miR-381-3p knockdown ischemia contributed to the elevation of miR-381-3p on remote organ injury. As illustrated in Fig. 6a–d, miR- expression (Fig. 7a) and the reduction of nurr1 expression 381-3p silencing clearly mitigated intestinal I/R-induced (Fig. 7c, d). Thus, miR-381-3p expression was inversely liver and lung histological injury. Intestinal I/R-induced correlated with nurr1 expression in ischemic gut tissue augmentations of ALT and AST levels were significantly (Fig. 7b). Furthermore, occludin and ZO-1 down-regula- reduced in LNA-381-pretreated mice compared with tion under ischemia suggested that miR-381-3p plays a LNA-NC-pretreated mice (Fig. 6e, f). Similarly, intest- role in regulating epithelial barrier function (Fig. 7c, d). inal I/R-induced lung neutrophilic infiltration (as Collectively, these findings support the idea that miR-381- demonstrated by MPO activity) was markedly atte- 3p modulates nurr1 signaling, thereby affecting intestinal nuated after LNA-381 administration (Fig. 6g). These ischemia injury in clinical patients. Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 8 of 14 Fig. 6 miR-381-3p inhibition attenuates intestinal I/R induced liver and lung injury. The mice were divided into the following four groups: a sham + LNA-NC group, a sham + LNA-381 group, an I/R + LNA-NC group, an I/R + LNA-381 group (n = 8). LNA-381 or LNA-NC (2 mg/kg) was injected via the caudal vein at 12 h before surgery. The I/R times were 45/240 min, respectively. a and b Representative images of H&E-stained hepatic sections from mice. Hepatic injury was scored histopathologically (Eckhoff’s score) according to a scoring system. Scale bar = 100 μm. c and d Representative images of H&E-stained lung sections from mice. Lung injury was scored histopathologically (Mikawa’s score) according to a scoring system. Scale bar = 100 μm. e Serum ALT levels. f Serum AST levels. g MPO activity in the lung. n = 8. *P < 0.05, **P < 0.01. The error bars describe the standard deviation Discussion epithelial barrier function attenuates intestinal I/R In this study, we identified a miRNA-regulated sig- injury. naling pathway that alleviates intestinal I/R injury. We Loss of intestinal barrier function caused by enterocyte made the following observations: (1) nurr1 regulated disruption or cell death is a particularly dangerous com- intestinal epithelial barrier function after intestinal I/R plication of intestinal I/R injury, as the complication may injury; (2) among the miRNAs differentially expressed lead to life-threatening bacterial translocation from the between ischemic and normal tissues, miR-381-3p gut, numerous secondary organ injuries, multi-system directly suppressed nurr1 translation; (3) miR-381-3p organ failure and death . Intestinal barrier repair is based inhibition ameliorated intestinal I/R injury in vitro and on the tight coordination of cell migration, proliferation in vivo, attenuated remote organ injury and improved and differentiation . Enterocytes migrate from the crypt survival; (4) miR-381-3p inhibition exerted protective base to villi while differentiating into enterocytes, goblet effects on intestinal I/R injury by targeting nurr1. To the cells and enteroendocrine cells during intestinal epithelial 27,28 best of our knowledge, this study showed for the first development . Cell proliferation within the crypt is the time that miRNA-mediated restoration of intestinal primary force driving cell migration along the villus . Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 9 of 14 Fig. 7 miR-381-3p, nurr1 and tight junction protein expression levels in the ischemic intestine of clinical patients. a qRT-PCR showing miR- 381-3p expression in normal and ischemic human intestines, n = 6. b The association between miR-381-3p expression and Nurr1 protein expression (r = 0.8052, p = 0.0153). c and d Representative western blot showing nurr1, p21, occludin or ZO-1 protein expression in the intestine, n = 3. *P < 0.05, **P < 0.01. The error bars describe the standard deviation Therefore, increased epithelial cell proliferation con- activator C-DIM12 significantly attenuated intestinal I/R 13,14 tributes to intestinal barrier restoration . We recently injury in mice, a change reflected by improvements in found that nurr1 promotes epithelial proliferation after intestinal histological injury, increases in tight junction intestinal I/R injury . In the current study, we found that protein expression and decreases in intestinal perme- nurr1 protein expression reached the valley value at 4 h ability. These data indicate that nurr1 mitigates intestinal after the onset of reperfusion. Concomitant decreases in I/R injury. We speculate that the different roles of nurr1 gut epithelial proliferation and barrier function were in I/R injury may be tissue type dependent. observed. Gain- and loss-of-function studies revealed that Recent reports have shown that miRNAs regulate key 33,34 nurr1 overexpression enhanced epithelial proliferation pathogenic events and affect intestinal I/R injury . and barrier function after I/R injury. However, However, few reports have examined whether miRNAs nurr1 silencing had the opposite effect. Thus, these data mitigate intestinal I/R injury by restoring epithelial barrier demonstrate that nurr1 improves epithelial barrier func- function. To thoroughly clarify the effects of miRNA on tion after intestinal I/R injury. epithelial barrier repair after intestinal I/R injury, we An increasing number of studies have shown that nurr1 utilized a miRNA microarray platform to identify 131 is involved in ischemia/reperfusion injury. Nurr1 mRNA miRNAs that are differentially expressed between the I/R is reportedly up-regulated during liver or kidney I/R group and the sham group. Based on our findings injury, indicating that nurr1 may be associated with the regarding the effects of nurr1 on intestinal barrier func- 30,31 aggravation of I/R injury . However, Hossmann et al. tion, we used bioinformatics analysis to determine miR- and our team suggested that nurr1 protein expression is 381-3p that can target nurr1. The miR-381-3p binding 12,32 down-regulated during stroke or intestinal I/R injury . sequences in the nurr1 3′-UTR are highly conserved In addition, we found that nurr1 mediated epithelial across various species. Gain-of-function and loss-of- proliferation in intestinal I/R injury . Here, the nurr1 function studies demonstrated that miR-381-3p directly Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 10 of 14 repressed nurr1 translation. We also showed that miR- down-regulated the expression of tight junction proteins 381-3p was involved in regulating gut barrier function suggested that miR-381-3p plays a crucial role in intest- after I/R. In vitro, miR-381-p inhibition enhanced intest- inal barrier function. To validate the regulatory role of inal epithelial proliferation and barrier function by up- miR-381-3p in clinical patients with intestinal ischemia, regulating nurr1 under H/R conditions. In vivo, LNA- we need to collect enough samples to analyze its function mediated miR-381-p knockdown prevented intestinal I/R in such patients. injury by improving epithelial proliferation and tightening In summary, we found that nurr1 enhanced intestinal the intestinal epithelium. In addition, our study demon- barrier function after intestinal I/R injury. Using micro- strated that nurr1-mediated p21 repression stimulates array and bioinformatics analysis, we found that miR-381- intestinal epithelial cell proliferation . p21 suppression 3p targets nurr1. Furthermore, our study demonstrated restores the barrier function of skin suffering from the that miR-381-3p inhibition improves epithelial prolifera- loss of Dicer function by regulating cellular proliferation tion and barrier function by targeting nurr1 signaling, and differentiation . In this study, p21 was significantly thereby reducing Intestinal I/R injury. This may provide a down-regulated when miR-381-3p was inhibited to pro- new miRNA-based strategy for the treatment of intestinal mote nurr1-mediated epithelial barrier function after I/R-related clinical conditions. intestinal I/R injury. These data suggest that miR-381-3p inhibition improves epithelial proliferation and barrier Materials and methods function by modulating the nurr1/p21 pathway, and then Murine model of intestinal I/R attenuates intestinal I/R injury. Young male C57BL/6 mice (aged 8 weeks) were pur- Intestinal I/R injury-induced MODS is a leading cause chased from the Animal Center of Dalian Medical Uni- 36,37 of death in critically ill ICU patients . As demonstrated versity (Dalian, China). The mice were housed in specific in this study, mesenteric I/R injury aggravates lung and pathogen-free conditions at a constant temperature (22 ± liver histopathological damage, as well as pulmonary 2 °C) and under a 12-h light/dark cycle. The mice were fed neutrophil infiltration and liver dysfunction. Interesting, standard food and water and were given 1 week to we found that miR-381-3p knockdown contributes to the acclimate to their environment before being used in the attenuation of lung and liver injury and improvements in study. The mice were randomly divided into the following survival after mesenteric I/R. These results suggest that four groups: a sham group, a sham + 1,1-bis(39-indolyl)- miR-381-3p is an important target for the treatment of 1-(p-chlorophenyl) methane (C-DIM12) group, an I/R intestinal I/R-induced MODS. group, and an I/R + C-DIM12 group. All mice were LNA oligonucleotides are conformational RNA analogs anesthetized via an intraperitoneal injection of pento- that have an unprecedented affinity for and bind specifi- barbital (50 mg/kg body weight). Midline laparotomy was cally to complementary RNA, leading to selective miRNA performed, and the superior mesenteric artery was iden- 38,39 silencing . A LNA-modified inhibitor of miR-122 tified, isolated and clamped. After 45 min of ischemia, the (Miravirsen) was used in phase 2 clinical trials of treat- vascular clamp was removed from the artery to allow ments for HCV infection and induced dose-dependent reperfusion. The mice used for the survival study were reductions in HCV RNA levels that endured beyond the anesthetized with buprenorphine (0.1 mg/kg, IP, every 40 43 end of active therapy . In this study, LNA-381 was 12 h) . Corn oil was used to dissolve C-DIM12 (Selleck, injected into C57 mice to specifically reduce miR-381-3p Houston, USA). C-DIM12 (50 mg/kg body weight) was expression in vivo without inducing hepatotoxicity. We administered by gavage at 4 h prior to surgery, in accor- observed that LNA-381 attenuated local intestinal damage dance with existing pharmacokinetic data . After 4 h of and remote organ injury and improved survival in mice reperfusion, intestinal tissue samples and blood samples subjected to mesenteric I/R. These findings support that were harvested for various experimental evaluations LNA-381 may be a therapeutic intervention for clinical required for this study. All procedures were performed in patients with intestinal I/R. accordance with the guidelines for the care and use of Previous studies have shown that miR-381-3p may be a medical laboratory animals. This study was approved by target for the treatment of patients with TB or HIV- the Institutional Ethics Committee of Dalian Medical 41,42 associated neurocognitive disorders . To determine University (Dalian, China). the clinical significance of miR-381-3p in patients with intestinal I/R injury, we measured the expression of miR- Cell culture and H/R 381-3p and associated proteins in ischemic intestinal tis- Caco2 cells and IEC-6 cells were obtained from Amer- sues and normal tissues from clinical patients. The inverse ican Type Culture Collection (Manassas, VA, USA) and relationship between miR-381-3p and nurr1 expression grown in Dulbecco's modified eagle medium supple- was confirmed through analysis of the intestinal tissue mented with 10% fetal bovine serum, 1% non-essential samples. In addition, the finding that intestinal ischemia amino acids and 1% glutamine. IEC-6 cells were also Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 11 of 14 Table 1 Sequences of antagomirs, agomirs, LNAs, siRNAs and primers Name Sequences (5′–3′) miR-381-3p antagomir (human) ACAGAGAGCUUGCCCUUGUAUA miR-381-3p antagomir (rat) AGAGCUUGCCCUUGUAUA antagomir negative control CAGUACUUUUGUGUAGUACAA miR-381-3p agomir (human) UAUACAAGGGCAAGCUCUCUGUAGAGAGCUUGCCCUUGUAUAUU agomir negative control UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT LNA-381 (mouse) GAGCUUGCCCUUGUAU LNA-NC (mouse) TACGTCTATACGCCCA nurr1 siRNA (human) GGCUUGUAAAUUUACCCAATTUUGGGUAAAUUUACAAGCCTT nurr1 siRNA (rat) CCUCACCAACACUGAAAUUttAAUUUCAGUGUUGGUGAGGtc siRNA negative control UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT nurr1 (human) ForwardReverse GGCCGGAGAGGTCGTTTGCCAGGGTTCGCCTGGAACCTGGA nurr1 (rat) ForwardReverse GGGCTCAAGGAACCCAAGAGGCAAAGGGTGCGAAGTTCTG treated with 0.1 unit/ml bovine insulin. The cultures were miRCURY™ Hy3™/Hy5™ Power labeling kit and hybridized maintained at 37 °C in a humidified atmosphere of 5% on a miRCURYTM LNA Array station. Scanning was CO . To induce hypoxia, we incubated the Caco2 and performed with an Axon GenePix 4000B microarray IEC-6 cells in a microaerophilic system (Thermo, Wal- scanner (Axon Instruments, Foster City, CA). Scanned tham, MA) containing 1% O and 5% CO balanced with images were then imported into GenePix Pro 6.0 software 2 2 94% N gas for 12 h and 6 h, respectively. The cells were (Axon) for grid alignment and data extraction. Replicated then reoxygenated under normoxic conditions for 6 h. miRNAs were averaged and miRNAs that intensities ≥30 in all samples were chosen for calculating normalization Transfection of pcDNA-Nurr1, small interfering RNA factor. Expressed data were normalized using the Median (siRNA), agomirs and antagomirs normalization. Discriminant miRNAs and differences Plasmids encoding nurr1 were used to over-express the between groups were analyzed using Bayes moderated t- protein. We previously described a siRNA that targets test (limma) with Benjamini Hochberg false discovery rate nurr1. A nonspecific scrambled siRNA duplex was used as at P < 0.05, unless otherwise specified. A two-fold cut-off a control. A chemically modified antagomir com- was applied to select up-regulated and down-regulated plementary to miR-381-3p was used to inhibit miR-381- miRNAs. 3p expression, while an agomir was used to increase miR- 381-3p expression. The plasmids, siRNAs, agomirs, Luciferase activity assay antagomirs and corresponding negative control oligonu- Plasmids containing the wild-type miR-381-3p 3′- cleotides were purchased from GenePharma (Shanghai, untranslated region (3′-UTR-WT) or the corresponding China). The sequences of the oligonucleotides are shown mutant sequence (3′-UTR-mut) were purchased from in Table 1. The cells were transfected with the oligonu- GenePharma. Plasmid DNA and ago-381 or ago-NC were cleotides using Lipofectamine 3000, according to the co-transfected into cells seeded in 24-well plates using manufacturer’s protocols. Lipofectamine 3000. The Caco-2 cells were evaluated with the Dual-Luciferase Reporter Assay Kit (TransGen, Beij- miRNAs microarray analysis ing, China) after 36 h of transfection. Luciferase activity The microarray analysis for miRNA profiling was con- was measured using a Dual-Light Chemiluminescent ducted by the miRCURY LNA Array system (Exiqon, Reporter Gene Assay System (Berthold, Germany) nor- Vedbaek, Denmark). The total RNA was extracted from malized to Renilla luciferase activity. intestinal samples of mice subjected to intestinal I/R or sham surgery using Trizol (Invitrogen) according to the Immunofluorescence instructions provided by the manufacturer. The quality IEC-6 cells were seeded on chamber-slides, fixed in ice- and quantity of RNA samples were assessed by using cold 4% paraformaldehyde for 15 min, permeabilized nanodrop spectrophotometer (ND-1000, Nanodrop using 0.1% Triton X-100 for 10 min and then blocked Technologies). RNA samples were labeled with an Exiqon with 3% BSA in PBS for 1 h at 37 °C. The cells were Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 12 of 14 subsequently incubated with Ki-67 (1:200 Abcam, UK) Aldrich, USA) fluorescence intensity. We used Caco-2 cells antibodies overnight at 4 °C, after which they were incu- instead of IEC-6 cells because IEC-6 cells are unable to bated with Alexa flour 594 secondary antibodies (Invi- form a tight monolayer . We added 1.0 mg/ml FD-4 to the trogen Life Technologies, Carlsbad, CA, USA) for 1h at apical side of each monolayer after H/R injury, after which room temperature and treated with DAPI (1 μg/μl for 10 a100-μl sample was taken from the basolateral chamber min) at room temperature to stain the nuclei. The and assayed for fluorescence using an Enspire2300 resulting immunofluorescence was examined using an microplate reader (excitation, 480 nm; emission, 520 nm). Olympus fluorescence microscope. Two-hundred microliters of PBS containing 25 mg/ml FD- 4 was gavaged orally during ischemia, as described in a Transepithelial electrical resistance (TEER) assay previous study. The 100-μl blood sample was collected To assess intestinal barrier function in vitro, we used 24- after the reperfusion period .The fluorescence intensity of well transwell system plates (0.4-µm pore size, Costar each sample was measured with an Enspire2300 microplate Incorporated Corning, NY) to perform TEER assay, as reader (excitation, 480 nm; emission, 520 nm). described previously . Because IEC-6 cells rarely form a tight monolayer, we used Caco-2 cells to study intestinal Real-time PCR 45,46 barrier function by TEER assay . Briefly, 0.3 ml of Caco- miRNA was isolated from the cells with TRIzol (Takara, 2 cells were seeded in the upper chamber of the transwell Dalian, China). We detected miR-381-3p with a Bulge- system at a density of 1 × 10 cells/ml. The apical one Loop miRNA qRT-PCR Primer Set (Ribobio Co.), bathed in the basal chamber with 0.7 ml medium for according to the manufacturer’s instructions. The 20 days. TEER was measured daily by an epithelial volt expression levels of the miRNA were normalized to those ohmmeter (WPI, Sarasota, FL, USA). The medium was of U6 snRNAs, which served as an endogenous control. refreshed every day. The Caco-2 cells were transfected with Total RNA was extracted by TRIzol reagent and reversed antagomirs or siRNA during a steady monolayer state. transcribed with a Transcript All-in-one SuperMix for TEER was calculated by the following formula: TEER= qPCR Kit (TransGen, Beijing, China). Nurr1 mRNA (R1− R0) × A Ω cm , where R1 is the background resis- expression was quantified using a SYBR Real-time PCR tance, R0 is the collagen layer and membrane insert Kit (TransGen, Beijing, China). Specific primers were resistance, and A is the insert membrane area. The mean produced by Invitrogen (Ribobio Co.). The sequences of TEER was calculated using data from three experiments. the primers are listed in Table 1. Nurr1 mRNA levels were normalized to β-actin mRNA levels. In vivo knockdown of miR-381-3p To inhibit miR-381-3p expression in vivo, we injected Western blotting mice with 2 mg/kg locked nucleic acid-modified antisense Intestinal tissue and cell protein were extracted oligonucleotides targeting miR-381-3p (LNA-381) or LNA- according to the manufacturer’s instructions (KeyGEN NC oligonucleotides via the tail vein at 12 h before ische- Biotech, Nanjing, China). Western blotting was per- mia. The LNA oligonucleotides were obtained from Exiqon formed with primary antibodies against nurr1, p21 Vedbaek, Denmark. Their sequences are shown in Table 1. (Abcam, Cambridge, UK), ZO-1, occludin (Proteintech, Wuhan, China), and β-actin (ZSGB-BIO, Beijing, China) Histopathology and immunohistochemistry and horseradish peroxidase (HRP)-conjugated secondary To evaluate intestinal, hepatic and pulmonary injury antibodies (ZSGB-BIO, Beijing, China). Protein levels after intestinal I/R, we divided paraffin-embedded tissue were analyzed using Gel-Pro Analyzer Version 4.0 (Media samples into 4-μm sections, which we stained with Cybernetics, MD, USA). hematoxylin and eosin (H&E). The intestinal, hepatic and pulmonary pathological scores were graded based on D-lactate, ALT, AST and MPO activity assays 47 48 49 Chiu, Eckhoff and Mikawa, respectively. Mouse Serum D-lactate content was assayed using an enzyme- small intestinal tissue sections were blocked with 5% goat linked immunosorbent assay kit (J&L Biological, Shang- serum, after which they were incubated with anti-Ki-67 hai, China), according to the manufacturer’s instructions. antibodies overnight at 4 °C. An ABC kit and DAB sub- Pulmonary MPO activity levels and serum ALT and AST strates were used for Ki-67. The sections were then levels were measured using commercial assay kits (Nanj- counterstained by hematoxylin. The IHC results were ing Jiancheng Corp, Nanjing, China), according to the examined using a fluorescence microscope. manufacturer’s protocols. Intestinal permeability assay Acquisition of clinical specimens Intestinal barrier permeability was measured by 4.4-kDa The collection and use of human intestinal samples fluorescein isothiocyanate FITC-dextran (FD4, Sigma- were approved by the local ethics committee at Dalian Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 13 of 14 Medical University. Patient intestinal samples were 3. Stone, J. R. & Wilkins, L. R. Acute mesenteric ischemia. Tech. Vasc. Interv. Radiol. 18,24–30 (2015). obtained after the patients provided informed written 4. Gibot, S. et al. Effects of the TREM-1 pathway modulation during mesenteric consent. Ischemic gut segments, which were assigned to ischemia-reperfusion in rats. Crit. Care Med. 36,504–510 (2008). the model group, and the margins of the resected gut 5. Jin, X.,Zimmers,T. A., Zhang, Z.,Pierce, R. H. & Koniaris, L. G. Interleukin-6 is an important in vivo inhibitor of intestinal epithelial cell death in mice. Gut 59, segments, which were assigned to the control group, were 186–196 (2010). obtained from patients who underwent surgery for acute 6. Kannan, L. et al. R-spondin3 prevents mesenteric ischemia/reperfusion- superior mesenteric artery emboli or intestinal hernia induced tissue damage by tightening endothelium and preventing vascular leakage. Proc. Natl. Acad. Sci. USA 110, 14348–14353 (2013). strangulation in the Department of Acute Abdominal 7. Meckel, K. et al. Serum 25-hydroxyvitamin D concentration is inversely asso- Surgery of the Second Affiliated Hospital of Dalian ciated with mucosal inflammation in patients with ulcerative colitis. Am. J. Clin. Medical University. The intestinal samples were imme- Nutr. 104,113–120 (2016). 8. Klepsch, V. et al. Nuclear orphan receptor NR2F6 as a safeguard against diately frozen in liquid nitrogen and stored at −80 °C until experimental murine colitis. Gut [Epub ahead of print] https://doi.org/10.1136/ analysis. gutjnl-2017-314241 (2017). 9. Gadaleta, R. M. et al. Farnesoid X receptor activation inhibits inflammation and preserves the intestinal barrier in inflammatory bowel disease. Gut 60, Statistical analysis 463–472 (2011). All values are expressed as the mean ± SD. Data with 10. Chen, P. et al. Adenovirus-mediated expression of orphan nuclear receptor normal distributions were compared using one-way ana- NR4A2 targeting hepatic stellate cell attenuates liver fibrosis in rats. Sci. Rep. 6, 33593 (2016). lysis of variance followed by the Student–Newman–Keuls 11. Llopis, S. et al. Dichotomous roles for the orphan nuclear receptor NURR1 in test. The survival study results were analyzed using the breast cancer. BMC Cancer 13, 139 (2013). Kaplan–Meier method. A two-tailed Student’s t-test was 12. Guo, Z. et al. Nurr1 promotes intestinal regeneration after ischemia/reperfu- sion injury by inhibiting the expression ofp21 (Waf1/Cip1). J. Mol. Med. 95, used to compare means between two groups. At least 1–13 (2016). three independent experiments were performed to con- 13. Shim, S. et al. Rebamipide ameliorates radiation-induced intestinal injury in a firm the results. Statistical analysis was performed using mouse model. Toxicol. Appl. Pharmacol. 329,40–47 (2017). 14. Nan, X. et al. Hsa-miRNA-31 regulates epithelial cell barrier function by GraphPad Prism 5.0 (GraphPad Prism Software, La Jolla, inhibiting TNFSF15 expression. Cell Mol. Biol. (Noisy-Le.-Grand.) 62, CA, USA). P < 0.05 was considered statistically significant. 104–110 (2016). 15. Yan,W., Chen,Z.Y., Chen,J.Q.& Chen,H. M. BMP2promotes the differ- Acknowledgements entiation of neural stem cells into dopaminergic neurons in vitro via miR-145- This work was supported by the National Natural Science Foundation of China mediated upregulation of Nurr1 expression. Am. J. Transl. Res. 8,3689–3699 (grant numbers 81671954 and 81372037). (2016). 16. Yang, D. et al. miR-132 regulates the differentiation of dopamine neu- Author details rons by directly targeting Nurr1 expression. J. Cell Sci. 125,1673–1682 Department of General Surgery, The Second Affiliated Hospital of Dalian (2012). Medical University, Dalian 116023, China. Department of Pharmacology, 17. Wu, S. et al. MicroRNA-132 promotes estradiol synthesis in ovarian granulosa Dalian Medical University, Dalian 116044, China cells via translational repression of Nurr1. Reprod. Biol. Endocrinol. 13, 94 (2015). 18. Bartel, D. P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215–233 (2009). Author contributions 19. Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing. Nature X.T., L.L., and J.Y. designed this research. L.L., D.F., Z.L., Y.L., and W.Q. performed 425,415–419 (2003). the research. L.L., G.Z., S.Z., T.L., H.Z., and J.Y. analyzed the data. X.T. and L.L. 20. Lesizza, P. et al. Single-dose intracardiac Injection of pro-regenerative Micro- wrote and revised the paper. X.T. provided financial support. All authors RNAs improves cardiac function after myocardial infarction. Circ. Res. 116, reviewed and approved the manuscript. 309589–1304 (2017). 21. Yang, J.,Zhang,X., Chen,X., Lei, W. & Yang, G. Exosome mediated delivery of Conflict of interest miR-124 promotes neurogenesis after ischemia. Mol. Ther. Nucleic Acids 7, The authors declare that they have no conflict of interest. 278–287 (2017). 22. Enright,A.J.etal. MicroRNA targetsinDrosophila. Genome. Biol. 5, R1 (2003). 23. Dweep,H., Sticht,C., Pandey, P.&Gretz, N. miRWalk-Database: predictionof Publisher's note possible miRNA binding sites by “walking” the genes of three genomes. J. Springer Nature remains neutral with regard to jurisdictional claims in Biomed. Inform. 44, 839–847 (2011). published maps and institutional affiliations. 24. Moraes, L. B. et al. Gut ischemia/reperfusion induced acute lung injury is an alveolar macrophage dependent event. J. Trauma 64, 1200–1201 (2008). Supplementary Information accompanies this paper at https://doi.org/ 25. Kannan, K. B. et al. Hypoxia-inducible factor plays a gut-injurious role in 10.1038/s41419-018-0450-z. intestinal ischemia reperfusion injury. Am. J. Physiol. Gastrointest. Liver Physiol. 300, G853 (2011). Received: 8 November 2017 Revised: 2 February 2018 Accepted: 14 26. Iizuka, M. & Konno, S. Wound healing of intestinal epithelial cells. World J. February 2018 Gastroenterol. 17, 2161–2171 (2011). 27. Sun,X., Yang,Q., Rogers,C.J., Du, M. & Zhu, M. J. AMPK improves gut epithelial differentiation and barrier function via regulating Cdx2 expression. Cell Death Differ. 24,819–831 (2017). 28. Clevers, H. & Batlle, E. SnapShot: the intestinal crypt. Cell 152,1198–1198.e2 References (2013). 1. Kong,S. E., Blennerhassett, L.R., Heel,K.A., Mccauley,R. D. & Hall, J. C. 29. Parker, A. et al. Cell proliferation within small intestinal crypts is the principal Ischaemia‐reperfusion injury to the intestine. Aust. N.Z.J.Surg. 68, 554 (1998). driving force for cell migration on villi. FASEB J. 31,636–649 (2017). 2. Acosta,S.&Björck,M.Moderntreatment of acute mesenteric ischaemia. Br. J. 30. Ohkubo, T. et al. Early induction of nerve growth factor-induced genes after Surg. 101,e100–e108 (2014). liver resection–reperfusion injury. J. Hepatol. 36,210–217 (2002). Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 14 of 14 31. Balasubramanian, S., Jansen, M., Valerius, M. T., Humphreys, B. D. & Strom, T. B. 42. Xu, Z. et al. MicroRNAs upregulated during HIV infection target peroxisome Orphan nuclear receptor Nur77 promotes acute kidney injury and renal epi- biogenesis factors: Implications for virus biology, disease mechanisms and thelial apoptosis. J. Am.Soc.Nephrol. 23,674–686 (2012). neuropathology. PLoS. Pathog. 13, e1006360 (2017). 13. 32. Erdö, F., Trapp, T., Mies, G. & Hossmann, K.-A. Immunohistochemical analysis of 43. Ban, K., Peng, Z. & Kozar, R. A. Inhibition of ERK1/2 worsens intestinal ischemia/ protein expression after middle cerebral artery occlusion in mice. Acta Neu- reperfusion injury. PLoS One 8, e76790–e76790 (2013). 8. ropathol. 107,127–136 (2004). 44. De Miranda, B. R. et al. Neuroprotective efficacy and pharmacokinetic 33. Zhang, N. et al. SIRT1 promotes metastasis of human osteosarcoma cells. behavior of novel anti-inflammatory para-phenyl substituted diindo- Oncotarget 7, 79654–79669 (2016). lylmethanes in a mouse model of Parkinson’s disease. J. Pharmacol. Exp. 34. Liu, Z. et al. MicroRNA-682-mediated downregulation of PTEN in intestinal Ther. 345, 125 (2013). epithelial cells ameliorates intestinal ischemia-reperfusion injury. Cell Death & 45. Li, Y. et al. 6-Gingerol protects intestinal barrier from ischemia/reperfusion- Dis. 7, e2210 (2016). 7. induced damage via inhibition of p38 MAPK to NF-κB signalling. Pharmacol. 35. Ghatak, S. et al. Barrier function of the repaired skin is disrupted following Res. 119,137–148 (2017). arrest of dicer in keratinocytes. Mol. Ther. J. Am. Soc. Gene Ther. 23,1201–1210 46. Tovah, W., Baier, S. R. & Janos, Z. The intestinal transport of bovine milk (2015). exosomes is mediated by endocytosis in human colon carcinoma 36. Ware, L. B. & Matthay, M. A. The acute respiratory distress syndrome—NEJM. Caco-2 cells and rat small intestinal IEC-6 cells. J. Nutr. 145, 2201–2206 JAMA J. Am.Med.Assoc. 307, 2542 (2000). (2015). 37. Schwarz, B. et al. [Intestinal ischemic reperfusion syndrome: pathophysiology, 47. Chiu, C. J.,Mcardle,A.H., Brown, R.,Scott, H.J. & Gurd,F.N.Intestinalmucosal clinical significance, therapy]. Wien. Klin. Wochenschr. 111,539–548 (1999). lesion in low-flow states: I. A morphological, hemodynamic, and metabolic 38. Stenvang, J., Silahtaroglu, A. N., Lindow, M., Elmen, J. & Kauppinen, S. The utility reappraisal. Arch. Surg. 101, 478–483 (1970). of LNA in microRNA-based cancer diagnostics and therapeutics. Semin. Cancer 48. Eckhoff, D. E., Bilbao,G., Frenette,L., Thompson,J.A.&Contreras, J. L. 17-Beta- Biol. 18,89–102 (2008). estradiol protects the liver against warm ischemia/reperfusion injury and is 39. Fluiter, K. et al. In vivo tumor growth inhibition and biodistribution studies of associated with increased serum nitric oxide and decreased tumor necrosis locked nucleic acid (LNA) antisense oligonucleotides. Nucleic Acids Res. 31, factor-alpha. Surgery 132,302–309 (2002). 953–962 (2003). 49. Mikawa, K., Nishina, K., Takao, Y. & Obara, H. ONO-1714, a nitric oxide synthase 40. Janssen,H.L.etal. TreatmentofHCV infectionbytargeting microRNA. New inhibitor, attenuates endotoxin-induced acute lung injury in rabbits. Anesth. Engl.J.Med. 368, 1685–1694 (2013). Analg. 97, 1751–1755 (2003). 41. Wen, Q. et al. MiR-381-3p regulates the antigen-presenting capability of 50. Chassin, C. et al. MicroRNA-146a-mediated downregulation of IRAK1 protects dendritic cells and represses antituberculosis cellular immune responses by mouse and human small intestine against ischemia/reperfusion injury. EMBO targeting CD1c. J. Immunol. 197, 580–589 (2016). Mol. Med. 4, 1308–1319 (2012). Official journal of the Cell Death Differentiation Association http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cell Death & Disease Springer Journals

miR-381-3p knockdown improves intestinal epithelial proliferation and barrier function after intestinal ischemia/reperfusion injury by targeting nurr1

Download PDF
14 pages

Loading next page...
 
/lp/springer_journal/mir-381-3p-knockdown-improves-intestinal-epithelial-proliferation-and-vWU9qp0v0T

References (49)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s)
Subject
Life Sciences; Life Sciences, general; Biochemistry, general; Cell Biology; Immunology; Cell Culture; Antibodies
eISSN
2041-4889
DOI
10.1038/s41419-018-0450-z
Publisher site
See Article on Publisher Site

Abstract

Impairment in gut barrier function induced by intestinal ischemia/reperfusion (I/R) injury is associated with high morbidity and mortality. Intestinal barrier function requires the tight coordination of epithelial migration, proliferation and differentiation. We previously observed that nuclear receptor-related protein 1 (nurr1)-mediated proliferative pathway was impaired in intestinal I/R injury. Here, we aimed to assess the effect of nurr1 on intestinal barrier function and to evaluate microRNA (miRNA)-nurr1-mediated restoration of intestinal barrier function in intestinal I/R injury. We induced an in vivo intestinal I/R injury mouse model by clamping and then releasing the superior mesenteric artery. We also performed an in vitro study in which we exposed Caco-2 and IEC-6 cells to hypoxia/reoxygenation (H/R) conditions to stimulate intestinal I/R injury. Our results demonstrated that nurr1 regulated intestinal epithelial development and barrier function after intestinal I/R injury. miR-381-3p, which directly suppressed nurr1 translation, was identified by microarray and bioinformatics analysis. miR-381-3p inhibition enhanced intestinal epithelial proliferation and barrier function in vitro and in vivo and also attenuated remote organ injury and improved survival. Importantly, nurr1 played an indispensable role in the protective effect of miR-381-3p inhibition. Collectively, these findings show that miR-381-3p inhibition mitigates intestinal I/R injury by enhancing nurr1-mediated intestinal epithelial proliferation and barrier function. This discovery may lead to the development of therapeutic interventions for intestinal I/R injury. Introduction bowel volvulus, abdominal aortic aneurysm surgery, 1–3 The damage sustained by ischemic intestinal tissue as a hemorrhagic shock and sepsis . Intestinal ischemia result of the activation of vicious cascades during the causes severe cellular damage that provokes epithelial restoration of blood flow is known as intestinal ischemia/ barrier dysfunction during reperfusion. Intestinal epithelial reperfusion (I/R) injury. Intestinal I/R injury is a common barrier loss leads to increases in permeability and bacterial 4,5 life-threatening complication observed in many clinical translocation . The resulting intestinal barrier dysfunc- conditions, such as mesenteric arterial thrombosis, small tion is a key factor in the aggravation of the deleterious complications of intestinal I/R, including systemic inflammatory response syndrome and multiple organ dysfunction syndrome (MODS) . Thus, therapeutic Correspondence: Xiaofeng Tian (txfdl@dmu.edu.cn) or Jihong Yao (yaojihong65@hotmail.com) restoration of intestinal barrier function, which requires Department of General Surgery, The Second Affiliated Hospital of Dalian the tight coordination of epithelial migration, proliferation Medical University, Dalian 116023, China Department of Pharmacology, Dalian Medical University, Dalian 116044, China Edited by S. Lavandero © The Author(s) 2018 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to theCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association 1234567890():,; 1234567890():,; Liu et al. Cell Death and Disease (2018) 9:411 Page 2 of 14 Fig. 1 (See legend on next page.) Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 3 of 14 Fig. 1 Nurr1 regulates intestinal restoration after I/R injury. a Mice were subjected to 45 min of intestinal ischemia followed by 0–16 h of reperfusion or sham surgery. I, ischemia; R, reperfusion; representative western blot showing nurr1 protein expression in the intestinal tissue lysates (n = 3 per group, **P < 0.01 versus sham group). b-i The mice were divided into the following four groups: a sham group, a sham + C-DIM12 group, an I/R group, and an I/R + C-DIM12 group (n = 8 per group). C-DIM12 (50 mg/kg) was orally gavaged at 4 h before surgery. The I/R times were 45/240 min, respectively. b and c Representative images of H&E-stained intestinal sections of mice from the above four groups. Intestinal injury was scored histopathologically (Chiu’s score) according to a scoring system. Scale bar = 100 μm. d and e Immunohistochemical staining for the Ki-67 antibody in intestinal tissues for proliferation analysis. Scale bar = 50 μm. f-h Representative western blot showing occludin and ZO-1 protein expression in the intestinal tissue lysates, n = 3 per group. i FITC-dextran intestinal epithelial paracellular permeability. j-n IEC-6 cells were transfected with plasmids encoding Nurr1 for 36 h and then incubated in hypoxic conditions for 6 h before being incubated in normoxic conditions for 6 h. j Representative western blot showing nurr1 protein expression, n = 3. k Immunofluorescence staining for the Ki-67 antibody in IEC-6 cells for proliferation analysis. Scale bar = 100 μm, n = 6. l-n Representative western blot showing occludin and ZO-1 protein expression, n = 3. o and p Caco-2 cells were infected with si-Nurr1 or its negative control (si-control) for 36 h and then exposed to hypoxic conditions for 12 h before being exposed to normoxic conditions 6 h. o Si-nurr1-induced changes in intestinal epithelial permeability, as measured by FITC-dextran permeability, n = 3. p The effect of si- Nurr1 on intestinal epithelial integrity was evaluated by TEER, n = 3. Data are representative of three independent experiments. *P < 0.05, **P < 0.01. The error bars describe the standard deviation and differentiation, is indispensable for intestinal I/R regulates epithelial proliferation and barrier function after injury. intestinal I/R injury. This study aimed to provide infor- It has been reported that several nuclear receptors mation regarding a potential strategy for the treatment of improved intestinal epithelial development and barrier intestinal I/R injury. 7–9 function after injury . Nuclear receptor-related protein 1 (nurr1), an orphan nuclear receptor, is a well-known Results transcription factor that participates in several cellular Nurr1 enhances intestinal epithelial regeneration and development processes, such as proliferation, differentia- barrier function after intestinal I/R injury 10,11 tion and apoptosis . We previously found that mod- Western blotting was used to assess nurr1 expression at ulating nurr1 expression improves epithelial proliferation different reperfusion time points after intestinal ischemia. after intestinal I/R injury . Increased epithelial cell pro- Intestinal nurr1 levels decreased significantly during the liferation contributes to enhance intestinal epithelial first 4 h after the onset of reperfusion and then progres- 13,14 barrier function . However, the effect of nurr1 on sively increased from 4–16 h after the onset of reperfusion, epithelial barrier function after intestinal I/R injury, as suggesting that nurr1 plays a critical role in regulating well as the mechanism by which nurr1 is modulated, intestinal I/R injury (Fig. 1a). To validate the effect of require further investigation. nurr1 in vivo, we administered the nurr1 activator C- Recent research regarding nurr1 has demonstrated that DIM12 to C57BL/6 mice. Compared with I/R group, its expression can be regulated by microRNAs (miRNAs) intestinal histological injury was dramatically attenuated in 15–17 in some diseases . miRNAs are a class of endogenous the I/R+ C-DIM12 group (Fig. 1b and c). Consistent with small non-coding RNAs of approximately 22 nucleotides these findings, regeneration levels, as reflected by the in length that negatively modulate gene expression by numbers of Ki-67-positive cells, were higher in the I/R + promoting mRNA degradation or inhibiting transcript C-DIM12 group than in the I/R group (Fig. 1d and e). 18,19 translation . A growing number of studies have shown Intestinal barrier functional restoration, a change reflected that miRNA modulation contributes to organ repair fol- by increases in occludin and ZO-1 protein expression lowing a variety of events, including myocardial or cere- (Fig. 1f–h) and decreases in the FITC-dextran paracellular 20,21 bral ischemic injury . However, miRNA-mediated gut permeability, occurred in conjunction with the enhance- epithelial restoration after intestinal I/R injury remains ment of epithelial regeneration (Fig. 1i). poorly understood. Based on the above findings regarding Furthermore, in vitro pcDNA-Nurr1 transfection the role of nurr1, we hypothesized that miRNA modula- (Fig. 1j) increased Ki-67-labeled IEC-6 cell proliferation in tion may improve intestinal epithelial proliferation and hypoxia/reoxygenation (H/R; Fig. 1k) and occludin and barrier function by targeting nurr1, thereby reducing ZO-1 protein expression (Fig. 1l–n). Conversely, RNAi- intestinal I/R injury. mediated Nurr1 knockdown decreased intestinal epithe- In this study, we investigated the regulatory role of lial barrier function, a change reflected by increases in nurr1 in epithelial barrier function after intestinal I/R FITC-dextran paracellular permeability (Fig. 1o) and injury. We performed microarray chip to identify the reductions in transepithelial electrical resistance (TEER; miRNAs that are differentially expressed between I/R- Fig. 1p) in Caco-2 cells. Consistent with the results of our injured intestinal tissues and normal tissues and further previous study , these results indicate that nurr1 screened miR-381-3p that targets nurr1. We speculate improves intestinal epithelial proliferation and barrier that miR-381-3p and nurr1 constitute an axis that function in I/R injury. Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 4 of 14 Fig. 2 miR-381-3p negatively regulates nurr1 expression. a The miR-381-3p target sequence in the nurr1 3ʹ-UTR is conserved across various species. b The WT nurr1 3ʹ-UTR and the MT nurr1 3ʹ-UTR in the luciferase constructs. BS, binding site. c Caco-2 cells were infected with miR-381 or miR-NC and WT nurr1 3ʹ-UTR or MT nurr1 3ʹ-UTR, n = 3. d-g Caco-2 or IEC-6 cells were transfected with the ant-381 or the ant-NC. d Representative western blot showing nurr1 protein expression in Caco-2 cells, n = 3. e qRT-PCR showing nurr1 mRNA expression in Caco-2 cells, n = 6. f Representative western blot showing nurr1 protein expression in IEC-6 cells, n = 3. g qRT-PCR showing nurr1 mRNA expression in IEC-6 cells, n = 6. *P < 0.05, **P < 0.01. The error bars describe the standard deviation miR-381-3p participates in regulating nurr1 expression whether endogenous nurr1 expression is regulated by To explore the molecular mechanism underlying the miR-381-3p modulation (Supplementary Figures 2a–c). effects of nurr1 down-regulation on H/R and I/R injury, miR-381-3p silencing up-regulated nurr1 protein levels we tested whether nurr1 is regulated by miRNA. Intestinal but had no effect on mRNA expression in Caco-2 cells samples derived from mice subjected to intestinal I/R (n (Fig. 2d, e). These data showed that miR-381-3p represses = 3) or sham surgery (n = 3) were collected and the nurr1 translation. Similar results were observed in the miRNA expression profiles were determined by a miRNA experiments involving IEC-6 cells (Fig. 2f, g). Taken microarray (GEO accession number: GSE83701). We together, these results indicate that miR-381-3p directly found that 57 miRNAs were up-regulated, and 74 miR- regulates nurr1 expression in the intestine. NAs were down-regulated (fold change ≥2, P < 0.05) in the I/R group compared with the sham group (Supple- miR-381-3p inhibition increases intestinal epithelial mentary Table 1). It is well known that miRNAs nega- proliferation and barrier function after H/R injury tively regulate the expression of specific genes by targeting We investigated the effect of miR-381-3p on intestinal their 3′-UTRs. Therefore, we used the miRNA prediction epithelial cells exposed to H/R injury and the involve- programs TargetScan (http://www.targetscan.org/) and ment of nurr1 signaling in this effect. miR-381-3p miRWalk (http://zmf.umm.uni-heidelberg.de/apps/zmf/ inhibition elevated Ki-67-labeled cell proliferation mirwalk) to determine that miR-381-3p, one of the 57 up- under H/R conditions (Fig. 3a). Consistently, miR-381- regulated miRNAs, targets nurr1. 3p inhibition also restored TEER value (Fig. 3b) and According to the bioinformatics analysis, the miR-381- attenuated the increases in FITC-dextran paracellular 3p binding sequences in the 3′-UTR of nurr1 are highly permeability (Fig. 3c) induced by H/R. Furthermore, conserved across several species, including humans, mice western blotting revealed that miR-381-3p inhibition and rats (Fig. 2a, Supplementary Figure 1). We used a ameliorated the nurr1 down-regulation and p21 up- dual-luciferase assay system to further validate that miR- regulation induced by H/R (Fig. 3d–f). Tight junction 381-3p targets the 3′-UTR of nurr1. As demonstrated in protein (occludin and ZO-1) expression was clearly Fig. 2b, the WT nurr1 3′-UTR exhibited low luciferase enhanced in the miR-381-3p inhibition group compared activity after miR-381-3p agomir (miR-381) transfection. with the negative control group under H/R conditions However, the mutated nurr1 3′-UTR abolished the inhi- (Fig. 3g, h). These data indicate that miR-381-3p inhi- bitory effect of miR-381 (Fig. 2c). We then explored bition increases intestinal epithelial proliferation and Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 5 of 14 Fig. 3 miR-381-3p inhibition promotes intestinal epithelial restoration after H/R injury. a Immunofluorescence staining for the Ki-67 antibody in IEC-6 cells for proliferation analysis. IEC-6 cells were infected with the ant-381 or the ant-NC for 36 h and then incubated under H/R conditions for 6/6 h, respectively. Scale bar = 100 μm, n = 6. b and c Caco-2 cells were transfected with the ant-381 or the ant-NC for 36 h and then exposed to hypoxic conditions for 12 h before being exposed to normoxic conditions for 6 h. b Effect of the ant-381 on TEER, n = 3. c Changes in FITC-dextran intestinal epithelial permeability in response to the ant-381, n = 3. d-h IEC-6 cells were infected with the ant-381 or the ant-NC for 36 h and then incubated under H/R conditions for 6/6 h, respectively. Representative western blot showing nurr1, p21, occludin, ZO-1 protein expression, n = 3. *P < 0.05, **P < 0.01. The error bars describe the standard deviation barrier function, and that the effect may be mediated by the knockdown of endogenous miR-381-3p restores epi- nurr1 signaling. thelial barrier function and improves survival rates in intestinal I/R injury. miR-381-3p knockdown improves intestinal epithelial restoration and survival after intestinal I/R injury in mice miR-381-3p inhibition improves epithelial proliferation To determine the role of miR-381-3p in the regulation and barrier function after intestinal I/R injury by targeting of the pathogenesis of intestinal I/R injury in vivo, we nurr1 knocked down miR-381-3p expression in mice using The above experiments showed that miR-381-3p inhi- LNA-381. As shown in Fig. 4a, LNA-381 dramatically bition improved intestinal epithelial restoration and up- attenuated the miR-381-3p up-regulation induced by regulated nurr1 expression. Thus, we explored whether intestinal I/R injury. Ki-67-labeled intestinal cell pro- nurr1 plays an important role in the protective effects of liferation was enforced in the presence of LNA-381 miR-381-3p inhibition. The ant-381 elevated Ki-67- (Fig. 4b, c). miR-381-3p knockdown reduced D-lactate labeled cell proliferation and TEER and inhibited FITC- levels (Fig. 4d) and FITC-dextran epithelial permeability dextran paracellular permeability after H/R (Fig. 5a–c, (Fig. 4e) to attenuate the effect of I/R on intestinal barrier groups 2 and 3). However, the protective effect of the ant- function. Intestinal histological injury was significantly 381 was abolished by the knockdown of nurr1 (Fig. 5a–c, mitigated after miR-381-3p silencing (Fig. 4f, g). Fur- groups 3 and 5). In addition, we also measured the thermore, LNA-381 preserved nurr1 expression and expression of p21, a downstream target of nurr1 ,to down-regulated p21 expression in mice subjected to explore the potential mechanisms underlying the effects intestinal I/R injury (Fig. 4h–j). Consequently, the of miR-318-3p inhibition. As anticipated, p21 levels were expression of the tight junction proteins occludin and markedly enhanced after H/R injury (Fig. 5f, groups 1 and ZO-1 was enhanced after treatment with LNA-381 2). The ant-381 up-regulated nurr1 expression and (Fig. 4k, l). In addition, we measured 24-h survival rates inhibited p21 expression (Fig. 5d–f, groups 2 and 3), to test the long-term protective effects of LNA-381 under whereas nurr1 silencing abolished the effect of the ant- I/R injury. As shown in Fig. 4m, the overall survival rate 381 on p21 expression under H/R conditions (Fig. 5f, was higher in the LNA-381 group than the LNA-NC groups 3 and 5). Additionally, the ant-381 preserved group. Collectively, these findings support the notion that occludin and ZO-1 expression after H/R; however, these Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 6 of 14 Fig. 4 miR-381-3p inhibition improves intestinal barrier restoration after I/R injury in mice. The mice were divided into the following four groups: a sham + LNA-NC group, a sham + LNA-381 group, an I/R + LNA-NC group, an I/R + LNA-381 group (n = 8 per group). LNA-381 or LNA-NC (2 mg/kg) was administered by caudal vein injection at 12 h before surgery. The I/R times were 45/240 min, respectively. a qRT-PCR showing miR-381- 3p expression, n = 8. b and c Immunohistochemical staining for the Ki-67 antibody in intestinal tissues for proliferation analysis. Scale bar = 50 μm, n = 6. d Serum D-lactate levels, n = 8. e FITC-dextran intestinal epithelial paracellular permeability, n = 8. f and g Representative images of H&E-stained intestinal sections of mice from the above four groups. Intestinal injury was scored histopathologically (Chiu’s score) according to a scoring system. Scale bar = 100 μm, n = 8. h-l Representative western blot showing nurr1, p21, occludin or ZO-1 protein expression in intestinal tissue, n = 3. m The survival rate of the mice, n = 15. *P < 0.05, **P < 0.01. The error bars describe the standard deviation Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 7 of 14 Fig. 5 miR-381-3p inhibition provides protective effects by targeting nurr1. a Immunofluorescence staining for the Ki-67 antibody in IEC-6 cells for proliferation analysis. IEC-6 cells were infected with si-Nurr1 or si-control, transfected with the ant-381 or the ant-NC, and then incubated in H/R conditions for 6/6 h, respectively. Scale bar = 100 μm, n = 6. b and c Caco-2 cells were co-transfected with ant-381, si-Nurr1 or the corresponding negative control, and then exposed to H/R conditions for 12/6 h, respectively. b Effect of the ant-381 on TEER, n = 3. c Effect of the ant-381 on FITC- dextran intestinal epithelial permeability, n = 3. d-h IEC-6 cells were co-transfected with ant-381, si-Nurr1 or the corresponding negative control, and then incubated in H/R for 6/6 h, respectively. Representative western blot showing nurr1, p21, occludin, ZO-1 protein expression, n = 3. *P < 0.05, **P < 0.01. The error bars describe the standard deviation effects were not observed in the nurr1-knockdown group results indicate that miR-381-3p knockdown amelio- (Fig. 5g, h). These findings suggest that miR-381-3p rates the remote hepatic and pulmonary damage inhibition exerts its protective effects on intestinal I/R induced by intestinal I/R. injury by modulating nurr1 expression. miR-381-3p, nurr1 and tight junction protein expression in miR-381-3p knockdown attenuates mesenteric I/R-induced the ischemic intestine of clinical patients remote organ injury To investigate the clinical relevance of miR-381-3p in Intestinal I/R is invariably followed by remote organ intestinal I/R injury, we measured the expression of miR- injury, which plays a critical role in prognosis . 381-3p and associated genes in ischemic intestinal tissues Therefore, liver and lung tissue injury was examined to and normal tissues from clinical patients. Intestinal evaluate the protective effect of miR-381-3p knockdown ischemia contributed to the elevation of miR-381-3p on remote organ injury. As illustrated in Fig. 6a–d, miR- expression (Fig. 7a) and the reduction of nurr1 expression 381-3p silencing clearly mitigated intestinal I/R-induced (Fig. 7c, d). Thus, miR-381-3p expression was inversely liver and lung histological injury. Intestinal I/R-induced correlated with nurr1 expression in ischemic gut tissue augmentations of ALT and AST levels were significantly (Fig. 7b). Furthermore, occludin and ZO-1 down-regula- reduced in LNA-381-pretreated mice compared with tion under ischemia suggested that miR-381-3p plays a LNA-NC-pretreated mice (Fig. 6e, f). Similarly, intest- role in regulating epithelial barrier function (Fig. 7c, d). inal I/R-induced lung neutrophilic infiltration (as Collectively, these findings support the idea that miR-381- demonstrated by MPO activity) was markedly atte- 3p modulates nurr1 signaling, thereby affecting intestinal nuated after LNA-381 administration (Fig. 6g). These ischemia injury in clinical patients. Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 8 of 14 Fig. 6 miR-381-3p inhibition attenuates intestinal I/R induced liver and lung injury. The mice were divided into the following four groups: a sham + LNA-NC group, a sham + LNA-381 group, an I/R + LNA-NC group, an I/R + LNA-381 group (n = 8). LNA-381 or LNA-NC (2 mg/kg) was injected via the caudal vein at 12 h before surgery. The I/R times were 45/240 min, respectively. a and b Representative images of H&E-stained hepatic sections from mice. Hepatic injury was scored histopathologically (Eckhoff’s score) according to a scoring system. Scale bar = 100 μm. c and d Representative images of H&E-stained lung sections from mice. Lung injury was scored histopathologically (Mikawa’s score) according to a scoring system. Scale bar = 100 μm. e Serum ALT levels. f Serum AST levels. g MPO activity in the lung. n = 8. *P < 0.05, **P < 0.01. The error bars describe the standard deviation Discussion epithelial barrier function attenuates intestinal I/R In this study, we identified a miRNA-regulated sig- injury. naling pathway that alleviates intestinal I/R injury. We Loss of intestinal barrier function caused by enterocyte made the following observations: (1) nurr1 regulated disruption or cell death is a particularly dangerous com- intestinal epithelial barrier function after intestinal I/R plication of intestinal I/R injury, as the complication may injury; (2) among the miRNAs differentially expressed lead to life-threatening bacterial translocation from the between ischemic and normal tissues, miR-381-3p gut, numerous secondary organ injuries, multi-system directly suppressed nurr1 translation; (3) miR-381-3p organ failure and death . Intestinal barrier repair is based inhibition ameliorated intestinal I/R injury in vitro and on the tight coordination of cell migration, proliferation in vivo, attenuated remote organ injury and improved and differentiation . Enterocytes migrate from the crypt survival; (4) miR-381-3p inhibition exerted protective base to villi while differentiating into enterocytes, goblet effects on intestinal I/R injury by targeting nurr1. To the cells and enteroendocrine cells during intestinal epithelial 27,28 best of our knowledge, this study showed for the first development . Cell proliferation within the crypt is the time that miRNA-mediated restoration of intestinal primary force driving cell migration along the villus . Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 9 of 14 Fig. 7 miR-381-3p, nurr1 and tight junction protein expression levels in the ischemic intestine of clinical patients. a qRT-PCR showing miR- 381-3p expression in normal and ischemic human intestines, n = 6. b The association between miR-381-3p expression and Nurr1 protein expression (r = 0.8052, p = 0.0153). c and d Representative western blot showing nurr1, p21, occludin or ZO-1 protein expression in the intestine, n = 3. *P < 0.05, **P < 0.01. The error bars describe the standard deviation Therefore, increased epithelial cell proliferation con- activator C-DIM12 significantly attenuated intestinal I/R 13,14 tributes to intestinal barrier restoration . We recently injury in mice, a change reflected by improvements in found that nurr1 promotes epithelial proliferation after intestinal histological injury, increases in tight junction intestinal I/R injury . In the current study, we found that protein expression and decreases in intestinal perme- nurr1 protein expression reached the valley value at 4 h ability. These data indicate that nurr1 mitigates intestinal after the onset of reperfusion. Concomitant decreases in I/R injury. We speculate that the different roles of nurr1 gut epithelial proliferation and barrier function were in I/R injury may be tissue type dependent. observed. Gain- and loss-of-function studies revealed that Recent reports have shown that miRNAs regulate key 33,34 nurr1 overexpression enhanced epithelial proliferation pathogenic events and affect intestinal I/R injury . and barrier function after I/R injury. However, However, few reports have examined whether miRNAs nurr1 silencing had the opposite effect. Thus, these data mitigate intestinal I/R injury by restoring epithelial barrier demonstrate that nurr1 improves epithelial barrier func- function. To thoroughly clarify the effects of miRNA on tion after intestinal I/R injury. epithelial barrier repair after intestinal I/R injury, we An increasing number of studies have shown that nurr1 utilized a miRNA microarray platform to identify 131 is involved in ischemia/reperfusion injury. Nurr1 mRNA miRNAs that are differentially expressed between the I/R is reportedly up-regulated during liver or kidney I/R group and the sham group. Based on our findings injury, indicating that nurr1 may be associated with the regarding the effects of nurr1 on intestinal barrier func- 30,31 aggravation of I/R injury . However, Hossmann et al. tion, we used bioinformatics analysis to determine miR- and our team suggested that nurr1 protein expression is 381-3p that can target nurr1. The miR-381-3p binding 12,32 down-regulated during stroke or intestinal I/R injury . sequences in the nurr1 3′-UTR are highly conserved In addition, we found that nurr1 mediated epithelial across various species. Gain-of-function and loss-of- proliferation in intestinal I/R injury . Here, the nurr1 function studies demonstrated that miR-381-3p directly Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 10 of 14 repressed nurr1 translation. We also showed that miR- down-regulated the expression of tight junction proteins 381-3p was involved in regulating gut barrier function suggested that miR-381-3p plays a crucial role in intest- after I/R. In vitro, miR-381-p inhibition enhanced intest- inal barrier function. To validate the regulatory role of inal epithelial proliferation and barrier function by up- miR-381-3p in clinical patients with intestinal ischemia, regulating nurr1 under H/R conditions. In vivo, LNA- we need to collect enough samples to analyze its function mediated miR-381-p knockdown prevented intestinal I/R in such patients. injury by improving epithelial proliferation and tightening In summary, we found that nurr1 enhanced intestinal the intestinal epithelium. In addition, our study demon- barrier function after intestinal I/R injury. Using micro- strated that nurr1-mediated p21 repression stimulates array and bioinformatics analysis, we found that miR-381- intestinal epithelial cell proliferation . p21 suppression 3p targets nurr1. Furthermore, our study demonstrated restores the barrier function of skin suffering from the that miR-381-3p inhibition improves epithelial prolifera- loss of Dicer function by regulating cellular proliferation tion and barrier function by targeting nurr1 signaling, and differentiation . In this study, p21 was significantly thereby reducing Intestinal I/R injury. This may provide a down-regulated when miR-381-3p was inhibited to pro- new miRNA-based strategy for the treatment of intestinal mote nurr1-mediated epithelial barrier function after I/R-related clinical conditions. intestinal I/R injury. These data suggest that miR-381-3p inhibition improves epithelial proliferation and barrier Materials and methods function by modulating the nurr1/p21 pathway, and then Murine model of intestinal I/R attenuates intestinal I/R injury. Young male C57BL/6 mice (aged 8 weeks) were pur- Intestinal I/R injury-induced MODS is a leading cause chased from the Animal Center of Dalian Medical Uni- 36,37 of death in critically ill ICU patients . As demonstrated versity (Dalian, China). The mice were housed in specific in this study, mesenteric I/R injury aggravates lung and pathogen-free conditions at a constant temperature (22 ± liver histopathological damage, as well as pulmonary 2 °C) and under a 12-h light/dark cycle. The mice were fed neutrophil infiltration and liver dysfunction. Interesting, standard food and water and were given 1 week to we found that miR-381-3p knockdown contributes to the acclimate to their environment before being used in the attenuation of lung and liver injury and improvements in study. The mice were randomly divided into the following survival after mesenteric I/R. These results suggest that four groups: a sham group, a sham + 1,1-bis(39-indolyl)- miR-381-3p is an important target for the treatment of 1-(p-chlorophenyl) methane (C-DIM12) group, an I/R intestinal I/R-induced MODS. group, and an I/R + C-DIM12 group. All mice were LNA oligonucleotides are conformational RNA analogs anesthetized via an intraperitoneal injection of pento- that have an unprecedented affinity for and bind specifi- barbital (50 mg/kg body weight). Midline laparotomy was cally to complementary RNA, leading to selective miRNA performed, and the superior mesenteric artery was iden- 38,39 silencing . A LNA-modified inhibitor of miR-122 tified, isolated and clamped. After 45 min of ischemia, the (Miravirsen) was used in phase 2 clinical trials of treat- vascular clamp was removed from the artery to allow ments for HCV infection and induced dose-dependent reperfusion. The mice used for the survival study were reductions in HCV RNA levels that endured beyond the anesthetized with buprenorphine (0.1 mg/kg, IP, every 40 43 end of active therapy . In this study, LNA-381 was 12 h) . Corn oil was used to dissolve C-DIM12 (Selleck, injected into C57 mice to specifically reduce miR-381-3p Houston, USA). C-DIM12 (50 mg/kg body weight) was expression in vivo without inducing hepatotoxicity. We administered by gavage at 4 h prior to surgery, in accor- observed that LNA-381 attenuated local intestinal damage dance with existing pharmacokinetic data . After 4 h of and remote organ injury and improved survival in mice reperfusion, intestinal tissue samples and blood samples subjected to mesenteric I/R. These findings support that were harvested for various experimental evaluations LNA-381 may be a therapeutic intervention for clinical required for this study. All procedures were performed in patients with intestinal I/R. accordance with the guidelines for the care and use of Previous studies have shown that miR-381-3p may be a medical laboratory animals. This study was approved by target for the treatment of patients with TB or HIV- the Institutional Ethics Committee of Dalian Medical 41,42 associated neurocognitive disorders . To determine University (Dalian, China). the clinical significance of miR-381-3p in patients with intestinal I/R injury, we measured the expression of miR- Cell culture and H/R 381-3p and associated proteins in ischemic intestinal tis- Caco2 cells and IEC-6 cells were obtained from Amer- sues and normal tissues from clinical patients. The inverse ican Type Culture Collection (Manassas, VA, USA) and relationship between miR-381-3p and nurr1 expression grown in Dulbecco's modified eagle medium supple- was confirmed through analysis of the intestinal tissue mented with 10% fetal bovine serum, 1% non-essential samples. In addition, the finding that intestinal ischemia amino acids and 1% glutamine. IEC-6 cells were also Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 11 of 14 Table 1 Sequences of antagomirs, agomirs, LNAs, siRNAs and primers Name Sequences (5′–3′) miR-381-3p antagomir (human) ACAGAGAGCUUGCCCUUGUAUA miR-381-3p antagomir (rat) AGAGCUUGCCCUUGUAUA antagomir negative control CAGUACUUUUGUGUAGUACAA miR-381-3p agomir (human) UAUACAAGGGCAAGCUCUCUGUAGAGAGCUUGCCCUUGUAUAUU agomir negative control UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT LNA-381 (mouse) GAGCUUGCCCUUGUAU LNA-NC (mouse) TACGTCTATACGCCCA nurr1 siRNA (human) GGCUUGUAAAUUUACCCAATTUUGGGUAAAUUUACAAGCCTT nurr1 siRNA (rat) CCUCACCAACACUGAAAUUttAAUUUCAGUGUUGGUGAGGtc siRNA negative control UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT nurr1 (human) ForwardReverse GGCCGGAGAGGTCGTTTGCCAGGGTTCGCCTGGAACCTGGA nurr1 (rat) ForwardReverse GGGCTCAAGGAACCCAAGAGGCAAAGGGTGCGAAGTTCTG treated with 0.1 unit/ml bovine insulin. The cultures were miRCURY™ Hy3™/Hy5™ Power labeling kit and hybridized maintained at 37 °C in a humidified atmosphere of 5% on a miRCURYTM LNA Array station. Scanning was CO . To induce hypoxia, we incubated the Caco2 and performed with an Axon GenePix 4000B microarray IEC-6 cells in a microaerophilic system (Thermo, Wal- scanner (Axon Instruments, Foster City, CA). Scanned tham, MA) containing 1% O and 5% CO balanced with images were then imported into GenePix Pro 6.0 software 2 2 94% N gas for 12 h and 6 h, respectively. The cells were (Axon) for grid alignment and data extraction. Replicated then reoxygenated under normoxic conditions for 6 h. miRNAs were averaged and miRNAs that intensities ≥30 in all samples were chosen for calculating normalization Transfection of pcDNA-Nurr1, small interfering RNA factor. Expressed data were normalized using the Median (siRNA), agomirs and antagomirs normalization. Discriminant miRNAs and differences Plasmids encoding nurr1 were used to over-express the between groups were analyzed using Bayes moderated t- protein. We previously described a siRNA that targets test (limma) with Benjamini Hochberg false discovery rate nurr1. A nonspecific scrambled siRNA duplex was used as at P < 0.05, unless otherwise specified. A two-fold cut-off a control. A chemically modified antagomir com- was applied to select up-regulated and down-regulated plementary to miR-381-3p was used to inhibit miR-381- miRNAs. 3p expression, while an agomir was used to increase miR- 381-3p expression. The plasmids, siRNAs, agomirs, Luciferase activity assay antagomirs and corresponding negative control oligonu- Plasmids containing the wild-type miR-381-3p 3′- cleotides were purchased from GenePharma (Shanghai, untranslated region (3′-UTR-WT) or the corresponding China). The sequences of the oligonucleotides are shown mutant sequence (3′-UTR-mut) were purchased from in Table 1. The cells were transfected with the oligonu- GenePharma. Plasmid DNA and ago-381 or ago-NC were cleotides using Lipofectamine 3000, according to the co-transfected into cells seeded in 24-well plates using manufacturer’s protocols. Lipofectamine 3000. The Caco-2 cells were evaluated with the Dual-Luciferase Reporter Assay Kit (TransGen, Beij- miRNAs microarray analysis ing, China) after 36 h of transfection. Luciferase activity The microarray analysis for miRNA profiling was con- was measured using a Dual-Light Chemiluminescent ducted by the miRCURY LNA Array system (Exiqon, Reporter Gene Assay System (Berthold, Germany) nor- Vedbaek, Denmark). The total RNA was extracted from malized to Renilla luciferase activity. intestinal samples of mice subjected to intestinal I/R or sham surgery using Trizol (Invitrogen) according to the Immunofluorescence instructions provided by the manufacturer. The quality IEC-6 cells were seeded on chamber-slides, fixed in ice- and quantity of RNA samples were assessed by using cold 4% paraformaldehyde for 15 min, permeabilized nanodrop spectrophotometer (ND-1000, Nanodrop using 0.1% Triton X-100 for 10 min and then blocked Technologies). RNA samples were labeled with an Exiqon with 3% BSA in PBS for 1 h at 37 °C. The cells were Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 12 of 14 subsequently incubated with Ki-67 (1:200 Abcam, UK) Aldrich, USA) fluorescence intensity. We used Caco-2 cells antibodies overnight at 4 °C, after which they were incu- instead of IEC-6 cells because IEC-6 cells are unable to bated with Alexa flour 594 secondary antibodies (Invi- form a tight monolayer . We added 1.0 mg/ml FD-4 to the trogen Life Technologies, Carlsbad, CA, USA) for 1h at apical side of each monolayer after H/R injury, after which room temperature and treated with DAPI (1 μg/μl for 10 a100-μl sample was taken from the basolateral chamber min) at room temperature to stain the nuclei. The and assayed for fluorescence using an Enspire2300 resulting immunofluorescence was examined using an microplate reader (excitation, 480 nm; emission, 520 nm). Olympus fluorescence microscope. Two-hundred microliters of PBS containing 25 mg/ml FD- 4 was gavaged orally during ischemia, as described in a Transepithelial electrical resistance (TEER) assay previous study. The 100-μl blood sample was collected To assess intestinal barrier function in vitro, we used 24- after the reperfusion period .The fluorescence intensity of well transwell system plates (0.4-µm pore size, Costar each sample was measured with an Enspire2300 microplate Incorporated Corning, NY) to perform TEER assay, as reader (excitation, 480 nm; emission, 520 nm). described previously . Because IEC-6 cells rarely form a tight monolayer, we used Caco-2 cells to study intestinal Real-time PCR 45,46 barrier function by TEER assay . Briefly, 0.3 ml of Caco- miRNA was isolated from the cells with TRIzol (Takara, 2 cells were seeded in the upper chamber of the transwell Dalian, China). We detected miR-381-3p with a Bulge- system at a density of 1 × 10 cells/ml. The apical one Loop miRNA qRT-PCR Primer Set (Ribobio Co.), bathed in the basal chamber with 0.7 ml medium for according to the manufacturer’s instructions. The 20 days. TEER was measured daily by an epithelial volt expression levels of the miRNA were normalized to those ohmmeter (WPI, Sarasota, FL, USA). The medium was of U6 snRNAs, which served as an endogenous control. refreshed every day. The Caco-2 cells were transfected with Total RNA was extracted by TRIzol reagent and reversed antagomirs or siRNA during a steady monolayer state. transcribed with a Transcript All-in-one SuperMix for TEER was calculated by the following formula: TEER= qPCR Kit (TransGen, Beijing, China). Nurr1 mRNA (R1− R0) × A Ω cm , where R1 is the background resis- expression was quantified using a SYBR Real-time PCR tance, R0 is the collagen layer and membrane insert Kit (TransGen, Beijing, China). Specific primers were resistance, and A is the insert membrane area. The mean produced by Invitrogen (Ribobio Co.). The sequences of TEER was calculated using data from three experiments. the primers are listed in Table 1. Nurr1 mRNA levels were normalized to β-actin mRNA levels. In vivo knockdown of miR-381-3p To inhibit miR-381-3p expression in vivo, we injected Western blotting mice with 2 mg/kg locked nucleic acid-modified antisense Intestinal tissue and cell protein were extracted oligonucleotides targeting miR-381-3p (LNA-381) or LNA- according to the manufacturer’s instructions (KeyGEN NC oligonucleotides via the tail vein at 12 h before ische- Biotech, Nanjing, China). Western blotting was per- mia. The LNA oligonucleotides were obtained from Exiqon formed with primary antibodies against nurr1, p21 Vedbaek, Denmark. Their sequences are shown in Table 1. (Abcam, Cambridge, UK), ZO-1, occludin (Proteintech, Wuhan, China), and β-actin (ZSGB-BIO, Beijing, China) Histopathology and immunohistochemistry and horseradish peroxidase (HRP)-conjugated secondary To evaluate intestinal, hepatic and pulmonary injury antibodies (ZSGB-BIO, Beijing, China). Protein levels after intestinal I/R, we divided paraffin-embedded tissue were analyzed using Gel-Pro Analyzer Version 4.0 (Media samples into 4-μm sections, which we stained with Cybernetics, MD, USA). hematoxylin and eosin (H&E). The intestinal, hepatic and pulmonary pathological scores were graded based on D-lactate, ALT, AST and MPO activity assays 47 48 49 Chiu, Eckhoff and Mikawa, respectively. Mouse Serum D-lactate content was assayed using an enzyme- small intestinal tissue sections were blocked with 5% goat linked immunosorbent assay kit (J&L Biological, Shang- serum, after which they were incubated with anti-Ki-67 hai, China), according to the manufacturer’s instructions. antibodies overnight at 4 °C. An ABC kit and DAB sub- Pulmonary MPO activity levels and serum ALT and AST strates were used for Ki-67. The sections were then levels were measured using commercial assay kits (Nanj- counterstained by hematoxylin. The IHC results were ing Jiancheng Corp, Nanjing, China), according to the examined using a fluorescence microscope. manufacturer’s protocols. Intestinal permeability assay Acquisition of clinical specimens Intestinal barrier permeability was measured by 4.4-kDa The collection and use of human intestinal samples fluorescein isothiocyanate FITC-dextran (FD4, Sigma- were approved by the local ethics committee at Dalian Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 13 of 14 Medical University. Patient intestinal samples were 3. Stone, J. R. & Wilkins, L. R. Acute mesenteric ischemia. Tech. Vasc. Interv. Radiol. 18,24–30 (2015). obtained after the patients provided informed written 4. Gibot, S. et al. Effects of the TREM-1 pathway modulation during mesenteric consent. Ischemic gut segments, which were assigned to ischemia-reperfusion in rats. Crit. Care Med. 36,504–510 (2008). the model group, and the margins of the resected gut 5. Jin, X.,Zimmers,T. A., Zhang, Z.,Pierce, R. H. & Koniaris, L. G. Interleukin-6 is an important in vivo inhibitor of intestinal epithelial cell death in mice. Gut 59, segments, which were assigned to the control group, were 186–196 (2010). obtained from patients who underwent surgery for acute 6. Kannan, L. et al. R-spondin3 prevents mesenteric ischemia/reperfusion- superior mesenteric artery emboli or intestinal hernia induced tissue damage by tightening endothelium and preventing vascular leakage. Proc. Natl. Acad. Sci. USA 110, 14348–14353 (2013). strangulation in the Department of Acute Abdominal 7. Meckel, K. et al. Serum 25-hydroxyvitamin D concentration is inversely asso- Surgery of the Second Affiliated Hospital of Dalian ciated with mucosal inflammation in patients with ulcerative colitis. Am. J. Clin. Medical University. The intestinal samples were imme- Nutr. 104,113–120 (2016). 8. Klepsch, V. et al. Nuclear orphan receptor NR2F6 as a safeguard against diately frozen in liquid nitrogen and stored at −80 °C until experimental murine colitis. Gut [Epub ahead of print] https://doi.org/10.1136/ analysis. gutjnl-2017-314241 (2017). 9. Gadaleta, R. M. et al. Farnesoid X receptor activation inhibits inflammation and preserves the intestinal barrier in inflammatory bowel disease. Gut 60, Statistical analysis 463–472 (2011). All values are expressed as the mean ± SD. Data with 10. Chen, P. et al. Adenovirus-mediated expression of orphan nuclear receptor normal distributions were compared using one-way ana- NR4A2 targeting hepatic stellate cell attenuates liver fibrosis in rats. Sci. Rep. 6, 33593 (2016). lysis of variance followed by the Student–Newman–Keuls 11. Llopis, S. et al. Dichotomous roles for the orphan nuclear receptor NURR1 in test. The survival study results were analyzed using the breast cancer. BMC Cancer 13, 139 (2013). Kaplan–Meier method. A two-tailed Student’s t-test was 12. Guo, Z. et al. Nurr1 promotes intestinal regeneration after ischemia/reperfu- sion injury by inhibiting the expression ofp21 (Waf1/Cip1). J. Mol. Med. 95, used to compare means between two groups. At least 1–13 (2016). three independent experiments were performed to con- 13. Shim, S. et al. Rebamipide ameliorates radiation-induced intestinal injury in a firm the results. Statistical analysis was performed using mouse model. Toxicol. Appl. Pharmacol. 329,40–47 (2017). 14. Nan, X. et al. Hsa-miRNA-31 regulates epithelial cell barrier function by GraphPad Prism 5.0 (GraphPad Prism Software, La Jolla, inhibiting TNFSF15 expression. Cell Mol. Biol. (Noisy-Le.-Grand.) 62, CA, USA). P < 0.05 was considered statistically significant. 104–110 (2016). 15. Yan,W., Chen,Z.Y., Chen,J.Q.& Chen,H. M. BMP2promotes the differ- Acknowledgements entiation of neural stem cells into dopaminergic neurons in vitro via miR-145- This work was supported by the National Natural Science Foundation of China mediated upregulation of Nurr1 expression. Am. J. Transl. Res. 8,3689–3699 (grant numbers 81671954 and 81372037). (2016). 16. Yang, D. et al. miR-132 regulates the differentiation of dopamine neu- Author details rons by directly targeting Nurr1 expression. J. Cell Sci. 125,1673–1682 Department of General Surgery, The Second Affiliated Hospital of Dalian (2012). Medical University, Dalian 116023, China. Department of Pharmacology, 17. Wu, S. et al. MicroRNA-132 promotes estradiol synthesis in ovarian granulosa Dalian Medical University, Dalian 116044, China cells via translational repression of Nurr1. Reprod. Biol. Endocrinol. 13, 94 (2015). 18. Bartel, D. P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215–233 (2009). Author contributions 19. Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing. Nature X.T., L.L., and J.Y. designed this research. L.L., D.F., Z.L., Y.L., and W.Q. performed 425,415–419 (2003). the research. L.L., G.Z., S.Z., T.L., H.Z., and J.Y. analyzed the data. X.T. and L.L. 20. Lesizza, P. et al. Single-dose intracardiac Injection of pro-regenerative Micro- wrote and revised the paper. X.T. provided financial support. All authors RNAs improves cardiac function after myocardial infarction. Circ. Res. 116, reviewed and approved the manuscript. 309589–1304 (2017). 21. Yang, J.,Zhang,X., Chen,X., Lei, W. & Yang, G. Exosome mediated delivery of Conflict of interest miR-124 promotes neurogenesis after ischemia. Mol. Ther. Nucleic Acids 7, The authors declare that they have no conflict of interest. 278–287 (2017). 22. Enright,A.J.etal. MicroRNA targetsinDrosophila. Genome. Biol. 5, R1 (2003). 23. Dweep,H., Sticht,C., Pandey, P.&Gretz, N. miRWalk-Database: predictionof Publisher's note possible miRNA binding sites by “walking” the genes of three genomes. J. Springer Nature remains neutral with regard to jurisdictional claims in Biomed. Inform. 44, 839–847 (2011). published maps and institutional affiliations. 24. Moraes, L. B. et al. Gut ischemia/reperfusion induced acute lung injury is an alveolar macrophage dependent event. J. Trauma 64, 1200–1201 (2008). Supplementary Information accompanies this paper at https://doi.org/ 25. Kannan, K. B. et al. Hypoxia-inducible factor plays a gut-injurious role in 10.1038/s41419-018-0450-z. intestinal ischemia reperfusion injury. Am. J. Physiol. Gastrointest. Liver Physiol. 300, G853 (2011). Received: 8 November 2017 Revised: 2 February 2018 Accepted: 14 26. Iizuka, M. & Konno, S. Wound healing of intestinal epithelial cells. World J. February 2018 Gastroenterol. 17, 2161–2171 (2011). 27. Sun,X., Yang,Q., Rogers,C.J., Du, M. & Zhu, M. J. AMPK improves gut epithelial differentiation and barrier function via regulating Cdx2 expression. Cell Death Differ. 24,819–831 (2017). 28. Clevers, H. & Batlle, E. SnapShot: the intestinal crypt. Cell 152,1198–1198.e2 References (2013). 1. Kong,S. E., Blennerhassett, L.R., Heel,K.A., Mccauley,R. D. & Hall, J. C. 29. Parker, A. et al. Cell proliferation within small intestinal crypts is the principal Ischaemia‐reperfusion injury to the intestine. Aust. N.Z.J.Surg. 68, 554 (1998). driving force for cell migration on villi. FASEB J. 31,636–649 (2017). 2. Acosta,S.&Björck,M.Moderntreatment of acute mesenteric ischaemia. Br. J. 30. Ohkubo, T. et al. Early induction of nerve growth factor-induced genes after Surg. 101,e100–e108 (2014). liver resection–reperfusion injury. J. Hepatol. 36,210–217 (2002). Official journal of the Cell Death Differentiation Association Liu et al. Cell Death and Disease (2018) 9:411 Page 14 of 14 31. Balasubramanian, S., Jansen, M., Valerius, M. T., Humphreys, B. D. & Strom, T. B. 42. Xu, Z. et al. MicroRNAs upregulated during HIV infection target peroxisome Orphan nuclear receptor Nur77 promotes acute kidney injury and renal epi- biogenesis factors: Implications for virus biology, disease mechanisms and thelial apoptosis. J. Am.Soc.Nephrol. 23,674–686 (2012). neuropathology. PLoS. Pathog. 13, e1006360 (2017). 13. 32. Erdö, F., Trapp, T., Mies, G. & Hossmann, K.-A. Immunohistochemical analysis of 43. Ban, K., Peng, Z. & Kozar, R. A. Inhibition of ERK1/2 worsens intestinal ischemia/ protein expression after middle cerebral artery occlusion in mice. Acta Neu- reperfusion injury. PLoS One 8, e76790–e76790 (2013). 8. ropathol. 107,127–136 (2004). 44. De Miranda, B. R. et al. Neuroprotective efficacy and pharmacokinetic 33. Zhang, N. et al. SIRT1 promotes metastasis of human osteosarcoma cells. behavior of novel anti-inflammatory para-phenyl substituted diindo- Oncotarget 7, 79654–79669 (2016). lylmethanes in a mouse model of Parkinson’s disease. J. Pharmacol. Exp. 34. Liu, Z. et al. MicroRNA-682-mediated downregulation of PTEN in intestinal Ther. 345, 125 (2013). epithelial cells ameliorates intestinal ischemia-reperfusion injury. Cell Death & 45. Li, Y. et al. 6-Gingerol protects intestinal barrier from ischemia/reperfusion- Dis. 7, e2210 (2016). 7. induced damage via inhibition of p38 MAPK to NF-κB signalling. Pharmacol. 35. Ghatak, S. et al. Barrier function of the repaired skin is disrupted following Res. 119,137–148 (2017). arrest of dicer in keratinocytes. Mol. Ther. J. Am. Soc. Gene Ther. 23,1201–1210 46. Tovah, W., Baier, S. R. & Janos, Z. The intestinal transport of bovine milk (2015). exosomes is mediated by endocytosis in human colon carcinoma 36. Ware, L. B. & Matthay, M. A. The acute respiratory distress syndrome—NEJM. Caco-2 cells and rat small intestinal IEC-6 cells. J. Nutr. 145, 2201–2206 JAMA J. Am.Med.Assoc. 307, 2542 (2000). (2015). 37. Schwarz, B. et al. [Intestinal ischemic reperfusion syndrome: pathophysiology, 47. Chiu, C. J.,Mcardle,A.H., Brown, R.,Scott, H.J. & Gurd,F.N.Intestinalmucosal clinical significance, therapy]. Wien. Klin. Wochenschr. 111,539–548 (1999). lesion in low-flow states: I. A morphological, hemodynamic, and metabolic 38. Stenvang, J., Silahtaroglu, A. N., Lindow, M., Elmen, J. & Kauppinen, S. The utility reappraisal. Arch. Surg. 101, 478–483 (1970). of LNA in microRNA-based cancer diagnostics and therapeutics. Semin. Cancer 48. Eckhoff, D. E., Bilbao,G., Frenette,L., Thompson,J.A.&Contreras, J. L. 17-Beta- Biol. 18,89–102 (2008). estradiol protects the liver against warm ischemia/reperfusion injury and is 39. Fluiter, K. et al. In vivo tumor growth inhibition and biodistribution studies of associated with increased serum nitric oxide and decreased tumor necrosis locked nucleic acid (LNA) antisense oligonucleotides. Nucleic Acids Res. 31, factor-alpha. Surgery 132,302–309 (2002). 953–962 (2003). 49. Mikawa, K., Nishina, K., Takao, Y. & Obara, H. ONO-1714, a nitric oxide synthase 40. Janssen,H.L.etal. TreatmentofHCV infectionbytargeting microRNA. New inhibitor, attenuates endotoxin-induced acute lung injury in rabbits. Anesth. Engl.J.Med. 368, 1685–1694 (2013). Analg. 97, 1751–1755 (2003). 41. Wen, Q. et al. MiR-381-3p regulates the antigen-presenting capability of 50. Chassin, C. et al. MicroRNA-146a-mediated downregulation of IRAK1 protects dendritic cells and represses antituberculosis cellular immune responses by mouse and human small intestine against ischemia/reperfusion injury. EMBO targeting CD1c. J. Immunol. 197, 580–589 (2016). Mol. Med. 4, 1308–1319 (2012). Official journal of the Cell Death Differentiation Association

Journal

Cell Death & Disease – Springer Journals

Published: Mar 14, 2018

There are no references for this article.