Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin

Method for improving the quality of genomic DNA obtained from minute quantities of tissue and... Background: Although genomic DNA isolation using the Chelex 100 resin is rapid and inexpensive, the DNA obtained by this method has a low concentration in solution and contains suspended impurities. The presence of debris in the DNA solution may result in degradation of DNA on long term storage and inhibition of the polymerase chain reaction. In order to remove impurities and concentrate the DNA in solution, we have introduced modifications in the existing DNA isolation protocol using Chelex-100. We used ammonium acetate to precipitate proteins and a sodium acetate- isopropanol mixture to pellet out DNA which was washed with ethanol. Results: A pure DNA pellet that can be dissolved in water or Tris-EDTA buffer and stored for a long time at − 80 °C was obtained. We also observed a 20-fold change in the DNA concentration following precipitation and re-dissolution. Conclusion: Our method is different from other extraction methods since it uses non-toxic, easily available and inexpensive reagents as well as minimal amounts of blood or tissue samples for the DNA extraction process. Besides its use in sex determination and genotyping in lab animals as described in this paper, it may also have applications in forensic science and diagnostics such as the easy detection of pathogenic DNA in blood. Keywords: DNA Isolation, Genomic DNA, Chelex 100, Zebra finches, House crows Background A major drawback, common to all these methods, is Genomic DNA finds diverse applications in the study of the requirement of large quantities of biological samples mutations, genome structures, DNA fingerprinting and for DNA extraction. To obtain ample amounts of gen- in the creation of genomic libraries. The varied usage of etic material for PCR reactions from trace quantities of genomic DNA has brought multiple DNA extraction biological samples, Singer-Sam [6] suggested the use of methods into existence. Some of the widely used DNA an ion-exchanging resin (Chelex 100) for the DNA extraction methods include chloroform-based extraction extraction process. Chelex 100 (Bio-Rad Laboratories, [1], silica-based extraction (QIAmp DNA mini kit, CA, USA) is a styrene-divinylbenzene copolymer con- Qiagen), [2] and magnetic separation [3–5]. Whereas taining paired iminodiacetate ions. It acts by chelating chloroform-based DNA extraction requires the use of transition metal ions, the selectivity of which depends toxic chemicals, magnetic separation and silica-based upon iminodiacetic acid. The cation exchanging ability DNA extraction tend to be expensive. of the resin is functional at neutral or weakly acidic pH (> 4.0). At very low pH, the resin begins to function as an anion exchanger. Hence, Chelex is categorized as a weakly acidic cation exchanger with high affinity for * Correspondence: soumya@nbrc.ac.in Equal contributors divalent metal ions. Division of Systems Neuroscience, National Brain Research Centre, Deemed The first protocol for DNA extraction using Chelex University, Gurugram, Haryana, India 100 was developed by Walsh et al. [7]. This method, Professor, Systems Neuroscience, National Brain Research Centre, NH-8, Manesar, Gurgaon, Haryana 122051, India © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Singh et al. Biological Procedures Online (2018) 20:12 Page 2 of 8 which has found application mostly in forensics, involves and quantity, this protocol also ensures the purity of heat denaturation of cells which may be attached to DNA obtained without the use of toxic or expensive paper or fabric, in a solution containing Chelex 100 chemicals. The DNA obtained by our protocol may resin. High temperatures result in the release of DNA find application in the detection of single nucleotide into the solution as well as facilitate the binding of Chelex polymorphisms (SNPs), which may further be utilised resin to magnesium ions. Magnesium ions serve as for genotypic screening and also in the targeted se- cofactors to deoxyribonucleases and aid in their activation. quencing of specific genes in order to study their role Since magnesium ions are rendered unavailable to bind to in a particular phenotype. deoxyribonucleases, DNA degradation is averted. After this protocol was established, the Chelex 100 resin became the Methods method of choice for protocols requiring the rapid extrac- Reagents tion of DNA from trace amounts of biological samples. Chelex 100 Resin (BioRad, Cat no #142–1253), Tris We needed to determine the sex of zebra finches Buffer GR (Merck, 61,771,405,001,730), EDTA (Sigma- (Taeniopygia guttata) and house crows (Corvus splendens) Aldrich, E9884-500G), Ammonium acetate (Merck, , for some of the experiments in our lab. In order to per- 61,750,105,001,046), Sodium acetate (Qualigens, 15,955), form PCR reactions for avian sex chromosomes Z- and Isopropanol (Sigma-Aldrich, I9516-500ML), Ethanol W- [8, 9], we isolated genomic DNA from blood and tis- (Merck, K45420483412). sue samples of these birds. However, even after multiple iterations of the standard Chelex protocol [7, 9], we found that on an average, the 260/230 ratio for DNA was 0.4 Buffers and the concentration of DNA was 40 ng/μl. We also 1 M Tris solution (pH 8.0), 0.5 M EDTA (pH 8.0), 10X found that the DNA extract was impure and pigmented TE (Tris EDTA) Buffer (pH 8.0), 5% Chelex suspension due to suspended cellular debris. (pH 8.0, to be prepared in 1X TE buffer), 7.5 M Ammo- Earlier studies have shown that organic debris in the nium acetate, 3 M Sodium acetate, 10 N NaOH (for pH form of proteins, for example, haemoglobin in blood and adjustment, to be made in autoclaved deionized water), other compounds such as lactoferrin, IgG, and myoglo- 50X Tris Acetate EDTA buffer (TAE buffer, pH 8.6), 5× bin are known to inhibit polymerase activity during PCR Tris Borate EDTA buffer (TBE buffer pH 8.3), 30% reactions [10]. Long term storage of impure DNA sam- Acrylamide Bis Acrylamide solution (Table 1). ples may also lead to the binding of these compounds to the DNA double helix, which may result in the inhib- ition of the PCR reaction. To purify and concentrate the Blood and tissue sample preparation DNA further, we introduced modifications in the exist- All experiments conducted on birds (zebra finches, n =5; ing Chelex protocol that involved removal of proteins Indian house crows, n = 5) as well as trans-cardiac perfu- and cellular debris as well as precipitation, washing and sion with fixatives at the end of terminal experiments resuspension of DNA. When compared to results ob- following an overdose of the anaesthetic ketamine were tained using the protocol described by Soderstrom [9], approved by the Institutional Animal Ethics Committee at our modified Chelex-based method yielded a 6.3-fold the National Brain Research Centre, Manesar, which are increase in quality (260 and 230 nm ratio of 2.35 com- in accordance with regulations provided by the Commit- pared to a median value of 0.375 using the old protocol). tee for the Purpose of Control and Supervision of Experi- Our method also yielded an approximately 20-fold in- ments on Animals, India. Approximately 5 μlof blood crease in the quantity of DNA (275.25 ng/μl versus a me- was adsorbed onto a disc of Whatman filter paper (No. dian value of 13.2 ng/μl using the earlier protocol) for the 1001917) created by using a sterile paper punch (radius, same amount of the sample. In the present study, we re- 4 mm; thickness, 180 μm). The discs were then left to dry port in detail a method of isolation of genomic DNA from in a hood equipped with laminar flow for 30 min. In order liver tissue samples and the quality and quantity of DNA to assess the smallest quantity of blood or tissue sample thus obtained, using the Chelex resin. Additionally, we that was required to obtain an ample DNA yield for a have also tried to quantify the minimum amount of tissue PCR reaction, we used two, one, half and one-fourth of a samples required to obtain a good yield of genomic DNA. Whatman filter paper disc and subjected them to our A major drawback of DNA extraction using Chelex modified Chelex 100 DNA extraction protocol. The discs resin is the contaminated DNA extract obtained at were separated to prevent them from sticking to each the end of the procedure. The method that we other after drying. For tissue, samples weighing 7 mg, present here ensures the purification of the extract 9 mg and 11 mg were excised from crow liver and slightly and minimal loss of the quantity of DNA from mi- macerated with a pair of forceps, after which they were nute samples. Hence, along with specifying the quality placed in Eppendorf tubes for further processing. Singh et al. Biological Procedures Online (2018) 20:12 Page 3 of 8 Table 1 Recipes for Buffers used for the Protocol solution was 2.5 M [11, 12]. A thick yellowish-white pre- cipitate of protein appeared immediately after adding am- Components Volume monium acetate. This solution was allowed to rest for 50X TAE Buffer (500 ml) 5 min on ice. The sample was vortexed for 5 s and protein Tris Buffer GR 121 g was pelleted out by centrifugation at 12000 rpm for EDTA Stock (0.5 M) 50 ml 10 min at room temperature, after which the clear super- Glacial Acetic Acid 28.55 ml natant containing genomic DNA was collected. 5× TBE Buffer (1 l, pH 8.3) DNA precipitation Tris Buffer GR 54 g Sodium acetate stock (3 M) was added to the super- natant obtained after protein precipitation so that the Boric Acid 27.5 g working concentration of sodium acetate was 0.3 M in EDTA Stock (0.5 M) 20 ml solution. This was followed by the addition of 200 μlof ice cold ethanol. The solution was vortexed for 5 s and 30% Acrylamide (25 ml) allowed to stand for 4 h at − 30 °C for the DNA to pre- Acrylamide 7.3 g cipitate after which the samples were centrifuged at Bis-acrylamide 0.2 g 15000 g for 1 h at 4 °C. The supernatant was discarded and the pellet was washed twice with 75% ice cold etha- 8% Polyacrylamide Gel nol. Each wash step was followed by centrifugation at 30% Acrylamide 2.620 ml 15000 rpm for 10 min at 4 °C. This was followed by a 5x TBE Buffer 1.97 ml final wash with 100% ice cold isopropanol, after which Autoclaved Milli Q water 5.24 ml the wash solution was removed and the pellet was left to 10% Ammonium 163 μl air dry in a laminar flow hood. After 7 to 10 min of Persulfate drying, 10 μl of deionized water or 1X TE was added to TEMED 8 μl the pellet and it was incubated at 55 °C for 10 min to facilitate solubilisation. The quality and quantity of DNA Total 10 ml were measured using a NanoDrop. EtBr (for staining) 0.5 μg/ml in 1X TBE 10X TE Buffer (pH 8.0) PCR reaction Tris Buffer 1 ml (Stock 1 M; Final concentration 100 mM) We used four different primer pairs, three pairs were EDTA 200 μl (Stock 1 M; Final concentration 10 mM) targeted against avian sex chromosomes Z1 (forward: GTGTAGTCCGCTGCTTTTGG), Z2 (reverse: GTTC Autoclaved Milli Q water 8.8 ml GTGGTCTTCCACGTTT), W1(forward: GGGTTTT GACTGACTAACTGAT), W2 (reverse: GTTCAAAGC Chelex Isolation protocol TACATGAATAAACA) [9], P2 (TCTGCATCGCTAAAT Chelex solution (200 μl of 5% stock) was added to 1.5 ml CCTTT), P8 (CTCCCAAGGATGAGRAAYTG) [8], and Eppendorf tubes. These tubes were heated at 100 °C for one pair was used for amplification of the δ-Opioid 10 min in a boiling water bath. Whatman paper discs with Receptor gene, δ-OR (forward: TTCAACCTGGCTC blood samples or the liver tissue samples were then added TGGCTGATG), δ-OR (reverse: GTCAATAGAGAGCA to the hot Chelex solution. The Chelex suspension along CAACCTTGC) in extracted DNA samples from males with the paper disc or tissue samples was further heated and females of both species. for 8 min, vortexed and again heated for 7 min. The Amongst different species, male birds possess homo- Eppendorf tubes were centrifuged at 12000 g for one and morphic sex chromosomes, that is, they are arranged as a half minutes at room temperature. The supernatant was ZZ, whereas females are heteromorphic and have a ZW pipetted out gently to avoid extracting the Chelex resin as chromosomal arrangement. As a result, the PCR prod- well. The yield and quality of DNA in each sample of the ucts from zebra finch blood samples appeared as a single supernatant was measured using a spectrophotometer band in case of males at 242 bp and for female sex chro- [Nanodrop 1000 (ND 1000 V3.8.1, Thermo Fisher)]. mosomes at 242 bp and 179 bp using Z1/Z2 and W1/ W2 primer pairs (Fig. 1a; agarose and Fig. 1b; polyacryl- Protein precipitation amide gel, performed on separate sets of blood samples A 7.5 M stock solution of Ammonium Acetate was added for proper visualization of band separation for the to the supernatant collected after Chelex extraction, so female PCR product). For crow tissue samples, the PCR that the working concentration of ammonium acetate in products appeared as a single band in case of males at Singh et al. Biological Procedures Online (2018) 20:12 Page 4 of 8 Fig. 1 Gel electrophoresis following PCR for zebra finch blood samples. Single bands were obtained for a male at 242 bp and double bands at 242 and 179 bp for a female performed using (a) 2% agarose gel and (b) 8% polyacrylamide gel respectively; each lane beginning from the marker to the edge of the gel represents double, single, half and one fourth Whatman filter paper disc respectively for both male and female sample. Separate sets of samples were run on agarose and polyacrylamide gels respectively, to demonstrate better band separation of the PCR product obtained from female zebra finch genomic DNA sample by using the latter electrophoresis method. c PCR products from crow tissue samples showing a single band at 390 bp for ZZ chromosomes of males and double bands at 390 and 460 bp for Z and W chromosomes for females. d A single band was obtained for the delta opioid receptor gene at 120 bp for both male and female zebra finches 390 bp and double bands in case of females at 390 bp Gel Electrophoresis and 460 bp using the P2/P8 primer pair (Fig. 1c). Using Gel electrophoresis was performed using 2% agarose zebra finch blood samples for detecting the delta opioid gels, but the resolution between Z and W bands for the receptor gene, we found a sharp band at 120 bp in zebra crow samples was very poor. To improve the band reso- finch DNA samples (Fig. 1d). Zebra finch genomic DNA lution, electrophoresis was repeated using 8% polyacryl- samples were amplified for sex identification using Z1 amide gels, which were stained with ethidium bromide Z2 and W1 W2 primers beginning with denaturation at (Table 1). Images were acquired using a Syngene Gel 94 °C for 15 min followed by 30 cycles of 94 °C for 30 s, Doc (G:Box, Syngene; Gene Sys software). 56 °C for 45 s and 72 °C for 45 s, terminating with a final incubation at 72 °C for 7 min. For P2 P8 primer Statistics pairs the amplification was begun with an initial Software from SigmaPlot, Version 12.0 was used to run denaturation at 94 °C for 2 min followed by 45 cycles of Mann-Whitney U tests to compare the DNA yield and 94 °C for 30 s, 48 °C for 45 s and 68 °C for 45 s, ending quality obtained from samples using the protocol pub- with a final cycle of 68 °C for 10 min. lished in Soderstrom (2007) [9] and our method. Singh et al. Biological Procedures Online (2018) 20:12 Page 5 of 8 Troubleshooting yield approximately 93 ng/μl of DNA, which was a 2.4- The following steps are critical for this extraction protocol. fold increase compared to the DNA yield from the same Firstly, 5% Chelex solution should be stirred constantly to amount of blood sample subjected to the old protocol ensure that it is equally distributed in all the tubes. Sec- (Mann-Whitney U statistic = 11, T = 56, P = 0.010, Me- ondly, since Chelex beads tend to be sticky, the tip of the dian = 38.9). Half a Whatman filter paper disc (approxi- micropipette needs to be cut slightly prior to pipetting out mately 2.5 μl of blood) containing the blood sample the solution with the resin into Eppendorf tubes. Thirdly, yielded 207 ng/μl of DNA, which was a 3-fold improve- the stock solution of ammonium acetate should be stored ment over the old protocol (Mann-Whitney U Statistic at 4 °C and used within a month. =2, T = 47, P < 0.001; Fig. 2D), whereas no difference Finally, the DNA pellet is occasionally too small to was observed in the 260/280 nm ratio. visualize after precipitation. In such cases, the washing To estimate the minimum measurable amount of tis- and dissolution steps should be carried out as mentioned sue sample which may result in a good yield of DNA, after which the purity of the DNA should be assessed by different quantities of liver tissue (7 mg, 9 mg and measuring its absorbance using a spectrophotometer 11 mg) were subjected to the old as well as modified followed by electrophoresis on agarose gel. Chelex DNA isolation protocol. We observed that by following our protocol, we could obtain 1000 ng/μlof Results DNA (260/280 = 1.86, 260/230 = 1.92) from as little as We used a modified Chelex DNA isolation protocol, 7 mg of liver tissue (Fig. 2e). which involved removal of protein debris and purifica- For comparing the DNA quality obtained using the tion of DNA. We observed a 6.3-fold improvement [me- old and new methods, we compared PCR products of dian values of absorbance: older protocol [9]= 0.375, blood samples (of two male zebra finches, shown in current protocol = 2.370; Mann-Whitney U statistic = 0, Figs. 3a, b) obtained from two, one, half and one-fourth T = 497, P < 0.001] in the ratio of absorbance at 260 nm of theWhatman filter paperdiscusing theZ1/Z2 W1/ and 230 nm, whereas there was a 20-fold improvement W2 primer pair. As demonstrated in Fig. 3a,bands in the yield of genomic DNA from the blood sample were obtained by both old and new methods for the (Mann-Whitney U statistic = 0, T = 497, P < 0.001; me- first bird. However, for the second male bird, despite dian values, old protocol = 13.20, modified protocol = repeating the experiments three times, bands were ob- 275.25). However, there was little effect on the absorb- tained only using the new protocol (Fig. 3b,right). ance ratio at 260 nm and 280 nm (Mann-Whitney U These results demonstrate that the old method failed to statistic = 140, T = 245, P = 0.138; median values, old provide consistent results, since we only occasionally protocol = 1.70, modified protocol = 1.56; Fig. 2a, b). The obtained clear bands of the amplified DNA. Chelex DNA isolation protocol is seldom used to isolate genomic DNA from tissue samples. However, we de- Discussion cided to try our modified version of this protocol on The Chelex method for DNA extraction has served as a samples of liver tissue and checked the yield before and boon for researchers and has provided a high yielding after DNA precipitation and washing. We observed a 6. DNA isolation protocol with few chances of contamin- 3-fold improvement in the yield of genomic DNA from ation. Apart from forensic medicine, this method is now approximately 20 mg of liver tissue (Mann-Whitney U utilised in different fields like microbiology and path- Statistic = 0, T = 10, P = 0.006, median values before ology for detecting genetic traces of pathogens [13–19]. DNA precipitation = 634, median value after DNA pre- We realised that despite having wide applicability, the cipitation = 3971.3; Fig. 2b) compared to results obtained purification of DNA samples was limited to proteinase K by the older method [9]. treatment for removal of proteins [20, 21]. Proteinase K As stated in the Methods section, we wanted to assess is not only expensive but also needs to be inactivated be- the minimum amount of biological sample (blood or fore performing a PCR as it may digest the polymerase liver tissue) required to isolate genomic DNA through enzyme and inhibit the reaction. Further, we found that our modified protocol. Thus, we halved and quartered most of the reports did not involve any step regarding the Whatman filter paper disc and subjected it to the precipitation of DNA [19, 22–25]. This might result in a modified Chelex method. We observed that both for one DNA template for PCR that is impure, unstable and also fourth and one half of a filter paper disc, there was a prone to inhibition. significant improvement in the 260/230 nm ratio (1/4th The modified protocol for DNA extraction using Chelex disc, Mann-Whitney U statistic = 0, T = 45, P < 0.001; 1/ 100 explained in this paper, involves a systematic ap- 2 disc: Mann-Whitney U statistic = 0, T = 45, P < 0.001; proach to first removing the protein and cellular debris, Fig. 2c). Further, we found that even one fourth of the followed by precipitation and purification of DNA. The filter paper disc (approximately 1.25 μl of blood) would aim of this method was to provide a protocol for DNA Singh et al. Biological Procedures Online (2018) 20:12 Page 6 of 8 Fig. 2 Yield and quality of DNA using the old and modified Chelex protocols. Bar graphs representing median values showing the absorbance ratio (a) and yield (b) of DNA obtained from blood and tissue samples. Bar graphs in (d) represent absorbance ratio and in (e) represent yield obtained from half and one fourth of filter paper discs containing the blood sample. White bars represent data obtained by using the old [9] Chelex protocol whereas black bars represent data from the modified Chelex protocol. Error bars represent standard deviations. (c) Minimum quantities of tissue samples utilised for DNA extraction are represented by line graphs wherein the dark gray line represents the yield obtained from the modified method whereas light gray line represents the yield obtained from the old Chelex method extraction which was less expensive than silica-based or debris that may interfere with the PCR reaction is already magnetic separation kits and less toxic than organic precipitated out. For the first time, we have attempted to extraction using phenol chloroform. This protocol also establish a relation between the amount of biological sam- provides researchers with more control over the experi- ple required and the quantity as well as quality of DNA ment and makes troubleshooting easier since much of the obtained. Singh et al. Biological Procedures Online (2018) 20:12 Page 7 of 8 Zebra finch blood samples old protocol modified Chelex protocol Fig. 3 Comparison between PCR products obtained from zebra finch blood samples using the old and modified Chelex method. a Clear bands were obtained using the old (left) and modified (right) protocols to analyse the product from Z1/Z2 W1/W2 primer pairs in zebra finch blood samples from adult male birds. The bands represent PCR products obtained from two, one, half and one fourth of a Whatman filter paper disc, beginning at the lane closest to the marker and moving outwards towards the edge of the gel, respectively. b The second gel shows no bands obtained by using the old protocol (left), whereas clear bands were obtained by using the modified protocol (right). Band representation remains the same We have demonstrated that our method not only im- 14 mg of tissue, when the DNA was resuspended in proved the quality of DNA (a 6.3-fold improvement in the 200 μl of 8 M NaOH solution. Further, we have demon- 260/230 ratio) but also enhanced the yield by concentrating strated that extracting DNA from blood samples using the the DNA in solution (a 20-fold improvement in the yield older Chelex-based protocol is inconsistent and occasion- compared to the old protocol). We have also shown that ally inhibits the PCR reaction. However, our modified minimal quantities of blood or liver samples, that is, a method is consistent across all trials of these experiments fraction of 5 μl of blood taken on a Whatman filter paper for different samples. disc 8 mm in diameter yield ample genomic DNA for Many laboratories use mouse tail tissue or blood from multiple PCR reactions. Our method also works well for the tail vein for genotyping of mutants, a method which tissues and even trace quantities (7 mg of liver tissue) are is painful, time-consuming and often causes permanent able to yield 1000 ng/μl of purified DNA. For comparison, damage to the tail. Our method uses less than half the 300 μl of blood yields 5–15 μg, whereas 11 mg of liver tis- volume of blood normally withdrawn from the tail for sue yields 15–20 μg of DNA using commercially available genotyping, and results in a purified DNA sample with a kits from Promega [Wizard(R) Genomic DNA Purification yield for multiple PCR reactions. Similarly, this method Kit Technical Manual TM050]. Similarly, 200 μl of blood may find applications in determining specific mutations yields 4–12 μg whereas 25 mg of brain tissue yields 15- that may have resulted in speciation as well as point 30 μg of DNA using the QiaAmp kit (DNeasy Blood and mutations that may result in disease. Besides its use in Tissue Kits, Qiagen; https://www.qiagen.com/). We also forensic medicine, our protocol may be utilized for performed Trizol based DNA extraction and obtained a genotypic screening and sequencing of specific genes, yield of 127.9 ng/μl (260/280 = 1.7; 260/230 = 1.12) from following the detection of SNPs. Singh et al. Biological Procedures Online (2018) 20:12 Page 8 of 8 Conclusions 6. Singer-Sam J, Tanguay RL, Rijggs AO. Use of Chelex to improve PC signal from a small number of cells, Amplifications: A Forum for PCR Despite the fact that DNA extraction using Chelex 100 Users; 1989. p. 11. resin is one of the easiest and most inexpensive methods, 7. Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple there remains a persistent inconsistency in the quality and extraction of DNA for PCR-based typing from forensic material. BioTechniques. 1991;10(4):506–13. amount of DNA extract obtained. Impurities and often- 8. Griffiths R, Double MC, Orr K, Dawson RJG. A DNA test to sex most birds. times Chelex beads carried over into the final DNA Mol Ecol. 1998;7(8):1071–5. extract interfere with downstream processing such as the 9. Soderstrom K, Qin W, Leggett MH. A Minimally-Invasive Procedure for Sexing Young Zebra Finches. J Neurosci Methods. 2007;164(1):116–9. polymerase chain reaction. In order to avoid inhibition of 10. Al-Soud WA, Rådström P. Purification and Characterization of PCR-Inhibitory the PCR reaction and to purify the DNA, we included Components in Blood Cells. J Clin Microbiol. 2001;39(2):485–93. certain modifications in the Chelex 100 DNA extraction 11. Crouse J, Amorese D. Ethanol Precipitation: Ammonium Acetate as an Alternative to Sodium Acetate. Focus. 1987;9(2):2. protocol. These changes, involving non-toxic and easily 12. Pitcher DG, Saunders NA, Owen RJ. Rapid extraction of bacterial available chemicals, ensure the removal of protein and genomic DNA with guanidium thiocyanate. Lett Appl Microbiol. 1989; cellular debris and also the purification and precipitation 8(4):151–6. 13. Giraffa G, Rossetti L, Neviani E. An evaluation of chelex-based DNA of DNA, which can be then re-suspended as per the purification protocols for the typing of lactic acid bacteria. J Microbiol experimenters’ requirements. Methods. 2000;42(2):175–84. 14. Hailemariam Z, Ahmed JS, Clausen P-H, Nijhof AM. A comparison of DNA Acknowledgements extraction protocols from blood spotted on FTA cards for the detection of We are indebted to Dr Chaaya Iyengar, Department of Biotechnology, National tick-borne pathogens by Reverse Line Blot hybridization. Ticks Tick-borne Institute of Pharmaceutical Education and Research, Mohali, India for her Dis. 2017;8(1):185–9. insightful comments on the manuscript. 15. Lin JT, Ubalee R, Lon C, Balasubramanian S, Kuntawunginn W, Rahman R, et al. Microscopic Plasmodium falciparum Gametocytemia and Infectivity to Funding Mosquitoes in Cambodia. J Infect Dis. 2016;213(9):1491–4. This study was funded partly by NBRC core funds and partly by a grant from 16. Liu L, Wang CL, Peng WY, Yang J, Lan MQ, Zhang B, et al. Direct DNA the Department of Science and Technology, India to SI (EMR/2015/001422). extraction method of an obligate parasitic fungus from infected plant tissue. Gen Mol Res. 2015;14(4):18546–51. Availability of data and materials 17. Mseddi F, Jarboui MA, Sellami A, Sellami H, Ayadi A. A rapid and easy All data generated or analysed during this study are included in this method for the DNA extraction from Cryptococcus neoformans. Biol Proc published article. Online. 2011;13:5. 18. Musapa M, Kumwenda T, Mkulama M, Chishimba S, Norris DE, Thuma PE, Authors’ contributions et al. A Simple Chelex Protocol for DNA Extraction from Anopheles spp. J UAS and SI conceived the experiments, UAS and MK were joint first authors Vis Exp. 2013;(71):e3281. and contributed equally to designing, performing the experiments and 19. Mygind T, Birkelund S, Birkebæk NH, Østergaard L, Jensen JS, Christiansen G. analyzing the data. UAS and SI wrote the paper; SI supervised the study and Determination of PCR efficiency in chelex-100 purified clinical samples and corrected the manuscript. All authors read and approved the final manuscript. comparison of real-time quantitative PCR and conventional PCR for detection of Chlamydia pneumoniae. BMC Microbiol. 2002;2(1):17. Ethics approval 20. Ellegren H. Linkage mapping of the apolipoprotein A-I (APOA1) gene to pig All the procedures were approved by the Institutional Animal Ethics Chromosome 9. Mamm Genome. 1994;5(1):58–9. Committee at the National Brain Research Centre, Manesar, which are in 21. Sweet D, Lorente M, Valenzuela A, Lorente J, Alvarez JC. Increasing DNA accordance with regulations provided by the Committee for the Purpose of extraction yield from saliva stains with a modified Chelex method. Forensic Control and Supervision of Experiments on Animals, India (Protocol numbers Sci Int. 1996;83(3):167–77. IAEC/NBRC/83/2013 and IAEC/NBRC/85/2013). 22. de Lamballerie X, Zandotti C, Vignoli C, Bollet C, de Micco P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene Consent for publication amplification. Res Microbiol. 1992;143(8):785–90. Not applicable 23. Polski JM, Kimzey S, Percival RW, Grosso LE. Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100. Competing interests Mol Pathol. 1998;51(4):215–7. The authors declare no commercial or financial conflict of interest. 24. Sepp R, Szabo I, Uda H, Sakamoto H. Rapid techniques for DNA extraction from routinely processed archival tissue for use in PCR. J Clin Pathol. 1994; 47(4):318–23. Publisher’sNote 25. Yue GH, Orban L. A simple and affordable method for high-throughput Springer Nature remains neutral with regard to jurisdictional claims in DNA extraction from animal tissues for polymerase chain reaction. published maps and institutional affiliations. Electrophoresis. 2005;26(16):3081–3. Received: 23 January 2018 Accepted: 19 March 2018 References 1. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory; 1989. 2. Ivanova NV, Dewaard JR, Hebert PDN. An inexpensive, automation- friendly protocol for recovering high-quality DNA. Mol Ecol Notes. 2006; 6(4):998–1002. 3. Hawkins T. DNA purification and isolation using magnetic particles. Google Patents; 1998. 4. Uhlen M. Magnetic separation of DNA. Nature. 1989;340(6236):733–4. 5. Berensmeier S. Magnetic particles for the separation and purification of nucleic acids. Appl Microbiol Biotechnol. 2006;73(3):495–504. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Biological Procedures Online Springer Journals

Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin

Free
8 pages
Loading next page...
 
/lp/springer_journal/method-for-improving-the-quality-of-genomic-dna-obtained-from-minute-6mNikcXjWU
Publisher
BioMed Central
Copyright
Copyright © 2018 by The Author(s).
Subject
Biomedicine; Biomedicine, general; Biological Techniques
ISSN
1480-9222
eISSN
1480-9222
D.O.I.
10.1186/s12575-018-0077-6
Publisher site
See Article on Publisher Site

Abstract

Background: Although genomic DNA isolation using the Chelex 100 resin is rapid and inexpensive, the DNA obtained by this method has a low concentration in solution and contains suspended impurities. The presence of debris in the DNA solution may result in degradation of DNA on long term storage and inhibition of the polymerase chain reaction. In order to remove impurities and concentrate the DNA in solution, we have introduced modifications in the existing DNA isolation protocol using Chelex-100. We used ammonium acetate to precipitate proteins and a sodium acetate- isopropanol mixture to pellet out DNA which was washed with ethanol. Results: A pure DNA pellet that can be dissolved in water or Tris-EDTA buffer and stored for a long time at − 80 °C was obtained. We also observed a 20-fold change in the DNA concentration following precipitation and re-dissolution. Conclusion: Our method is different from other extraction methods since it uses non-toxic, easily available and inexpensive reagents as well as minimal amounts of blood or tissue samples for the DNA extraction process. Besides its use in sex determination and genotyping in lab animals as described in this paper, it may also have applications in forensic science and diagnostics such as the easy detection of pathogenic DNA in blood. Keywords: DNA Isolation, Genomic DNA, Chelex 100, Zebra finches, House crows Background A major drawback, common to all these methods, is Genomic DNA finds diverse applications in the study of the requirement of large quantities of biological samples mutations, genome structures, DNA fingerprinting and for DNA extraction. To obtain ample amounts of gen- in the creation of genomic libraries. The varied usage of etic material for PCR reactions from trace quantities of genomic DNA has brought multiple DNA extraction biological samples, Singer-Sam [6] suggested the use of methods into existence. Some of the widely used DNA an ion-exchanging resin (Chelex 100) for the DNA extraction methods include chloroform-based extraction extraction process. Chelex 100 (Bio-Rad Laboratories, [1], silica-based extraction (QIAmp DNA mini kit, CA, USA) is a styrene-divinylbenzene copolymer con- Qiagen), [2] and magnetic separation [3–5]. Whereas taining paired iminodiacetate ions. It acts by chelating chloroform-based DNA extraction requires the use of transition metal ions, the selectivity of which depends toxic chemicals, magnetic separation and silica-based upon iminodiacetic acid. The cation exchanging ability DNA extraction tend to be expensive. of the resin is functional at neutral or weakly acidic pH (> 4.0). At very low pH, the resin begins to function as an anion exchanger. Hence, Chelex is categorized as a weakly acidic cation exchanger with high affinity for * Correspondence: soumya@nbrc.ac.in Equal contributors divalent metal ions. Division of Systems Neuroscience, National Brain Research Centre, Deemed The first protocol for DNA extraction using Chelex University, Gurugram, Haryana, India 100 was developed by Walsh et al. [7]. This method, Professor, Systems Neuroscience, National Brain Research Centre, NH-8, Manesar, Gurgaon, Haryana 122051, India © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Singh et al. Biological Procedures Online (2018) 20:12 Page 2 of 8 which has found application mostly in forensics, involves and quantity, this protocol also ensures the purity of heat denaturation of cells which may be attached to DNA obtained without the use of toxic or expensive paper or fabric, in a solution containing Chelex 100 chemicals. The DNA obtained by our protocol may resin. High temperatures result in the release of DNA find application in the detection of single nucleotide into the solution as well as facilitate the binding of Chelex polymorphisms (SNPs), which may further be utilised resin to magnesium ions. Magnesium ions serve as for genotypic screening and also in the targeted se- cofactors to deoxyribonucleases and aid in their activation. quencing of specific genes in order to study their role Since magnesium ions are rendered unavailable to bind to in a particular phenotype. deoxyribonucleases, DNA degradation is averted. After this protocol was established, the Chelex 100 resin became the Methods method of choice for protocols requiring the rapid extrac- Reagents tion of DNA from trace amounts of biological samples. Chelex 100 Resin (BioRad, Cat no #142–1253), Tris We needed to determine the sex of zebra finches Buffer GR (Merck, 61,771,405,001,730), EDTA (Sigma- (Taeniopygia guttata) and house crows (Corvus splendens) Aldrich, E9884-500G), Ammonium acetate (Merck, , for some of the experiments in our lab. In order to per- 61,750,105,001,046), Sodium acetate (Qualigens, 15,955), form PCR reactions for avian sex chromosomes Z- and Isopropanol (Sigma-Aldrich, I9516-500ML), Ethanol W- [8, 9], we isolated genomic DNA from blood and tis- (Merck, K45420483412). sue samples of these birds. However, even after multiple iterations of the standard Chelex protocol [7, 9], we found that on an average, the 260/230 ratio for DNA was 0.4 Buffers and the concentration of DNA was 40 ng/μl. We also 1 M Tris solution (pH 8.0), 0.5 M EDTA (pH 8.0), 10X found that the DNA extract was impure and pigmented TE (Tris EDTA) Buffer (pH 8.0), 5% Chelex suspension due to suspended cellular debris. (pH 8.0, to be prepared in 1X TE buffer), 7.5 M Ammo- Earlier studies have shown that organic debris in the nium acetate, 3 M Sodium acetate, 10 N NaOH (for pH form of proteins, for example, haemoglobin in blood and adjustment, to be made in autoclaved deionized water), other compounds such as lactoferrin, IgG, and myoglo- 50X Tris Acetate EDTA buffer (TAE buffer, pH 8.6), 5× bin are known to inhibit polymerase activity during PCR Tris Borate EDTA buffer (TBE buffer pH 8.3), 30% reactions [10]. Long term storage of impure DNA sam- Acrylamide Bis Acrylamide solution (Table 1). ples may also lead to the binding of these compounds to the DNA double helix, which may result in the inhib- ition of the PCR reaction. To purify and concentrate the Blood and tissue sample preparation DNA further, we introduced modifications in the exist- All experiments conducted on birds (zebra finches, n =5; ing Chelex protocol that involved removal of proteins Indian house crows, n = 5) as well as trans-cardiac perfu- and cellular debris as well as precipitation, washing and sion with fixatives at the end of terminal experiments resuspension of DNA. When compared to results ob- following an overdose of the anaesthetic ketamine were tained using the protocol described by Soderstrom [9], approved by the Institutional Animal Ethics Committee at our modified Chelex-based method yielded a 6.3-fold the National Brain Research Centre, Manesar, which are increase in quality (260 and 230 nm ratio of 2.35 com- in accordance with regulations provided by the Commit- pared to a median value of 0.375 using the old protocol). tee for the Purpose of Control and Supervision of Experi- Our method also yielded an approximately 20-fold in- ments on Animals, India. Approximately 5 μlof blood crease in the quantity of DNA (275.25 ng/μl versus a me- was adsorbed onto a disc of Whatman filter paper (No. dian value of 13.2 ng/μl using the earlier protocol) for the 1001917) created by using a sterile paper punch (radius, same amount of the sample. In the present study, we re- 4 mm; thickness, 180 μm). The discs were then left to dry port in detail a method of isolation of genomic DNA from in a hood equipped with laminar flow for 30 min. In order liver tissue samples and the quality and quantity of DNA to assess the smallest quantity of blood or tissue sample thus obtained, using the Chelex resin. Additionally, we that was required to obtain an ample DNA yield for a have also tried to quantify the minimum amount of tissue PCR reaction, we used two, one, half and one-fourth of a samples required to obtain a good yield of genomic DNA. Whatman filter paper disc and subjected them to our A major drawback of DNA extraction using Chelex modified Chelex 100 DNA extraction protocol. The discs resin is the contaminated DNA extract obtained at were separated to prevent them from sticking to each the end of the procedure. The method that we other after drying. For tissue, samples weighing 7 mg, present here ensures the purification of the extract 9 mg and 11 mg were excised from crow liver and slightly and minimal loss of the quantity of DNA from mi- macerated with a pair of forceps, after which they were nute samples. Hence, along with specifying the quality placed in Eppendorf tubes for further processing. Singh et al. Biological Procedures Online (2018) 20:12 Page 3 of 8 Table 1 Recipes for Buffers used for the Protocol solution was 2.5 M [11, 12]. A thick yellowish-white pre- cipitate of protein appeared immediately after adding am- Components Volume monium acetate. This solution was allowed to rest for 50X TAE Buffer (500 ml) 5 min on ice. The sample was vortexed for 5 s and protein Tris Buffer GR 121 g was pelleted out by centrifugation at 12000 rpm for EDTA Stock (0.5 M) 50 ml 10 min at room temperature, after which the clear super- Glacial Acetic Acid 28.55 ml natant containing genomic DNA was collected. 5× TBE Buffer (1 l, pH 8.3) DNA precipitation Tris Buffer GR 54 g Sodium acetate stock (3 M) was added to the super- natant obtained after protein precipitation so that the Boric Acid 27.5 g working concentration of sodium acetate was 0.3 M in EDTA Stock (0.5 M) 20 ml solution. This was followed by the addition of 200 μlof ice cold ethanol. The solution was vortexed for 5 s and 30% Acrylamide (25 ml) allowed to stand for 4 h at − 30 °C for the DNA to pre- Acrylamide 7.3 g cipitate after which the samples were centrifuged at Bis-acrylamide 0.2 g 15000 g for 1 h at 4 °C. The supernatant was discarded and the pellet was washed twice with 75% ice cold etha- 8% Polyacrylamide Gel nol. Each wash step was followed by centrifugation at 30% Acrylamide 2.620 ml 15000 rpm for 10 min at 4 °C. This was followed by a 5x TBE Buffer 1.97 ml final wash with 100% ice cold isopropanol, after which Autoclaved Milli Q water 5.24 ml the wash solution was removed and the pellet was left to 10% Ammonium 163 μl air dry in a laminar flow hood. After 7 to 10 min of Persulfate drying, 10 μl of deionized water or 1X TE was added to TEMED 8 μl the pellet and it was incubated at 55 °C for 10 min to facilitate solubilisation. The quality and quantity of DNA Total 10 ml were measured using a NanoDrop. EtBr (for staining) 0.5 μg/ml in 1X TBE 10X TE Buffer (pH 8.0) PCR reaction Tris Buffer 1 ml (Stock 1 M; Final concentration 100 mM) We used four different primer pairs, three pairs were EDTA 200 μl (Stock 1 M; Final concentration 10 mM) targeted against avian sex chromosomes Z1 (forward: GTGTAGTCCGCTGCTTTTGG), Z2 (reverse: GTTC Autoclaved Milli Q water 8.8 ml GTGGTCTTCCACGTTT), W1(forward: GGGTTTT GACTGACTAACTGAT), W2 (reverse: GTTCAAAGC Chelex Isolation protocol TACATGAATAAACA) [9], P2 (TCTGCATCGCTAAAT Chelex solution (200 μl of 5% stock) was added to 1.5 ml CCTTT), P8 (CTCCCAAGGATGAGRAAYTG) [8], and Eppendorf tubes. These tubes were heated at 100 °C for one pair was used for amplification of the δ-Opioid 10 min in a boiling water bath. Whatman paper discs with Receptor gene, δ-OR (forward: TTCAACCTGGCTC blood samples or the liver tissue samples were then added TGGCTGATG), δ-OR (reverse: GTCAATAGAGAGCA to the hot Chelex solution. The Chelex suspension along CAACCTTGC) in extracted DNA samples from males with the paper disc or tissue samples was further heated and females of both species. for 8 min, vortexed and again heated for 7 min. The Amongst different species, male birds possess homo- Eppendorf tubes were centrifuged at 12000 g for one and morphic sex chromosomes, that is, they are arranged as a half minutes at room temperature. The supernatant was ZZ, whereas females are heteromorphic and have a ZW pipetted out gently to avoid extracting the Chelex resin as chromosomal arrangement. As a result, the PCR prod- well. The yield and quality of DNA in each sample of the ucts from zebra finch blood samples appeared as a single supernatant was measured using a spectrophotometer band in case of males at 242 bp and for female sex chro- [Nanodrop 1000 (ND 1000 V3.8.1, Thermo Fisher)]. mosomes at 242 bp and 179 bp using Z1/Z2 and W1/ W2 primer pairs (Fig. 1a; agarose and Fig. 1b; polyacryl- Protein precipitation amide gel, performed on separate sets of blood samples A 7.5 M stock solution of Ammonium Acetate was added for proper visualization of band separation for the to the supernatant collected after Chelex extraction, so female PCR product). For crow tissue samples, the PCR that the working concentration of ammonium acetate in products appeared as a single band in case of males at Singh et al. Biological Procedures Online (2018) 20:12 Page 4 of 8 Fig. 1 Gel electrophoresis following PCR for zebra finch blood samples. Single bands were obtained for a male at 242 bp and double bands at 242 and 179 bp for a female performed using (a) 2% agarose gel and (b) 8% polyacrylamide gel respectively; each lane beginning from the marker to the edge of the gel represents double, single, half and one fourth Whatman filter paper disc respectively for both male and female sample. Separate sets of samples were run on agarose and polyacrylamide gels respectively, to demonstrate better band separation of the PCR product obtained from female zebra finch genomic DNA sample by using the latter electrophoresis method. c PCR products from crow tissue samples showing a single band at 390 bp for ZZ chromosomes of males and double bands at 390 and 460 bp for Z and W chromosomes for females. d A single band was obtained for the delta opioid receptor gene at 120 bp for both male and female zebra finches 390 bp and double bands in case of females at 390 bp Gel Electrophoresis and 460 bp using the P2/P8 primer pair (Fig. 1c). Using Gel electrophoresis was performed using 2% agarose zebra finch blood samples for detecting the delta opioid gels, but the resolution between Z and W bands for the receptor gene, we found a sharp band at 120 bp in zebra crow samples was very poor. To improve the band reso- finch DNA samples (Fig. 1d). Zebra finch genomic DNA lution, electrophoresis was repeated using 8% polyacryl- samples were amplified for sex identification using Z1 amide gels, which were stained with ethidium bromide Z2 and W1 W2 primers beginning with denaturation at (Table 1). Images were acquired using a Syngene Gel 94 °C for 15 min followed by 30 cycles of 94 °C for 30 s, Doc (G:Box, Syngene; Gene Sys software). 56 °C for 45 s and 72 °C for 45 s, terminating with a final incubation at 72 °C for 7 min. For P2 P8 primer Statistics pairs the amplification was begun with an initial Software from SigmaPlot, Version 12.0 was used to run denaturation at 94 °C for 2 min followed by 45 cycles of Mann-Whitney U tests to compare the DNA yield and 94 °C for 30 s, 48 °C for 45 s and 68 °C for 45 s, ending quality obtained from samples using the protocol pub- with a final cycle of 68 °C for 10 min. lished in Soderstrom (2007) [9] and our method. Singh et al. Biological Procedures Online (2018) 20:12 Page 5 of 8 Troubleshooting yield approximately 93 ng/μl of DNA, which was a 2.4- The following steps are critical for this extraction protocol. fold increase compared to the DNA yield from the same Firstly, 5% Chelex solution should be stirred constantly to amount of blood sample subjected to the old protocol ensure that it is equally distributed in all the tubes. Sec- (Mann-Whitney U statistic = 11, T = 56, P = 0.010, Me- ondly, since Chelex beads tend to be sticky, the tip of the dian = 38.9). Half a Whatman filter paper disc (approxi- micropipette needs to be cut slightly prior to pipetting out mately 2.5 μl of blood) containing the blood sample the solution with the resin into Eppendorf tubes. Thirdly, yielded 207 ng/μl of DNA, which was a 3-fold improve- the stock solution of ammonium acetate should be stored ment over the old protocol (Mann-Whitney U Statistic at 4 °C and used within a month. =2, T = 47, P < 0.001; Fig. 2D), whereas no difference Finally, the DNA pellet is occasionally too small to was observed in the 260/280 nm ratio. visualize after precipitation. In such cases, the washing To estimate the minimum measurable amount of tis- and dissolution steps should be carried out as mentioned sue sample which may result in a good yield of DNA, after which the purity of the DNA should be assessed by different quantities of liver tissue (7 mg, 9 mg and measuring its absorbance using a spectrophotometer 11 mg) were subjected to the old as well as modified followed by electrophoresis on agarose gel. Chelex DNA isolation protocol. We observed that by following our protocol, we could obtain 1000 ng/μlof Results DNA (260/280 = 1.86, 260/230 = 1.92) from as little as We used a modified Chelex DNA isolation protocol, 7 mg of liver tissue (Fig. 2e). which involved removal of protein debris and purifica- For comparing the DNA quality obtained using the tion of DNA. We observed a 6.3-fold improvement [me- old and new methods, we compared PCR products of dian values of absorbance: older protocol [9]= 0.375, blood samples (of two male zebra finches, shown in current protocol = 2.370; Mann-Whitney U statistic = 0, Figs. 3a, b) obtained from two, one, half and one-fourth T = 497, P < 0.001] in the ratio of absorbance at 260 nm of theWhatman filter paperdiscusing theZ1/Z2 W1/ and 230 nm, whereas there was a 20-fold improvement W2 primer pair. As demonstrated in Fig. 3a,bands in the yield of genomic DNA from the blood sample were obtained by both old and new methods for the (Mann-Whitney U statistic = 0, T = 497, P < 0.001; me- first bird. However, for the second male bird, despite dian values, old protocol = 13.20, modified protocol = repeating the experiments three times, bands were ob- 275.25). However, there was little effect on the absorb- tained only using the new protocol (Fig. 3b,right). ance ratio at 260 nm and 280 nm (Mann-Whitney U These results demonstrate that the old method failed to statistic = 140, T = 245, P = 0.138; median values, old provide consistent results, since we only occasionally protocol = 1.70, modified protocol = 1.56; Fig. 2a, b). The obtained clear bands of the amplified DNA. Chelex DNA isolation protocol is seldom used to isolate genomic DNA from tissue samples. However, we de- Discussion cided to try our modified version of this protocol on The Chelex method for DNA extraction has served as a samples of liver tissue and checked the yield before and boon for researchers and has provided a high yielding after DNA precipitation and washing. We observed a 6. DNA isolation protocol with few chances of contamin- 3-fold improvement in the yield of genomic DNA from ation. Apart from forensic medicine, this method is now approximately 20 mg of liver tissue (Mann-Whitney U utilised in different fields like microbiology and path- Statistic = 0, T = 10, P = 0.006, median values before ology for detecting genetic traces of pathogens [13–19]. DNA precipitation = 634, median value after DNA pre- We realised that despite having wide applicability, the cipitation = 3971.3; Fig. 2b) compared to results obtained purification of DNA samples was limited to proteinase K by the older method [9]. treatment for removal of proteins [20, 21]. Proteinase K As stated in the Methods section, we wanted to assess is not only expensive but also needs to be inactivated be- the minimum amount of biological sample (blood or fore performing a PCR as it may digest the polymerase liver tissue) required to isolate genomic DNA through enzyme and inhibit the reaction. Further, we found that our modified protocol. Thus, we halved and quartered most of the reports did not involve any step regarding the Whatman filter paper disc and subjected it to the precipitation of DNA [19, 22–25]. This might result in a modified Chelex method. We observed that both for one DNA template for PCR that is impure, unstable and also fourth and one half of a filter paper disc, there was a prone to inhibition. significant improvement in the 260/230 nm ratio (1/4th The modified protocol for DNA extraction using Chelex disc, Mann-Whitney U statistic = 0, T = 45, P < 0.001; 1/ 100 explained in this paper, involves a systematic ap- 2 disc: Mann-Whitney U statistic = 0, T = 45, P < 0.001; proach to first removing the protein and cellular debris, Fig. 2c). Further, we found that even one fourth of the followed by precipitation and purification of DNA. The filter paper disc (approximately 1.25 μl of blood) would aim of this method was to provide a protocol for DNA Singh et al. Biological Procedures Online (2018) 20:12 Page 6 of 8 Fig. 2 Yield and quality of DNA using the old and modified Chelex protocols. Bar graphs representing median values showing the absorbance ratio (a) and yield (b) of DNA obtained from blood and tissue samples. Bar graphs in (d) represent absorbance ratio and in (e) represent yield obtained from half and one fourth of filter paper discs containing the blood sample. White bars represent data obtained by using the old [9] Chelex protocol whereas black bars represent data from the modified Chelex protocol. Error bars represent standard deviations. (c) Minimum quantities of tissue samples utilised for DNA extraction are represented by line graphs wherein the dark gray line represents the yield obtained from the modified method whereas light gray line represents the yield obtained from the old Chelex method extraction which was less expensive than silica-based or debris that may interfere with the PCR reaction is already magnetic separation kits and less toxic than organic precipitated out. For the first time, we have attempted to extraction using phenol chloroform. This protocol also establish a relation between the amount of biological sam- provides researchers with more control over the experi- ple required and the quantity as well as quality of DNA ment and makes troubleshooting easier since much of the obtained. Singh et al. Biological Procedures Online (2018) 20:12 Page 7 of 8 Zebra finch blood samples old protocol modified Chelex protocol Fig. 3 Comparison between PCR products obtained from zebra finch blood samples using the old and modified Chelex method. a Clear bands were obtained using the old (left) and modified (right) protocols to analyse the product from Z1/Z2 W1/W2 primer pairs in zebra finch blood samples from adult male birds. The bands represent PCR products obtained from two, one, half and one fourth of a Whatman filter paper disc, beginning at the lane closest to the marker and moving outwards towards the edge of the gel, respectively. b The second gel shows no bands obtained by using the old protocol (left), whereas clear bands were obtained by using the modified protocol (right). Band representation remains the same We have demonstrated that our method not only im- 14 mg of tissue, when the DNA was resuspended in proved the quality of DNA (a 6.3-fold improvement in the 200 μl of 8 M NaOH solution. Further, we have demon- 260/230 ratio) but also enhanced the yield by concentrating strated that extracting DNA from blood samples using the the DNA in solution (a 20-fold improvement in the yield older Chelex-based protocol is inconsistent and occasion- compared to the old protocol). We have also shown that ally inhibits the PCR reaction. However, our modified minimal quantities of blood or liver samples, that is, a method is consistent across all trials of these experiments fraction of 5 μl of blood taken on a Whatman filter paper for different samples. disc 8 mm in diameter yield ample genomic DNA for Many laboratories use mouse tail tissue or blood from multiple PCR reactions. Our method also works well for the tail vein for genotyping of mutants, a method which tissues and even trace quantities (7 mg of liver tissue) are is painful, time-consuming and often causes permanent able to yield 1000 ng/μl of purified DNA. For comparison, damage to the tail. Our method uses less than half the 300 μl of blood yields 5–15 μg, whereas 11 mg of liver tis- volume of blood normally withdrawn from the tail for sue yields 15–20 μg of DNA using commercially available genotyping, and results in a purified DNA sample with a kits from Promega [Wizard(R) Genomic DNA Purification yield for multiple PCR reactions. Similarly, this method Kit Technical Manual TM050]. Similarly, 200 μl of blood may find applications in determining specific mutations yields 4–12 μg whereas 25 mg of brain tissue yields 15- that may have resulted in speciation as well as point 30 μg of DNA using the QiaAmp kit (DNeasy Blood and mutations that may result in disease. Besides its use in Tissue Kits, Qiagen; https://www.qiagen.com/). We also forensic medicine, our protocol may be utilized for performed Trizol based DNA extraction and obtained a genotypic screening and sequencing of specific genes, yield of 127.9 ng/μl (260/280 = 1.7; 260/230 = 1.12) from following the detection of SNPs. Singh et al. Biological Procedures Online (2018) 20:12 Page 8 of 8 Conclusions 6. Singer-Sam J, Tanguay RL, Rijggs AO. Use of Chelex to improve PC signal from a small number of cells, Amplifications: A Forum for PCR Despite the fact that DNA extraction using Chelex 100 Users; 1989. p. 11. resin is one of the easiest and most inexpensive methods, 7. Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple there remains a persistent inconsistency in the quality and extraction of DNA for PCR-based typing from forensic material. BioTechniques. 1991;10(4):506–13. amount of DNA extract obtained. Impurities and often- 8. Griffiths R, Double MC, Orr K, Dawson RJG. A DNA test to sex most birds. times Chelex beads carried over into the final DNA Mol Ecol. 1998;7(8):1071–5. extract interfere with downstream processing such as the 9. Soderstrom K, Qin W, Leggett MH. A Minimally-Invasive Procedure for Sexing Young Zebra Finches. J Neurosci Methods. 2007;164(1):116–9. polymerase chain reaction. In order to avoid inhibition of 10. Al-Soud WA, Rådström P. Purification and Characterization of PCR-Inhibitory the PCR reaction and to purify the DNA, we included Components in Blood Cells. J Clin Microbiol. 2001;39(2):485–93. certain modifications in the Chelex 100 DNA extraction 11. Crouse J, Amorese D. Ethanol Precipitation: Ammonium Acetate as an Alternative to Sodium Acetate. Focus. 1987;9(2):2. protocol. These changes, involving non-toxic and easily 12. Pitcher DG, Saunders NA, Owen RJ. Rapid extraction of bacterial available chemicals, ensure the removal of protein and genomic DNA with guanidium thiocyanate. Lett Appl Microbiol. 1989; cellular debris and also the purification and precipitation 8(4):151–6. 13. Giraffa G, Rossetti L, Neviani E. An evaluation of chelex-based DNA of DNA, which can be then re-suspended as per the purification protocols for the typing of lactic acid bacteria. J Microbiol experimenters’ requirements. Methods. 2000;42(2):175–84. 14. Hailemariam Z, Ahmed JS, Clausen P-H, Nijhof AM. A comparison of DNA Acknowledgements extraction protocols from blood spotted on FTA cards for the detection of We are indebted to Dr Chaaya Iyengar, Department of Biotechnology, National tick-borne pathogens by Reverse Line Blot hybridization. Ticks Tick-borne Institute of Pharmaceutical Education and Research, Mohali, India for her Dis. 2017;8(1):185–9. insightful comments on the manuscript. 15. Lin JT, Ubalee R, Lon C, Balasubramanian S, Kuntawunginn W, Rahman R, et al. Microscopic Plasmodium falciparum Gametocytemia and Infectivity to Funding Mosquitoes in Cambodia. J Infect Dis. 2016;213(9):1491–4. This study was funded partly by NBRC core funds and partly by a grant from 16. Liu L, Wang CL, Peng WY, Yang J, Lan MQ, Zhang B, et al. Direct DNA the Department of Science and Technology, India to SI (EMR/2015/001422). extraction method of an obligate parasitic fungus from infected plant tissue. Gen Mol Res. 2015;14(4):18546–51. Availability of data and materials 17. Mseddi F, Jarboui MA, Sellami A, Sellami H, Ayadi A. A rapid and easy All data generated or analysed during this study are included in this method for the DNA extraction from Cryptococcus neoformans. Biol Proc published article. Online. 2011;13:5. 18. Musapa M, Kumwenda T, Mkulama M, Chishimba S, Norris DE, Thuma PE, Authors’ contributions et al. A Simple Chelex Protocol for DNA Extraction from Anopheles spp. J UAS and SI conceived the experiments, UAS and MK were joint first authors Vis Exp. 2013;(71):e3281. and contributed equally to designing, performing the experiments and 19. Mygind T, Birkelund S, Birkebæk NH, Østergaard L, Jensen JS, Christiansen G. analyzing the data. UAS and SI wrote the paper; SI supervised the study and Determination of PCR efficiency in chelex-100 purified clinical samples and corrected the manuscript. All authors read and approved the final manuscript. comparison of real-time quantitative PCR and conventional PCR for detection of Chlamydia pneumoniae. BMC Microbiol. 2002;2(1):17. Ethics approval 20. Ellegren H. Linkage mapping of the apolipoprotein A-I (APOA1) gene to pig All the procedures were approved by the Institutional Animal Ethics Chromosome 9. Mamm Genome. 1994;5(1):58–9. Committee at the National Brain Research Centre, Manesar, which are in 21. Sweet D, Lorente M, Valenzuela A, Lorente J, Alvarez JC. Increasing DNA accordance with regulations provided by the Committee for the Purpose of extraction yield from saliva stains with a modified Chelex method. Forensic Control and Supervision of Experiments on Animals, India (Protocol numbers Sci Int. 1996;83(3):167–77. IAEC/NBRC/83/2013 and IAEC/NBRC/85/2013). 22. de Lamballerie X, Zandotti C, Vignoli C, Bollet C, de Micco P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene Consent for publication amplification. Res Microbiol. 1992;143(8):785–90. Not applicable 23. Polski JM, Kimzey S, Percival RW, Grosso LE. Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100. Competing interests Mol Pathol. 1998;51(4):215–7. The authors declare no commercial or financial conflict of interest. 24. Sepp R, Szabo I, Uda H, Sakamoto H. Rapid techniques for DNA extraction from routinely processed archival tissue for use in PCR. J Clin Pathol. 1994; 47(4):318–23. Publisher’sNote 25. Yue GH, Orban L. A simple and affordable method for high-throughput Springer Nature remains neutral with regard to jurisdictional claims in DNA extraction from animal tissues for polymerase chain reaction. published maps and institutional affiliations. Electrophoresis. 2005;26(16):3081–3. Received: 23 January 2018 Accepted: 19 March 2018 References 1. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory; 1989. 2. Ivanova NV, Dewaard JR, Hebert PDN. An inexpensive, automation- friendly protocol for recovering high-quality DNA. Mol Ecol Notes. 2006; 6(4):998–1002. 3. Hawkins T. DNA purification and isolation using magnetic particles. Google Patents; 1998. 4. Uhlen M. Magnetic separation of DNA. Nature. 1989;340(6236):733–4. 5. Berensmeier S. Magnetic particles for the separation and purification of nucleic acids. Appl Microbiol Biotechnol. 2006;73(3):495–504.

Journal

Biological Procedures OnlineSpringer Journals

Published: Jun 1, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off