Localization of the beta2-microglobulin gene to pig Chromosome 1ql7

Localization of the beta2-microglobulin gene to pig Chromosome 1ql7 948 Mammalian Genome 8, Brief Data Reports The organization of the pig B2M gene is not known, although its Localization of the beta2-microglobulin gene corresponding cDNA sequence has been established [2]. The de- to pig Chromosome lq17 rived amino acid sequence revealed 72% identity with its human counterpart. At the molecular level, the alignment of the pig B2M C. Rogel-Gaillard, l M. Vaiman, 1 C. Renard, 1 cDNA (Acc. No. L13854) with the human B2M gene (Acc. No. P. Chardon, 1 M. Yerle z M17986) [5] allowed the identification of the different exons. A PCR primer pair was derived from the pig sequence corresponding 1Laboratoire mixte INRA-CEA de Radiobiologie appliquee, DSV, DRR, to the exon 2 in human. The resulting PCR product on pig genomic LRA, Domaine de Vilvert, 78352 Jouy en Josas Cedex, France DNA was obtained at an annealing temperature of 60~ with the 2Laboratoire de GrnEtique cellulaire, INRA BP27, F-31326 Amplitaq enzyme (Perkin-Elmer). The amplified fragment was Castanet Tolosan, France checked by sequencing and was identical to the previously pub- lished sequence [2]. PCR screening of the somatic cell hybrids Received: 30 May 1997 / Accepted: 23 July 1997 revealed that the pig B2M gene mapped to Chr I in the region Species: Pig (Sus scrofa domestica) ql 1--<t17 with a probability of 81% [10]. The FISH mapping un- Locus name: Beta2-microglobulin ambiguously localized the B2M gene on SSClqI7 for both YACs, Locus symbol: B2M in spite of extra signals on Chr 13 for YAC 163A06 (Fig. 1). Note Map position: lq17 that this localization is in agreement with the human-pig compara- Method of mapping: PCR screening on a panel of 27 pig-rodent tive cytogenetic map [11] and adds a new marker to the conserved somatic cell hybrids [1] and fluorescence in situ hybridization on CYP19-IGF1R synthenic group between HSA15 and SSC1. In pig metaphases. conclusion, as in humans and mice, the pig B2M gene does not Molecular reagents: Primers designed from the pig B2M cDNA belong to the Mhc region that is assigned near the centromere of [2]. The direct primer was 5'GGTTCAGGTTTACTCACGC- Chr 7 in pig. CAC 3' (position 135-156), and the reverse primer was 5'CT- TAACTATCTTGGGCTTATCG 3" (position 396--375). The gen- erated PCR product was 262 bp in size. The FISH experiment was References performed with 2 YACs recovered by PCR screening from our pig library [3], including a 1-Mb YAC (163A06) and a 120-kb YAC 1. Yerle M, Echard G, Robic A, Mairal A, Dubut-Fontana C, Riquet J, (171A09). Pinton P, Milan D, Lahbib-Mansais Y, Gellin J (1996) Cytogenet Cell Previously identified homologs: The corresponding human B2M Genet 73, 194-202 gene has been mapped on Chromosome (Cbr) 15q21-q22.2 [4]. 2. Milland J, Loveland BE, McKenzie IFC (1993) Immunogenetics 38, Results and Discussion: The ~2 M protein, which is a member of the immunoglobulin superfamily, forms a non-covalent associa- 3. Rogel-Gaillard C, Bourgeaux N, Save JC, Renard C, Coullin P, Pinton tion with the extracellular domain of the major histocompatibility P, Yerle M, Valman M, Chardon P (1997) Mamm Genome 8, 186-192 complex (Mhc) classical class I [5] as well as class I-related mol- 4. Pajunen L, Solomon E, i3urgess S, Bobrow M, Povey S, Swallow D ecules such as the human CD1 antigens [6]. This 11.7-kDa protein (1978) Cytogenet Cell Genet 22, 511-512 also forms heterodimers with the more distantly class I-related Fc 5. Gtissow D, Rein R, Ginjaar I, Hochstenbach F, Seeman G, Kottman A, receptor that is expressed in the intestinal epithelial cells of neo- Ploegh HL (1987) J Immunol 139, 3132-3138 natal rats (FcRn) or mice [7]. In addition, the 132M protein is present as a free form in various physiological fluids. The role of 6. Calabi F, Bradbnry A (1991) Tissue Antigens 37, 1-9 the [~2M protein is crucial to obtain correct class I molecule three- 7. Simister NE, Mostov KE (1989) Nature 337, 184-187 dimensional folding, allowing adequate groove loading of endog- 8. Chardon P, Vaiman M, Renard C, Arnoux B (1978) Transplantation enously processed peptides, normal intracellular trafficking of the 26, 107-112 complex, and finally stable expression at the cell surface [5]. In 9. Gtissow D, Rein R, Ginjaar I, Hochstenbach F, Seeman G, Kottman A, pig, the [3aM protein was also shown to be non-covalently asso- Ploegh HL (1987) J Immunol 139, 3132-3138 ciated with the various expressed Mhc class I polymorphic heavy 10. Chevalet C, Gouzy I, San Cristobal-Gaudy M (1997) Comput Appl chains [8]. Biosci 13, 69-73 11. Goureau A, Yerle M, Schmitz A, Riquet J, Milan D, Pinton P, Frelat Correspondence to: C. Rogel-Galllard G, Gellin J (1996) Genomics 36, 252-262 Fig. 1. Regional localization of B2M gene by FISH. (a) YAC 163A06: a bright hybridization signal is observed on pig Chr 1 in the q17 region, and a secondary signal is detected on Chr 13q33, indicating that this YAC is chimeric. (b) YAC 171A09: a strong hybridization signal is observed on pig Chr 1 in the q17 region. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Localization of the beta2-microglobulin gene to pig Chromosome 1ql7

Free
1 page

Loading next page...
1 Page
 
/lp/springer_journal/localization-of-the-beta2-microglobulin-gene-to-pig-chromosome-1ql7-K0z7hSMxBX
Publisher
Springer-Verlag
Copyright
Copyright © 1997 by Springer-Verlag
Subject
Life Sciences; Cell Biology; Anatomy; Zoology
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900618
Publisher site
See Article on Publisher Site

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial