Medium-chain fatty acids decrease serum cholesterol via reduction of intestinal bile acid reabsorption in C57BL/6J mice

Medium-chain fatty acids decrease serum cholesterol via reduction of intestinal bile acid... Background: Bile acids play a pivotal role in cholesterol metabolism via the enterohepatic circulation. This study investigated the effects of medium-chain triglycerides (MCTs)/medium-chain fatty acids (MCFAs) on the reduction of bile acid absorption in the small intestine and the mechanisms of action in vivo and partially verified in vitro. Methods: Thirty-six C57BL/6 J mice with hypercholesterolaemia were randomly divided into 3 groups: fed a cholesterol-rich diet (CR group), fed a cholesterol-rich and medium-chain triglyceride diet (CR-MCT group) and fed a cholesterol-rich and long-chain triglyceride diet (CR-LCT group). Body weights and blood lipid profiles were measured in all groups after 16 weeks of treatment. The concentrations of bile acids in bile and faeces were analysed using HPLC- MS (high-performance liquid chromatography-mass spectrometry). Gene transcription and the expression levels associated with bile acid absorption in the small intestines were determined using real-time PCR and Western blot. Ileal bile acid binding protein (I-BABP) was analysed using immunofluorescence. The effects of MCFAs on the permeability of bile acid (cholic acid, CA) in Caco-2 cell monolayers and I-BABP expression levels in Caco-2 cells treated with caprylic acid (C8:0), capric acid (C10:0), stearic acid (C18:0) and oleic acid (C18:1) were determined. Results: Mice in the CR-MCT group exhibited lower body weights and serum total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) levels and a higher HDL-C/LDL-C ratio than the CR-LCT group (P <0.05). The concentrations of primary bile acids (primarily CA) and secondary bile acids in faeces and secondary bile acids in bile in the CR-MCT group were significantly higher than in the CR-LCT group (P < 0.05). C8:0 and C10:0 decreased the permeability of CA in Caco-2 cell monolayers. MCT/MCFAs (C8:0 and C10:0) inhibited I-BABP gene expression in the small intestines and Caco-2 cells (P <0.05). Conclusions: MCT slowed the body weight increase and promoted the excretion of bile acids. MCT lowered serum cholesterol levels at least partially via reduction of bile acid absorption in the small intestine by inhibition of I-BABP expression. Our results provide the basis for clinical trials of MCT as a dietary supplement for lowering plasma cholesterol and reducing risk of CHD. Keywords: Medium-chain triglyceride, Medium-chain fatty acids, Bile acids, Ileal bile acid binding protein, Caco-2 cells * Correspondence: cnxcy@163.com; guocjtj@126.com Department of Nutrition, Chinese PLA General Hospital, Beijing 100853, China Department of Nutrition, Tianjin Institute of Environmental & Operational Medicine, Tianjin 300050, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Li et al. Nutrition & Metabolism (2018) 15:37 Page 2 of 12 Background Mice were fed a basal diet (AIN-93G diet, purchased The latest data from the World Health Organization re- from the Academy of Military Medical Science) during veal that cardiovascular diseases (CVDs), principally the first week for adaptation. Ten mice were randomly stroke and coronary heart disease (CHD), remain the chosen and fed a basal diet as the normal control, and major cause of human death worldwide and claim the the remaining mice were fed a cholesterol-rich (CR) diet lives of 17.7 million people annually (31% of all global modified from the AIN-96G diet. Blood samples were deaths) (http://www.who.int/cardiovascular_diseases/en/). collected from the mandibular venous plexus two weeks High blood cholesterol is a crucial risk factor for CVDs later. Mice with serum TC levels that were 2 standard [1]. A projected increase of serum total cholesterol deviations greater than the normal control (accounting (TC) increase of 0.58 mmol/L (22.4 mg/dL) in for 67% of mice fed the CR diet) were randomly assigned Chinese men and 0.55 mmol/L (21.6 mg/dL) in Chinese to three groups (n = 12 in each group). Each group was women from 2010 to 2030 would produce the highest in- fed a different diet for 16 weeks (Table 1): cholesterol- crease in CHD events (increase by 31% of CHD baseline rich and medium-chain triglyceride (CR-MCT), events in men and 15% in women) of all risk factors cholesterol-rich and long-chain triglyceride (CR-LCT) or modeled in China [2]. CR. Nisshin Oillio (Tokyo, Japan) donated the MCTs Bile acids play a pivotal role in cholesterol metabolism (C8:0 and C10:0) and LCTs (long-chain triglycerides, soy via the enterohepatic circulation. Bile acids are con- bean oil). Cholesterol was purchased from Sigma- verted from cholesterol in liver cells, and 90%–95% of Aldrich (St. Louis, MO, USA). The Beijing Institute of bile acids are reabsorbed into the intestinal epithelial Nutrition Resources (Beijing, China) measured the fatty cells at the end of the ileum and transported to the acid compositions of the CR-MCT and CR-LCT diets blood circulation to re-enter liver cells. Only approxi- (Table 2). Body weights and food intake were monitored mately 5% of bile acids in the intestine are excreted in weekly. the stool. The physiological significance of enterohepatic circulation of bile acids is to make the limited bile acid Blood, ileum, bile and faeces sampling reusable for maintaining cholesterol homeostasis, and to Five mice were chosen randomly from each group after facilitate the elimination of excess cholesterol from the 16 weeks of feeding to record diet intake and faeces ex- body [3]. cretion using separate metabolic cages for 3 days. Faeces Medium-chain triglycerides (MCTs) with 8–12 carbon were lyophilized, weighed, pulverised, and stored at − atoms is digested by lipase in the stomach and duode- 80 °C for further analysis. All mice were fasted overnight num into glycerol and medium-chain fatty acids (approximately 12 h) prior to blood sample collection (MCFAs). Our previous studies confirmed that a diet Table 1 Composition and nutrition factors of experimental diets containing MCFAs reduced serum total cholesterol (TC) for C57BL/6 J mice via promotion of bile acid synthesis in the liver and in- Ingredients CR-MCT CR-LCT CR creased excretion of bile acids in faeces [4, 5]. We Basal diet (%) 86.7 86.7 88.7 hypothesized that the small intestine also plays an essen- tial role in the maintenance of cholesterol balance. Lard (%) 10 10 10 Therefore, the present study investigated whether MCT Cholesterol (%) 1 1 1 decreased serum cholesterol via inhibition of bile acid Bile salt (%) 0.3 0.3 0.3 reabsorption in the small intestine and the expression of MCT (%) 2 –– relevant transporters of bile acid reabsorption in the LCT (%) – 2 – small intestine in C57BL/6 J mice and Caco-2 cell Energy (KJ/g) 16.81 16.81 16.39 monolayers. Percentage of Nutrients Protein (%) 18.69 18.69 19.07 Methods Fat (%) 15.36 15.36 13.63 Animals and diets Carbohydrate (%) 47.22 47.22 48.18 Male C57BL/6 J mice (4 weeks old, n = 80) were pur- Cholesterol (%) 1 1 1 chased from the Institute of Laboratory Animal Science, Mineral mixture (%) 1.06 1.06 1.08 Chinese Academy of Medical Sciences (License No. SCXK: JING2009–0007) and housed in a temperature- Vitamin mixture (%) 0.51 0.51 0.52 controlled room (22 ± 2 °C, 40% to 60% humidity) with a Fibre (%) 1.47 1.47 1.5 12-h light/dark cycle. The Animal Care and Use Com- Water (%) 9.11 9.11 9.3 mittee of the Chinese PLA General Hospital approved Others (%) 5.58 5.58 5.72 all experimental procedures. Li et al. Nutrition & Metabolism (2018) 15:37 Page 3 of 12 Table 2 Fatty acid composition of CR-MCT, CR-LCT and CR diets (Applied Biosystems, Carlsbad, USA) was used. The Fatty acids CR-MCT CR-LCT CR HPLC and MS systems were controlled using Analyst 1. C18:3 C18:0 4.2 software. All chromatographic separations were g/100 g diet % g/100 g diet % g/100 g diet % performed using a Venusil AQ C18 column (2.5 μm, a a a a C8:0 1.51 9.75 ND ND ND ND 50 mm × 2.1 mm) (Agela Techonologies, Delaware, USA). a a a a C10:0 0.55 3.55 ND ND ND ND Cholic acid (CA), deoxycholic acid (DCA), chenodeoxy- cholic acid (CDCA), ursodeoxycholic acid (UDCA), C14:0 0.01 0.06 0.01 0.06 0.01 0.07 lithocholic acid (LCA), taurocholic acid (TCA), tauro- C16:0 3.09 19.95 3.51 22.52 3.13 22.90 deoxycholic acid (TDCA), taurochenodeoxycholic acid C16:1 0.19 1.23 0.19 1.22 0.19 1.39 (TCDCA), taurolithocholic acid (TLCA), glycocholic acid C17:0 0.06 0.39 0.06 0.39 0.06 0.44 (GCA), glycodeoxycholic acid (GDCA) and glycocheno- C17:1 0.02 0.13 0.02 0.13 0.02 0.15 deoxycholic acid (GCDCA) were used as standard sub- C18:0 1.47 9.49 1.66 10.68 1.54 11.27 stances. Chloramphenicol was used as an internal C18:1 5.26 33.96 6.21 39.88 5.36 39.21 standard. The abovementioned materials were purchased C18:2 3.09 19.95 3.61 23.16 3.12 22.82 from Sigma-Aldrich (St. Louis, MO, USA). Primary bile acids, including CA, CDCA, TCA, TCDCA, GCA and C18:3 0.18 1.16 0.22 1.39 0.18 1.32 GCDCA, and secondary bile acids, including DCA, LCA, C20:0 0.03 0.19 0.04 0.26 0.03 0.22 UDCA, TLCA, TDCA and GDCA, in bile and faeces were C20:4 0.01 0.06 0.02 0.13 0.01 0.07 determined by the retention times. C20:5 0.01 0.06 0.02 0.13 0.01 0.07 C22:0 0.01 0.06 0.01 0.06 0.01 0.07 Quantitative real-time PCR (qRT-PCR) Total 15.49 100 15.58 100 13.67 100 Samples from small intestine tissue (approximately not detectable 100 mg) were washed with ice-cold PBS and homoge- nized. Total RNA from tissues and cells was isolated using Trizol reagent (Omega Bio-Tek, Norcross, USA, from the aorta ventralis under anaesthesia (xylazine no. R6812). Primers were designed using Primer Express hydrochloride). Serum was collected after centrifugation 3.0 software based on the mRNA sequences from a data- of the blood samples. A microcapsule was used to punc- base (Table 3) and synthesized by Invitrogen (Beijing, ture the gallbladder wall and extract the bile, and each China). Methods for RNA extraction and quantitative bile sample was centrifuged at 16,000 g for 30 min. The real-time PCR (qRT-PCR) are described in our previous supernatant was collected and stored at − 80 °C. Ileum publications. qRT-PCR was performed using a One Step tissues were excised and rinsed with ice-cold saline, and SYBR® PrimeScript® RT-PCR Kit (Takara Biotechnology portions were immediately stored at − 80 °C for further Co., Ltd., Dalian, China). Amplification was performed analysis. using a BIO-RAD iCycler Thermal Cycler (BIO-RAD, Hercules, CA, USA). Relative mRNA expression levels Measurement of serum lipid profiles were determined using the comparative critical thresh- Serum TC and triglyceride (TG) were determined at the old (Ct) method (in a separate tube). The housekeeping end of the experiment using commercial kits from Wako gene β-actin was used as a control for normalization. (Osaka, Japan). High-density lipoprotein-cholesterol (HDL-C) and low-density lipoprotein-cholesterol (LDL- Western blot assay C) were measured using sediment methods and a com- Western blot analyses of small intestine tissue and cul- mercial kit from Abcam (Cambridge, UK). Serum total tured cells were performed as described previously [7]. bile acid (TBA) was measured using a commercial kit Equivalent amounts of protein from each sample were from Blue Gene (Shanghai, China). All manufacturer’s prepared and separated using SDS-PAGE (12% gels) instructions were strictly followed. followed by electrotransfer to PVDF membranes. Mem- branes were incubated with blocking solution (Tris-buff- Analysis of bile acids in faeces and bile using HPLC-MS ered saline, 8% non-fat dry milk) for 2 h followed by The methods for the preparation and determination of incubation with specific antibodies at 4 °C overnight. bile acids in faeces and bile were performed according to Membranes were washed extensively in TBST (Tris- our previous study and reports from Steiner et al. [4, 6]. buffered saline with Tween, containing 0.5% Tween-20 A Shimadzu LC-20 AD high-performance liquid chro- in TBS) and incubated with horseradish peroxidase- matography system (Shimadzu, Kyoto, Japan) coupled to conjugated secondary antibodies in TBST for 1 h. an Applied Biosystecm 3200 Q TRAP mass spectrom- Membranes were washed further in TBST, and bands eter with an electrospray ionization (ESI) source were detected using chemiluminescence detection Li et al. Nutrition & Metabolism (2018) 15:37 Page 4 of 12 Table 3 Primer sequences used for mRNA quantification with qRT-PCR Target Genes Human / Mouse Forward (5′-3′) Reverse (5′-3′) Accession no. ASBT M AGGCTTTATCCTGTCTGTGGC CAGTGTGGAGCAAGTGGTCAT NM_011388.2 I-BABP H GAGAGCTGTGTTGTCTGCGT TTGAAGTTGCGGGCCTTTTC NM_001040442.1 M GATCATCACAGAGGTCCAGC CTCCATCTTCACGGTAGCCT NM_008375.2 OST-α M TCCCTGACGGCATCTATGAC ACAAGCACCTGGAACAGAGC NM_145932.3 OST-β M GGAACTGCTGGAAGAAATGC TTCTGTTTGCCAGGATGCTC NM_178933.2 gene name: a solute carrier family 10, member 2 (Slc10a2), protein name: apical sodium-dependent bile salt transporter (ASBT) gene name: fatty acid binding protein 6 (FABP6/fabp6), protein name: ileal bile acid binding protein (I-BABP) gene name: solute carrier family 51, alpha subunit (Slc51a), protein name: organic solute transporter (Ost-α) gene name: solute carrier family 51, beta subunit (Slc51b), protein name: organic solute transporter (Ost-β) agents. Blot densitometry was performed, and the bands Infrastructure of Cell Line Resource (Beijing, China) or were analysed using ImageJ software. Antibodies target- Sigma-Aldrich (St. Louis, MO, USA). ing the apical sodium-dependent bile acid transporter (ASBT), ileal bile acid binding protein (I-BABP) and or- Caprylic acid permeability assay through Caco-2 cell ganic solute transporter α/β (Ostα/β) were purchased monolayers from Abcam (Cambridge, UK). Secondary antibodies For bile acid reabsorption experiments, referring to the against goat IgG were obtained from Sun Biomedical report of Y. Wang, et al. [10], cells were seeded and Technology Co. (Beijing, China). grown on Millicell Hanging Cell Culture Inserts (0.4 μm, Millipore, Molsheim, France) for 21 days to obtain Immunofluorescence confluent and highly differentiated cell monolayers. The Ileum tissue fixed with 4% buffered paraformaldehyde formation of functional epithelial monolayers was moni- was embedded in paraffin, and 4-μm thick sections were tored via measurement of the transepithelial electrical prepared. Sections were deparaffinized and quenched in resistance (TEER) using a Millicell-ERS meter (Milli- 3% H O for 15 min to block endogenous peroxidase. pore) prior to experiments. Cellular morphology was 2 2 Sections were washed in PBS and incubated with an observed using an electron microscope, and permeability anti-I-BABP antibody in PBS (1:50 dilution) for 1 h at was determined using Lucifer Yellow (Sigma, MO, USA) 37 °C. A FITC-conjugated (fluorescein isothiocyanate) as a marker. antibody was added at a 1:50 dilution and incubated for The preparation of fatty acids and CA was performed as 0.5 h at 37 °C. Sections were washed, and PI (propidium described by X. Zhang, et al. [11]. Fatty acids and CA were iodide) was used to stain the nuclei. I-BABP was imaged measured and dissolved in ethanol, then were diluted with using a fluorescence microscope (BX60, Olympus, Ina, cell culture medium containing 20 mg/L endotoxin-free Japan). I-BABP was observed as green fluorescence, and BSA to a final concentration of 50, 100 or 200 μmol/L the nucleus was observed as red fluorescence [8]. (ethanol< 0.1%). The dissolved fatty acids and CA were in- cubated in a water bath at 37 °C for 1 h prior to addition Caco-2 cell culture to the cells. Caprylic acid (C8:0), capric acid (C10:0), ste- The Caco-2 cell line was obtained from the Cell Re- aric acid (C18:0) and oleic acid (C18:1) were purchased source Center, Peking Union Medical College (which is from Sigma-Aldrich (St. Louis, MO, USA). the headquarters of the National Infrastructure of Cell The apical (AP) and basolateral (BL) sides of the Line Resource) on Sept. 20, 2016. PCR and culture monolayer were washed with Hank’s Balanced Salt Solu- confirmed that the cell line was checked free of myco- tion (HBSS) and equilibrated in serum-free complete plasma contamination. The species origin of these cells medium for 15 min. The medium in the AP was re- was confirmed using PCR. The identity of the cell line placed with fresh medium-containing CA (200 μmmol/ was authenticated using STR profiling (FBI, CODIS) [9]. L) or mixed with one of the fatty acids (C8:0, C10:0, All of the results are available on the website (http://cell- C18:0 or C18:1) at 50, 100 or 200 μmol/L. Cell viability resource.cn). Caco-2 cells were cultured in Dulbecco’s of Caco-2 cells in different conditions was assessed by modified Eagle’s medium (DMEM) containing 10% foetal the WST-1 cell cytotoxicity assay (Fig. 1). The medium bovine serum (FBS), 1% penicillin-streptomycin, and 1% with one of the fatty acids was defined as the “C8:0, C10: non-essential-amino acids. Caco-2 cells were maintained 0, C18:0 or C18:1 group”. The “control group” contained at 37 °C in a humidified atmosphere containing 5% CO no fatty acids, and the “blank group” lacked CA and and 95% air. The medium was changed every 2 days. fatty acids. Only fresh medium was used in the BL. The The DMEM, FBS, 1% non-essential amino acids, and media from the AP and BL sides were removed 2 h later other materials were purchased from the National and stored for analyses of CA using HPLC-MS. The Li et al. Nutrition & Metabolism (2018) 15:37 Page 5 of 12 the experiments. The body weight of the CR-MCT group was significantly lower than that of the CR-LCT group after 12 weeks. There were no differences in body weight between the CR-MCT and CR groups until the 16th week (Fig. 2). Serum TC and LDL-C levels in the CR- MCT group were significantly lower than those in the CR-LCT and CR groups at the end of the study, and the HDL-C/LDL-C ratio was significantly higher in the CR- MCT group than in the CR-LCT group (Table 4). Effects of MCT on bile acid profiles in bile and faeces The concentrations of bile acids, including CA, CDCA, LCA, UDCA and TLCA, in the faeces of the CR-MCT group were significantly higher than those in the other Fig. 1 Cell viability of Caco-2 cells in different conditions. Cell viabil- groups. TCDCA in the CR-MCT group was higher than ity percentage = OD in experiment group /OD in control group× 100% that in the CR-LCT group. The excretions of total pri- mary bile acids (CA, CDCA, TCA, TCDCA, GCA and GCDCA), secondary bile acids (DCA, LCA, UDCA, apparent permeability (Papp) was calculated using the TLCA, TDCA and GDCA) and total bile acids were sig- following equation: Papp = dQ/dt×1/C A (dQ is the nificantly different in the CR-MCT group compared to compound appearance in the receiver compartment, dt the other groups (Table 5). is the time, C is the concentration in the donor com- There were significant differences in the excretion of partment, and A is the surface area of the insert). CA, CDCA, TCDCA and GCDCA in bile between the CR-MCT group and the other groups. The excretions of I-BABP expression levels in Caco-2 cells total primary bile acids and total bile acids in the CR- Caco-2 cells were seeded into a 6-well plate (Corning, MCT group were higher than those in the CR and CR- NY, USA) and cultured to total confluence with high dif- LCT groups (Table 6). ferentiation to confirm the effects of MCFAs on I-BABP [12]. The culture medium was replaced prior to experi- ments with medium containing delipidized FBS for 24 h. Effects of MCT on the mRNA and protein expression of Cells were washed with ice-cold phosphate-buffered sa- bile acid transporters in the small intestine line (PBS) and incubated with fresh medium containing The mRNA expression levels of I-BABP in the small in- CA at 200 μmol/L (defined as CA group) or CA mixed testine of C57BL/6 J mice in the CR-MCT groups was with one of the fatty acids (C8:0, C10:0, C18:0 or C18:1) lower than that in the other groups. However, the tran- at 200 μmol/L (defined as the “C8:0+CA, C10:0+CA, scription levels of ASBT and Ostα/β in the small intes- C18:0+CA or C18:1+CA group”) or C8:0 or C10:0 at tine were not different between groups (Fig. 1). Similar 200 μmol/L without CA (defined as “C8:0 group and results were observed in the protein expression levels of C10:0 group”) for 24 h. And the blank group was with- I-BABP, ASBT and Ostα/β in the small intestine using out fatty acids and CA. The medium was removed, and Western blot analysis (Fig. 3). cells were washed three times with ice-cold PBS. Total The I-BABP expression level detected by immuno- RNA and protein were isolated and collected for further fluorescence in the CR-MCT group decreased signifi- analyses of I-BABP mRNA and protein expression levels. cantly compared to the other groups. There were no Statistical analysis Table 4 Blood lipid profiles in C57BL/6 J mice (n = 12) All data are expressed as the mean ± SD. Data were ana- Blood lipid profiles CR-MCT CR-LCT CR lysed using one-way analysis of variance followed by the a,b TC (mmol/L) 3.52 ± 0.65 4.13 ± 0.49 4.01 ± 0.33 independent t-test to determine the significance of dif- TG (mmol/L) 0.70 ± 0.29 0.88 ± 0.24 0.86 ± 0.15 ference between groups using SPSS software version 17. HDL- C (mmol/L) 3.12 ± 0.57 3.34 ± 0.39 3.21 ± 0.25 0. P < 0.05 was considered statistically significant. a,b LDL-C (mmol/L) 0.43 ± 0.11 0.66 ± 0.18 0.61 ± 0.24 Results HDL-C/LDL-C 7.54 ± 1.74 5.44 ± 1.61 6.17 ± 2.65 Effects of MCT on body weight and blood lipid profiles TBA (mmol/L) 16.23 ± 6.51 17.71 ± 5.84 18.23 ± 11.91 No significant differences in body weight were observed a P < 0.05, versus CR-LCT group between the CR-MCT, CR-LCT and CR groups prior to P < 0.05, versus CR group Li et al. Nutrition & Metabolism (2018) 15:37 Page 6 of 12 Table 5 Bile acid profiles in faeces in C57BL/6 J mice after 16 weeks (n =5) BAs in Faeces (mg/3 d) CR-MCT CR-LCT CR a,b CA 115.11 ± 14.05 69.48 ± 11.14 78.03 ± 12.82 a,b CDCA 10.62 ± 1.44 4.57 ± 1.01 4.52 ± 0.96 TCA 2.43 ± 0.45 2.7 ± 0.31 2.84 ± 0.43 TCDCA 3.77 ± 0.27 3.05 ± 0.06 3.24 ± 0.98 GCA 1.05 ± 0.27 1.16 ± 0.33 1.33 ± 0.32 GCDCA 7.00 ± 2.92 4.94 ± 2.76 5.38 ± 2.25 a,b Total Primary BAs 139.98 ± 11.44 85.89 ± 10.7 95.33 ± 13.89 DCA 2.1 ± 0.22 1.98 ± 0.13 1.62 ± 0.42 a.b LCA 8.71 ± 0.9 4.15 ± 0.69 4.55 ± 0.19 a.b UDCA 6.89 ± 0.99 5.37 ± 0.73 4.9 ± 0.89 a.b TLCA 0.76 ± 0.02 0.48 ± 0.13 0.49 ± 0.05 TDCA 3.82 ± 0.28 3.70 ± 0.14 3.26 ± 0.48 GDCA 1.38 ± 0.45 1.18 ± 0.01 1.48 ± 0.35 a,b Total Secondary BAs 23.66 ± 1.53 16.87 ± 1.37 16.3 ± 1.67 a,b Total BAs 163.64 ± 11.6 102.77 ± 11.14 111.62 ± 13.96 P < 0.05, versus CR-LCT group P < 0.05, versus CR group significant change in the I-BABP expression levels in the 500 Ω·cm , which was in line with the the integrity CR-LCT group and CR group (Fig. 4). requirements of Caco-2 cell monolayers [13] (Table 7). The Papp values (apical-to-basolateral) of CA across Caco-2 cell monolayers were significantly lower in the Effects of MCFAs on cholic acid permeability across Caco- C8:0 and C10:0 groups than in the LCFA groups (C18:0 2 cell monolayers group and C18:1 group) and control group for the three There was no significant difference in the TEER value of fatty acid concentrations (except the C10:0 group com- Caco-2 monolayer cell model in different experimental pared with C18:1 group at 50 μmol/L). This change was conditions. All of TEER values were greater than more obvious with increased fatty acid concentration. The effect of C8:0 was more significant than that of C10: Table 6 Bile acid profiles in bile in C57BL/6 J mice after 0 at 200 μmol/L (Table 7). 16 weeks (n =5) BAs in bile (mmol/L) CR-MCT CR-LCT CR Effects of MCFAs on the I-BABP mRNA and protein a,b CA 92.00 ± 16.05 71.42 ± 8.00 62.29 ± 6.70 expression in Caco-2 cells a,b CDCA 3.65 ± 0.48 2.38 ± 0.27 2.50 ± 0.66 RT-PCR and Western blot analyses demonstrated that TCA 1.53 ± 0.22 1.43 ± 1.00 1.73 ± 0.62 (Fig. 5) the expression level of I-BABP in Caco-2 cells a,b TCDCA 2.97 ± 0.77 2.04 ± 0.38 1.85 ± 0.25 treated with MCFAs or with CA (those were C8:0 group, C10:0 group, C8:0 + CA group and C10:0 + CA group) GCA 1.75 ± 1.05 1.70 ± 0.57 1.52 ± 0.10 a,b were much lower than the level in those treated with GCDCA 0.56 ± 0.07 0.23 ± 0.05 0.25 ± 0.03 LCFAs with CA (those were C18:0 + CA group, C18:1 + a,b Total Primary BAs 102.47 ± 17.51 79.19 ± 6.75 70.13 ± 7.51 CA group) and CA group. DCA 0.67 ± 0.09 0.71 ± 0.04 0.66 ± 0.13 LCA 2.03 ± 0.11 1.90 ± 0.28 1.97 ± 0.10 Discussion UDCA 0.30 ± 0.05 0.27 ± 0.04 0.27 ± 0.05 MCFAs are primarily composed of glycerides of caprylic TLCA 0.12 ± 0.02 0.14 ± 0.02 0.14 ± 0.02 acids (C8:0) and capric acids (C10:0). Some previous in- TDCA 0.13 ± 0.04 0.11 ± 0.03 0.10 ± 0.03 vestigations reported that MCTs/MCFAs were beneficial GDCA 0.89 ± 0.13 0.95 ± 0.22 0.97 ± 0.18 in lipid metabolism and some diseases (e.g., CVDs and Total Secondary BAs 4.14 ± 0.20 4.09 ± 0.44 4.11 ± 0.24 Alzheimer’s disease) [14–19]. MCTs in our study slowed a,b the increase in body weight and altered serum lipid Total BAs 106.61 ± 17.68 83.28 ± 6.67 74.25 ± 7.39 a profiles (lower levels of TC and LDL-C in the CR-MCT P < 0.05, versus CR-LCT group P < 0.05, versus CR group group) in hypercholesterolemic C57BL/6 J mice. The Li et al. Nutrition & Metabolism (2018) 15:37 Page 7 of 12 a b Fig. 2 Body weights in C57BL/6J mice during 16 weeks (n = 12). P < 0.05, versus CR-LCT group; P < 0.05, versus CR group results of serum lipid profiles (lower levels of TC and (MCTs/LCTs) was added to basal diets, leading to differ- LDL-C) were consistent with other previous studies ent levels of total energy between groups. Addition of [4, 5, 7, 17] which were in different experiment condi- MCTs did not result in a weight increase even though the tions, such as diet formula (MCT or MCFAs with energy contributed from fats was increased. Compared to cholesterol-rich diet or high-fat diet) and animal models MCFAs, MCTs exhibit more stable physical and chemical (obesity mice or hypercholesterolemic mice). Increased properties, particularly a stable fatty acid composition serum. TC is a main risk factor of atherosclerosis. HDL-C at room temperature. The previous experimental diet is regarded as “good cholesterol”, and LDL-C is labelled required refrigeration because of the volatility and in- “bad cholesterol” [1, 20]. MCT may be a protective agent stability of fatty acids. As a promising functional in- for the cardiovascular system. The absence of significant gredient in food and pharmacy industry applications differences in weight changes in the CR-MCT and CR [21, 22], MCTs are more conveniently stored and groups prior to the 12th week might be associated with provide a more stable nutrient content, which is prac- the composition of the experimental diets in which oil tical for future applications. Fig. 3 The mRNA and protein expression of bile acid absorption transporters in C57BL/6J mice (n = 5). Total RNA and total protein were extracted from small intestine tissues. mRNA transcription levels were measured using real-time PCR analysis, and protein expression levels were measured using Western blot analysis. The housekeeping gene β-actin was used to normalize expression levels. Critical threshold (Ct) values were compared a b in a, while relative light density values were compared in c. P < 0.05 versus CR-LCT group; P < 0.05 versus CR group; a. critical threshold; b. section of blots; c. grey-scale analysis Li et al. Nutrition & Metabolism (2018) 15:37 Page 8 of 12 Table 7 The Papp values of CA across Caco-2 monolayers treated with various fatty acids and the TEER values (n =5) Group C8:0 C10:0 C18:0 C18:1 Control Condition Vehicle + + + + + CA + + + + + C8:0 + –– – – C10:0 – + –– – C18:0 –– + –– C18:1 –– – + – Fatty acid concentration 0 μmol/L P –– – – 1.16 ± 0.14 app TEER 622.80 ± 56.03 e a,c,d a,c 50 μmol/L P 0.87 ± 0.06 0.93 ± 0.13 1.26 ± 0.19 1.06 ± 0.02 – app TEER 669.80 ± 44.56 713.60 ± 87.06 653.40 ± 59.08 696.60 ± 116.57 e a,c,d a,c,d 100 μmol/L P 0.74 ± 0.03 0.81 ± 0.06 1.06 ± 0.21 1.1 ± 0.09 – app TEER 710.60 ± 115.01 673.80 ± 60.20 628.40 ± 58.92 668.00 ± 124.00 e a,b,c,d a,c,d 200 μmol/L P 0.43 ± 0.07 0.64 ± 0.04 1.11 ± 0.16 1.02 ± 0.09 – app TEER 707.00 ± 134.62 591.20 ± 47.56 651.00 ± 57.72 586.20 ± 53.60 P < 0.05, versus control group P < 0.05, versus C10:0 P < 0.05, versus C18:0 group P < 0.05, versus C18:1 group Papp of CA (AP→ BL, cm/s × 10–6) f 2 TEER values of Caco-2 monolayers (Ω·cm ) Primary bile acids are converted from cholesterol into homeostasis. The faecal excretion of bile acids is a major CA and CDCA in the liver and combined with taurine pathway for the elimination of excessive cholesterol [23]. and glycine to form binding primary bile acids, which HPLC-MS was used in our study to evaluate the differ- enter into bile. Gallbladder contraction allows the pri- ences in bile acids in the bile and faeces. The excretion of mary bile acids to enter the small intestines and form total primary and secondary bile acids in faeces after treat- secondary bile acids in the upper part of the ileum and ment was significantly higher in the CR-MCT group. colon (DCA, LCA and UDCA) [3]. Enterohepatic circula- While increased production of bile acids in the liver can tion is essential for the maintenance of cholesterol lead to increased reabsorption in the small intestine [24], Fig. 4 Immunofluorescence of I-BABP in the small intestine in C57BL/6J mice. The bar represents 50 μm in the image. I-BABP was observed as green fluorescence, and the nucleus was observed as red fluorescence Li et al. Nutrition & Metabolism (2018) 15:37 Page 9 of 12 Fig. 5 The mRNA and protein expression of I-BABP in Caco-2 cells (n = 5). Total RNA and total protein were extracted from Caco-2 cells, the mRNA transcription level was measured using real-time PCR analysis, and the protein expression level was measured using Western blot analysis. The housekeeping gene β-actin was used to normalize the expression levels, and Critical threshold (Ct) values were compared in a, while relative a b c light density values were compared in c. P < 0.05 versus CA group; P < 0.05 versus C18:0 + CA; P < 0.05 versus C18:1 + CA group; a. critical threshold; b. section of blots; c. grey-scale analysis our previous data and this work show that MCT not only the related transporter (I-BABP) in the cytoplasm. The promoted bile acid synthesis in the liver [4, 5] but also re- lack of change in apical ASBT or basal Ostα/β may par- duce bile acid reabsorption in the intestine, thus facilitat- tially explain the lack of alterations in serum total bile ing removal of excess cholesterol from the body. acids, although faecal bile acids increased. I-BABP may We specifically focused on the bile acid transport sys- play a critical role in the regulation of bile acid resorp- tem, which involves the absorption of bile acids into in- tion as a buffering agent in the cytoplasm. testinal epithelial cells, to better understand the We preliminarily hypothesized that MCTs may re- mechanisms underlying bile acid uptake in the small in- duce bile acid reabsorption in the small intestine par- testine. Bile acids are reabsorbed from the apical side in tially via inhibition of I-BABP expression. We the terminal ileum via ASBT. Bile acids enter entero- performed a permeability assay of bile acids through cytes and bind to I-BABP for transport to the basal Caco-2 cell monolayers for further confirmation. The plane and absorption into the vein via Ostα/β [25]. I- Caco-2 cell model is an effective tool to investigate BABP in mice fed an MCT diet exhibited a significant the absorption process of orally administered medi- decrease, but no significant changes in ASBT or Ostα/β cines or nutrients [30]. C8:0 and C10:0 decreased the expression were found. MCTs reduced bile acid re- apparent permeability (Papp) of CA (which was highly absorption in the ileum, which partially explains the dif- excreted in mice fed with MCTs) in the medium ference in the content of bile acids between stool and (from AP to BL) compared to C18:0 and C18:1 (the bile. The transport of intracellular bile acids in the enter- highest content of long-chain saturated fatty acids ocytes was mediated via cytosolic I-BABP, which is the and long-chain unsaturated fatty acids in the experi- bile acid cytoplasmic transporter in the fatty acid bind- mental diet). The reduction in CA permeation in ing protein (FABP) family with a similar structure [26]. Caco-2 cell monolayers treated with MCFAs indicated I-BABP combines with the ASBT transporter to promote that MCFAs likely decreased bile acid reabsorption in bile acid uptake and transported bile acids into the basi- the human small intestine. We investigated whether lar membrane in the cytoplasm. Therefore, I-BABP may MCFAs affected I-BABP expression to examine the be the important protein involved in the transport of mechanism of this phenomenon. Caco-2 cells were bile acids through intestinal epithelial cells [27–29]. The cultured with CA-mixed fatty acids for analysis. increase of bile acids (primarily CA) in the faeces in the MCFAs (C8:0 or C10:0) with or without CA downreg- present study may be due to the decreased expression of ulated I-BABP expression, and CA alone or with Li et al. Nutrition & Metabolism (2018) 15:37 Page 10 of 12 Fig. 6 Graphical abstract of the effects of MCTs/MCFAs on reducing intestinal bile acid reabsorption. Arrows (↑) represent an increasing level and upregulation of activity or protein or mRNA expression. Arrows (↓) represent downregulation LCFAs (C18:0 or C18:1) greatly induced I-BABP ex- Conclusion pression. The increase in bile acids, which are the bil- MCTs/MCFAs reduce serum cholesterol levels via a par- iary factors responsible for the induction of I-BABP tial increase in the excretion of bile acids probably expression, upregulated I-BABP expression in a time- through the reduction of absorption in the small intes- and dose-dependent manner [12, 31]. Then, more bile tines. One possible mechanism is associated with re- acids were reabsorbed into the small intestine. CA in- duced expression of I-BABP (Graphical abstract of the duced I-BABP expression levels in our study. How- effects of MCTs/MCFAs on reducing intestinal bile acid ever, this change was not observed when a mixture of reabsorption was shown in Fig. 6). MCTs/MCFAs may CA and MCFAs was used. The same result was seen exert potential therapeutic and protective roles in this in MCFAs without CA. It implied MCT might dir- process, but the regulatory mechanism is not clear. ectly affect I-BABP expression to partially reduce the transcellular permeation of bile acids in Caco-2 cells. Abbreviations AP: Apical side; ASBT: Apical sodium-dependent bile salt transporter; The bile acid transport system performs various regu- BL: Basolateral side; C10:0: Capric acid; C18:0: Stearic acid; C18:1: Oleic acid; latory mechanisms [32, 33]. Farnesoid X receptor (FXR) C8:0: Caprylic acid; CA: Cholic acid; CDCA: Chenodeoxycholic acid; CHD: Coronary plays a critical role in enterohepatic circulation of bile heart disease; CR: Cholesterol-rich; CR-LCT: Cholesterol-rich and long-chain trigly- ceride; CR-MCT: Cholesterol-rich and medium-chain triglyceride; Ct: Critical acids by regulating bile acid synthesis, biliary bile acid threshold; CVDs: Cardiovascular diseases; DCA: Deoxycholic acid; secretion, intestinal bile acid reabsorption and secretion, DMEM: Dulbecco’s modified Eagle’s medium; ESI: Electrospray ionization; and bile acid uptake into hepatocytes. In the ileum, bile FABP6:Atty acid binding protein 6;FBS:Foetalbovine serum; FITC: Fluorescein isothiocyanate; GCA: Glycocholic acid; acids bind to I-BABP, which is highly induced by FXR GCDCA: Glycochenodeoxycholic acid; GDCA: Glycodeoxycholic acid; [34]. Bile acids are excreted into portal circulation by HBSS: Hank’s Balanced Salt Solution; HDL-C: High density lipoprotein- OSTα/β located in the basolateral membrane of entero- cholesterol; HPLC-MS: High performance liquid chromatography-mass spectrometry; I-BABP: Ileal bile acid binding protein; LCA: Lithocholicacid; cytes [35], which is induced FXR either. Meanwhile FXR LCFAs: Long-chain fatty acids; LCTs: Long-chain triglycerides; LDL-C: Low- is inversely correlated to the bile acid synthetase density lipoprotein cholesterol; MCFAs: Medium-chain fatty acids; CYP7A1 expression and regulating the bile acid trans- MCTs: Medium-chain triglyceride; Ost-a: Organic solute transporter; Ost- β: Protein name: organic solute transporter; Papp: Apparent permeability; porter expression in the liver.Thus, we considered PBS: Phosphate-buffered saline; PI: Propidium iodide; qRT- whether MCT affect FXR to increase the excretion of PCR: Quantitative real-time PCR; Slc51a: Solute carrier family 51, alpha fecal bile acids, and reduce the reabsorption of bile acids subunit; Slc51b: Solute carrier family 51, beta subunit; TBA: Total bile acid; TBST: Tris buffered saline with tween; TC: Total cholesterol; in small intestine, and inhibit the expression of I-BABP. TCA: Taurocholic acid; TCDCA: Taurochenodeoxycholic acid; Further research was needed to clarify the mechanism of TDCA: Taurodeoxycholic acid; TEER: Transepithelial electrical resistance; MCT lowering cholesterol by bile acid metabolism. TG: Triglyceride; TLCA: Taurolithocholic acid; UDCA: Ursodeoxycholic acid Li et al. Nutrition & Metabolism (2018) 15:37 Page 11 of 12 Acknowledgements 10. Wang Y, Yi X, Ghanam K, Zhang S, Zhao T, Zhu X. Berberine decreases We are grateful to Mr. Shengming Wu and Mrs. Zheng Li from the Academy cholesterol levels in rats through multiple mechanisms, including inhibition of Military Medical Sciences for their kind technical support. of cholesterol absorption. Metabolism. 2014;63:1167–77. 11. Zhang X, Zhang Y, Liu Y, Wang J, Xu Q, Yu X, Yang X, Liu Z, Xue C. Funding Medium-chain triglycerides promote macrophage reverse cholesterol This work was partially supported by the National Natural Science Fund of transport and improve atherosclerosis in ApoE-deficient mice fed a high-fat China (no. 81172667). diet. Nutr Res. 2016;36:964–73. 12. Kanda T, Foucand L, Nakamura Y, Niot I, Besnard P, Fujita M, Sakai Y, Availability of data and materials Hatakeyama K, Ono T, Fujii H. Regulation of expression of human intestinal Please contact author (Huizi Li) for data or material requests. bile acid-binding protein in Caco-2 cells. Biochem J. 1998;330(Pt 1):261–5. 13. Ranaldi G, Consalvo R, Sambuy Y, Scarino ML. Permeability characteristics of Authors’ contributions parental and clonal human intestinal Caco-2 cell lines differentiated in CG and CX designed the research and provided research funding. HL, YL, XZ serum-supplemented and serum-free media. Toxicol in Vitro. 2003;17:761–7. and QX conducted the research. HL and YZ analysed the data. HL wrote the 14. Beermann C, Jelinek J, Reinecker T, Hauenschild A, Boehm G, Klor HU. Short first draft. All authors read and approved the final manuscript. term effects of dietary medium-chain fatty acids and n-3 long-chain polyunsaturated fatty acids on the fat metabolism of healthy volunteers. Ethics approval and consent to participate Lipids Health Dis. 2003;2:10. All experimental procedures were approved by the Animal Care and Use 15. Rial SA, Karelis AD, Bergeron KF, Mounier C. Gut microbiota and metabolic Committee of the Chinese PLA General Hospital. health: the potential beneficial effects of a medium chain triglyceride diet in obese individuals. Nutrients. 2016;8;281–300. Consent for publication 16. van de Heijning BJM, Oosting A, Kegler D, van der Beek EM. An increased The authors consent to the publication of the data. dietary supply of medium-chain fatty acids during early weaning in rodents prevents excessive fat accumulation in adulthood. Nutrients. 2017;9:631–47. Competing interests 17. Liu YH, Zhang Y, Xu Q, Yu XM, Zhang XS, Wang J, Xue C, Yang XY, Zhang The authors declare that they have no competing interests. RX, Xue CY. Increased norepinephrine by medium-chain triglyceride attributable to lipolysis in white and brown adipose tissue of C57BL/6J mice. Biosci Biotechnol Biochem. 2012;76:1213–8. Publisher’sNote 18. Kondreddy VK, Anikisetty M, Naidu KA. Medium-chain triglycerides and Springer Nature remains neutral with regard to jurisdictional claims in monounsaturated fatty acids potentiate the beneficial effects of fish oil on published maps and institutional affiliations. selected cardiovascular risk factors in rats. J Nutr Biochem. 2016;28:91–102. 19. Augustin K, Khabbush A, Williams S, Eaton S, Orford M, Cross JH, Heales SJR, Author details Walker MC, Williams RSB. Mechanisms of action for the medium-chain Department of Nutrition, Tianjin Institute of Environmental & Operational triglyceride ketogenic diet in neurological and metabolic disorders. Lancet Medicine, Tianjin 300050, China. Department of Nutrition, PLA Rocket Force Neurol. 2018;17:84–93. General Hospital, Beijing 100088, China. Department of Nutrition, Chinese 20. Elshourbagy NA, Meyers HV, Abdel-Meguid SS. Cholesterol: the good, the PLA General Hospital, Beijing 100853, China. bad, and the ugly - therapeutic targets for the treatment of dyslipidemia. Med Princ Pract. 2014;23:99–111. Received: 25 January 2018 Accepted: 13 April 2018 21. Ren T, Cong L, Wang Y, Tang Y, Tian B, Lin X, Zhang Y, Tang X. Lipid emulsions in parenteral nutrition: current applications and future developments. Expert Opin Drug Deliv. 2013;10:1533–49. References 22. Liu YM, Wang HS. Medium-chain triglyceride ketogenic diet, an effective 1. Tzoulaki I, Elliott P, Kontis V, Ezzati M. Worldwide exposures to treatment for drug-resistant epilepsy and a comparison with other cardiovascular risk factors and associated health effects: current knowledge ketogenic diets. Biom J. 2013;36:9–15. and data gaps. Circulation. 2016;133:2314–33. 23. Landrier JF, Grober J, Zaghini I, Besnard P. Regulation of the ileal bile acid- 2. Moran A, Gu D, Zhao D, Coxson P, Wang YC, Chen CS, Liu J, Cheng J, binding protein gene: an approach to determine its physiological Bibbins-Domingo K, Shen YM, et al. Future cardiovascular disease in China: function(s). Mol Cell Biochem. 2002;239:149–55. markov model and risk factor scenario projections from the coronary heart 24. Ferrebee CB, Dawson PA. Metabolic effects of intestinal absorption and disease policy model-China. Circ Cardiovasc Qual Outcomes. 2010;3:243–52. enterohepatic cycling of bile acids. Acta Pharm Sin B. 2015;5:129–34. 3. Chiang JY. Bile acid metabolism and signaling. Compr Physiol. 2013;3:1191–212. 25. Alrefai WA, Gill RK. Bile acid transporters: structure, function, regulation and 4. Xu Q, Xue C, Zhang Y, Liu Y, Wang J, Yu X, Zhang X, Zhang R, Yang X, Guo pathophysiological implications. Pharm Res. 2007;24:1803–23. C. Medium-chain fatty acids enhanced the excretion of fecal cholesterol 26. Smathers RL, Petersen DR. The human fatty acid-binding protein family: and cholic acid in C57BL/6J mice fed a cholesterol-rich diet. Biosci evolutionary divergences and functions. Hum Genomics. 2011;5:170–91. Biotechnol Biochem. 2013;77:1390–6. 27. Badiee M, Tochtrop GP. Bile acid recognition by mouse Ileal bile acid 5. Liu Y, Zhang Y, Zhang X, Xu Q, Yang X, Xue C. Medium-chain fatty acids binding protein. ACS Chem Biol. 2017;12:3049–56. reduce serum cholesterol by regulating the metabolism of bile acid in 28. Nakahara M, Furuya N, Takagaki K, Sugaya T, Hirota K, Fukamizu A, C57BL/6J mice. Food Funct. 2017;8:291–8. Kanda T, Fujii H, Sato R. Ileal bile acid-binding protein, functionally 6. Steiner C, von Eckardstein A, Rentsch KM. Quantification of the 15 major associated with the Farnesoid X receptor or the Ileal bile acid human bile acids and their precursor 7alpha-hydroxy-4-cholesten-3-one in transporter, regulates bile acid activity in the small intestine. J Biol serum by liquid chromatography-tandem mass spectrometry. J Chromatogr Chem. 2005;280:42283–9. B Analyt Technol Biomed Life Sci. 2010;878:2870–80. 29. Hwang ST, Urizar NL, Moore DD, Henning SJ. Bile acids regulate the 7. Zhang Y, Xu Q, Liu YH, Zhang XS, Wang J, Yu XM, Zhang RX, Xue C, Yang ontogenic expression of ileal bile acid binding protein in the rat via the XY, Xue CY. Medium-chain triglyceride activated Brown adipose tissue and farnesoid X receptor. Gastroenterology. 2002;122:1483–92. induced reduction of fat mass in C57BL/6J mice fed high-fat diet. Biomed 30. Sun H, Chow ECY, Liu S, Du Y, Pang KS. The Caco-2 cell monolayer: Environ Sci. 2015;28:97–104. usefulness and limitations. Expert Opin Drug Metab Toxicol. 2008;4:395–411. 8. Dvorak K, Watts GS, Ramsey L, Holubec H, Payne CM, Bernstein C, Jenkins 31. Kanda T, Niot I, Foucaud L, Fujii H, Bernard A, Ono T, Besnard P. Effect of GJ, Sampliner RE, Prasad A, Garewal HS, Bernstein H. Expression of bile acid bile on the intestinal bile-acid binding protein (I-BABP) expression. In vitro transporting proteins in Barrett's esophagus and esophageal and in vivo studies. FEBS Lett. 1996;384:131–4. adenocarcinoma. Am J Gastroenterol. 2009;104:302–9. 9. McNamara-Schroeder K, Olonan C, Chu S, Montoya MC, Alviri M, Ginty S, 32. Klaassen CD, Aleksunes LM. Xenobiotic, bile acid, and cholesterol Love JJ. DNA fingerprint analysis of three short tandem repeat (STR) loci for transporters: function and regulation. Pharmacol Rev. 2010;62:1–96. biochemistry and forensic science laboratory courses. Biochem Mol Biol 33. Zhang X, Osaka T, Tsuneda S. Bacterial metabolites directly modulate Educ. 2006;34:378–83. farnesoid X receptor activity. Nutr Metab (Lond). 2015;12:48. Li et al. Nutrition & Metabolism (2018) 15:37 Page 12 of 12 34. Tu H, Okamoto AY, Shan B. FXR, a bile acid receptor and biological sensor. Trends Cardiovasc Med. 2000;10:30–5. 35. Dawson PA, Hubbert M, Haywood J, Craddock AL, Zerangue N, Christian WV, Ballatori N. The heteromeric organic solute transporter alpha-beta, Ostalpha-Ostbeta, is an ileal basolateral bile acid transporter. J Biol Chem. 2005;280:6960–8. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nutrition & Metabolism Springer Journals

Medium-chain fatty acids decrease serum cholesterol via reduction of intestinal bile acid reabsorption in C57BL/6J mice

Free
12 pages

Loading next page...
 
/lp/springer_journal/medium-chain-fatty-acids-decrease-serum-cholesterol-via-reduction-of-E0UTApg40f
Publisher
BioMed Central
Copyright
Copyright © 2018 by The Author(s).
Subject
Medicine & Public Health; Clinical Nutrition; Metabolic Diseases
eISSN
1743-7075
D.O.I.
10.1186/s12986-018-0267-x
Publisher site
See Article on Publisher Site

Abstract

Background: Bile acids play a pivotal role in cholesterol metabolism via the enterohepatic circulation. This study investigated the effects of medium-chain triglycerides (MCTs)/medium-chain fatty acids (MCFAs) on the reduction of bile acid absorption in the small intestine and the mechanisms of action in vivo and partially verified in vitro. Methods: Thirty-six C57BL/6 J mice with hypercholesterolaemia were randomly divided into 3 groups: fed a cholesterol-rich diet (CR group), fed a cholesterol-rich and medium-chain triglyceride diet (CR-MCT group) and fed a cholesterol-rich and long-chain triglyceride diet (CR-LCT group). Body weights and blood lipid profiles were measured in all groups after 16 weeks of treatment. The concentrations of bile acids in bile and faeces were analysed using HPLC- MS (high-performance liquid chromatography-mass spectrometry). Gene transcription and the expression levels associated with bile acid absorption in the small intestines were determined using real-time PCR and Western blot. Ileal bile acid binding protein (I-BABP) was analysed using immunofluorescence. The effects of MCFAs on the permeability of bile acid (cholic acid, CA) in Caco-2 cell monolayers and I-BABP expression levels in Caco-2 cells treated with caprylic acid (C8:0), capric acid (C10:0), stearic acid (C18:0) and oleic acid (C18:1) were determined. Results: Mice in the CR-MCT group exhibited lower body weights and serum total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) levels and a higher HDL-C/LDL-C ratio than the CR-LCT group (P <0.05). The concentrations of primary bile acids (primarily CA) and secondary bile acids in faeces and secondary bile acids in bile in the CR-MCT group were significantly higher than in the CR-LCT group (P < 0.05). C8:0 and C10:0 decreased the permeability of CA in Caco-2 cell monolayers. MCT/MCFAs (C8:0 and C10:0) inhibited I-BABP gene expression in the small intestines and Caco-2 cells (P <0.05). Conclusions: MCT slowed the body weight increase and promoted the excretion of bile acids. MCT lowered serum cholesterol levels at least partially via reduction of bile acid absorption in the small intestine by inhibition of I-BABP expression. Our results provide the basis for clinical trials of MCT as a dietary supplement for lowering plasma cholesterol and reducing risk of CHD. Keywords: Medium-chain triglyceride, Medium-chain fatty acids, Bile acids, Ileal bile acid binding protein, Caco-2 cells * Correspondence: cnxcy@163.com; guocjtj@126.com Department of Nutrition, Chinese PLA General Hospital, Beijing 100853, China Department of Nutrition, Tianjin Institute of Environmental & Operational Medicine, Tianjin 300050, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Li et al. Nutrition & Metabolism (2018) 15:37 Page 2 of 12 Background Mice were fed a basal diet (AIN-93G diet, purchased The latest data from the World Health Organization re- from the Academy of Military Medical Science) during veal that cardiovascular diseases (CVDs), principally the first week for adaptation. Ten mice were randomly stroke and coronary heart disease (CHD), remain the chosen and fed a basal diet as the normal control, and major cause of human death worldwide and claim the the remaining mice were fed a cholesterol-rich (CR) diet lives of 17.7 million people annually (31% of all global modified from the AIN-96G diet. Blood samples were deaths) (http://www.who.int/cardiovascular_diseases/en/). collected from the mandibular venous plexus two weeks High blood cholesterol is a crucial risk factor for CVDs later. Mice with serum TC levels that were 2 standard [1]. A projected increase of serum total cholesterol deviations greater than the normal control (accounting (TC) increase of 0.58 mmol/L (22.4 mg/dL) in for 67% of mice fed the CR diet) were randomly assigned Chinese men and 0.55 mmol/L (21.6 mg/dL) in Chinese to three groups (n = 12 in each group). Each group was women from 2010 to 2030 would produce the highest in- fed a different diet for 16 weeks (Table 1): cholesterol- crease in CHD events (increase by 31% of CHD baseline rich and medium-chain triglyceride (CR-MCT), events in men and 15% in women) of all risk factors cholesterol-rich and long-chain triglyceride (CR-LCT) or modeled in China [2]. CR. Nisshin Oillio (Tokyo, Japan) donated the MCTs Bile acids play a pivotal role in cholesterol metabolism (C8:0 and C10:0) and LCTs (long-chain triglycerides, soy via the enterohepatic circulation. Bile acids are con- bean oil). Cholesterol was purchased from Sigma- verted from cholesterol in liver cells, and 90%–95% of Aldrich (St. Louis, MO, USA). The Beijing Institute of bile acids are reabsorbed into the intestinal epithelial Nutrition Resources (Beijing, China) measured the fatty cells at the end of the ileum and transported to the acid compositions of the CR-MCT and CR-LCT diets blood circulation to re-enter liver cells. Only approxi- (Table 2). Body weights and food intake were monitored mately 5% of bile acids in the intestine are excreted in weekly. the stool. The physiological significance of enterohepatic circulation of bile acids is to make the limited bile acid Blood, ileum, bile and faeces sampling reusable for maintaining cholesterol homeostasis, and to Five mice were chosen randomly from each group after facilitate the elimination of excess cholesterol from the 16 weeks of feeding to record diet intake and faeces ex- body [3]. cretion using separate metabolic cages for 3 days. Faeces Medium-chain triglycerides (MCTs) with 8–12 carbon were lyophilized, weighed, pulverised, and stored at − atoms is digested by lipase in the stomach and duode- 80 °C for further analysis. All mice were fasted overnight num into glycerol and medium-chain fatty acids (approximately 12 h) prior to blood sample collection (MCFAs). Our previous studies confirmed that a diet Table 1 Composition and nutrition factors of experimental diets containing MCFAs reduced serum total cholesterol (TC) for C57BL/6 J mice via promotion of bile acid synthesis in the liver and in- Ingredients CR-MCT CR-LCT CR creased excretion of bile acids in faeces [4, 5]. We Basal diet (%) 86.7 86.7 88.7 hypothesized that the small intestine also plays an essen- tial role in the maintenance of cholesterol balance. Lard (%) 10 10 10 Therefore, the present study investigated whether MCT Cholesterol (%) 1 1 1 decreased serum cholesterol via inhibition of bile acid Bile salt (%) 0.3 0.3 0.3 reabsorption in the small intestine and the expression of MCT (%) 2 –– relevant transporters of bile acid reabsorption in the LCT (%) – 2 – small intestine in C57BL/6 J mice and Caco-2 cell Energy (KJ/g) 16.81 16.81 16.39 monolayers. Percentage of Nutrients Protein (%) 18.69 18.69 19.07 Methods Fat (%) 15.36 15.36 13.63 Animals and diets Carbohydrate (%) 47.22 47.22 48.18 Male C57BL/6 J mice (4 weeks old, n = 80) were pur- Cholesterol (%) 1 1 1 chased from the Institute of Laboratory Animal Science, Mineral mixture (%) 1.06 1.06 1.08 Chinese Academy of Medical Sciences (License No. SCXK: JING2009–0007) and housed in a temperature- Vitamin mixture (%) 0.51 0.51 0.52 controlled room (22 ± 2 °C, 40% to 60% humidity) with a Fibre (%) 1.47 1.47 1.5 12-h light/dark cycle. The Animal Care and Use Com- Water (%) 9.11 9.11 9.3 mittee of the Chinese PLA General Hospital approved Others (%) 5.58 5.58 5.72 all experimental procedures. Li et al. Nutrition & Metabolism (2018) 15:37 Page 3 of 12 Table 2 Fatty acid composition of CR-MCT, CR-LCT and CR diets (Applied Biosystems, Carlsbad, USA) was used. The Fatty acids CR-MCT CR-LCT CR HPLC and MS systems were controlled using Analyst 1. C18:3 C18:0 4.2 software. All chromatographic separations were g/100 g diet % g/100 g diet % g/100 g diet % performed using a Venusil AQ C18 column (2.5 μm, a a a a C8:0 1.51 9.75 ND ND ND ND 50 mm × 2.1 mm) (Agela Techonologies, Delaware, USA). a a a a C10:0 0.55 3.55 ND ND ND ND Cholic acid (CA), deoxycholic acid (DCA), chenodeoxy- cholic acid (CDCA), ursodeoxycholic acid (UDCA), C14:0 0.01 0.06 0.01 0.06 0.01 0.07 lithocholic acid (LCA), taurocholic acid (TCA), tauro- C16:0 3.09 19.95 3.51 22.52 3.13 22.90 deoxycholic acid (TDCA), taurochenodeoxycholic acid C16:1 0.19 1.23 0.19 1.22 0.19 1.39 (TCDCA), taurolithocholic acid (TLCA), glycocholic acid C17:0 0.06 0.39 0.06 0.39 0.06 0.44 (GCA), glycodeoxycholic acid (GDCA) and glycocheno- C17:1 0.02 0.13 0.02 0.13 0.02 0.15 deoxycholic acid (GCDCA) were used as standard sub- C18:0 1.47 9.49 1.66 10.68 1.54 11.27 stances. Chloramphenicol was used as an internal C18:1 5.26 33.96 6.21 39.88 5.36 39.21 standard. The abovementioned materials were purchased C18:2 3.09 19.95 3.61 23.16 3.12 22.82 from Sigma-Aldrich (St. Louis, MO, USA). Primary bile acids, including CA, CDCA, TCA, TCDCA, GCA and C18:3 0.18 1.16 0.22 1.39 0.18 1.32 GCDCA, and secondary bile acids, including DCA, LCA, C20:0 0.03 0.19 0.04 0.26 0.03 0.22 UDCA, TLCA, TDCA and GDCA, in bile and faeces were C20:4 0.01 0.06 0.02 0.13 0.01 0.07 determined by the retention times. C20:5 0.01 0.06 0.02 0.13 0.01 0.07 C22:0 0.01 0.06 0.01 0.06 0.01 0.07 Quantitative real-time PCR (qRT-PCR) Total 15.49 100 15.58 100 13.67 100 Samples from small intestine tissue (approximately not detectable 100 mg) were washed with ice-cold PBS and homoge- nized. Total RNA from tissues and cells was isolated using Trizol reagent (Omega Bio-Tek, Norcross, USA, from the aorta ventralis under anaesthesia (xylazine no. R6812). Primers were designed using Primer Express hydrochloride). Serum was collected after centrifugation 3.0 software based on the mRNA sequences from a data- of the blood samples. A microcapsule was used to punc- base (Table 3) and synthesized by Invitrogen (Beijing, ture the gallbladder wall and extract the bile, and each China). Methods for RNA extraction and quantitative bile sample was centrifuged at 16,000 g for 30 min. The real-time PCR (qRT-PCR) are described in our previous supernatant was collected and stored at − 80 °C. Ileum publications. qRT-PCR was performed using a One Step tissues were excised and rinsed with ice-cold saline, and SYBR® PrimeScript® RT-PCR Kit (Takara Biotechnology portions were immediately stored at − 80 °C for further Co., Ltd., Dalian, China). Amplification was performed analysis. using a BIO-RAD iCycler Thermal Cycler (BIO-RAD, Hercules, CA, USA). Relative mRNA expression levels Measurement of serum lipid profiles were determined using the comparative critical thresh- Serum TC and triglyceride (TG) were determined at the old (Ct) method (in a separate tube). The housekeeping end of the experiment using commercial kits from Wako gene β-actin was used as a control for normalization. (Osaka, Japan). High-density lipoprotein-cholesterol (HDL-C) and low-density lipoprotein-cholesterol (LDL- Western blot assay C) were measured using sediment methods and a com- Western blot analyses of small intestine tissue and cul- mercial kit from Abcam (Cambridge, UK). Serum total tured cells were performed as described previously [7]. bile acid (TBA) was measured using a commercial kit Equivalent amounts of protein from each sample were from Blue Gene (Shanghai, China). All manufacturer’s prepared and separated using SDS-PAGE (12% gels) instructions were strictly followed. followed by electrotransfer to PVDF membranes. Mem- branes were incubated with blocking solution (Tris-buff- Analysis of bile acids in faeces and bile using HPLC-MS ered saline, 8% non-fat dry milk) for 2 h followed by The methods for the preparation and determination of incubation with specific antibodies at 4 °C overnight. bile acids in faeces and bile were performed according to Membranes were washed extensively in TBST (Tris- our previous study and reports from Steiner et al. [4, 6]. buffered saline with Tween, containing 0.5% Tween-20 A Shimadzu LC-20 AD high-performance liquid chro- in TBS) and incubated with horseradish peroxidase- matography system (Shimadzu, Kyoto, Japan) coupled to conjugated secondary antibodies in TBST for 1 h. an Applied Biosystecm 3200 Q TRAP mass spectrom- Membranes were washed further in TBST, and bands eter with an electrospray ionization (ESI) source were detected using chemiluminescence detection Li et al. Nutrition & Metabolism (2018) 15:37 Page 4 of 12 Table 3 Primer sequences used for mRNA quantification with qRT-PCR Target Genes Human / Mouse Forward (5′-3′) Reverse (5′-3′) Accession no. ASBT M AGGCTTTATCCTGTCTGTGGC CAGTGTGGAGCAAGTGGTCAT NM_011388.2 I-BABP H GAGAGCTGTGTTGTCTGCGT TTGAAGTTGCGGGCCTTTTC NM_001040442.1 M GATCATCACAGAGGTCCAGC CTCCATCTTCACGGTAGCCT NM_008375.2 OST-α M TCCCTGACGGCATCTATGAC ACAAGCACCTGGAACAGAGC NM_145932.3 OST-β M GGAACTGCTGGAAGAAATGC TTCTGTTTGCCAGGATGCTC NM_178933.2 gene name: a solute carrier family 10, member 2 (Slc10a2), protein name: apical sodium-dependent bile salt transporter (ASBT) gene name: fatty acid binding protein 6 (FABP6/fabp6), protein name: ileal bile acid binding protein (I-BABP) gene name: solute carrier family 51, alpha subunit (Slc51a), protein name: organic solute transporter (Ost-α) gene name: solute carrier family 51, beta subunit (Slc51b), protein name: organic solute transporter (Ost-β) agents. Blot densitometry was performed, and the bands Infrastructure of Cell Line Resource (Beijing, China) or were analysed using ImageJ software. Antibodies target- Sigma-Aldrich (St. Louis, MO, USA). ing the apical sodium-dependent bile acid transporter (ASBT), ileal bile acid binding protein (I-BABP) and or- Caprylic acid permeability assay through Caco-2 cell ganic solute transporter α/β (Ostα/β) were purchased monolayers from Abcam (Cambridge, UK). Secondary antibodies For bile acid reabsorption experiments, referring to the against goat IgG were obtained from Sun Biomedical report of Y. Wang, et al. [10], cells were seeded and Technology Co. (Beijing, China). grown on Millicell Hanging Cell Culture Inserts (0.4 μm, Millipore, Molsheim, France) for 21 days to obtain Immunofluorescence confluent and highly differentiated cell monolayers. The Ileum tissue fixed with 4% buffered paraformaldehyde formation of functional epithelial monolayers was moni- was embedded in paraffin, and 4-μm thick sections were tored via measurement of the transepithelial electrical prepared. Sections were deparaffinized and quenched in resistance (TEER) using a Millicell-ERS meter (Milli- 3% H O for 15 min to block endogenous peroxidase. pore) prior to experiments. Cellular morphology was 2 2 Sections were washed in PBS and incubated with an observed using an electron microscope, and permeability anti-I-BABP antibody in PBS (1:50 dilution) for 1 h at was determined using Lucifer Yellow (Sigma, MO, USA) 37 °C. A FITC-conjugated (fluorescein isothiocyanate) as a marker. antibody was added at a 1:50 dilution and incubated for The preparation of fatty acids and CA was performed as 0.5 h at 37 °C. Sections were washed, and PI (propidium described by X. Zhang, et al. [11]. Fatty acids and CA were iodide) was used to stain the nuclei. I-BABP was imaged measured and dissolved in ethanol, then were diluted with using a fluorescence microscope (BX60, Olympus, Ina, cell culture medium containing 20 mg/L endotoxin-free Japan). I-BABP was observed as green fluorescence, and BSA to a final concentration of 50, 100 or 200 μmol/L the nucleus was observed as red fluorescence [8]. (ethanol< 0.1%). The dissolved fatty acids and CA were in- cubated in a water bath at 37 °C for 1 h prior to addition Caco-2 cell culture to the cells. Caprylic acid (C8:0), capric acid (C10:0), ste- The Caco-2 cell line was obtained from the Cell Re- aric acid (C18:0) and oleic acid (C18:1) were purchased source Center, Peking Union Medical College (which is from Sigma-Aldrich (St. Louis, MO, USA). the headquarters of the National Infrastructure of Cell The apical (AP) and basolateral (BL) sides of the Line Resource) on Sept. 20, 2016. PCR and culture monolayer were washed with Hank’s Balanced Salt Solu- confirmed that the cell line was checked free of myco- tion (HBSS) and equilibrated in serum-free complete plasma contamination. The species origin of these cells medium for 15 min. The medium in the AP was re- was confirmed using PCR. The identity of the cell line placed with fresh medium-containing CA (200 μmmol/ was authenticated using STR profiling (FBI, CODIS) [9]. L) or mixed with one of the fatty acids (C8:0, C10:0, All of the results are available on the website (http://cell- C18:0 or C18:1) at 50, 100 or 200 μmol/L. Cell viability resource.cn). Caco-2 cells were cultured in Dulbecco’s of Caco-2 cells in different conditions was assessed by modified Eagle’s medium (DMEM) containing 10% foetal the WST-1 cell cytotoxicity assay (Fig. 1). The medium bovine serum (FBS), 1% penicillin-streptomycin, and 1% with one of the fatty acids was defined as the “C8:0, C10: non-essential-amino acids. Caco-2 cells were maintained 0, C18:0 or C18:1 group”. The “control group” contained at 37 °C in a humidified atmosphere containing 5% CO no fatty acids, and the “blank group” lacked CA and and 95% air. The medium was changed every 2 days. fatty acids. Only fresh medium was used in the BL. The The DMEM, FBS, 1% non-essential amino acids, and media from the AP and BL sides were removed 2 h later other materials were purchased from the National and stored for analyses of CA using HPLC-MS. The Li et al. Nutrition & Metabolism (2018) 15:37 Page 5 of 12 the experiments. The body weight of the CR-MCT group was significantly lower than that of the CR-LCT group after 12 weeks. There were no differences in body weight between the CR-MCT and CR groups until the 16th week (Fig. 2). Serum TC and LDL-C levels in the CR- MCT group were significantly lower than those in the CR-LCT and CR groups at the end of the study, and the HDL-C/LDL-C ratio was significantly higher in the CR- MCT group than in the CR-LCT group (Table 4). Effects of MCT on bile acid profiles in bile and faeces The concentrations of bile acids, including CA, CDCA, LCA, UDCA and TLCA, in the faeces of the CR-MCT group were significantly higher than those in the other Fig. 1 Cell viability of Caco-2 cells in different conditions. Cell viabil- groups. TCDCA in the CR-MCT group was higher than ity percentage = OD in experiment group /OD in control group× 100% that in the CR-LCT group. The excretions of total pri- mary bile acids (CA, CDCA, TCA, TCDCA, GCA and GCDCA), secondary bile acids (DCA, LCA, UDCA, apparent permeability (Papp) was calculated using the TLCA, TDCA and GDCA) and total bile acids were sig- following equation: Papp = dQ/dt×1/C A (dQ is the nificantly different in the CR-MCT group compared to compound appearance in the receiver compartment, dt the other groups (Table 5). is the time, C is the concentration in the donor com- There were significant differences in the excretion of partment, and A is the surface area of the insert). CA, CDCA, TCDCA and GCDCA in bile between the CR-MCT group and the other groups. The excretions of I-BABP expression levels in Caco-2 cells total primary bile acids and total bile acids in the CR- Caco-2 cells were seeded into a 6-well plate (Corning, MCT group were higher than those in the CR and CR- NY, USA) and cultured to total confluence with high dif- LCT groups (Table 6). ferentiation to confirm the effects of MCFAs on I-BABP [12]. The culture medium was replaced prior to experi- ments with medium containing delipidized FBS for 24 h. Effects of MCT on the mRNA and protein expression of Cells were washed with ice-cold phosphate-buffered sa- bile acid transporters in the small intestine line (PBS) and incubated with fresh medium containing The mRNA expression levels of I-BABP in the small in- CA at 200 μmol/L (defined as CA group) or CA mixed testine of C57BL/6 J mice in the CR-MCT groups was with one of the fatty acids (C8:0, C10:0, C18:0 or C18:1) lower than that in the other groups. However, the tran- at 200 μmol/L (defined as the “C8:0+CA, C10:0+CA, scription levels of ASBT and Ostα/β in the small intes- C18:0+CA or C18:1+CA group”) or C8:0 or C10:0 at tine were not different between groups (Fig. 1). Similar 200 μmol/L without CA (defined as “C8:0 group and results were observed in the protein expression levels of C10:0 group”) for 24 h. And the blank group was with- I-BABP, ASBT and Ostα/β in the small intestine using out fatty acids and CA. The medium was removed, and Western blot analysis (Fig. 3). cells were washed three times with ice-cold PBS. Total The I-BABP expression level detected by immuno- RNA and protein were isolated and collected for further fluorescence in the CR-MCT group decreased signifi- analyses of I-BABP mRNA and protein expression levels. cantly compared to the other groups. There were no Statistical analysis Table 4 Blood lipid profiles in C57BL/6 J mice (n = 12) All data are expressed as the mean ± SD. Data were ana- Blood lipid profiles CR-MCT CR-LCT CR lysed using one-way analysis of variance followed by the a,b TC (mmol/L) 3.52 ± 0.65 4.13 ± 0.49 4.01 ± 0.33 independent t-test to determine the significance of dif- TG (mmol/L) 0.70 ± 0.29 0.88 ± 0.24 0.86 ± 0.15 ference between groups using SPSS software version 17. HDL- C (mmol/L) 3.12 ± 0.57 3.34 ± 0.39 3.21 ± 0.25 0. P < 0.05 was considered statistically significant. a,b LDL-C (mmol/L) 0.43 ± 0.11 0.66 ± 0.18 0.61 ± 0.24 Results HDL-C/LDL-C 7.54 ± 1.74 5.44 ± 1.61 6.17 ± 2.65 Effects of MCT on body weight and blood lipid profiles TBA (mmol/L) 16.23 ± 6.51 17.71 ± 5.84 18.23 ± 11.91 No significant differences in body weight were observed a P < 0.05, versus CR-LCT group between the CR-MCT, CR-LCT and CR groups prior to P < 0.05, versus CR group Li et al. Nutrition & Metabolism (2018) 15:37 Page 6 of 12 Table 5 Bile acid profiles in faeces in C57BL/6 J mice after 16 weeks (n =5) BAs in Faeces (mg/3 d) CR-MCT CR-LCT CR a,b CA 115.11 ± 14.05 69.48 ± 11.14 78.03 ± 12.82 a,b CDCA 10.62 ± 1.44 4.57 ± 1.01 4.52 ± 0.96 TCA 2.43 ± 0.45 2.7 ± 0.31 2.84 ± 0.43 TCDCA 3.77 ± 0.27 3.05 ± 0.06 3.24 ± 0.98 GCA 1.05 ± 0.27 1.16 ± 0.33 1.33 ± 0.32 GCDCA 7.00 ± 2.92 4.94 ± 2.76 5.38 ± 2.25 a,b Total Primary BAs 139.98 ± 11.44 85.89 ± 10.7 95.33 ± 13.89 DCA 2.1 ± 0.22 1.98 ± 0.13 1.62 ± 0.42 a.b LCA 8.71 ± 0.9 4.15 ± 0.69 4.55 ± 0.19 a.b UDCA 6.89 ± 0.99 5.37 ± 0.73 4.9 ± 0.89 a.b TLCA 0.76 ± 0.02 0.48 ± 0.13 0.49 ± 0.05 TDCA 3.82 ± 0.28 3.70 ± 0.14 3.26 ± 0.48 GDCA 1.38 ± 0.45 1.18 ± 0.01 1.48 ± 0.35 a,b Total Secondary BAs 23.66 ± 1.53 16.87 ± 1.37 16.3 ± 1.67 a,b Total BAs 163.64 ± 11.6 102.77 ± 11.14 111.62 ± 13.96 P < 0.05, versus CR-LCT group P < 0.05, versus CR group significant change in the I-BABP expression levels in the 500 Ω·cm , which was in line with the the integrity CR-LCT group and CR group (Fig. 4). requirements of Caco-2 cell monolayers [13] (Table 7). The Papp values (apical-to-basolateral) of CA across Caco-2 cell monolayers were significantly lower in the Effects of MCFAs on cholic acid permeability across Caco- C8:0 and C10:0 groups than in the LCFA groups (C18:0 2 cell monolayers group and C18:1 group) and control group for the three There was no significant difference in the TEER value of fatty acid concentrations (except the C10:0 group com- Caco-2 monolayer cell model in different experimental pared with C18:1 group at 50 μmol/L). This change was conditions. All of TEER values were greater than more obvious with increased fatty acid concentration. The effect of C8:0 was more significant than that of C10: Table 6 Bile acid profiles in bile in C57BL/6 J mice after 0 at 200 μmol/L (Table 7). 16 weeks (n =5) BAs in bile (mmol/L) CR-MCT CR-LCT CR Effects of MCFAs on the I-BABP mRNA and protein a,b CA 92.00 ± 16.05 71.42 ± 8.00 62.29 ± 6.70 expression in Caco-2 cells a,b CDCA 3.65 ± 0.48 2.38 ± 0.27 2.50 ± 0.66 RT-PCR and Western blot analyses demonstrated that TCA 1.53 ± 0.22 1.43 ± 1.00 1.73 ± 0.62 (Fig. 5) the expression level of I-BABP in Caco-2 cells a,b TCDCA 2.97 ± 0.77 2.04 ± 0.38 1.85 ± 0.25 treated with MCFAs or with CA (those were C8:0 group, C10:0 group, C8:0 + CA group and C10:0 + CA group) GCA 1.75 ± 1.05 1.70 ± 0.57 1.52 ± 0.10 a,b were much lower than the level in those treated with GCDCA 0.56 ± 0.07 0.23 ± 0.05 0.25 ± 0.03 LCFAs with CA (those were C18:0 + CA group, C18:1 + a,b Total Primary BAs 102.47 ± 17.51 79.19 ± 6.75 70.13 ± 7.51 CA group) and CA group. DCA 0.67 ± 0.09 0.71 ± 0.04 0.66 ± 0.13 LCA 2.03 ± 0.11 1.90 ± 0.28 1.97 ± 0.10 Discussion UDCA 0.30 ± 0.05 0.27 ± 0.04 0.27 ± 0.05 MCFAs are primarily composed of glycerides of caprylic TLCA 0.12 ± 0.02 0.14 ± 0.02 0.14 ± 0.02 acids (C8:0) and capric acids (C10:0). Some previous in- TDCA 0.13 ± 0.04 0.11 ± 0.03 0.10 ± 0.03 vestigations reported that MCTs/MCFAs were beneficial GDCA 0.89 ± 0.13 0.95 ± 0.22 0.97 ± 0.18 in lipid metabolism and some diseases (e.g., CVDs and Total Secondary BAs 4.14 ± 0.20 4.09 ± 0.44 4.11 ± 0.24 Alzheimer’s disease) [14–19]. MCTs in our study slowed a,b the increase in body weight and altered serum lipid Total BAs 106.61 ± 17.68 83.28 ± 6.67 74.25 ± 7.39 a profiles (lower levels of TC and LDL-C in the CR-MCT P < 0.05, versus CR-LCT group P < 0.05, versus CR group group) in hypercholesterolemic C57BL/6 J mice. The Li et al. Nutrition & Metabolism (2018) 15:37 Page 7 of 12 a b Fig. 2 Body weights in C57BL/6J mice during 16 weeks (n = 12). P < 0.05, versus CR-LCT group; P < 0.05, versus CR group results of serum lipid profiles (lower levels of TC and (MCTs/LCTs) was added to basal diets, leading to differ- LDL-C) were consistent with other previous studies ent levels of total energy between groups. Addition of [4, 5, 7, 17] which were in different experiment condi- MCTs did not result in a weight increase even though the tions, such as diet formula (MCT or MCFAs with energy contributed from fats was increased. Compared to cholesterol-rich diet or high-fat diet) and animal models MCFAs, MCTs exhibit more stable physical and chemical (obesity mice or hypercholesterolemic mice). Increased properties, particularly a stable fatty acid composition serum. TC is a main risk factor of atherosclerosis. HDL-C at room temperature. The previous experimental diet is regarded as “good cholesterol”, and LDL-C is labelled required refrigeration because of the volatility and in- “bad cholesterol” [1, 20]. MCT may be a protective agent stability of fatty acids. As a promising functional in- for the cardiovascular system. The absence of significant gredient in food and pharmacy industry applications differences in weight changes in the CR-MCT and CR [21, 22], MCTs are more conveniently stored and groups prior to the 12th week might be associated with provide a more stable nutrient content, which is prac- the composition of the experimental diets in which oil tical for future applications. Fig. 3 The mRNA and protein expression of bile acid absorption transporters in C57BL/6J mice (n = 5). Total RNA and total protein were extracted from small intestine tissues. mRNA transcription levels were measured using real-time PCR analysis, and protein expression levels were measured using Western blot analysis. The housekeeping gene β-actin was used to normalize expression levels. Critical threshold (Ct) values were compared a b in a, while relative light density values were compared in c. P < 0.05 versus CR-LCT group; P < 0.05 versus CR group; a. critical threshold; b. section of blots; c. grey-scale analysis Li et al. Nutrition & Metabolism (2018) 15:37 Page 8 of 12 Table 7 The Papp values of CA across Caco-2 monolayers treated with various fatty acids and the TEER values (n =5) Group C8:0 C10:0 C18:0 C18:1 Control Condition Vehicle + + + + + CA + + + + + C8:0 + –– – – C10:0 – + –– – C18:0 –– + –– C18:1 –– – + – Fatty acid concentration 0 μmol/L P –– – – 1.16 ± 0.14 app TEER 622.80 ± 56.03 e a,c,d a,c 50 μmol/L P 0.87 ± 0.06 0.93 ± 0.13 1.26 ± 0.19 1.06 ± 0.02 – app TEER 669.80 ± 44.56 713.60 ± 87.06 653.40 ± 59.08 696.60 ± 116.57 e a,c,d a,c,d 100 μmol/L P 0.74 ± 0.03 0.81 ± 0.06 1.06 ± 0.21 1.1 ± 0.09 – app TEER 710.60 ± 115.01 673.80 ± 60.20 628.40 ± 58.92 668.00 ± 124.00 e a,b,c,d a,c,d 200 μmol/L P 0.43 ± 0.07 0.64 ± 0.04 1.11 ± 0.16 1.02 ± 0.09 – app TEER 707.00 ± 134.62 591.20 ± 47.56 651.00 ± 57.72 586.20 ± 53.60 P < 0.05, versus control group P < 0.05, versus C10:0 P < 0.05, versus C18:0 group P < 0.05, versus C18:1 group Papp of CA (AP→ BL, cm/s × 10–6) f 2 TEER values of Caco-2 monolayers (Ω·cm ) Primary bile acids are converted from cholesterol into homeostasis. The faecal excretion of bile acids is a major CA and CDCA in the liver and combined with taurine pathway for the elimination of excessive cholesterol [23]. and glycine to form binding primary bile acids, which HPLC-MS was used in our study to evaluate the differ- enter into bile. Gallbladder contraction allows the pri- ences in bile acids in the bile and faeces. The excretion of mary bile acids to enter the small intestines and form total primary and secondary bile acids in faeces after treat- secondary bile acids in the upper part of the ileum and ment was significantly higher in the CR-MCT group. colon (DCA, LCA and UDCA) [3]. Enterohepatic circula- While increased production of bile acids in the liver can tion is essential for the maintenance of cholesterol lead to increased reabsorption in the small intestine [24], Fig. 4 Immunofluorescence of I-BABP in the small intestine in C57BL/6J mice. The bar represents 50 μm in the image. I-BABP was observed as green fluorescence, and the nucleus was observed as red fluorescence Li et al. Nutrition & Metabolism (2018) 15:37 Page 9 of 12 Fig. 5 The mRNA and protein expression of I-BABP in Caco-2 cells (n = 5). Total RNA and total protein were extracted from Caco-2 cells, the mRNA transcription level was measured using real-time PCR analysis, and the protein expression level was measured using Western blot analysis. The housekeeping gene β-actin was used to normalize the expression levels, and Critical threshold (Ct) values were compared in a, while relative a b c light density values were compared in c. P < 0.05 versus CA group; P < 0.05 versus C18:0 + CA; P < 0.05 versus C18:1 + CA group; a. critical threshold; b. section of blots; c. grey-scale analysis our previous data and this work show that MCT not only the related transporter (I-BABP) in the cytoplasm. The promoted bile acid synthesis in the liver [4, 5] but also re- lack of change in apical ASBT or basal Ostα/β may par- duce bile acid reabsorption in the intestine, thus facilitat- tially explain the lack of alterations in serum total bile ing removal of excess cholesterol from the body. acids, although faecal bile acids increased. I-BABP may We specifically focused on the bile acid transport sys- play a critical role in the regulation of bile acid resorp- tem, which involves the absorption of bile acids into in- tion as a buffering agent in the cytoplasm. testinal epithelial cells, to better understand the We preliminarily hypothesized that MCTs may re- mechanisms underlying bile acid uptake in the small in- duce bile acid reabsorption in the small intestine par- testine. Bile acids are reabsorbed from the apical side in tially via inhibition of I-BABP expression. We the terminal ileum via ASBT. Bile acids enter entero- performed a permeability assay of bile acids through cytes and bind to I-BABP for transport to the basal Caco-2 cell monolayers for further confirmation. The plane and absorption into the vein via Ostα/β [25]. I- Caco-2 cell model is an effective tool to investigate BABP in mice fed an MCT diet exhibited a significant the absorption process of orally administered medi- decrease, but no significant changes in ASBT or Ostα/β cines or nutrients [30]. C8:0 and C10:0 decreased the expression were found. MCTs reduced bile acid re- apparent permeability (Papp) of CA (which was highly absorption in the ileum, which partially explains the dif- excreted in mice fed with MCTs) in the medium ference in the content of bile acids between stool and (from AP to BL) compared to C18:0 and C18:1 (the bile. The transport of intracellular bile acids in the enter- highest content of long-chain saturated fatty acids ocytes was mediated via cytosolic I-BABP, which is the and long-chain unsaturated fatty acids in the experi- bile acid cytoplasmic transporter in the fatty acid bind- mental diet). The reduction in CA permeation in ing protein (FABP) family with a similar structure [26]. Caco-2 cell monolayers treated with MCFAs indicated I-BABP combines with the ASBT transporter to promote that MCFAs likely decreased bile acid reabsorption in bile acid uptake and transported bile acids into the basi- the human small intestine. We investigated whether lar membrane in the cytoplasm. Therefore, I-BABP may MCFAs affected I-BABP expression to examine the be the important protein involved in the transport of mechanism of this phenomenon. Caco-2 cells were bile acids through intestinal epithelial cells [27–29]. The cultured with CA-mixed fatty acids for analysis. increase of bile acids (primarily CA) in the faeces in the MCFAs (C8:0 or C10:0) with or without CA downreg- present study may be due to the decreased expression of ulated I-BABP expression, and CA alone or with Li et al. Nutrition & Metabolism (2018) 15:37 Page 10 of 12 Fig. 6 Graphical abstract of the effects of MCTs/MCFAs on reducing intestinal bile acid reabsorption. Arrows (↑) represent an increasing level and upregulation of activity or protein or mRNA expression. Arrows (↓) represent downregulation LCFAs (C18:0 or C18:1) greatly induced I-BABP ex- Conclusion pression. The increase in bile acids, which are the bil- MCTs/MCFAs reduce serum cholesterol levels via a par- iary factors responsible for the induction of I-BABP tial increase in the excretion of bile acids probably expression, upregulated I-BABP expression in a time- through the reduction of absorption in the small intes- and dose-dependent manner [12, 31]. Then, more bile tines. One possible mechanism is associated with re- acids were reabsorbed into the small intestine. CA in- duced expression of I-BABP (Graphical abstract of the duced I-BABP expression levels in our study. How- effects of MCTs/MCFAs on reducing intestinal bile acid ever, this change was not observed when a mixture of reabsorption was shown in Fig. 6). MCTs/MCFAs may CA and MCFAs was used. The same result was seen exert potential therapeutic and protective roles in this in MCFAs without CA. It implied MCT might dir- process, but the regulatory mechanism is not clear. ectly affect I-BABP expression to partially reduce the transcellular permeation of bile acids in Caco-2 cells. Abbreviations AP: Apical side; ASBT: Apical sodium-dependent bile salt transporter; The bile acid transport system performs various regu- BL: Basolateral side; C10:0: Capric acid; C18:0: Stearic acid; C18:1: Oleic acid; latory mechanisms [32, 33]. Farnesoid X receptor (FXR) C8:0: Caprylic acid; CA: Cholic acid; CDCA: Chenodeoxycholic acid; CHD: Coronary plays a critical role in enterohepatic circulation of bile heart disease; CR: Cholesterol-rich; CR-LCT: Cholesterol-rich and long-chain trigly- ceride; CR-MCT: Cholesterol-rich and medium-chain triglyceride; Ct: Critical acids by regulating bile acid synthesis, biliary bile acid threshold; CVDs: Cardiovascular diseases; DCA: Deoxycholic acid; secretion, intestinal bile acid reabsorption and secretion, DMEM: Dulbecco’s modified Eagle’s medium; ESI: Electrospray ionization; and bile acid uptake into hepatocytes. In the ileum, bile FABP6:Atty acid binding protein 6;FBS:Foetalbovine serum; FITC: Fluorescein isothiocyanate; GCA: Glycocholic acid; acids bind to I-BABP, which is highly induced by FXR GCDCA: Glycochenodeoxycholic acid; GDCA: Glycodeoxycholic acid; [34]. Bile acids are excreted into portal circulation by HBSS: Hank’s Balanced Salt Solution; HDL-C: High density lipoprotein- OSTα/β located in the basolateral membrane of entero- cholesterol; HPLC-MS: High performance liquid chromatography-mass spectrometry; I-BABP: Ileal bile acid binding protein; LCA: Lithocholicacid; cytes [35], which is induced FXR either. Meanwhile FXR LCFAs: Long-chain fatty acids; LCTs: Long-chain triglycerides; LDL-C: Low- is inversely correlated to the bile acid synthetase density lipoprotein cholesterol; MCFAs: Medium-chain fatty acids; CYP7A1 expression and regulating the bile acid trans- MCTs: Medium-chain triglyceride; Ost-a: Organic solute transporter; Ost- β: Protein name: organic solute transporter; Papp: Apparent permeability; porter expression in the liver.Thus, we considered PBS: Phosphate-buffered saline; PI: Propidium iodide; qRT- whether MCT affect FXR to increase the excretion of PCR: Quantitative real-time PCR; Slc51a: Solute carrier family 51, alpha fecal bile acids, and reduce the reabsorption of bile acids subunit; Slc51b: Solute carrier family 51, beta subunit; TBA: Total bile acid; TBST: Tris buffered saline with tween; TC: Total cholesterol; in small intestine, and inhibit the expression of I-BABP. TCA: Taurocholic acid; TCDCA: Taurochenodeoxycholic acid; Further research was needed to clarify the mechanism of TDCA: Taurodeoxycholic acid; TEER: Transepithelial electrical resistance; MCT lowering cholesterol by bile acid metabolism. TG: Triglyceride; TLCA: Taurolithocholic acid; UDCA: Ursodeoxycholic acid Li et al. Nutrition & Metabolism (2018) 15:37 Page 11 of 12 Acknowledgements 10. Wang Y, Yi X, Ghanam K, Zhang S, Zhao T, Zhu X. Berberine decreases We are grateful to Mr. Shengming Wu and Mrs. Zheng Li from the Academy cholesterol levels in rats through multiple mechanisms, including inhibition of Military Medical Sciences for their kind technical support. of cholesterol absorption. Metabolism. 2014;63:1167–77. 11. Zhang X, Zhang Y, Liu Y, Wang J, Xu Q, Yu X, Yang X, Liu Z, Xue C. Funding Medium-chain triglycerides promote macrophage reverse cholesterol This work was partially supported by the National Natural Science Fund of transport and improve atherosclerosis in ApoE-deficient mice fed a high-fat China (no. 81172667). diet. Nutr Res. 2016;36:964–73. 12. Kanda T, Foucand L, Nakamura Y, Niot I, Besnard P, Fujita M, Sakai Y, Availability of data and materials Hatakeyama K, Ono T, Fujii H. Regulation of expression of human intestinal Please contact author (Huizi Li) for data or material requests. bile acid-binding protein in Caco-2 cells. Biochem J. 1998;330(Pt 1):261–5. 13. Ranaldi G, Consalvo R, Sambuy Y, Scarino ML. Permeability characteristics of Authors’ contributions parental and clonal human intestinal Caco-2 cell lines differentiated in CG and CX designed the research and provided research funding. HL, YL, XZ serum-supplemented and serum-free media. Toxicol in Vitro. 2003;17:761–7. and QX conducted the research. HL and YZ analysed the data. HL wrote the 14. Beermann C, Jelinek J, Reinecker T, Hauenschild A, Boehm G, Klor HU. Short first draft. All authors read and approved the final manuscript. term effects of dietary medium-chain fatty acids and n-3 long-chain polyunsaturated fatty acids on the fat metabolism of healthy volunteers. Ethics approval and consent to participate Lipids Health Dis. 2003;2:10. All experimental procedures were approved by the Animal Care and Use 15. Rial SA, Karelis AD, Bergeron KF, Mounier C. Gut microbiota and metabolic Committee of the Chinese PLA General Hospital. health: the potential beneficial effects of a medium chain triglyceride diet in obese individuals. Nutrients. 2016;8;281–300. Consent for publication 16. van de Heijning BJM, Oosting A, Kegler D, van der Beek EM. An increased The authors consent to the publication of the data. dietary supply of medium-chain fatty acids during early weaning in rodents prevents excessive fat accumulation in adulthood. Nutrients. 2017;9:631–47. Competing interests 17. Liu YH, Zhang Y, Xu Q, Yu XM, Zhang XS, Wang J, Xue C, Yang XY, Zhang The authors declare that they have no competing interests. RX, Xue CY. Increased norepinephrine by medium-chain triglyceride attributable to lipolysis in white and brown adipose tissue of C57BL/6J mice. Biosci Biotechnol Biochem. 2012;76:1213–8. Publisher’sNote 18. Kondreddy VK, Anikisetty M, Naidu KA. Medium-chain triglycerides and Springer Nature remains neutral with regard to jurisdictional claims in monounsaturated fatty acids potentiate the beneficial effects of fish oil on published maps and institutional affiliations. selected cardiovascular risk factors in rats. J Nutr Biochem. 2016;28:91–102. 19. Augustin K, Khabbush A, Williams S, Eaton S, Orford M, Cross JH, Heales SJR, Author details Walker MC, Williams RSB. Mechanisms of action for the medium-chain Department of Nutrition, Tianjin Institute of Environmental & Operational triglyceride ketogenic diet in neurological and metabolic disorders. Lancet Medicine, Tianjin 300050, China. Department of Nutrition, PLA Rocket Force Neurol. 2018;17:84–93. General Hospital, Beijing 100088, China. Department of Nutrition, Chinese 20. Elshourbagy NA, Meyers HV, Abdel-Meguid SS. Cholesterol: the good, the PLA General Hospital, Beijing 100853, China. bad, and the ugly - therapeutic targets for the treatment of dyslipidemia. Med Princ Pract. 2014;23:99–111. Received: 25 January 2018 Accepted: 13 April 2018 21. Ren T, Cong L, Wang Y, Tang Y, Tian B, Lin X, Zhang Y, Tang X. Lipid emulsions in parenteral nutrition: current applications and future developments. Expert Opin Drug Deliv. 2013;10:1533–49. References 22. Liu YM, Wang HS. Medium-chain triglyceride ketogenic diet, an effective 1. Tzoulaki I, Elliott P, Kontis V, Ezzati M. Worldwide exposures to treatment for drug-resistant epilepsy and a comparison with other cardiovascular risk factors and associated health effects: current knowledge ketogenic diets. Biom J. 2013;36:9–15. and data gaps. Circulation. 2016;133:2314–33. 23. Landrier JF, Grober J, Zaghini I, Besnard P. Regulation of the ileal bile acid- 2. Moran A, Gu D, Zhao D, Coxson P, Wang YC, Chen CS, Liu J, Cheng J, binding protein gene: an approach to determine its physiological Bibbins-Domingo K, Shen YM, et al. Future cardiovascular disease in China: function(s). Mol Cell Biochem. 2002;239:149–55. markov model and risk factor scenario projections from the coronary heart 24. Ferrebee CB, Dawson PA. Metabolic effects of intestinal absorption and disease policy model-China. Circ Cardiovasc Qual Outcomes. 2010;3:243–52. enterohepatic cycling of bile acids. Acta Pharm Sin B. 2015;5:129–34. 3. Chiang JY. Bile acid metabolism and signaling. Compr Physiol. 2013;3:1191–212. 25. Alrefai WA, Gill RK. Bile acid transporters: structure, function, regulation and 4. Xu Q, Xue C, Zhang Y, Liu Y, Wang J, Yu X, Zhang X, Zhang R, Yang X, Guo pathophysiological implications. Pharm Res. 2007;24:1803–23. C. Medium-chain fatty acids enhanced the excretion of fecal cholesterol 26. Smathers RL, Petersen DR. The human fatty acid-binding protein family: and cholic acid in C57BL/6J mice fed a cholesterol-rich diet. Biosci evolutionary divergences and functions. Hum Genomics. 2011;5:170–91. Biotechnol Biochem. 2013;77:1390–6. 27. Badiee M, Tochtrop GP. Bile acid recognition by mouse Ileal bile acid 5. Liu Y, Zhang Y, Zhang X, Xu Q, Yang X, Xue C. Medium-chain fatty acids binding protein. ACS Chem Biol. 2017;12:3049–56. reduce serum cholesterol by regulating the metabolism of bile acid in 28. Nakahara M, Furuya N, Takagaki K, Sugaya T, Hirota K, Fukamizu A, C57BL/6J mice. Food Funct. 2017;8:291–8. Kanda T, Fujii H, Sato R. Ileal bile acid-binding protein, functionally 6. Steiner C, von Eckardstein A, Rentsch KM. Quantification of the 15 major associated with the Farnesoid X receptor or the Ileal bile acid human bile acids and their precursor 7alpha-hydroxy-4-cholesten-3-one in transporter, regulates bile acid activity in the small intestine. J Biol serum by liquid chromatography-tandem mass spectrometry. J Chromatogr Chem. 2005;280:42283–9. B Analyt Technol Biomed Life Sci. 2010;878:2870–80. 29. Hwang ST, Urizar NL, Moore DD, Henning SJ. Bile acids regulate the 7. Zhang Y, Xu Q, Liu YH, Zhang XS, Wang J, Yu XM, Zhang RX, Xue C, Yang ontogenic expression of ileal bile acid binding protein in the rat via the XY, Xue CY. Medium-chain triglyceride activated Brown adipose tissue and farnesoid X receptor. Gastroenterology. 2002;122:1483–92. induced reduction of fat mass in C57BL/6J mice fed high-fat diet. Biomed 30. Sun H, Chow ECY, Liu S, Du Y, Pang KS. The Caco-2 cell monolayer: Environ Sci. 2015;28:97–104. usefulness and limitations. Expert Opin Drug Metab Toxicol. 2008;4:395–411. 8. Dvorak K, Watts GS, Ramsey L, Holubec H, Payne CM, Bernstein C, Jenkins 31. Kanda T, Niot I, Foucaud L, Fujii H, Bernard A, Ono T, Besnard P. Effect of GJ, Sampliner RE, Prasad A, Garewal HS, Bernstein H. Expression of bile acid bile on the intestinal bile-acid binding protein (I-BABP) expression. In vitro transporting proteins in Barrett's esophagus and esophageal and in vivo studies. FEBS Lett. 1996;384:131–4. adenocarcinoma. Am J Gastroenterol. 2009;104:302–9. 9. McNamara-Schroeder K, Olonan C, Chu S, Montoya MC, Alviri M, Ginty S, 32. Klaassen CD, Aleksunes LM. Xenobiotic, bile acid, and cholesterol Love JJ. DNA fingerprint analysis of three short tandem repeat (STR) loci for transporters: function and regulation. Pharmacol Rev. 2010;62:1–96. biochemistry and forensic science laboratory courses. Biochem Mol Biol 33. Zhang X, Osaka T, Tsuneda S. Bacterial metabolites directly modulate Educ. 2006;34:378–83. farnesoid X receptor activity. Nutr Metab (Lond). 2015;12:48. Li et al. Nutrition & Metabolism (2018) 15:37 Page 12 of 12 34. Tu H, Okamoto AY, Shan B. FXR, a bile acid receptor and biological sensor. Trends Cardiovasc Med. 2000;10:30–5. 35. Dawson PA, Hubbert M, Haywood J, Craddock AL, Zerangue N, Christian WV, Ballatori N. The heteromeric organic solute transporter alpha-beta, Ostalpha-Ostbeta, is an ileal basolateral bile acid transporter. J Biol Chem. 2005;280:6960–8.

Journal

Nutrition & MetabolismSpringer Journals

Published: Jun 5, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off