Mapping of the Simpson-Golabi-Behmel overgrowth syndrome gene (GPC3) to Chromosome X in human and rat by fluorescence in situ hybridization

Mapping of the Simpson-Golabi-Behmel overgrowth syndrome gene (GPC3) to Chromosome X in human and... 72 Mammalian Genome 8, Brief Data Reports Acknowledgments: Thanks to LB. Rowe and M.E. Barter at The Jackson Laboratory for sharing the BSS DNA and plenty of useful information. We are deeply grateful to Emilia Viganotti for her generous donation to our research on brain development. This work was also supported by the Italian Telethon, grant B14. References 1. Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K., Mattick, J.S. (1991). Nucleic Acids Res. 19, 4008. 2. Beier, D.R., Dushkin, H., Sussman, D.J. (1992). Proc. Natl. Acad. Sci. USA 89, 9102-9106. 3. Beier, D.R. (1993). Mamm. Genome 4, 627-631. 4. Rowe, L.B., Nadeau, J.H., Turner, R., Frankel, W.N., Letts, V.A., Eppig, J.T., Ko, M.S.H., Thurston, S.J., Birkenmeier, E.H. (1994). Mamm. Genome 5, 253-274. 5. Dalton, D., Chadwick, R., McGinnis, W. (1989). Genes Dev. 3, 1940-- Fig. 1. Partial metaphase spreads after FISH with GPC3 cDNA probes: 6. Simeone, A., Gulisano, M., Acampora, D., Stornaiuolo, A., Rambaldi, (left) human chromosomes depicting hybridization signals at Xq26, and M., Boncinelli, E. (1992). EMBO J. 11, 2541-2550. (right) rat chromosomes showing signals at Xq36. Arrows indicate the 7. Simeone, A., Acampora, D., Gulisano, M., Stornaiuolo, A., Boncinelli, specific signals on Chr X. Insets: Respective labeled human and rat Chr X E. (1992). Nature 358, 687-690. from additional metaphases. The photographs represent computer- 8. BruneUi, S., Faiella, A., Nigro, V., Simeone, A., Cama, A., Boncinelli, enhanced, merged images of fluorescein signals and DAPl-stained chro- E. (1996). Nature Genet. 12, 94--96. mosomes. 9. Kastury, K., Druck, T., Huebner, K., Barletta, C., Acampora, D., Sire- cone, A., Boncinelli, E. (1994). Genomics 22, 41-45. 10. Oakey, R.P., Caron, M.G., Lefkowitz, R.J., Seldin, M.F. (1991). Ge- were located specifically at Xq26-27, with the vast majority being nomics 113, 338-344. at band Xq26 (Fig. la). Additional hybridization experiments with metaphase spreads from a male donor confirmed the localization of GPC3 to Xq26. The physical mapping of GPC3 is consistent Mapping of the Simpson-Golabi-Behmel with the genetic map location reported by others [1,4]. The rodent overgrowth syndrome gene (GPC3) to GPC3 probe hybridized specifically to rat Chr X with 36% (88 of Chromosome X in human and rat by 246) of all fluorescent signals located at Xq36 (Fig. lb). Recent cDNA cloning has identified a family of genes encod- fluorescence in situ hybridization ing core proteins of heparan proteoglycans related to glypican [5] which are anchored to the cell membrane via covalent linkage to T. Shen, 1 G. Sonoda, 1 J. Hamid, 2 M. Li, 2 J. Filmus, 2 glycosyl-phosphatidylinositol (GPI). The function of these mol- R.N. Buick, 2 J.R, Testa l ecules remains obscure, but on the basis of their relationship to other proteoglycans, they are considered to be candidate co-factors 1Department of Medical Oncology, Fox Chase Cancer Center, 7701 in receptor-growth factor interactions or in cell-matrix interactions. Burholme Avenue, Philadelphia, Pennsylvania 19111, USA 2Ontario Cancer Institute and Department of Medical Biophysics, One member of this gene family, GPC3, was originally designated University of Toronto, 610 University Avenue, OCI-5, a developmentally regulated transcript observed at elevated Toronto, Ontario, M5G 2M9, Canada levels during intestinal morphogenesis [1]. A recent study has shown that mutations in this gene cause the Simpson-Golabi- Received: 30 June 1996 / Accepted: 21 August 1996 Behmel overgrowth syndrome [2]. Like all members of the glypi- can gene family, GPC3 is very highly conserved among species. Species: Human and rat The human GPC3 cDNA is 89% identical to the rat sequence [J. Locus name: Glypican 3 [1] Locus symbol: GPC3 Harold et al., unpublished observations]. Moreover, the data pre- Map position: Xq26 (human) and Xq36 (rat) sented here demonstrate evolutionary conservation of the GPC3 locus within the long arm of Chr X in both human and rat. Method of mapping: Fluorescence in situ hybridization (FISH) Molecular reagents: The human GPC3 probe was a full-length cDNA isolated from a library representing transcripts of the human Acknowledgments: This research was supported by National Cancer Insti- colonic carcinoma cell line CaCo-2. The rodent probe was a 1580- tute Grants CA-45745 and CA-06927, by the International Association of bp GPC3 cDNA generated by RT-PCR with mRNA from normal Heat and Frost Insulators & Asbestos Workers, Local 14, Mesothelioma rat (Fisher strain) cells and two primers (5' CTCTACATCT- Fund in memory of Hank Vaughan and Alice Haas, and by an appropria- TGGGq'rCTGA 3' and 5' ACCATGACAACCATGTTCCA 3') tion from the Commonwealth of Pennsylvania. specific for this rat sequence [1,2]. Metaphase spreads were pre- pared from Fisher rat embryo fibroblast cultures and human pe- References ripheral blood lymphocytes cultured for 72 h in the presence of phytohemagglutinin. The cDNAs were nick translated with biotin 1. Filmus, J., Church, G., Buick, R.N. (1988). Mol. Cell. Biol. 8, 4243- 16-dUTP (Boehringer Mannheim). FISH and detection of immu- nofluorescence were performed as previously described [3]. 2. Pilia, G., Hughes-Benzie, R.M., MacKenzie, A., Baynyan, P., Chen, Discussion: The human GPC3 cDNA probe hybridized to the E.Y., Huber, R., Neri, G., Cao, A., Forabosco, A., Schlessinger, D. Chromosome (Chr) X in 24 of 27 metaphase spreads from a nor- (1996). Nature Genet. 12, 241-247. mal female donor. Altogether, 62 of 138 fluorescent signals (45%) 3. Testa, J.R., Taguchi, T., Knudson, A.G., Hino, O. (1992). Cytogenet. Cell Genet. 60, 247-249. Correspondence to: J.R. Testa 4. Xuan, J.Y., Besner, A., Ireland, M., Hughes-Benzie, R.M., MacKenzie, A.E. (1994). Hum. Mol. Genet. 3, 133-137. This report is dedicated to the memory of Ronald N. Buick, Ph.D. (1948- 1996) 5. David, G. (1993). FASEB J. 7, 1023-i030. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Mapping of the Simpson-Golabi-Behmel overgrowth syndrome gene (GPC3) to Chromosome X in human and rat by fluorescence in situ hybridization

Free
1 page

Loading next page...
1 Page
 
/lp/springer_journal/mapping-of-the-simpson-golabi-behmel-overgrowth-syndrome-gene-gpc3-to-5QmuGOVaMc
Publisher
Springer-Verlag
Copyright
Copyright © 1997 by Springer-Verlag
Subject
Life Sciences; Cell Biology; Anatomy; Zoology
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900357
Publisher site
See Article on Publisher Site

Abstract

72 Mammalian Genome 8, Brief Data Reports Acknowledgments: Thanks to LB. Rowe and M.E. Barter at The Jackson Laboratory for sharing the BSS DNA and plenty of useful information. We are deeply grateful to Emilia Viganotti for her generous donation to our research on brain development. This work was also supported by the Italian Telethon, grant B14. References 1. Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K., Mattick, J.S. (1991). Nucleic Acids Res. 19, 4008. 2. Beier, D.R., Dushkin, H., Sussman, D.J. (1992). Proc. Natl. Acad. Sci. USA 89, 9102-9106. 3. Beier, D.R. (1993). Mamm. Genome 4, 627-631. 4. Rowe, L.B., Nadeau, J.H., Turner, R., Frankel, W.N., Letts, V.A., Eppig, J.T., Ko, M.S.H., Thurston, S.J., Birkenmeier, E.H. (1994). Mamm. Genome 5, 253-274. 5. Dalton, D., Chadwick, R., McGinnis, W. (1989). Genes Dev. 3, 1940-- Fig. 1. Partial metaphase spreads after FISH with GPC3 cDNA probes: 6. Simeone, A., Gulisano, M., Acampora, D., Stornaiuolo, A., Rambaldi, (left) human chromosomes depicting hybridization signals at Xq26, and M., Boncinelli, E. (1992). EMBO J. 11, 2541-2550. (right) rat chromosomes showing signals at Xq36. Arrows indicate the 7. Simeone, A., Acampora, D., Gulisano, M., Stornaiuolo, A., Boncinelli, specific signals on Chr X. Insets: Respective labeled human and rat Chr X E. (1992). Nature 358, 687-690. from additional metaphases. The photographs represent computer- 8. BruneUi, S., Faiella, A., Nigro, V., Simeone, A., Cama, A., Boncinelli, enhanced, merged images of fluorescein signals and DAPl-stained chro- E. (1996). Nature Genet. 12, 94--96. mosomes. 9. Kastury, K., Druck, T., Huebner, K., Barletta, C., Acampora, D., Sire- cone, A., Boncinelli, E. (1994). Genomics 22, 41-45. 10. Oakey, R.P., Caron, M.G., Lefkowitz, R.J., Seldin, M.F. (1991). Ge- were located specifically at Xq26-27, with the vast majority being nomics 113, 338-344. at band Xq26 (Fig. la). Additional hybridization experiments with metaphase spreads from a male donor confirmed the localization of GPC3 to Xq26. The physical mapping of GPC3 is consistent Mapping of the Simpson-Golabi-Behmel with the genetic map location reported by others [1,4]. The rodent overgrowth syndrome gene (GPC3) to GPC3 probe hybridized specifically to rat Chr X with 36% (88 of Chromosome X in human and rat by 246) of all fluorescent signals located at Xq36 (Fig. lb). Recent cDNA cloning has identified a family of genes encod- fluorescence in situ hybridization ing core proteins of heparan proteoglycans related to glypican [5] which are anchored to the cell membrane via covalent linkage to T. Shen, 1 G. Sonoda, 1 J. Hamid, 2 M. Li, 2 J. Filmus, 2 glycosyl-phosphatidylinositol (GPI). The function of these mol- R.N. Buick, 2 J.R, Testa l ecules remains obscure, but on the basis of their relationship to other proteoglycans, they are considered to be candidate co-factors 1Department of Medical Oncology, Fox Chase Cancer Center, 7701 in receptor-growth factor interactions or in cell-matrix interactions. Burholme Avenue, Philadelphia, Pennsylvania 19111, USA 2Ontario Cancer Institute and Department of Medical Biophysics, One member of this gene family, GPC3, was originally designated University of Toronto, 610 University Avenue, OCI-5, a developmentally regulated transcript observed at elevated Toronto, Ontario, M5G 2M9, Canada levels during intestinal morphogenesis [1]. A recent study has shown that mutations in this gene cause the Simpson-Golabi- Received: 30 June 1996 / Accepted: 21 August 1996 Behmel overgrowth syndrome [2]. Like all members of the glypi- can gene family, GPC3 is very highly conserved among species. Species: Human and rat The human GPC3 cDNA is 89% identical to the rat sequence [J. Locus name: Glypican 3 [1] Locus symbol: GPC3 Harold et al., unpublished observations]. Moreover, the data pre- Map position: Xq26 (human) and Xq36 (rat) sented here demonstrate evolutionary conservation of the GPC3 locus within the long arm of Chr X in both human and rat. Method of mapping: Fluorescence in situ hybridization (FISH) Molecular reagents: The human GPC3 probe was a full-length cDNA isolated from a library representing transcripts of the human Acknowledgments: This research was supported by National Cancer Insti- colonic carcinoma cell line CaCo-2. The rodent probe was a 1580- tute Grants CA-45745 and CA-06927, by the International Association of bp GPC3 cDNA generated by RT-PCR with mRNA from normal Heat and Frost Insulators & Asbestos Workers, Local 14, Mesothelioma rat (Fisher strain) cells and two primers (5' CTCTACATCT- Fund in memory of Hank Vaughan and Alice Haas, and by an appropria- TGGGq'rCTGA 3' and 5' ACCATGACAACCATGTTCCA 3') tion from the Commonwealth of Pennsylvania. specific for this rat sequence [1,2]. Metaphase spreads were pre- pared from Fisher rat embryo fibroblast cultures and human pe- References ripheral blood lymphocytes cultured for 72 h in the presence of phytohemagglutinin. The cDNAs were nick translated with biotin 1. Filmus, J., Church, G., Buick, R.N. (1988). Mol. Cell. Biol. 8, 4243- 16-dUTP (Boehringer Mannheim). FISH and detection of immu- nofluorescence were performed as previously described [3]. 2. Pilia, G., Hughes-Benzie, R.M., MacKenzie, A., Baynyan, P., Chen, Discussion: The human GPC3 cDNA probe hybridized to the E.Y., Huber, R., Neri, G., Cao, A., Forabosco, A., Schlessinger, D. Chromosome (Chr) X in 24 of 27 metaphase spreads from a nor- (1996). Nature Genet. 12, 241-247. mal female donor. Altogether, 62 of 138 fluorescent signals (45%) 3. Testa, J.R., Taguchi, T., Knudson, A.G., Hino, O. (1992). Cytogenet. Cell Genet. 60, 247-249. Correspondence to: J.R. Testa 4. Xuan, J.Y., Besner, A., Ireland, M., Hughes-Benzie, R.M., MacKenzie, A.E. (1994). Hum. Mol. Genet. 3, 133-137. This report is dedicated to the memory of Ronald N. Buick, Ph.D. (1948- 1996) 5. David, G. (1993). FASEB J. 7, 1023-i030.

Journal

Mammalian GenomeSpringer Journals

Published: Mar 23, 2009

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro

Price
FREE
$49/month

$360/year
Save searches from
Google Scholar,
PubMed
Create lists to
organize your research
Export lists, citations
Read DeepDyve articles
Abstract access only
Unlimited access to over
18 million full-text articles
Print
20 pages/month
PDF Discount
20% off