Living functional hydrogels generated by bioorthogonal cross-linking reactions of azide-modified cells with alkyne-modified polymers

Living functional hydrogels generated by bioorthogonal cross-linking reactions of azide-modified... ARTICLE DOI: 10.1038/s41467-018-04699-3 OPEN Living functional hydrogels generated by bioorthogonal cross-linking reactions of azide- modified cells with alkyne-modified polymers 1 1 1 Koji Nagahama , Yuuka Kimura & Ayaka Takemoto To date, many scientists have thoroughly investigated both cells and cellular functions, resulting in the identification of numerous molecular mechanisms underlying the cellular functions. Based on these findings, medical scientists and pharmacologists have developed many technological applications for cells and cellular functions in medicine. How can material scientists utilize cells and cellular functions? Here, we show a concept for utilizing cells and their functions from the viewpoint of materials science. In particular, we develop cell cross- linked living bulk hydrogels by bioorthogonal click cross-linking reactions of azide-modified mammalian cells with alkyne-modified biocompatible polymers. Importantly, we demonstrate the unique functionalities of the living hydrogels, originating from the basic functions of the cells incorporated in the living hydrogels as active cross-linking points. The findings of this study provide a promising route to generating living cell-based next-generation innovative materials, technologies, and medicines. Department of Nanobiochemistry, Frontiers of Innovative Research in Science and Technology (FIRST), Konan University, 7-1-20 Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan. Correspondence and requests for materials should be addressed to K.N. (email: nagahama@center.konan-u.ac.jp) NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 1 | | | 1234567890():,; ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 any scientists have been and continue to be interested precursor for azide-modified sialic acid residues, as reported 20, 21 in cells, and especially in cellular functions. This has led previously (Supplementary Fig. 1) . The obtained AC Man- Mto the identification of many molecular mechanisms NAz was characterized by ESI-MS and H-NMR measurements underlying cellular functions and cell–cell interactions in living (Supplementary Figs. 2 and 3). Conversion of the NH group of 1–5 systems , which in turn has led to the development by medical mannosamine into an azide groups was calculated to be 96% scientists and pharmacologists of many technological applications based on the H-NMR spectrum and conversion of the OH of cells and cellular functions in medicine, including cancer groups of N-azidomannosamine into acetyl groups was estimated 6–8 therapy and regenerative medicine . How can materials scien- to be 97%. AC ManNAz was not cytotoxic to C2C12 cells (mouse tists utilize cells and cellular functions? The molecular mechan- myoblast) below 100 μM (Supplementary Fig. 4). Following isms underlying cellular functions provide the best role models treatment with AC ManNAz, azide groups on the cell surface for the design of advanced multifunctional materials, and che- were detected by covalent labeling using the clickable fluorescent mists have utilized functional biomolecules, such as nucleic dye dibenzocyclooctyne (DBCO)-modified carboxyrhodamine. 9, 10 11, 12 13, 14 acids , proteins , and polysaccharides , as essential Fluorescence microscopic images (Supplementary Fig. 5a) active components for designing materials, including smart showed surface-labeled C2C12 cells, indicating the incorporation materials. Cells and cellular functions are also attractive and of azide groups on the cell surface glycans. The fluorescence promising active components for the design of functional mate- intensity per cell was quantified and clearly increased as the rials. Combining living cells with synthetic materials could enable AC ManNAz concentration increased (Supplementary Fig. 5b). the fabrication of living multifunctional materials capable of, for Moreover, growth curves of azide-modified C2C12 cells [N (+) example, sensing the environment, time-programming, move- C2C12] treated with 100 μMAC ManNAz were similar to that of ment, and signal transduction, all originating from the functions normal C2C12 cells [N (−)C2C12] (Supplementary Fig. 6). We of the incorporated cells. therefore chose 100 μM as the optimal AC ManNAz concentra- Here, we demonstrate a concept for utilizing cells and their tion. Importantly, cell-surface fluorescence was maintained even functions from the viewpoint of materials science. Specifically, we after 10 days’ cultivation in DMEM without AC ManNAz, demonstrate living multifunctional hydrogels generated by although the fluorescence intensity gradually decreased due to cell bioorthogonal click cross-linking reactions of azide-modified division (Supplementary Fig. 7). mammalian cells with alkyne-modified biocompatible polymers, Live cells were covalently cross-linked with alkyne-modified as shown in Fig. 1. Furthermore, we demonstrate the unique polymers using copper-free click chemistry to avoid the potential functionality of the living hydrogels originating from the basic toxicity of copper catalysts. We selected alginic acid (Alg, 100,000 functions of the incorporated cells as active cross-linking points. Da) as a polymer component because of its good biocompatibility and synthesized branched alginic acid (bAlg) using amine- terminated 4-arm branched polyethylene glycol (4-arm PEG, Results 20,000 Da, Supplementary Fig. 8). The molecular composition of Preparation of cell cross-linked hydrogels. Metabolic gly- bAlg was estimated by H-NMR analysis (Supplementary Fig. 9). coengineering was used to incorporate reactive azide groups on 15–17 The integration ratios of the anomeric protons of glucuronic acid the cell surface . The monosaccharide precursor was modified (peak a) and mannuronic acid (peak b) in the Alg segment to the with an azide group, then incorporated into cell-surface glycans methylene protons of the PEG segment (peak c) indicated that through biosynthetic machinery. Sialic acid is one of the most the molar ratio of Alg to 4-arm PEG in bAlg was ~9:1. Next, we abundant cell-surface glycans on mammalian cells and is typically 18, 19 synthesized dibenzocyclooctyne (DBCO)-modified bAlg (bAlg- found at the terminating branches of these glycans .We DBCO) (Supplementary Fig. 10); H-NMR analysis showed that therefore targeted sialic acid residues for azide-modification on average 13 DBCO groups were introduced per bAlg molecule because the location (the outermost surface of cells) and abun- and the molecular weight of bAlg-DBCO was 1,026,800 Da dance (high concentration on cell surface) of sialic acid residues is (Supplementary Fig. 11). We analyzed the hydrodynamic ideal for efficient bioorthogonal click cross-linking with alkyne- diameter of bAlg-DBCO by dynamic light scattering (DLS) using modified polymers. The tetraacetylated monosaccharide N-azi- a dilute solution (0.05%) of bAlg-DBCO and found that the doacetylmannosamine (AC ManNAz) was synthesized as the Branched alginate-DBCO (bAlg-DBCO) N N HN O OH O OH OH OH OH Azide-modified cells O O O O O O HO O HO Cell surface glycans Ac ManNAz N NH O O OH O R H COCO H 3 3 N N O N O 3 3 HN O N H COCO O 3 R = H or H COCO 3 OCOCH Metabolic Click cross-linking reaction between glycoengineering DBCO groups on the polymers and 3 the azide groups on the cell surface N 3 3 N glycans Cell cross-linked hydrogels Azide groups were (CxGels) generated on cell surface glycans Fig. 1 Schematic illustration of the construction of cell cross-linked hydrogels (CxGels). Reactive azide groups are covalently incorporated into cell-surface glycans through the biosynthetic machinery. CxGels are constructed via bioorthogonal click cross-linking reaction between the azide-modified cells and the alkyne-modified polymers 2 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE ab 10,000 6 6 G ′ (2.0 × 10 cells) G ″ (2.0 × 10 cells) 6 6 N (+)C2C12/bAlg-DBCO (1%) 3 G ′ (1.0 × 10 cells) G ″ (1.0 × 10 cells) 6 6 6 6 6 G ′ (0.5 × 10 cells) G ″ (0.5 × 10 cells) 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 0 h 24 h N (+)C2C12/bAlg-DBCO (2%) 6 6 6 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 0 500 1000 1500 2000 2500 3000 3500 0 h Time (seconds) 10,000 N (–)C2C12/bAlg-DBCO (1%) 6 6 6 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 24 h N (–)C2C12/bAlg-DBCO (2%) 6 6 6 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 24 h 020 40 60 80 100 Frequency (rad/s) cd e FITC-bAlg-DBCO C2C12 cells Merge Fig. 2 Preparation and characterization of cell cross-linked hydrogels (CxGels). a Photographs of reaction mixtures of azide-modified C2C12 cells (0.5 × 6 6 6 10 , 1.0 × 10 , and 2.0 × 10 cells) and bAlg-DBCO solutions (1% and 2%, w/v) at 0 h and 24 h after the reaction. Photographs of dispersions of C2C12 6 6 6 cells (0.5 × 10 , 1.0 × 10 , and 2.0 × 10 cells) and bAlg-DBCO solutions (1% and 2%, w/v) after 24 h. b (upper) Gelation kinetics determined through 6 6 6 oscillatory time sweep of CxGels prepared from bAlg-DBCO (2%) and azide-modified C2C12 (0.5 × 10 , 1.0 × 10 , and 2.0 × 10 ) at 37 °C under constant strain (5%) and frequency (10 rad/s). The crossover time point of the storage modulus (G′) and the loss modulus (G″) curves is defined as the mechanical 6 6 6 gel point. (lower) Frequency sweep of CxGels prepared from bAlg-DBCO (2%) and azide-modified C2C12 (0.5 × 10 , 1.0 × 10 , and 2.0 × 10 ) at 2 h after the start of the cross-link reactions at 37 °C under constant strain (5%). c Photographs of CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%). Scale bar indicates 5 mm. d Photographs of the word FIRST written in CxGel made through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%). CxGels were stained with Fast Green FCF to aid visualization. Scale bar indicates 10 mm. e CLSM images of CxGels made through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%). Green: FITC-bAlg-DBCO, red: azide-modified C2C12 cells stained with CytoTell Red. Scale bars indicate 20 μm hydrodynamic diameter was approximately 0.8 μm (Supplemen- cross-linked hydrogels and thus cell cross-linking reactions were tary Fig. 12). performed with different numbers of N (+)cells and different Next, we investigated the click reaction between N (+)C2C12 bAlg-DBCO concentrations. Hydrogel formation was analyzed cells and bAlg-DBCO by suspending N (+)C2C12 cells in PBS using the classic test tube inversion method and by rheological and reacting with FITC-labeled bAlg-DBCO at 37 °C for 30 min. characterization. First, oscillatory time sweep and frequency Fluorescence microscopic images (Supplementary Fig. 13) sweep analyses of 2% bAlg-DBCO solutions showed that the G″ showed C2C12 cells with green fluorescence on their surface, values were always larger than the G′ values, indicating that the demonstrating the successful bioorthogonal click reaction bAlg-DBCO solution was in a sol state (Supplementary Fig. 14a). between bAlg-DBCO and the azide groups on the cell surface We performed a gelation study using a combination of N (−) glycans. The number of N (+)cells and the concentration of C2C12 cells and bAlg-DBCO solutions, using combinations of bAlg-DBCO can be critical factors for the construction of cell N (+)C2C12 cells and bAlg solutions as negative controls. As NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 3 | | | G ′ and G ″ (Pa) G ′ and G ″ (Pa) ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 shown in Fig. 2a and Supplementary Fig. 14, we confirmed that of the CxGels decreased as the number of N (+)C2C12 cells these negative controls did not result in hydrogel formation. increased, indicating that the N ( + )C2C12 cells are a critical Reaction mixtures of N (+)C2C12 cells and bAlg-DBCO solution factor in facilitating the fabrication of networks of bAlg polymers. (1%) did not form bulk-sized hydrogels even after 24 h (Fig. 2a). Frequency sweep experiments were performed on the CxGels In contrast, immediate gelation was achieved using a reaction were performed 2 h after initiation of the cross-linking reaction. mixture of 2.0 × 10 N (+)C2C12 cells and 2% bAlg-DBCO The G′ values of CxGels containing relatively high cell numbers 6 6 solution (Fig. 2a and Supplementary Movie 1). (1.0 × 10 and 2.0 × 10 ) did not change with angular frequency, suggesting that the hydrogels were stably formed. In contrast, the G′ values of CxGels containing a low cell number (0.5 × 10 ) Characterizations of cell cross-linked hydrogels. We investi- changed at high frequency, suggesting that the bAlg networks in gated the gelation time by performing oscillatory time sweep the hydrogels were defective. The G′ values of the CxGels increased as the number of N (+)C2C12 cells increased, indi- measurements of reaction mixtures comprising various numbers 6 6 6 of N (+)C2C12 cells (0.5 × 10 , 1.0 × 10 , 2.0 × 10 ) and a fixed cating that the mechanical strength of the CxGels was governed by the number of N (+)C2C12 cells. These results strongly amount of 2% bAlg-DBCO solution (Fig. 2b). Importantly, the G′ value of a mixture of 2.0 × 10 N (+)C2C12 cells and 2% bAlg- indicate that N (+)C2C12 cells act as cross-linking points for the DBCO solution was already higher than their G″ value at time fabrication of three-dimensional bAlg networks in CxGels, as zero (just after mixing by pipetting), proving that cell cross-linked illustrated in Fig. 1. Interestingly, CxGels remained free-standing hydrogels (CxGels) are formed via bioorthogonal click reactions even after vortex shaking (Fig. 2c). Moreover, CxGels prepared between bAlg-DBCO and N ( + )C2C12 cells. The gelation time using 2.0 × 10 N (+)C2C12 cells and 2% bAlg-DBCO solution 3 3 CxGels (bAlg-DBCO/N (+)C2C12) Day 0 Day 3 Day 7 Control gels (bAlg/N (+)C2C12/CaCl ) 3 2 Day 0 Day 3 Day 7 bc d 100 100 CxGels Control gels (bAlg-DBCO/N (+)C2C12) (bAlg/N (+)C2C12/CaCl ) 3 3 2 Control gels CxGels (bAlg/N (+)C2C12/CaCl ) (bAlg-DBCO/N (+)C2C12) 3 2 10 12 bAlg/CaCl gels Control gels 8 (bAlg/N (+)C2C12/CaCl ) 3 2 CxGels (bAlg-DBCO/N (+)C2C12) 50 0.1 0 0123 4567 0 1 2 3 4567 0123 4567 Culture time (days) Culture time (days) Culture time (days) Fig. 3 Characterizations of the CxGels. a (upper) CLSM images of CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%) after live/dead assay. (lower) CLSM images of C2C12 cells-encapsulating control physical gels prepared through physical cross-linking reaction between bAlg solution (2%) and CaCl solution (0.5%) in the presence of azide-modified C2C12 cells (2.0 × 10 cells) after live/dead assay. CLSM observation was carried out at days 0, 3 and 7 after CxGels preparation. Green fluorescence indicates live cells stained with calcein- AM and red fluorescence indicates dead cells stained with PI. Scale bars indicate 200 μm. b Cell viability of C2C12 cells in the CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%) and the cell-encapsulating control physical gels analyzed using the CLSM images after live/dead assay. Live/dead assay was performed at days 0, 1, 3, 5, and 7. Error bars: standard deviation (n= 3). c Proliferation rates of C2C12 cells existing in the CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%) and the control physical gels analyzed using the WST-1 assay. Error bars: standard deviation (n= 3). d Time-dependent changes in the dry CxGels weight, the cell-encapsulating control physical gel, and normal bAlg physical gels cultured in DMEM for 7 days at 37 °C. Error bars: standard deviation (n= 3) 4 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | Cell viability (%) Proliferation rate of cells in gels (fold control) Dry gel weight (mg) NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE can be molded immediately into complex shapes by discharging contrast, ionically physically cross-linked alginate gels can be 2+ the reaction mixture from a pipet (Fig. 2d), indicating good swollen and then eroded by the release of Ca ions into the handling and molding properties. Furthermore, CxGels can be surrounding medium due to exchange reactions with monovalent constructed using several kinds of cells (Supplementary Fig. 15a cations such as sodium ions . Consequently, the swelling of 2+ and 12b), indicating that this gel construction method is uni- C2C12 cell-encapsulating bAlg/Ca gels would be due to versally applicable to whole mammalian cells. Note that, since exchange reactions with monovalent cations produced by cell N (+)C2C12 cells can be stored in the frozen state for long metabolism processes. On the other hand, the CxGels in which periods of time and retain their azide-modification, CxGels can be the bAlg network is covalently cross-linked with cells should be made using thawed cells (Supplementary Fig. 15c). Long-term resistant to swelling caused by ion exchange reaction. However, storage is advantageous for securing a stable supply of N (+)cells since cells act as the cross-linking points in the CxGels, cell for use as living building blocks. Confocal microscopy analysis of division in the CxGels would decrease the number of cross- CxGels revealed that C2C12 cells (labeled with red) were uni- linking points, leading to swelling. formly dispersed within the three-dimensional networks of bAlg The dry weights of the CxGels and the C2C12 cell- 2+ (labeled with green) (Supplementary Fig. 16). Moreover, micro- encapsulating bAlg/Ca gels increased in a time-dependent phase separated structures consisting of cell domains and bAlg manner over the first 4 days and the rate of increase of the C2C12 2+ networks were observed (Fig. 2e), indicating that bAlg did not cell-encapsulating bAlg/Ca gels was higher than that of the enter the cells but rather reacted with the surface of the cells. We CxGels (Fig. 3d). The number of C2C12 cells in both the CxGels 2+ calculated the total volume fraction of C2C12 cells in a CxGel and bAlg/Ca gels increased in a time-dependent manner but 6 2+ prepared by mixing 2.0 × 10 N (+)C2C12 cells and 100 μLof2% the proliferation rate in the bAlg/Ca gels was higher than that bAlg-DBCO solution by using a simple sphere model for the cells in the CxGels (Fig. 3c). These results suggest that the increase in and assuming that the radius of each cell is 10 μm. The volume of dry weight of both the CxGels and the C2C12 cell-encapsulating 3 3 2+ a cell was calculated to be 4187 μm using the formula (4/3)pi*r . bAlg/Ca gels is due to cell proliferation in these gels. To verify 9 3 The total volume of cells in the CxGel was 8.4 × 10 μm , and this interpretation, we examined the relationship between the thus the total volume fraction of C2C12 cells in the CxGel was number of C2C12 cells and their dry weights: we obtained a linear 8.4%. The total volume fraction of C2C12 cells likely corresponds relationship, and the dry weight per 1.0 × 10 cells was estimated to the three-dimensional image of a CxGel obtained by confocal to be 0.9 mg. This incremental increase in dry weights per 1.0 × microscopy analysis (Supplementary Fig. 16). 10 cells roughly corresponds with the dry weight of C2C12 cells A key question regarded the fate of cells in CxGels acting as initially present in these gels, although the dry weight of the gel active cross-linking points was: do the cells remain alive and grow would include the cell culture medium, metabolites, and ECM in the CxGels? The viability of C2C12 cells in CxGels was proteins produced by the cells. Note that the dry weight of the investigated using a live/dead assay. As shown in Fig. 3a, b, most CxGels decreased from day 4 to day 7, and the number of C2C12 of the C2C12 cells in the CxGels showed green fluorescence, with cells present in the CxGels also decreased during this time only a few cells showing red fluorescence, indicating high cell (Fig. 3d). On the other hand, the dry weight of the C2C12 cell- 2+ viability (over 93%). Next, we investigated the proliferation of encapsulating bAlg/Ca gels continuously increased during this 2+ C2C12 cells in CxGels using the WST-1 assay and obtained a 7 day periods, and the number of C2C12 cells in the bAlg/Ca linear relationship between the cell number and the absorbance gel also increased during this time. Changes in the mechanical within the cell concentration range tested (Supplementary strength of the CxGels during cultivation are shown in Supplementary Fig. 19. The G′ values of the CxGels decreased Fig. 17). The C2C12 cells in CxGels clearly proliferated by logarithmic growth, suggesting that cells in CxGels exhibit basic in a time-dependent manner, and remarkable changes in the G′ cellular functions. As mentioned above, our aim in this study is to values at high frequency were detected for CxGels cultured for 5 demonstrate that the covalent combination of living cells, acting and 7 days, suggesting that the bAlg networks in these hydrogels as active cross-linking points, enables the development of were defective. Taking all our results together, we conclude that multifunctional hydrogels with unique functionalities that since C2C12 cells act as the cross-linking points in CxGels, the originate from the cells. We therefore selected two basic cellular cell proliferation (cell division) causes a decrease in the number of functions to demonstrate utility of our approach: autonomous cell cross-linking points, leading to swelling (from day 1 to day 4) and growth and selective cell adhesion. subsequent degradation (from day 4 to day 7) of the CxGels, as illustrated in Supplementary Fig. 20. In other words, components of CxGels are released after day 4, leading to a decrease in dry gel Self-growing and self-degradation abilities of cell cross-linked weight. Thus, in the CxGel system, cell proliferation (cell hydrogels. First, autonomous cell growth in CxGels was used to division) directly affects the swelling and degradation properties endow functionality to the CxGels. We investigated time- of the CxGels but does not directly affect the swelling and 2+ dependent changes in the swelling ratio of the CxGels, the degradation properties of C2C12 cell-encapsulating bAlg/Ca number of C2C12 cells in the CxGels, their dry gel weight, and gels. Therefore, CxGels have the ability to self-grow and self- the mechanical strength of the gels during 7 days’ cultivation. degrade due to the autonomous growth of cells utilized as active Furthermore, we compared these physical properties with those cross-linking points, and we propose that these are unique of appropriate control gel: N (+)C2C12 cells encapsulated in properties of CxGels. bAlg gels physically cross-linked with calcium ions (gels in which 2+ the cells are not cross-linked with bAlg) and bAlg/Ca physical gels (gels which do not contain cells). No significant change in the Selective adhesion ability of cell cross-linked hydrogels. Second, 2+ swelling ratio or dry weight of the bAlg/Ca gels were observed we utilized the selective adhesion properties of cells. We per- during the 7 days (Fig. 3d; Supplementary Fig. 18), indicating that formed adhesion studies of CxGels and of the C2C12 cells in 2+ the bAlg/Ca gels were not degraded under these experimental CxGels, together with two appropriate control gels: N (+)C2C12 2+ 2+ condition. Note that the CxGels showed remarkably higher cell-encapsulating bAlg/Ca gels and bAlg/Ca gels. The gels 2+ swelling ratios than the C2C12 cell-encapsulating bAlg/Ca gels. were placed on collagen-coated dishes or 2-methacryloyloxyethyl Alginate is inherently non-degradable in cell culture medium, as phosphorylcholine (MPC) polymer-coated dishes and cultured medium lack enzymes that can cleave alginate polymer chains. In for 24 h in DMEM. An MPC polymer coating resists the surface NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 5 | | | ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 Collagen-coated dish MPC polymer-coated dish Trypsin-EDTA treatment Culture for 24 h Fig. 4 CxGel adhesion to cell culture dishes via the adhesion of cells at the surface. (left panels) Photographs of CxGels, prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%), adhered to collagen-coated dishes via the adhesion of cells in the CxGels. After trypsin-EDTA treatment, the adhering cells detached from the dish and the CxGels detached. The CxGels adhered onto a collagen-coated dish again when placed on the dish and cultured in DMEM for 24 h. (right panel) In contrast, since cells in the CxGels, prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%), did not adhere onto MPC polymer-coated dishes, the CxGel also did not adhere onto MPC polymer-coated dishes even after 24 h. Scale bars indicate 20 μm 23 2+ binding of cells . We found that the bAlg/Ca physical gels did to the reversible adhesion of cells in the CxGels (Fig. 4 bottom left not adhere to either the collagen- or MPC polymer-coated dishes panel and Supplementary Movie 6). (Supplementary Fig. 21), indicating that no effective interaction is formed between bAlg molecules and collagen- or MPC polymer- Preparation of tissue cross-linked hydrogels. To assess whether 2+ coated dishes. Moreover, the bAlg/Ca gels encapsulating our approach to fabricate cell cross-linked hydrogels is applicable C2C12 cells also did not adhere onto either dish, whereas C2C12 to cells in tissues, we attempted the in vivo azide-modification of 2+ cells physically encapsulated in bAlg/Ca gels adhered onto the cells in tissues via the intraperitoneal administration of collagen-coated dishes. This result indicates that the adhesion of Ac ManNAz to mice for 7 continuous days (Supplementary 2+ 4 C2C12 cells physically encapsulated in networks of bAlg/Ca Fig. 22). The azide-modification of lung, femoral muscle, kidney, gels did not result in the adhesion of the entire gel. On the other and heart tissues was assessed by excising the tissue and treating hand, C2C12 cells in CxGels cultured on a MPC polymer-coated with FITC-labeled bAlg-DBCO ex vivo. Control tissues (without dish did not adhere and the CxGels slipped on the dish when Ac ManNAz administration) did not show green fluorescence, tilted (Fig. 4 right panel and Supplementary Movie 2). In contrast, whereas tissues from mice subjected to Ac ManNAz adminis- C2C12 cells in CxGels cultured on a collagen-coated dish adhered tration clearly showed green fluorescence (Fig. 5a left and middle and the CxGels also adhered to the dish (Fig. 4 top of left panel). panel), indicating the successful in vivo reactive azide- Consequently, the adhesion of C2C12 cells chemically (cova- modification of tissues. We prepared tissue cross-linked hydro- lently) connected to the bAlg networks of CxGels results in gels (TxGels) via a bioorthogonal click cross-linking reaction adhesion of the entire gel. Surprisingly, the CxGels maintained between azide-modified tissues and bAlg-DBCO. Interestingly, all adhesion even after relatively strong physical stimuli (Supple- tissues tested formed TxGels, indicating that our approach for mentary Movie 3 and 4). However, trypsin-EDTA treatment fabrication of CxGels is applicable to cells in tissues (Fig. 5a right resulted in the adhering CxGels easily detaching from the dish panel). due to detachment of the adhering cells from the dish (Fig. 4, middle of left panel and Supplementary Movie 5), indicating that detachment of the cells directly results in detachment of the Potential application of cell cross-linked hydrogels as injectable CxGels. Thus, the selective adhesion of CxGels is derived from biomaterials for regenerative medicine. We conceived the the ability of C2C12 cells in CxGels to selectively adhere onto design of injectable gels for regenerative medicine as one example surfaces. Interestingly, the detached CxGels can adhere again of the potential application of CxGels and thus investigated onto a collagen-coated dish after 24 h’ cultivation in DMEM due in vivo CxGel formation. A suspension of LifeAct-GFP- 6 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE ab Azide-modified Tissue cross-linked Normal tissue tissue hydrogels (TxGels) Lung CxGels (bAlg-DBCO/N (+)C2C12) Control gels (bAlg/N (+)C2C12/CaCl ) 3 2 Heart PBS –10 02468 10 12 14 16 Time (days) Muscle CxGels bAlg Kidney Fig. 5 Tissue cross-linked hydrogels (TxGels) and in vivo CxGels formation. a (left panels) CLSM images of normal mouse tissues treated with FITC-bAlg- DBCO solution. These tissues were carefully excised, then shredded and suspended with 500 µL of FITC-labeled bAlg-DBCO (0.1%) solution at 37 °C for 30 min. After that, tissues were centrifuged and washed with PBS twice, then tissues were re-suspended with 1 mL of Live Cell Imaging Solution and observed by CLSM. Scale bars indicate 100 μm. (middle panels) CLSM images of azide-modified mouse tissues treated with FITC-bAlg-DBCO solution. Mice treated with AC ManNAz for continuous 7 days were killed and the tissues were excised carefully. These tissues were shredded and washed with PBS twice. These tissues were carefully excised, then shredded and suspended with 500 µL of FITC-labeled bAlg-DBCO (0.1%) solution at 37 °C for 30 min. After that, tissues were centrifuged and washed with PBS twice, then tissues were re-suspended with 1 mL of Live Cell Imaging Solution and observed by CLSM. Scale bars indicate 100 μm. (right panels) Photographs of tissue cross-linked hydrogels (TxGels) made through click reaction between azide- modified tissues and bAlg-DBCO solution (2%) ex vivo. Scale bars indicate 100 μm. b Photographs of in vivo formed CxGels. LifeAct-GFP-expressing azide-modified C2C12 cells (4.0 × 10 ) were suspended with 200 μL of bAlg-DBCO solution (2%) and immediately injected subcutaneously into the muscle layer of the back of each mouse. c Force recovery of injured femoral muscle treated with CxGels prepared through click reaction between LifeAct- GFP-expressing azide-modified C2C12 cells (5.0 × 10 ) and 250 μL of bAlg-DBCO (2%) or C2C12 cells-encapsulating control physical gels, prepared through physical cross-linking reaction between 250 μL of bAlg solution (2%) and CaCl solution (0.5%) in the presence of azide-modified C2C12 cells (5.0 × 10 cells). Error bars: standard deviation (n = 3). d Fluorescence images of LifeAct-GFP-expressing C2C12 cells in the CxGels or the control physical gels acquired 15 days after transplantation into injured muscle. Green: LifeAct-GFP, blue: Hoechst. Scale bars indicate 50 μm expressing N (+)C2C12 cells in bAlg-DBCO solution was Importantly, GFP-expressing muscle tissue-like structures were injected into the subcutaneous tissue of nude mice, and in situ detected within the CxGels at day 15 after transplantation hydrogel formation was observed (Fig. 5b). To assess the utility of (Fig. 5d) whereas no organized structures were observed in mice CxGels in regenerative medicine, LifeAct-GFP-expressing N (+) treated with the control gels. We therefore found that treatment C2C12 cells suspended in bAlg-DBCO solution were injected into with CxGels provides the most effective muscle force recovery, severe skeletal muscle defects in the hind limbs of mice (Sup- demonstrating the advantage of CxGels. Moreover, these results plementary Fig. 23) and functional recovery was evaluated using a indicate the utility of CxGels as delivery and scaffolding materials grip-strength meter . We also performed this muscle injury for regenerative medicine. study using two appropriate negative controls: treatment with 2+ bAlg/Ca physical gels encapsulating LifeAct-GFP-expressing N (+)C2C12 cells, and no treatment (PBS injection). Note that Discussion the CxGels formed in situ clung to the muscle defect site due to Cells and cellular functions should be attractive and promising the selective adhesion ability of the C2C12 cells in CxGels. Mice active components for the design of functional materials. Com- transplanted with CxGels exhibited remarkably higher force bining living cells with synthetic materials could enable the fab- 2+ recovery as compared with mice treated with bAlg/Ca gels rication of living multifunctional materials capable of, for encapsulating C2C12 cells (Fig. 5c) while mice treated with the example, sensing the environment, time-programming, move- control gels exhibited similar force recovery as untreated mice. ment, and signal transduction, all originating from the functions NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 7 | | | Force recovery (%) ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 of the incorporated cells. In this study, we present a concept for was purchased from NOF Corporation. Other reagents and solvents available in extra-pure grade were obtained commercially and used without further utilizing cells and their functions from the viewpoint of materials purification. science. In particular, we develop cell cross-linked living bulk hydrogels by bioorthogonal click cross-linking reactions of azide- Synthesis of Ac ManNAz. D-Mannosamine hydrochloride (500 mg, 2.3 mmol) modified mammalian cells with alkyne-modified biocompatible was added to an aqueous solution of azidoacetic acid (200 µL, 2.4 mmol). DMT- polymers (bAlg-DBCO). As mentioned above, our aim in this MM (664 mg, 2.4 mmol) was added to the solution, and the reaction mixture was study is to demonstrate that the covalent combination of living stirred at 45 °C for 2 days. The solution was removed by evaporation to give solid state crude reaction mixtures, and then the objective N-azidoacetyl D- cells, acting as active cross-linking points, enables the develop- mannosamine (ManNAz) was extracted from the crude mixtures by methanol ment of multifunctional hydrogels with unique functionalities wash three times. Moreover, silica gel chromatography (eluting solution: methanol/ that originate from the cells. We therefore selected two basic chloroform = 2/1, v/v) was performed to obtain pure ManNAz. Acetic anhydride cellular functions to demonstrate utility of our approach: (380 µL, 4.0 mmol) was added to a solution of ManNAz (170 mg, 0.66 mmol) in autonomous cell growth and selective cell adhesion. First, we anhydrous pyridine (5 mL, 62 mmol), and the reaction mixture was stirred over- night at room temperature under nitrogen atmosphere. The solution was con- found that the cell proliferation (cell division) directly affects the centrated, resuspended in dichloromethane, and washed with 1 M hydrogen swelling and degradation properties of the CxGels. Therefore, chloride, saturated sodium hydrogen carbonate, and then saturated sodium CxGels have the ability to self-grow and self-degrade due to the chloride. The organic phase was dried using magnesium sulfate, filtered, and autonomous growth of cells utilized as active cross-linking points, evaporated to give solid state of the objective tetraacetylated N-azidoacetyl man- nosamine (Ac ManNAz). H-NMR (500 MHz, CDCl ): 1.98−2.22 (−OCOCH , 4 3 3 and we successfully demonstrate that these are unique properties 12 H), 3.81 (C2HNHCO−, 1 H), 3.92 (−COCH N , 2 H), 4.05−4.13 (C3H,C4H, 2 3 of CxGels. Second, we found that the selective adhesion of CxGels and C5HCH , 4H), 4.27 (C5H, 1 H), 4.62 (C2H, 1 H), 5.18 (C1H, 1H). ESI-MS, is derived from the ability of cells in CxGels to selectively adhere calc. 430.4; found 429.08. onto surfaces. Hydrogels generally have a remarkably low friction coefficient because of the large amount of free water on their Cell culture. MCF-7 cells (human breast adenocarcinoma cell line), C2C12 cells surface, making the stable attachment of hydrogels onto solid (mouse myoblast cell line), and HL-60 cells (human promyelocytic leukemia cells) were purchased from ATCC. MCF-7 and C2C12 cells were cultured in DMEM materials difficult . On the other hand, cells can adhere onto supplemented with 10% FBS and antibiotic solution containing penicillin (100 various solid materials with a wide range of water contact angles −1 −1 units mL ) and streptomycin (100 µg mL ) and 2.0 mM L-glutamine at 37 °C in in the presence of cell attachment proteins . We found that a humidified atmosphere containing 5.0% CO . HL-60 cells were cultured in RPMI CxGels can adhere onto materials which alginate gels cannot by 1640 medium supplemented with 10% FBS and antibiotic solution containing −1 −1 using the selective adhesion abilities of the cells. Thus, we propose penicillin (100 units mL ) and streptomycin (100 µg mL ) and 2.0 mM L- glutamine at 37 °C in a humidified atmosphere containing 5.0% CO . that the selective adhesive ability of CxGels is unique as compared to existing hydrogels. Taken together, we have successfully Metabolic activity. C2C12 cells (1.0 × 10 cells per well) were seeded on 96-well demonstrated that the functions of cells covalently incorporated plate and then 200 μL of DMEM containing Ac ManNAz with varied concentra- into CxGels as active cross-linking points are useful for endowing tions was added to the well and cultured for 24 h at 37 °C in a humidified atmo- CxGels with unique functionalities. sphere containing 5.0% CO . Ten µL of WST-1 solution (WST-1/1-methoxy PMS In this study, we prepared tissue cross-linked hydrogels = 9/1, v/v) was added to the well, and incubated at 37 °C for 2 h. Absorbance at 450 nm and 620 nm was measured by microplate reader (Multiskan FC, Thermo (TxGels) via a bioorthogonal click cross-linking reaction between Scientific). Values are average of three separate experiments and are expressed as azide-modified tissues and bAlg-DBCO. Recently, organ on a mean ± SD. chip technology has received significant attention as an exciting 27, 28 approach to test chemicals for human safety . In this tech- Preparation of azide-modified cells. C2C12 cells (1.0 × 10 ) were seeded on 3 cm nology, three-dimensional cellular assemblies with organ-level glass bottom dish, and then 2 mL of DMEM containing Ac ManNAz (0, 10, 20, 30, structures and functions must be re-created on a chip. The suc- 50, and 100 μM) was added to the dish and incubated at 37 °C for 3 days. The cess of organ on a chip technology requires the development of supernatant was removed and then 2 mL of DMEM was freshly added to the dish. DBCO-carboxyrhodamine 110 (final concentration: 5 µM) was added to the dish methods to create three-dimensional cellular assemblies applic- and incubated at 37 °C for 1 h. Cells attached on the dish were washed twice with able to all types of cells in an organism. In this context, we phosphate buffered saline (PBS) and 1 mL of Live Cell Imaging Solution (Life conceived that the fabrication of CxGels would be applicable to Technologies) was added, and then the cells were observed by confocal laser creating three-dimensional cellular assemblies of various types of scattering microscopy (CLSM, ZEISS LSM700). Fluorescence intensity per cell is analyzed by line profiles across a cell in the z-stack images. To prevent saturation of cells. Generally, tissues exhibit more complicated, diverse, and the intensity, we firstly set gain to adjust the detector signal using C2C12 cells with higher functionalities than single cells, and thus TxGels likely 100 μMAc ManNAz treatment providing maximum fluorescence intensity. After exhibit unique, higher order functionalities than CxGels. This that, CLSM observation of C2C12 cells with different concentrations of Ac Man- approach to the fabrication of TxGels would be applicable to NAz treatments was performed using the same gain. The fluorescence intensity is represented as the average of ten cells analyzed and are expressed as mean ± SD. organ on a chip technology. In conclusion, we demonstrated a concept and a method for utilizing cells and cellular functions in the design of multi- Metabolism of azide groups on cell surfaces. C2C12 cells (1.0 × 10 ) were seeded on 3 cm glass bottom dish, and then 2 mL of DMEM containing functional bulk hydrogels. Importantly, whole mammalian cells Ac ManNAz (100 μM) was added to the dish and incubated at 37 °C for 3 days. and their functions are retained in CxGels, and unique func- The supernatant was removed and washed with PBS twice, and then cells were tionalities are generated. This method can be applied to bacteria cultured for 10 days with 2 mL of DMEM without Ac ManNAz. After pre- and viruses because their surfaces can be modified by metabolic determined times, DBCO-carboxyrhodamine 110 (final concentration: 5 µM) was 29–31 added to the dish and incubated at 37 °C for 1 h. Cells attached on the dish were glycoengineering . Therefore, the findings of this study pro- washed twice with phosphate buffered saline (PBS) and 1 mL of Live Cell Imaging vide a promising route to the generation of living cell-based next- Solution (Life Technologies) was added, and then the cells were observed by generation innovative materials, technologies, and medicines. confocal laser scattering microscopy. Fluorescence intensity of the whole cell sur- faces are represented as the average of ten cells analyzed using z-stack images and are expressed as mean ± SD. Methods Materials. D-Mannosamine hydrochloride, 2-azidoacetic acid, acetic anhydride, pyridine, alginic acid sodium salt (M : 100,000), and azide fluor 545 were pur- Proliferation of azide-modified cells. C2C12 cells were seeded on 10 cm dish, chased from Sigma-Aldrich. 4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-4-methylmor- then 10 mL of DMEM with or without Ac ManNAz (100 µM) was added to the pholinium chloride n-hydrate (DMT-MM) was purchased from Wako Pure dish and incubated at 37 °C for 3 days. Cells were collected by usual trypsin Chemical. WST-1 was purchased from Dojindo. DBCO-carboxyrhodamine 110 treatment and centrifuged (1000 rpm, 3 min), then supernatant was removed. The and dibenzylcyclooctyne-PEG -amine (DBCO-PEG -amine) were purchased from pellet of azide-modified cells was re-suspended with DMEM, and seeded on 6 well 4 4 Click Chemistry Tools. 4-arm PEG-NH (M : 20,000, SUNBRIGHT PTE-200PA) plate (5 × 10 cells) and cultured at 37 °C in a humidified atmosphere containing 2 w 8 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE 5.0% CO . After predetermined times, cell number was counted by trypan blue with 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES buffer (200 mM, pH 7.4), assay. Values are average of 3 separate experiments and are expressed as mean ± then test tube inverting methods were performed. SD. Cell viability in cell cross-linked hydrogels. NPellet of azide-modified C2C12 cells (2.0 × 10 ) was suspended with 100 µL of bAlg-DBCO solution (2%, w/v) in Synthesis of branched alginic acid. 4-arm PEG-NH (2 mg, 0.1 μmol) and DMT- HEPES buffer and cells were completely dispersed by gentle pipetting. The cell MM (33.2 μg, 0.12 μmol) dissolved in 2 mL of pure water was added to 18 mL of dispersion solution was put on glass bottom dish and incubated at 37 °C for 1 h. alginic acid (100 mg, 1 μmol) solution, and stirred at room temperature for 6 h. The Two mL of DMEM was added on the gels and cultured at 37 °C in a humidified reaction mixture was dialyzed (MWCO: 14,000) against pure water for 2 days, then atmosphere containing 5.0% CO . After a sufficient time, Calcein-AM (DOJINDO) the resultant solution was freeze-dried to give white powder of branched alginic and propidium iodide (PI, DOJINDO) were added in the medium and reacted for acid (bAlg). Molecular structure of bAlg was determined by H-NMR analysis 30 min at 37 °C, then gels were washed with PBS twice and CLSM observation was (D O, 85 °C). carried out in 1 mL of Live Cell Imaging Solution. Values are average of three separate experiments and are expressed as mean ± SD. To prepare C2C12 cells- Synthesis of alkyne-modified branched alginic acid. DBCO-PEG -amine (6.7 encapsulating control physical gels, azide-modified C2C12 cells (2.0 × 10 ) were mg, 12.7 μmol) and DMT-MM (4.2 mg, 15.3 μmol) dissolved in 1 mL of pure water well suspended with 100 µL of bAlg solution (2%, w/v) in HEPES buffer in the was added to 19 mL of bAlg (100 mg, 0.15 μmol) solution, and stirred at room presence of CaCl solution (0.5%). The cell viability of C2C12 cells physically temperature for 24 h. The reaction mixture was dialyzed (MWCO: 14,000) against encapsulated in the control gels was also examined with the same live/dead assay. pure water for 2 days, then the resultant solution was freeze-dried to give white powder of DBCO-modified branched alginic acid (bAlg-DBCO). Molecular Cell proliferation in cell cross-linked hydrogels. Pellet of azide-modified C2C12 structure of bAlg-DBCO was determined by H-NMR analysis (D O, 85 °C). The 2 5 cells (2.0 × 10 ) was suspended with 10 µL of bAlg-DBCO solution (2%, w/v) in hydrodynamic diameters of bAlg and bAlg-DBCO solutions (0.05%) in PBS were HEPES buffer and cells were completely dispersed by gentle pipetting. The cell measured by dynamic light scattering (DLS, ZETASIZER NanoSeries ZEN-3600, dispersions were poured into 96-well plate and incubated at 37 °C for 1 h. Two Malvern). hundred μL of DMEM was added on the gels and cultured for 7 days at 37 °C in a humidified atmosphere containing 5.0% CO . The supernatant was carefully changed with fresh DMEM with or without Ac ManNAz (100 μM) every day. After Bioorthogonal click reaction between azide-modified cells and bAlg-DBCO. 4 predetermined times, the gels were carefully transferred into a new well, then 100 Azide-modified C2C12 cells (4.5 × 10 ) were washed twice with PBS, the cen- μL of fresh DMEM and 5 µL of WST-1 solution was added to the well and incu- trifuged. The pellet was suspended with 500 µL of FITC-labeled bAlg-DBCO (0.5%) bated at 37 °C for 2 h. The gels were demolished thoroughly by vigorous pipetting, in DMEM, incubated at 37 °C for 30 min for bioorthogonal click reaction. After then the 96-well plate was centrifuged and the supernatant that, cells were centrifuged and washed with PBS twice, then cells were re- (100 μL) was carefully sucked and poured into new 96-well plate. Absorbance at suspended with 1 mL of Live Cell Imaging Solution and observed by CLSM. 450 nm and 620 nm was measured by microplate reader. Values are average of three separate experiments and are expressed as mean ± SD. To prepare C2C12 In vitro preparation of cell cross-linked hydrogels. Pellet of azide-modified cells-encapsulating control physical gels, azide-modified C2C12 cells (2.0 × 10 ) 6 6 6 C2C12 cells (0.5 × 10 , 1.0 × 10 or 2.0 × 10 ) was suspended with 100 µL of bAlg- were well suspended with 10 µL of bAlg solution (2%, w/v) in HEPES buffer in the DBCO solution (1% and 2%, w/v) in HEPES buffer (200 mM, pH 7.4) and cells presence of CaCl solution (0.5%). The cell proliferation of C2C12 cells physically were completely dispersed by gentle pipetting. The cell dispersions were added into encapsulated in the control gels was also examined with the same test tube and incubated at 37 °C. Gel formation was checked by usual test tube WST-1 assay. inverting methods. Five hundred mL of DMEM was carefully added on the hydrogels prepared in test tube, then hydrogels was taken out from the test tube by Weight change in cell cross-linked hydrogels. Pellet of azide-modified C2C12 vortex shaking, placed on the slide glass and taken a picture. The same procedure cells (1.0 × 10 ) was suspended with 50 µL of bAlg-DBCO solution (2%, w/v) in was carried out to prepare cell cross-linked hydrogels using MCF-7 and HL-60. As HEPES buffer and cells were completely dispersed by gentle pipetting. The cell 6 6 6 controls, normal C2C12 cells (0.5 × 10 , 1.0 × 10 or 2.0 × 10 ) was suspended with dispersion solution was poured into plastic microtube and incubated at 37 °C for 1 100 µL of bAlg-DBCO solution (1% and 2%, w/v) in HEPES buffer (200 mM, pH h. In total 1 mL of DMEM was added on the gels and cultured for 7 days at 37 °C in 7.4), and test tube inverting methods were performed. Moreover, azide-modified a humidified atmosphere containing 5.0% CO . DMEM was changed with fresh 6 2 C2C12 cells (2.0 × 10 ) was also suspended with 100 µL of bAlg solution (2%, w/v) one every day. After predetermined time, the remained gels were carefully trans- in HEPES buffer (200 mM, pH 7.4), and test tube inverting methods were per- ferred into a new plastic microtube, and washed with PBS twice, then the weight of formed as controls. swollen gels was measured. Moreover, gels were lyophilized and the weight of the dry gel was also measured. Values are average of three separate experiments and are expressed as mean ± SD. To prepare C2C12 cells-encapsulating control physical Rheological characterization of cell cross-linked hydrogels. Pellet of azide- 6 6 6 gels, azide-modified C2C12 cells (1.0 × 10 ) were well suspended with 50 µL of modified C2C12 cells (0.5 × 10 , 1.0 × 10 or 2.0 × 10 ) was suspended with 100 µL bAlg solution (2%, w/v) in HEPES buffer in the presence of CaCl solution (0.5%). of bAlg-DBCO solution (1% and 2%, w/v) in HEPES buffer (200 mM, pH 7.4) and 2 One mL of DMEM was added on the gels and cultured for 7 days at 37 °C in a cells were completely dispersed by gentle pipetting. Rheological test of the cell humidified atmosphere containing 5.0% CO . The changes in the weight of swollen dispersions were performed on MCR 302 rheometer (Anton Paar) using a standard 2 and the dry gels were examined with the same procedures. Moreover, bAlg physical steel parallel-plate geometry of 25 mm in diameter. Oscillatory time and frequency gels (2%, w/v) without cells were prepared in the presence of CaCl solution and were performed at 37 °C, and the storage modulus (G′) and loss modulus (G″) were 2 the changes in the weight of swollen and the dry gels were examined with the same recorded. The cell dispersions were cast between the lower plate and upper plate. procedures. To prevent evaporation of water and better temperature control during testing, the plates were enclosed in a chamber. Time zero was taken as the moment at which the cell dispersions were cast on the plate. The time sweep data collection was Cell adhesion in cell cross-linked hydrogels. Pellet of azide-modified C2C12 cells started from time zero to 3600 s to monitor the gelation process. The strain was 6 (2.0 × 10 ) was suspended with 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES maintained at 5% and operated at 10 rad/s. Frequency sweep was performed using buffer and cells were completely dispersed by gentle pipetting. The cell dispersion the same hydrogels 2 h after the addition of bAlg-DBCO solution to pellet of azide- solution was put onto collagen-type I-coated glass bottom dish (Cosmo Bio) or 2- modified C2C12 cells to determine the stability of the hydrogels. The strain was methacryloyloxyethyl phosphorylcholine (MPC) polymer-coated dish (Thermo maintained at 5%, and the frequency was swept from 100 to 0.1 rad/s. As controls, Fisher Scientific) and incubated at 37 °C for 1 h. Two mL of DMEM was carefully azide-modified C2C12 cells (2.0 × 10 ) was also suspended with 100 µL of bAlg added on the gels and cultured at 37 °C in a humidified atmosphere containing solution (2%, w/v) in HEPES buffer (200 mM, pH 7.4), and rheological char- 5.0% CO . After 24 h, cells in the hydrogels that exist on the interface between gels acterization was performed. Time-dependent changes in the G′ and G″ values of and the top surface of dish were observed by CLSM. To prepare C2C12 cells- the cell cross-linked hydrogels cultured in DMEM with or without Ac ManNAz 6 encapsulating control physical gels, azide-modified C2C12 cells (2.0 × 10 ) were (100 μM) were examined for 7 days. Frequency sweep was performed with the fixed well suspended with 100 µL of bAlg solution (2%, w/v) in HEPES buffer in the strain at 5%, and the frequency was swept from 100 to 0.1 rad/s. presence of CaCl solution (0.5%). Cell adhesion in the control physical gels on both the collagen- or MPC polymer-coated dishes was also observed by CLSM. Preparation of cell cross-linked hydrogels using freezing-thawing azide- modified cells. C2C12 cells were seeded on 10 cm dish, and then DMEM con- Gel adhesion. Pellet of azide-modified C2C12 cells (2.0 × 10 ) was suspended with taining 100 µM of Ac ManNAz was added to the dish and incubated at 37 °C for 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES buffer and cells were com- 3 days. Cells were collected by usual trypsin treatment and centrifuged (1000 rpm, pletely dispersed by gentle pipetting. The cell dispersions were put onto collagen- 3 min), then supernatant was removed. The pellet of azide-modified cells was type I-coated glass bottom dish and incubated at 37 °C for 1 h. Two mL of DMEM suspended with CELLBANKER (Wako Pure Chemical) and added to cryotube. The was added on the gels and cultured at 37 °C in a humidified atmosphere containing tube was gradually cooled in BICELL (NIHON FREEZER), then stored −80 °C. 5.0% CO . After 24 h, adhesion of the gels onto the surface of dish was examined by After that, azide-modified cells were thawed and the cells (2.0 × 10 ) was suspended dish inverting method. After that, 1 mL of trypsin solution was added to dish and NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 9 | | | ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 incubated at 37 °C for 10 min, then adhesion of the gel onto surface of dish was References examined. The harvested gel was gently washed with DMEM twice and put onto 1. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse new collagen-coated dish, then cultured at 37 °C in a humidified atmosphere embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676 containing 5.0% CO . After 24 h, adhesion of the gel onto surface of dish was 2 (2006). examined. To prepare C2C12 cells-encapsulating control physical gels, azide- 2. Mizushima, N. & Komatsu, M. Autophagy: renovation of cells and tissues. Cell modified C2C12 cells (2.0 × 10 ) were well suspended with 100 µL of bAlg solution 147, 728–741 (2011). (2%, w/v) in HEPES buffer in the presence of CaCl solution (0.5%). Moreover, 3. Chaffer, C. L. & Weinberg, R. A. A perspective on cancer cell metastasis. bAlg physical gels (2%, w/v) without cells were also prepared in the presence of Science 331, 1559–1564 (2011). CaCl solution as control gels. After 24 h, adhesion of the control gels onto the 4. Akira, S., Uematsu, S. & Takeuchi, O. Pathogen recognition and innate surface of dish was examined by dish inverting method. immunity. Cell 124, 783–801 (2006). 5. Engler, A. J., Sen, S., Sweeney, H. L. & Discher, D. E. Matrix control of stem cell fate. Cell 126, 645–647 (2006). In vivo preparation of cell cross-linked hydrogels. All animal experiments and 6. Langer, R. & Vacanti, J. P. Tissue engineering. Science 260, 920–926 (1993). all experimental protocols were approved by Konan University, and conformed to the Guidelines for the Care and Use of Laboratory Animals published by the 7. Neri, D. & Supuran, C. T. Interfering with pH regulation in tumours as a therapeutic strategy. Nat. Rev. Drug. Discov. 10, 767–777 (2011). National Institutes of Health. Female nude mice (ICR-nu/nu) at 4 weeks of age were purchased from Charles River. To generate retroviruses encoding Lifeact-GFP 8. Tabar, V. & Studer, L. Pluripotent stem cells in regenerative medicine: for the visualization of F-actin structures, the nucleotide sequence 5′- challenges and recent progress. Nat. Rev. Genet. 15,82–92 (2014). ATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCA 9. Ding, K., Alemdaroglu, F. E., Börsch, M., Berger, R. & Herrmann, A. AAGGAAGAA-3′, which encodes the Lifeact peptide, was subcloned into the Engineering the structural properties of DNA block copolymer micelles by pBabe blast vector containing a C-terminal GFP tag. pBabe Lifeact-GFP blast was molecular recognition. Angew. Chem. Int. Ed. 46, 1172–1175 (2007). cotransfected with psi-2 helper plasmid into human kidney 293 T cells (ATCC) 10. Chinen, A. B., Guan, C. M. & Mirkin, C. A. Spherical nucleic acid nanoparticle using the HilyMax transfection reagent (Dojindo, Kumamoto, Japan). Forty-eight conjugates enhance G-quadruplex formation and increase serum protein hours after transfection, the supernatant was collected and then used to infect interactions. Angew. Chem. Int. Ed. 54, 527–531 (2015). −1 C2C12 cells in the presence of 8 μgmL polybrene (Sigma). Infected C2C12 cells 11. Miyata, T., Asami, N. & Tadashi, U. A reversibly antigen-responsive hydrogel. −1 were selected using 3 μgmL blasticidin (Invitrogen, Carlsbad, CA) for 3 days. Nature 399, 766–769 (1999). Nude mice (ICR-nu/nu, 6 weeks old, female) were anesthetized with isoflurane. 12. Dirks, A. J., Nolte, R. J. M. & Cornelissen, J. J. L. M. Protein-polymer hybrid Azide-modified C2C12 cells constitutively expressing Lifeact-GFP (4.0 × 10 cells) amphiphiles. Adv. Mater. 20, 3953–3957 (2008). were suspended with 200 μL of bAlg-DBCO solution and immediately injected 13. Cobo, I., Li, M., Sumerlin, B. S. & Perrier, S. Smart hybrid materials by subcutaneously into the muscle layer of the back of each mouse. After a pre- conjugation of responsive polymers to biomacromolecules. Nat. Mat. 14, determined time, the mice were killed, the hydrogels were excised, and the 143–159 (2015). hydrogels were analyzed. 14. Lee, H. et al. Hyaluronate-gold nanoparticle/tocilizumab complex for the treatment of rheumatoid arthritis. ACS Nano 8, 4790–4798 (2014). Transplantation of cell cross-linked hydrogels in a mouse model of skeletal 15. Jewett, J. C. & Bertozzi, C. R. Cu-free click cycloaddition reactions in chemical muscle injury. Nude mice (BALB/c-nu/nu, 5 weeks old, female) were anesthetized biology. Chem. Soc. Rev. 39, 1272–1279 (2010). with isoflurane. The skin of the hind limb was opened, and the femoral muscle was 16. Agarwal, P., Beahm, B. J., Shieh, P. & Bertozzi, C. R. Systemic fluorescence gently exposed. In host femoral muscle, a local injury imaging of zebrafish glycans with bioorthogonal chemistry. Angew. Chem. Int. (ca. 7 mm long, 4 mm wide, and 5 mm deep) was created by removing skeletal Ed. 54, 11504–11510 (2015). muscle fibers. The skin was then carefully closed and the incision was sutured (4/ 17. Letschert, S. et al. Super-resolution imaging of plasma membrane glycans. 0 silk). One day after the surgery, 250 μL of CxGels precursor solution, Lifeact- Angew. Chem. Int. Ed. 53, 10921–10924 (2014). GFP-expressing N -C2C12 cells (5.0 × 10 ) suspended with bAlg-DBCO solution, 3 18. Chen, X. & Varki, A. Advances in the biology and chemistry of sialic acids. was injected into the injury site using a syringe with a 26-gauge needle. As control ACS Chem. Biol. 5, 163–176 (2010). gels, physically cross-linked bAlg gels encapsulating Lifeact-GFP-expressing N (+) 19. Adak, A. K., Yu, C.-C., Liang, C.-F. & Lin, C.-C. Synthesis of sialic acid- C2C12 cells (5.0 × 10 ) were prepared in the presence of CaCl solution (0.5%), containing saccharides. Curr. Opin. Chem. Biol. 17, 1030–1038 (2013). then the gels were transplanted into the injury site. After transplantation, the 20. Chang, P. V. et al. Copper-free click chemistry in living animals. Proc. Natl muscle strength of the injured hind limbs was quantitatively measured every day Acad. Sci. USA 107, 1821–1826 (2010). using a grip-strength meter (MELQUEST, GMP-100B). Values are average of three 21. Luchansky, S. J. & Bertozzi, C. R. Azido sialic acids can modulate cell-surface separate experiments in triplicate and are expressed as mean ± SD. At the end of interactions. Chembiochem 5, 1706–1709 (2004). the experiment (after 15 days), the injury site was carefully opened and the 22. Lee, K. Y. & Mooney, D. J. Alginate: properties and biomedical applications. regenerated skeletal muscle tissues were analyzed by CLSM observation. Prog. Polym. Sci. 37, 106–126 (2012). 23. Ishihara, K. et al. Hemocompatibility of human whole blood on polymers with Preparation of tissue cross-linked hydrogels. Female mice (ICR) at 5 weeks of a phospholipid polar group and its mechanism. J. Biomed. Mater. Res. 26, age were purchased from Charles River. In total 6 mg of AC ManNAz was dis- 4 1543–1552 (1992). solved in PBS/DMSO mixture (42/58, v/v). Mice were anesthetized using iso- 24. Saeui, C. T., Urias, E., Li, L., Mathew, M. P. & Yarema, K. J. Metabolic flurane, then 200 μLofAC ManNAz solution was administrated by intraperitoneal 4 glycoengineering bacteria for therapeutic, recombinant protein, and injection. This administration was carried out for continuous 7 days. The mice metabolite production applications. Glycoconj. J. 32, 425–441 (2015). were killed and heart, lung, kidney, and femoral muscle were excised carefully. 25. Gong, J. P. Friction and lubrication of hydrogels-its richness and complexity. These tissues were shredded and suspended with 500 µL of FITC-labeled bAlg- Soft Matter 2, 544–552 (2006). DBCO (0.1%) in DMEM, incubated at 37 °C for 30 min for biorthogonal click 26. Carré, A., Mittal, K. L. Surface and Interfacial Aspects of Cell Adhesion (CRC reaction. After that, tissues were centrifuged and washed with PBS twice, then Press, 2010). tissues were re-suspended with 1 mL of Live Cell Imaging Solution and observed by 27. Zhang, B. et al. Biodegradable scaffold with built-in vasculature for organ-on- CLSM. For preparation of tissue cross-linked hydrogels, these tissues were shred- a-chip engineering and direct surgical anastomosis. Nat. Mater. 15, 669–678 ded and washed with PBS twice. Pellet of azide-modified tissue was suspended with (2016). 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES buffer and completely dis- 28. Wagner, I. et al. A dynamic multi-organ-chip for long-term cultivation and persed by gentle pipetting. The tissue dispersion solution was added into test tube substance testing proven by 3D human liver and skin tissue co-culture. Lab. and incubated at 37 °C for 1 h. Gel formation was checked by usual test tube Chip. 13, 3538–3547 (2013). inverting methods. 29. Carosio, S. et al. Generation of ex vivo-vascularized Muscle Engineered Tissue (X-MET). Sci. Rep. 3, 1420 (2013). Data availability. The authors declare that the data supporting the findings of this 30. Zhao, X. et al. Labeling of enveloped virus via metabolic incorporation of study are available within the paper and its supplementary information files. azido sugars. Bioconjugate Chem. 26, 1868–1872 (2015). 31. Memmel, E., Homann, A., Oelschlaeger, T. A. & Seibel, J. Metabolic glycoengineering of Staphylococcus aureus reduces its adherence to human Received: 22 January 2016 Accepted: 1 May 2018 T24 bladder carcinoma cells. Chem. Commun. 49, 7301–7303 (2013). Acknowledgements This work was supported by JSPS KAKENHI Grant Number 15K13791. We thank Prof. Keiko Kawauchi, Konan University, for providing technical support to engineer Lifeact- GFP-expressing cells. 10 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE Author contributions Open Access This article is licensed under a Creative Commons K.N. designed this study, performed experiments, and wrote the paper. A.T. and Y.K. Attribution 4.0 International License, which permits use, sharing, performed experiments and analyzed the data. adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party Additional information material in this article are included in the article’s Creative Commons license, unless Supplementary Information accompanies this paper at https://doi.org/10.1038/s41467- indicated otherwise in a credit line to the material. If material is not included in the 018-04699-3. article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from Competing interests: The authors declare no competing interests. the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/. Reprints and permission information is available online at http://npg.nature.com/ reprintsandpermissions/ © The Author(s) 2018 Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 11 | | | http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nature Communications Springer Journals

Living functional hydrogels generated by bioorthogonal cross-linking reactions of azide-modified cells with alkyne-modified polymers

Free
11 pages
Loading next page...
 
/lp/springer_journal/living-functional-hydrogels-generated-by-bioorthogonal-cross-linking-sTv0PQM57k
Publisher
Nature Publishing Group UK
Copyright
Copyright © 2018 by The Author(s)
Subject
Science, Humanities and Social Sciences, multidisciplinary; Science, Humanities and Social Sciences, multidisciplinary; Science, multidisciplinary
eISSN
2041-1723
D.O.I.
10.1038/s41467-018-04699-3
Publisher site
See Article on Publisher Site

Abstract

ARTICLE DOI: 10.1038/s41467-018-04699-3 OPEN Living functional hydrogels generated by bioorthogonal cross-linking reactions of azide- modified cells with alkyne-modified polymers 1 1 1 Koji Nagahama , Yuuka Kimura & Ayaka Takemoto To date, many scientists have thoroughly investigated both cells and cellular functions, resulting in the identification of numerous molecular mechanisms underlying the cellular functions. Based on these findings, medical scientists and pharmacologists have developed many technological applications for cells and cellular functions in medicine. How can material scientists utilize cells and cellular functions? Here, we show a concept for utilizing cells and their functions from the viewpoint of materials science. In particular, we develop cell cross- linked living bulk hydrogels by bioorthogonal click cross-linking reactions of azide-modified mammalian cells with alkyne-modified biocompatible polymers. Importantly, we demonstrate the unique functionalities of the living hydrogels, originating from the basic functions of the cells incorporated in the living hydrogels as active cross-linking points. The findings of this study provide a promising route to generating living cell-based next-generation innovative materials, technologies, and medicines. Department of Nanobiochemistry, Frontiers of Innovative Research in Science and Technology (FIRST), Konan University, 7-1-20 Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan. Correspondence and requests for materials should be addressed to K.N. (email: nagahama@center.konan-u.ac.jp) NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 1 | | | 1234567890():,; ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 any scientists have been and continue to be interested precursor for azide-modified sialic acid residues, as reported 20, 21 in cells, and especially in cellular functions. This has led previously (Supplementary Fig. 1) . The obtained AC Man- Mto the identification of many molecular mechanisms NAz was characterized by ESI-MS and H-NMR measurements underlying cellular functions and cell–cell interactions in living (Supplementary Figs. 2 and 3). Conversion of the NH group of 1–5 systems , which in turn has led to the development by medical mannosamine into an azide groups was calculated to be 96% scientists and pharmacologists of many technological applications based on the H-NMR spectrum and conversion of the OH of cells and cellular functions in medicine, including cancer groups of N-azidomannosamine into acetyl groups was estimated 6–8 therapy and regenerative medicine . How can materials scien- to be 97%. AC ManNAz was not cytotoxic to C2C12 cells (mouse tists utilize cells and cellular functions? The molecular mechan- myoblast) below 100 μM (Supplementary Fig. 4). Following isms underlying cellular functions provide the best role models treatment with AC ManNAz, azide groups on the cell surface for the design of advanced multifunctional materials, and che- were detected by covalent labeling using the clickable fluorescent mists have utilized functional biomolecules, such as nucleic dye dibenzocyclooctyne (DBCO)-modified carboxyrhodamine. 9, 10 11, 12 13, 14 acids , proteins , and polysaccharides , as essential Fluorescence microscopic images (Supplementary Fig. 5a) active components for designing materials, including smart showed surface-labeled C2C12 cells, indicating the incorporation materials. Cells and cellular functions are also attractive and of azide groups on the cell surface glycans. The fluorescence promising active components for the design of functional mate- intensity per cell was quantified and clearly increased as the rials. Combining living cells with synthetic materials could enable AC ManNAz concentration increased (Supplementary Fig. 5b). the fabrication of living multifunctional materials capable of, for Moreover, growth curves of azide-modified C2C12 cells [N (+) example, sensing the environment, time-programming, move- C2C12] treated with 100 μMAC ManNAz were similar to that of ment, and signal transduction, all originating from the functions normal C2C12 cells [N (−)C2C12] (Supplementary Fig. 6). We of the incorporated cells. therefore chose 100 μM as the optimal AC ManNAz concentra- Here, we demonstrate a concept for utilizing cells and their tion. Importantly, cell-surface fluorescence was maintained even functions from the viewpoint of materials science. Specifically, we after 10 days’ cultivation in DMEM without AC ManNAz, demonstrate living multifunctional hydrogels generated by although the fluorescence intensity gradually decreased due to cell bioorthogonal click cross-linking reactions of azide-modified division (Supplementary Fig. 7). mammalian cells with alkyne-modified biocompatible polymers, Live cells were covalently cross-linked with alkyne-modified as shown in Fig. 1. Furthermore, we demonstrate the unique polymers using copper-free click chemistry to avoid the potential functionality of the living hydrogels originating from the basic toxicity of copper catalysts. We selected alginic acid (Alg, 100,000 functions of the incorporated cells as active cross-linking points. Da) as a polymer component because of its good biocompatibility and synthesized branched alginic acid (bAlg) using amine- terminated 4-arm branched polyethylene glycol (4-arm PEG, Results 20,000 Da, Supplementary Fig. 8). The molecular composition of Preparation of cell cross-linked hydrogels. Metabolic gly- bAlg was estimated by H-NMR analysis (Supplementary Fig. 9). coengineering was used to incorporate reactive azide groups on 15–17 The integration ratios of the anomeric protons of glucuronic acid the cell surface . The monosaccharide precursor was modified (peak a) and mannuronic acid (peak b) in the Alg segment to the with an azide group, then incorporated into cell-surface glycans methylene protons of the PEG segment (peak c) indicated that through biosynthetic machinery. Sialic acid is one of the most the molar ratio of Alg to 4-arm PEG in bAlg was ~9:1. Next, we abundant cell-surface glycans on mammalian cells and is typically 18, 19 synthesized dibenzocyclooctyne (DBCO)-modified bAlg (bAlg- found at the terminating branches of these glycans .We DBCO) (Supplementary Fig. 10); H-NMR analysis showed that therefore targeted sialic acid residues for azide-modification on average 13 DBCO groups were introduced per bAlg molecule because the location (the outermost surface of cells) and abun- and the molecular weight of bAlg-DBCO was 1,026,800 Da dance (high concentration on cell surface) of sialic acid residues is (Supplementary Fig. 11). We analyzed the hydrodynamic ideal for efficient bioorthogonal click cross-linking with alkyne- diameter of bAlg-DBCO by dynamic light scattering (DLS) using modified polymers. The tetraacetylated monosaccharide N-azi- a dilute solution (0.05%) of bAlg-DBCO and found that the doacetylmannosamine (AC ManNAz) was synthesized as the Branched alginate-DBCO (bAlg-DBCO) N N HN O OH O OH OH OH OH Azide-modified cells O O O O O O HO O HO Cell surface glycans Ac ManNAz N NH O O OH O R H COCO H 3 3 N N O N O 3 3 HN O N H COCO O 3 R = H or H COCO 3 OCOCH Metabolic Click cross-linking reaction between glycoengineering DBCO groups on the polymers and 3 the azide groups on the cell surface N 3 3 N glycans Cell cross-linked hydrogels Azide groups were (CxGels) generated on cell surface glycans Fig. 1 Schematic illustration of the construction of cell cross-linked hydrogels (CxGels). Reactive azide groups are covalently incorporated into cell-surface glycans through the biosynthetic machinery. CxGels are constructed via bioorthogonal click cross-linking reaction between the azide-modified cells and the alkyne-modified polymers 2 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE ab 10,000 6 6 G ′ (2.0 × 10 cells) G ″ (2.0 × 10 cells) 6 6 N (+)C2C12/bAlg-DBCO (1%) 3 G ′ (1.0 × 10 cells) G ″ (1.0 × 10 cells) 6 6 6 6 6 G ′ (0.5 × 10 cells) G ″ (0.5 × 10 cells) 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 0 h 24 h N (+)C2C12/bAlg-DBCO (2%) 6 6 6 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 0 500 1000 1500 2000 2500 3000 3500 0 h Time (seconds) 10,000 N (–)C2C12/bAlg-DBCO (1%) 6 6 6 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 24 h N (–)C2C12/bAlg-DBCO (2%) 6 6 6 0.5 × 10 cells 1 × 10 cells 2 × 10 cells 24 h 020 40 60 80 100 Frequency (rad/s) cd e FITC-bAlg-DBCO C2C12 cells Merge Fig. 2 Preparation and characterization of cell cross-linked hydrogels (CxGels). a Photographs of reaction mixtures of azide-modified C2C12 cells (0.5 × 6 6 6 10 , 1.0 × 10 , and 2.0 × 10 cells) and bAlg-DBCO solutions (1% and 2%, w/v) at 0 h and 24 h after the reaction. Photographs of dispersions of C2C12 6 6 6 cells (0.5 × 10 , 1.0 × 10 , and 2.0 × 10 cells) and bAlg-DBCO solutions (1% and 2%, w/v) after 24 h. b (upper) Gelation kinetics determined through 6 6 6 oscillatory time sweep of CxGels prepared from bAlg-DBCO (2%) and azide-modified C2C12 (0.5 × 10 , 1.0 × 10 , and 2.0 × 10 ) at 37 °C under constant strain (5%) and frequency (10 rad/s). The crossover time point of the storage modulus (G′) and the loss modulus (G″) curves is defined as the mechanical 6 6 6 gel point. (lower) Frequency sweep of CxGels prepared from bAlg-DBCO (2%) and azide-modified C2C12 (0.5 × 10 , 1.0 × 10 , and 2.0 × 10 ) at 2 h after the start of the cross-link reactions at 37 °C under constant strain (5%). c Photographs of CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%). Scale bar indicates 5 mm. d Photographs of the word FIRST written in CxGel made through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%). CxGels were stained with Fast Green FCF to aid visualization. Scale bar indicates 10 mm. e CLSM images of CxGels made through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%). Green: FITC-bAlg-DBCO, red: azide-modified C2C12 cells stained with CytoTell Red. Scale bars indicate 20 μm hydrodynamic diameter was approximately 0.8 μm (Supplemen- cross-linked hydrogels and thus cell cross-linking reactions were tary Fig. 12). performed with different numbers of N (+)cells and different Next, we investigated the click reaction between N (+)C2C12 bAlg-DBCO concentrations. Hydrogel formation was analyzed cells and bAlg-DBCO by suspending N (+)C2C12 cells in PBS using the classic test tube inversion method and by rheological and reacting with FITC-labeled bAlg-DBCO at 37 °C for 30 min. characterization. First, oscillatory time sweep and frequency Fluorescence microscopic images (Supplementary Fig. 13) sweep analyses of 2% bAlg-DBCO solutions showed that the G″ showed C2C12 cells with green fluorescence on their surface, values were always larger than the G′ values, indicating that the demonstrating the successful bioorthogonal click reaction bAlg-DBCO solution was in a sol state (Supplementary Fig. 14a). between bAlg-DBCO and the azide groups on the cell surface We performed a gelation study using a combination of N (−) glycans. The number of N (+)cells and the concentration of C2C12 cells and bAlg-DBCO solutions, using combinations of bAlg-DBCO can be critical factors for the construction of cell N (+)C2C12 cells and bAlg solutions as negative controls. As NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 3 | | | G ′ and G ″ (Pa) G ′ and G ″ (Pa) ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 shown in Fig. 2a and Supplementary Fig. 14, we confirmed that of the CxGels decreased as the number of N (+)C2C12 cells these negative controls did not result in hydrogel formation. increased, indicating that the N ( + )C2C12 cells are a critical Reaction mixtures of N (+)C2C12 cells and bAlg-DBCO solution factor in facilitating the fabrication of networks of bAlg polymers. (1%) did not form bulk-sized hydrogels even after 24 h (Fig. 2a). Frequency sweep experiments were performed on the CxGels In contrast, immediate gelation was achieved using a reaction were performed 2 h after initiation of the cross-linking reaction. mixture of 2.0 × 10 N (+)C2C12 cells and 2% bAlg-DBCO The G′ values of CxGels containing relatively high cell numbers 6 6 solution (Fig. 2a and Supplementary Movie 1). (1.0 × 10 and 2.0 × 10 ) did not change with angular frequency, suggesting that the hydrogels were stably formed. In contrast, the G′ values of CxGels containing a low cell number (0.5 × 10 ) Characterizations of cell cross-linked hydrogels. We investi- changed at high frequency, suggesting that the bAlg networks in gated the gelation time by performing oscillatory time sweep the hydrogels were defective. The G′ values of the CxGels increased as the number of N (+)C2C12 cells increased, indi- measurements of reaction mixtures comprising various numbers 6 6 6 of N (+)C2C12 cells (0.5 × 10 , 1.0 × 10 , 2.0 × 10 ) and a fixed cating that the mechanical strength of the CxGels was governed by the number of N (+)C2C12 cells. These results strongly amount of 2% bAlg-DBCO solution (Fig. 2b). Importantly, the G′ value of a mixture of 2.0 × 10 N (+)C2C12 cells and 2% bAlg- indicate that N (+)C2C12 cells act as cross-linking points for the DBCO solution was already higher than their G″ value at time fabrication of three-dimensional bAlg networks in CxGels, as zero (just after mixing by pipetting), proving that cell cross-linked illustrated in Fig. 1. Interestingly, CxGels remained free-standing hydrogels (CxGels) are formed via bioorthogonal click reactions even after vortex shaking (Fig. 2c). Moreover, CxGels prepared between bAlg-DBCO and N ( + )C2C12 cells. The gelation time using 2.0 × 10 N (+)C2C12 cells and 2% bAlg-DBCO solution 3 3 CxGels (bAlg-DBCO/N (+)C2C12) Day 0 Day 3 Day 7 Control gels (bAlg/N (+)C2C12/CaCl ) 3 2 Day 0 Day 3 Day 7 bc d 100 100 CxGels Control gels (bAlg-DBCO/N (+)C2C12) (bAlg/N (+)C2C12/CaCl ) 3 3 2 Control gels CxGels (bAlg/N (+)C2C12/CaCl ) (bAlg-DBCO/N (+)C2C12) 3 2 10 12 bAlg/CaCl gels Control gels 8 (bAlg/N (+)C2C12/CaCl ) 3 2 CxGels (bAlg-DBCO/N (+)C2C12) 50 0.1 0 0123 4567 0 1 2 3 4567 0123 4567 Culture time (days) Culture time (days) Culture time (days) Fig. 3 Characterizations of the CxGels. a (upper) CLSM images of CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%) after live/dead assay. (lower) CLSM images of C2C12 cells-encapsulating control physical gels prepared through physical cross-linking reaction between bAlg solution (2%) and CaCl solution (0.5%) in the presence of azide-modified C2C12 cells (2.0 × 10 cells) after live/dead assay. CLSM observation was carried out at days 0, 3 and 7 after CxGels preparation. Green fluorescence indicates live cells stained with calcein- AM and red fluorescence indicates dead cells stained with PI. Scale bars indicate 200 μm. b Cell viability of C2C12 cells in the CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%) and the cell-encapsulating control physical gels analyzed using the CLSM images after live/dead assay. Live/dead assay was performed at days 0, 1, 3, 5, and 7. Error bars: standard deviation (n= 3). c Proliferation rates of C2C12 cells existing in the CxGels prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%) and the control physical gels analyzed using the WST-1 assay. Error bars: standard deviation (n= 3). d Time-dependent changes in the dry CxGels weight, the cell-encapsulating control physical gel, and normal bAlg physical gels cultured in DMEM for 7 days at 37 °C. Error bars: standard deviation (n= 3) 4 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | Cell viability (%) Proliferation rate of cells in gels (fold control) Dry gel weight (mg) NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE can be molded immediately into complex shapes by discharging contrast, ionically physically cross-linked alginate gels can be 2+ the reaction mixture from a pipet (Fig. 2d), indicating good swollen and then eroded by the release of Ca ions into the handling and molding properties. Furthermore, CxGels can be surrounding medium due to exchange reactions with monovalent constructed using several kinds of cells (Supplementary Fig. 15a cations such as sodium ions . Consequently, the swelling of 2+ and 12b), indicating that this gel construction method is uni- C2C12 cell-encapsulating bAlg/Ca gels would be due to versally applicable to whole mammalian cells. Note that, since exchange reactions with monovalent cations produced by cell N (+)C2C12 cells can be stored in the frozen state for long metabolism processes. On the other hand, the CxGels in which periods of time and retain their azide-modification, CxGels can be the bAlg network is covalently cross-linked with cells should be made using thawed cells (Supplementary Fig. 15c). Long-term resistant to swelling caused by ion exchange reaction. However, storage is advantageous for securing a stable supply of N (+)cells since cells act as the cross-linking points in the CxGels, cell for use as living building blocks. Confocal microscopy analysis of division in the CxGels would decrease the number of cross- CxGels revealed that C2C12 cells (labeled with red) were uni- linking points, leading to swelling. formly dispersed within the three-dimensional networks of bAlg The dry weights of the CxGels and the C2C12 cell- 2+ (labeled with green) (Supplementary Fig. 16). Moreover, micro- encapsulating bAlg/Ca gels increased in a time-dependent phase separated structures consisting of cell domains and bAlg manner over the first 4 days and the rate of increase of the C2C12 2+ networks were observed (Fig. 2e), indicating that bAlg did not cell-encapsulating bAlg/Ca gels was higher than that of the enter the cells but rather reacted with the surface of the cells. We CxGels (Fig. 3d). The number of C2C12 cells in both the CxGels 2+ calculated the total volume fraction of C2C12 cells in a CxGel and bAlg/Ca gels increased in a time-dependent manner but 6 2+ prepared by mixing 2.0 × 10 N (+)C2C12 cells and 100 μLof2% the proliferation rate in the bAlg/Ca gels was higher than that bAlg-DBCO solution by using a simple sphere model for the cells in the CxGels (Fig. 3c). These results suggest that the increase in and assuming that the radius of each cell is 10 μm. The volume of dry weight of both the CxGels and the C2C12 cell-encapsulating 3 3 2+ a cell was calculated to be 4187 μm using the formula (4/3)pi*r . bAlg/Ca gels is due to cell proliferation in these gels. To verify 9 3 The total volume of cells in the CxGel was 8.4 × 10 μm , and this interpretation, we examined the relationship between the thus the total volume fraction of C2C12 cells in the CxGel was number of C2C12 cells and their dry weights: we obtained a linear 8.4%. The total volume fraction of C2C12 cells likely corresponds relationship, and the dry weight per 1.0 × 10 cells was estimated to the three-dimensional image of a CxGel obtained by confocal to be 0.9 mg. This incremental increase in dry weights per 1.0 × microscopy analysis (Supplementary Fig. 16). 10 cells roughly corresponds with the dry weight of C2C12 cells A key question regarded the fate of cells in CxGels acting as initially present in these gels, although the dry weight of the gel active cross-linking points was: do the cells remain alive and grow would include the cell culture medium, metabolites, and ECM in the CxGels? The viability of C2C12 cells in CxGels was proteins produced by the cells. Note that the dry weight of the investigated using a live/dead assay. As shown in Fig. 3a, b, most CxGels decreased from day 4 to day 7, and the number of C2C12 of the C2C12 cells in the CxGels showed green fluorescence, with cells present in the CxGels also decreased during this time only a few cells showing red fluorescence, indicating high cell (Fig. 3d). On the other hand, the dry weight of the C2C12 cell- 2+ viability (over 93%). Next, we investigated the proliferation of encapsulating bAlg/Ca gels continuously increased during this 2+ C2C12 cells in CxGels using the WST-1 assay and obtained a 7 day periods, and the number of C2C12 cells in the bAlg/Ca linear relationship between the cell number and the absorbance gel also increased during this time. Changes in the mechanical within the cell concentration range tested (Supplementary strength of the CxGels during cultivation are shown in Supplementary Fig. 19. The G′ values of the CxGels decreased Fig. 17). The C2C12 cells in CxGels clearly proliferated by logarithmic growth, suggesting that cells in CxGels exhibit basic in a time-dependent manner, and remarkable changes in the G′ cellular functions. As mentioned above, our aim in this study is to values at high frequency were detected for CxGels cultured for 5 demonstrate that the covalent combination of living cells, acting and 7 days, suggesting that the bAlg networks in these hydrogels as active cross-linking points, enables the development of were defective. Taking all our results together, we conclude that multifunctional hydrogels with unique functionalities that since C2C12 cells act as the cross-linking points in CxGels, the originate from the cells. We therefore selected two basic cellular cell proliferation (cell division) causes a decrease in the number of functions to demonstrate utility of our approach: autonomous cell cross-linking points, leading to swelling (from day 1 to day 4) and growth and selective cell adhesion. subsequent degradation (from day 4 to day 7) of the CxGels, as illustrated in Supplementary Fig. 20. In other words, components of CxGels are released after day 4, leading to a decrease in dry gel Self-growing and self-degradation abilities of cell cross-linked weight. Thus, in the CxGel system, cell proliferation (cell hydrogels. First, autonomous cell growth in CxGels was used to division) directly affects the swelling and degradation properties endow functionality to the CxGels. We investigated time- of the CxGels but does not directly affect the swelling and 2+ dependent changes in the swelling ratio of the CxGels, the degradation properties of C2C12 cell-encapsulating bAlg/Ca number of C2C12 cells in the CxGels, their dry gel weight, and gels. Therefore, CxGels have the ability to self-grow and self- the mechanical strength of the gels during 7 days’ cultivation. degrade due to the autonomous growth of cells utilized as active Furthermore, we compared these physical properties with those cross-linking points, and we propose that these are unique of appropriate control gel: N (+)C2C12 cells encapsulated in properties of CxGels. bAlg gels physically cross-linked with calcium ions (gels in which 2+ the cells are not cross-linked with bAlg) and bAlg/Ca physical gels (gels which do not contain cells). No significant change in the Selective adhesion ability of cell cross-linked hydrogels. Second, 2+ swelling ratio or dry weight of the bAlg/Ca gels were observed we utilized the selective adhesion properties of cells. We per- during the 7 days (Fig. 3d; Supplementary Fig. 18), indicating that formed adhesion studies of CxGels and of the C2C12 cells in 2+ the bAlg/Ca gels were not degraded under these experimental CxGels, together with two appropriate control gels: N (+)C2C12 2+ 2+ condition. Note that the CxGels showed remarkably higher cell-encapsulating bAlg/Ca gels and bAlg/Ca gels. The gels 2+ swelling ratios than the C2C12 cell-encapsulating bAlg/Ca gels. were placed on collagen-coated dishes or 2-methacryloyloxyethyl Alginate is inherently non-degradable in cell culture medium, as phosphorylcholine (MPC) polymer-coated dishes and cultured medium lack enzymes that can cleave alginate polymer chains. In for 24 h in DMEM. An MPC polymer coating resists the surface NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 5 | | | ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 Collagen-coated dish MPC polymer-coated dish Trypsin-EDTA treatment Culture for 24 h Fig. 4 CxGel adhesion to cell culture dishes via the adhesion of cells at the surface. (left panels) Photographs of CxGels, prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%), adhered to collagen-coated dishes via the adhesion of cells in the CxGels. After trypsin-EDTA treatment, the adhering cells detached from the dish and the CxGels detached. The CxGels adhered onto a collagen-coated dish again when placed on the dish and cultured in DMEM for 24 h. (right panel) In contrast, since cells in the CxGels, prepared through click reaction between azide-modified C2C12 cells (2.0 × 10 cells) and bAlg-DBCO solution (2%), did not adhere onto MPC polymer-coated dishes, the CxGel also did not adhere onto MPC polymer-coated dishes even after 24 h. Scale bars indicate 20 μm 23 2+ binding of cells . We found that the bAlg/Ca physical gels did to the reversible adhesion of cells in the CxGels (Fig. 4 bottom left not adhere to either the collagen- or MPC polymer-coated dishes panel and Supplementary Movie 6). (Supplementary Fig. 21), indicating that no effective interaction is formed between bAlg molecules and collagen- or MPC polymer- Preparation of tissue cross-linked hydrogels. To assess whether 2+ coated dishes. Moreover, the bAlg/Ca gels encapsulating our approach to fabricate cell cross-linked hydrogels is applicable C2C12 cells also did not adhere onto either dish, whereas C2C12 to cells in tissues, we attempted the in vivo azide-modification of 2+ cells physically encapsulated in bAlg/Ca gels adhered onto the cells in tissues via the intraperitoneal administration of collagen-coated dishes. This result indicates that the adhesion of Ac ManNAz to mice for 7 continuous days (Supplementary 2+ 4 C2C12 cells physically encapsulated in networks of bAlg/Ca Fig. 22). The azide-modification of lung, femoral muscle, kidney, gels did not result in the adhesion of the entire gel. On the other and heart tissues was assessed by excising the tissue and treating hand, C2C12 cells in CxGels cultured on a MPC polymer-coated with FITC-labeled bAlg-DBCO ex vivo. Control tissues (without dish did not adhere and the CxGels slipped on the dish when Ac ManNAz administration) did not show green fluorescence, tilted (Fig. 4 right panel and Supplementary Movie 2). In contrast, whereas tissues from mice subjected to Ac ManNAz adminis- C2C12 cells in CxGels cultured on a collagen-coated dish adhered tration clearly showed green fluorescence (Fig. 5a left and middle and the CxGels also adhered to the dish (Fig. 4 top of left panel). panel), indicating the successful in vivo reactive azide- Consequently, the adhesion of C2C12 cells chemically (cova- modification of tissues. We prepared tissue cross-linked hydro- lently) connected to the bAlg networks of CxGels results in gels (TxGels) via a bioorthogonal click cross-linking reaction adhesion of the entire gel. Surprisingly, the CxGels maintained between azide-modified tissues and bAlg-DBCO. Interestingly, all adhesion even after relatively strong physical stimuli (Supple- tissues tested formed TxGels, indicating that our approach for mentary Movie 3 and 4). However, trypsin-EDTA treatment fabrication of CxGels is applicable to cells in tissues (Fig. 5a right resulted in the adhering CxGels easily detaching from the dish panel). due to detachment of the adhering cells from the dish (Fig. 4, middle of left panel and Supplementary Movie 5), indicating that detachment of the cells directly results in detachment of the Potential application of cell cross-linked hydrogels as injectable CxGels. Thus, the selective adhesion of CxGels is derived from biomaterials for regenerative medicine. We conceived the the ability of C2C12 cells in CxGels to selectively adhere onto design of injectable gels for regenerative medicine as one example surfaces. Interestingly, the detached CxGels can adhere again of the potential application of CxGels and thus investigated onto a collagen-coated dish after 24 h’ cultivation in DMEM due in vivo CxGel formation. A suspension of LifeAct-GFP- 6 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE ab Azide-modified Tissue cross-linked Normal tissue tissue hydrogels (TxGels) Lung CxGels (bAlg-DBCO/N (+)C2C12) Control gels (bAlg/N (+)C2C12/CaCl ) 3 2 Heart PBS –10 02468 10 12 14 16 Time (days) Muscle CxGels bAlg Kidney Fig. 5 Tissue cross-linked hydrogels (TxGels) and in vivo CxGels formation. a (left panels) CLSM images of normal mouse tissues treated with FITC-bAlg- DBCO solution. These tissues were carefully excised, then shredded and suspended with 500 µL of FITC-labeled bAlg-DBCO (0.1%) solution at 37 °C for 30 min. After that, tissues were centrifuged and washed with PBS twice, then tissues were re-suspended with 1 mL of Live Cell Imaging Solution and observed by CLSM. Scale bars indicate 100 μm. (middle panels) CLSM images of azide-modified mouse tissues treated with FITC-bAlg-DBCO solution. Mice treated with AC ManNAz for continuous 7 days were killed and the tissues were excised carefully. These tissues were shredded and washed with PBS twice. These tissues were carefully excised, then shredded and suspended with 500 µL of FITC-labeled bAlg-DBCO (0.1%) solution at 37 °C for 30 min. After that, tissues were centrifuged and washed with PBS twice, then tissues were re-suspended with 1 mL of Live Cell Imaging Solution and observed by CLSM. Scale bars indicate 100 μm. (right panels) Photographs of tissue cross-linked hydrogels (TxGels) made through click reaction between azide- modified tissues and bAlg-DBCO solution (2%) ex vivo. Scale bars indicate 100 μm. b Photographs of in vivo formed CxGels. LifeAct-GFP-expressing azide-modified C2C12 cells (4.0 × 10 ) were suspended with 200 μL of bAlg-DBCO solution (2%) and immediately injected subcutaneously into the muscle layer of the back of each mouse. c Force recovery of injured femoral muscle treated with CxGels prepared through click reaction between LifeAct- GFP-expressing azide-modified C2C12 cells (5.0 × 10 ) and 250 μL of bAlg-DBCO (2%) or C2C12 cells-encapsulating control physical gels, prepared through physical cross-linking reaction between 250 μL of bAlg solution (2%) and CaCl solution (0.5%) in the presence of azide-modified C2C12 cells (5.0 × 10 cells). Error bars: standard deviation (n = 3). d Fluorescence images of LifeAct-GFP-expressing C2C12 cells in the CxGels or the control physical gels acquired 15 days after transplantation into injured muscle. Green: LifeAct-GFP, blue: Hoechst. Scale bars indicate 50 μm expressing N (+)C2C12 cells in bAlg-DBCO solution was Importantly, GFP-expressing muscle tissue-like structures were injected into the subcutaneous tissue of nude mice, and in situ detected within the CxGels at day 15 after transplantation hydrogel formation was observed (Fig. 5b). To assess the utility of (Fig. 5d) whereas no organized structures were observed in mice CxGels in regenerative medicine, LifeAct-GFP-expressing N (+) treated with the control gels. We therefore found that treatment C2C12 cells suspended in bAlg-DBCO solution were injected into with CxGels provides the most effective muscle force recovery, severe skeletal muscle defects in the hind limbs of mice (Sup- demonstrating the advantage of CxGels. Moreover, these results plementary Fig. 23) and functional recovery was evaluated using a indicate the utility of CxGels as delivery and scaffolding materials grip-strength meter . We also performed this muscle injury for regenerative medicine. study using two appropriate negative controls: treatment with 2+ bAlg/Ca physical gels encapsulating LifeAct-GFP-expressing N (+)C2C12 cells, and no treatment (PBS injection). Note that Discussion the CxGels formed in situ clung to the muscle defect site due to Cells and cellular functions should be attractive and promising the selective adhesion ability of the C2C12 cells in CxGels. Mice active components for the design of functional materials. Com- transplanted with CxGels exhibited remarkably higher force bining living cells with synthetic materials could enable the fab- 2+ recovery as compared with mice treated with bAlg/Ca gels rication of living multifunctional materials capable of, for encapsulating C2C12 cells (Fig. 5c) while mice treated with the example, sensing the environment, time-programming, move- control gels exhibited similar force recovery as untreated mice. ment, and signal transduction, all originating from the functions NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 7 | | | Force recovery (%) ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 of the incorporated cells. In this study, we present a concept for was purchased from NOF Corporation. Other reagents and solvents available in extra-pure grade were obtained commercially and used without further utilizing cells and their functions from the viewpoint of materials purification. science. In particular, we develop cell cross-linked living bulk hydrogels by bioorthogonal click cross-linking reactions of azide- Synthesis of Ac ManNAz. D-Mannosamine hydrochloride (500 mg, 2.3 mmol) modified mammalian cells with alkyne-modified biocompatible was added to an aqueous solution of azidoacetic acid (200 µL, 2.4 mmol). DMT- polymers (bAlg-DBCO). As mentioned above, our aim in this MM (664 mg, 2.4 mmol) was added to the solution, and the reaction mixture was study is to demonstrate that the covalent combination of living stirred at 45 °C for 2 days. The solution was removed by evaporation to give solid state crude reaction mixtures, and then the objective N-azidoacetyl D- cells, acting as active cross-linking points, enables the develop- mannosamine (ManNAz) was extracted from the crude mixtures by methanol ment of multifunctional hydrogels with unique functionalities wash three times. Moreover, silica gel chromatography (eluting solution: methanol/ that originate from the cells. We therefore selected two basic chloroform = 2/1, v/v) was performed to obtain pure ManNAz. Acetic anhydride cellular functions to demonstrate utility of our approach: (380 µL, 4.0 mmol) was added to a solution of ManNAz (170 mg, 0.66 mmol) in autonomous cell growth and selective cell adhesion. First, we anhydrous pyridine (5 mL, 62 mmol), and the reaction mixture was stirred over- night at room temperature under nitrogen atmosphere. The solution was con- found that the cell proliferation (cell division) directly affects the centrated, resuspended in dichloromethane, and washed with 1 M hydrogen swelling and degradation properties of the CxGels. Therefore, chloride, saturated sodium hydrogen carbonate, and then saturated sodium CxGels have the ability to self-grow and self-degrade due to the chloride. The organic phase was dried using magnesium sulfate, filtered, and autonomous growth of cells utilized as active cross-linking points, evaporated to give solid state of the objective tetraacetylated N-azidoacetyl man- nosamine (Ac ManNAz). H-NMR (500 MHz, CDCl ): 1.98−2.22 (−OCOCH , 4 3 3 and we successfully demonstrate that these are unique properties 12 H), 3.81 (C2HNHCO−, 1 H), 3.92 (−COCH N , 2 H), 4.05−4.13 (C3H,C4H, 2 3 of CxGels. Second, we found that the selective adhesion of CxGels and C5HCH , 4H), 4.27 (C5H, 1 H), 4.62 (C2H, 1 H), 5.18 (C1H, 1H). ESI-MS, is derived from the ability of cells in CxGels to selectively adhere calc. 430.4; found 429.08. onto surfaces. Hydrogels generally have a remarkably low friction coefficient because of the large amount of free water on their Cell culture. MCF-7 cells (human breast adenocarcinoma cell line), C2C12 cells surface, making the stable attachment of hydrogels onto solid (mouse myoblast cell line), and HL-60 cells (human promyelocytic leukemia cells) were purchased from ATCC. MCF-7 and C2C12 cells were cultured in DMEM materials difficult . On the other hand, cells can adhere onto supplemented with 10% FBS and antibiotic solution containing penicillin (100 various solid materials with a wide range of water contact angles −1 −1 units mL ) and streptomycin (100 µg mL ) and 2.0 mM L-glutamine at 37 °C in in the presence of cell attachment proteins . We found that a humidified atmosphere containing 5.0% CO . HL-60 cells were cultured in RPMI CxGels can adhere onto materials which alginate gels cannot by 1640 medium supplemented with 10% FBS and antibiotic solution containing −1 −1 using the selective adhesion abilities of the cells. Thus, we propose penicillin (100 units mL ) and streptomycin (100 µg mL ) and 2.0 mM L- glutamine at 37 °C in a humidified atmosphere containing 5.0% CO . that the selective adhesive ability of CxGels is unique as compared to existing hydrogels. Taken together, we have successfully Metabolic activity. C2C12 cells (1.0 × 10 cells per well) were seeded on 96-well demonstrated that the functions of cells covalently incorporated plate and then 200 μL of DMEM containing Ac ManNAz with varied concentra- into CxGels as active cross-linking points are useful for endowing tions was added to the well and cultured for 24 h at 37 °C in a humidified atmo- CxGels with unique functionalities. sphere containing 5.0% CO . Ten µL of WST-1 solution (WST-1/1-methoxy PMS In this study, we prepared tissue cross-linked hydrogels = 9/1, v/v) was added to the well, and incubated at 37 °C for 2 h. Absorbance at 450 nm and 620 nm was measured by microplate reader (Multiskan FC, Thermo (TxGels) via a bioorthogonal click cross-linking reaction between Scientific). Values are average of three separate experiments and are expressed as azide-modified tissues and bAlg-DBCO. Recently, organ on a mean ± SD. chip technology has received significant attention as an exciting 27, 28 approach to test chemicals for human safety . In this tech- Preparation of azide-modified cells. C2C12 cells (1.0 × 10 ) were seeded on 3 cm nology, three-dimensional cellular assemblies with organ-level glass bottom dish, and then 2 mL of DMEM containing Ac ManNAz (0, 10, 20, 30, structures and functions must be re-created on a chip. The suc- 50, and 100 μM) was added to the dish and incubated at 37 °C for 3 days. The cess of organ on a chip technology requires the development of supernatant was removed and then 2 mL of DMEM was freshly added to the dish. DBCO-carboxyrhodamine 110 (final concentration: 5 µM) was added to the dish methods to create three-dimensional cellular assemblies applic- and incubated at 37 °C for 1 h. Cells attached on the dish were washed twice with able to all types of cells in an organism. In this context, we phosphate buffered saline (PBS) and 1 mL of Live Cell Imaging Solution (Life conceived that the fabrication of CxGels would be applicable to Technologies) was added, and then the cells were observed by confocal laser creating three-dimensional cellular assemblies of various types of scattering microscopy (CLSM, ZEISS LSM700). Fluorescence intensity per cell is analyzed by line profiles across a cell in the z-stack images. To prevent saturation of cells. Generally, tissues exhibit more complicated, diverse, and the intensity, we firstly set gain to adjust the detector signal using C2C12 cells with higher functionalities than single cells, and thus TxGels likely 100 μMAc ManNAz treatment providing maximum fluorescence intensity. After exhibit unique, higher order functionalities than CxGels. This that, CLSM observation of C2C12 cells with different concentrations of Ac Man- approach to the fabrication of TxGels would be applicable to NAz treatments was performed using the same gain. The fluorescence intensity is represented as the average of ten cells analyzed and are expressed as mean ± SD. organ on a chip technology. In conclusion, we demonstrated a concept and a method for utilizing cells and cellular functions in the design of multi- Metabolism of azide groups on cell surfaces. C2C12 cells (1.0 × 10 ) were seeded on 3 cm glass bottom dish, and then 2 mL of DMEM containing functional bulk hydrogels. Importantly, whole mammalian cells Ac ManNAz (100 μM) was added to the dish and incubated at 37 °C for 3 days. and their functions are retained in CxGels, and unique func- The supernatant was removed and washed with PBS twice, and then cells were tionalities are generated. This method can be applied to bacteria cultured for 10 days with 2 mL of DMEM without Ac ManNAz. After pre- and viruses because their surfaces can be modified by metabolic determined times, DBCO-carboxyrhodamine 110 (final concentration: 5 µM) was 29–31 added to the dish and incubated at 37 °C for 1 h. Cells attached on the dish were glycoengineering . Therefore, the findings of this study pro- washed twice with phosphate buffered saline (PBS) and 1 mL of Live Cell Imaging vide a promising route to the generation of living cell-based next- Solution (Life Technologies) was added, and then the cells were observed by generation innovative materials, technologies, and medicines. confocal laser scattering microscopy. Fluorescence intensity of the whole cell sur- faces are represented as the average of ten cells analyzed using z-stack images and are expressed as mean ± SD. Methods Materials. D-Mannosamine hydrochloride, 2-azidoacetic acid, acetic anhydride, pyridine, alginic acid sodium salt (M : 100,000), and azide fluor 545 were pur- Proliferation of azide-modified cells. C2C12 cells were seeded on 10 cm dish, chased from Sigma-Aldrich. 4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-4-methylmor- then 10 mL of DMEM with or without Ac ManNAz (100 µM) was added to the pholinium chloride n-hydrate (DMT-MM) was purchased from Wako Pure dish and incubated at 37 °C for 3 days. Cells were collected by usual trypsin Chemical. WST-1 was purchased from Dojindo. DBCO-carboxyrhodamine 110 treatment and centrifuged (1000 rpm, 3 min), then supernatant was removed. The and dibenzylcyclooctyne-PEG -amine (DBCO-PEG -amine) were purchased from pellet of azide-modified cells was re-suspended with DMEM, and seeded on 6 well 4 4 Click Chemistry Tools. 4-arm PEG-NH (M : 20,000, SUNBRIGHT PTE-200PA) plate (5 × 10 cells) and cultured at 37 °C in a humidified atmosphere containing 2 w 8 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE 5.0% CO . After predetermined times, cell number was counted by trypan blue with 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES buffer (200 mM, pH 7.4), assay. Values are average of 3 separate experiments and are expressed as mean ± then test tube inverting methods were performed. SD. Cell viability in cell cross-linked hydrogels. NPellet of azide-modified C2C12 cells (2.0 × 10 ) was suspended with 100 µL of bAlg-DBCO solution (2%, w/v) in Synthesis of branched alginic acid. 4-arm PEG-NH (2 mg, 0.1 μmol) and DMT- HEPES buffer and cells were completely dispersed by gentle pipetting. The cell MM (33.2 μg, 0.12 μmol) dissolved in 2 mL of pure water was added to 18 mL of dispersion solution was put on glass bottom dish and incubated at 37 °C for 1 h. alginic acid (100 mg, 1 μmol) solution, and stirred at room temperature for 6 h. The Two mL of DMEM was added on the gels and cultured at 37 °C in a humidified reaction mixture was dialyzed (MWCO: 14,000) against pure water for 2 days, then atmosphere containing 5.0% CO . After a sufficient time, Calcein-AM (DOJINDO) the resultant solution was freeze-dried to give white powder of branched alginic and propidium iodide (PI, DOJINDO) were added in the medium and reacted for acid (bAlg). Molecular structure of bAlg was determined by H-NMR analysis 30 min at 37 °C, then gels were washed with PBS twice and CLSM observation was (D O, 85 °C). carried out in 1 mL of Live Cell Imaging Solution. Values are average of three separate experiments and are expressed as mean ± SD. To prepare C2C12 cells- Synthesis of alkyne-modified branched alginic acid. DBCO-PEG -amine (6.7 encapsulating control physical gels, azide-modified C2C12 cells (2.0 × 10 ) were mg, 12.7 μmol) and DMT-MM (4.2 mg, 15.3 μmol) dissolved in 1 mL of pure water well suspended with 100 µL of bAlg solution (2%, w/v) in HEPES buffer in the was added to 19 mL of bAlg (100 mg, 0.15 μmol) solution, and stirred at room presence of CaCl solution (0.5%). The cell viability of C2C12 cells physically temperature for 24 h. The reaction mixture was dialyzed (MWCO: 14,000) against encapsulated in the control gels was also examined with the same live/dead assay. pure water for 2 days, then the resultant solution was freeze-dried to give white powder of DBCO-modified branched alginic acid (bAlg-DBCO). Molecular Cell proliferation in cell cross-linked hydrogels. Pellet of azide-modified C2C12 structure of bAlg-DBCO was determined by H-NMR analysis (D O, 85 °C). The 2 5 cells (2.0 × 10 ) was suspended with 10 µL of bAlg-DBCO solution (2%, w/v) in hydrodynamic diameters of bAlg and bAlg-DBCO solutions (0.05%) in PBS were HEPES buffer and cells were completely dispersed by gentle pipetting. The cell measured by dynamic light scattering (DLS, ZETASIZER NanoSeries ZEN-3600, dispersions were poured into 96-well plate and incubated at 37 °C for 1 h. Two Malvern). hundred μL of DMEM was added on the gels and cultured for 7 days at 37 °C in a humidified atmosphere containing 5.0% CO . The supernatant was carefully changed with fresh DMEM with or without Ac ManNAz (100 μM) every day. After Bioorthogonal click reaction between azide-modified cells and bAlg-DBCO. 4 predetermined times, the gels were carefully transferred into a new well, then 100 Azide-modified C2C12 cells (4.5 × 10 ) were washed twice with PBS, the cen- μL of fresh DMEM and 5 µL of WST-1 solution was added to the well and incu- trifuged. The pellet was suspended with 500 µL of FITC-labeled bAlg-DBCO (0.5%) bated at 37 °C for 2 h. The gels were demolished thoroughly by vigorous pipetting, in DMEM, incubated at 37 °C for 30 min for bioorthogonal click reaction. After then the 96-well plate was centrifuged and the supernatant that, cells were centrifuged and washed with PBS twice, then cells were re- (100 μL) was carefully sucked and poured into new 96-well plate. Absorbance at suspended with 1 mL of Live Cell Imaging Solution and observed by CLSM. 450 nm and 620 nm was measured by microplate reader. Values are average of three separate experiments and are expressed as mean ± SD. To prepare C2C12 In vitro preparation of cell cross-linked hydrogels. Pellet of azide-modified cells-encapsulating control physical gels, azide-modified C2C12 cells (2.0 × 10 ) 6 6 6 C2C12 cells (0.5 × 10 , 1.0 × 10 or 2.0 × 10 ) was suspended with 100 µL of bAlg- were well suspended with 10 µL of bAlg solution (2%, w/v) in HEPES buffer in the DBCO solution (1% and 2%, w/v) in HEPES buffer (200 mM, pH 7.4) and cells presence of CaCl solution (0.5%). The cell proliferation of C2C12 cells physically were completely dispersed by gentle pipetting. The cell dispersions were added into encapsulated in the control gels was also examined with the same test tube and incubated at 37 °C. Gel formation was checked by usual test tube WST-1 assay. inverting methods. Five hundred mL of DMEM was carefully added on the hydrogels prepared in test tube, then hydrogels was taken out from the test tube by Weight change in cell cross-linked hydrogels. Pellet of azide-modified C2C12 vortex shaking, placed on the slide glass and taken a picture. The same procedure cells (1.0 × 10 ) was suspended with 50 µL of bAlg-DBCO solution (2%, w/v) in was carried out to prepare cell cross-linked hydrogels using MCF-7 and HL-60. As HEPES buffer and cells were completely dispersed by gentle pipetting. The cell 6 6 6 controls, normal C2C12 cells (0.5 × 10 , 1.0 × 10 or 2.0 × 10 ) was suspended with dispersion solution was poured into plastic microtube and incubated at 37 °C for 1 100 µL of bAlg-DBCO solution (1% and 2%, w/v) in HEPES buffer (200 mM, pH h. In total 1 mL of DMEM was added on the gels and cultured for 7 days at 37 °C in 7.4), and test tube inverting methods were performed. Moreover, azide-modified a humidified atmosphere containing 5.0% CO . DMEM was changed with fresh 6 2 C2C12 cells (2.0 × 10 ) was also suspended with 100 µL of bAlg solution (2%, w/v) one every day. After predetermined time, the remained gels were carefully trans- in HEPES buffer (200 mM, pH 7.4), and test tube inverting methods were per- ferred into a new plastic microtube, and washed with PBS twice, then the weight of formed as controls. swollen gels was measured. Moreover, gels were lyophilized and the weight of the dry gel was also measured. Values are average of three separate experiments and are expressed as mean ± SD. To prepare C2C12 cells-encapsulating control physical Rheological characterization of cell cross-linked hydrogels. Pellet of azide- 6 6 6 gels, azide-modified C2C12 cells (1.0 × 10 ) were well suspended with 50 µL of modified C2C12 cells (0.5 × 10 , 1.0 × 10 or 2.0 × 10 ) was suspended with 100 µL bAlg solution (2%, w/v) in HEPES buffer in the presence of CaCl solution (0.5%). of bAlg-DBCO solution (1% and 2%, w/v) in HEPES buffer (200 mM, pH 7.4) and 2 One mL of DMEM was added on the gels and cultured for 7 days at 37 °C in a cells were completely dispersed by gentle pipetting. Rheological test of the cell humidified atmosphere containing 5.0% CO . The changes in the weight of swollen dispersions were performed on MCR 302 rheometer (Anton Paar) using a standard 2 and the dry gels were examined with the same procedures. Moreover, bAlg physical steel parallel-plate geometry of 25 mm in diameter. Oscillatory time and frequency gels (2%, w/v) without cells were prepared in the presence of CaCl solution and were performed at 37 °C, and the storage modulus (G′) and loss modulus (G″) were 2 the changes in the weight of swollen and the dry gels were examined with the same recorded. The cell dispersions were cast between the lower plate and upper plate. procedures. To prevent evaporation of water and better temperature control during testing, the plates were enclosed in a chamber. Time zero was taken as the moment at which the cell dispersions were cast on the plate. The time sweep data collection was Cell adhesion in cell cross-linked hydrogels. Pellet of azide-modified C2C12 cells started from time zero to 3600 s to monitor the gelation process. The strain was 6 (2.0 × 10 ) was suspended with 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES maintained at 5% and operated at 10 rad/s. Frequency sweep was performed using buffer and cells were completely dispersed by gentle pipetting. The cell dispersion the same hydrogels 2 h after the addition of bAlg-DBCO solution to pellet of azide- solution was put onto collagen-type I-coated glass bottom dish (Cosmo Bio) or 2- modified C2C12 cells to determine the stability of the hydrogels. The strain was methacryloyloxyethyl phosphorylcholine (MPC) polymer-coated dish (Thermo maintained at 5%, and the frequency was swept from 100 to 0.1 rad/s. As controls, Fisher Scientific) and incubated at 37 °C for 1 h. Two mL of DMEM was carefully azide-modified C2C12 cells (2.0 × 10 ) was also suspended with 100 µL of bAlg added on the gels and cultured at 37 °C in a humidified atmosphere containing solution (2%, w/v) in HEPES buffer (200 mM, pH 7.4), and rheological char- 5.0% CO . After 24 h, cells in the hydrogels that exist on the interface between gels acterization was performed. Time-dependent changes in the G′ and G″ values of and the top surface of dish were observed by CLSM. To prepare C2C12 cells- the cell cross-linked hydrogels cultured in DMEM with or without Ac ManNAz 6 encapsulating control physical gels, azide-modified C2C12 cells (2.0 × 10 ) were (100 μM) were examined for 7 days. Frequency sweep was performed with the fixed well suspended with 100 µL of bAlg solution (2%, w/v) in HEPES buffer in the strain at 5%, and the frequency was swept from 100 to 0.1 rad/s. presence of CaCl solution (0.5%). Cell adhesion in the control physical gels on both the collagen- or MPC polymer-coated dishes was also observed by CLSM. Preparation of cell cross-linked hydrogels using freezing-thawing azide- modified cells. C2C12 cells were seeded on 10 cm dish, and then DMEM con- Gel adhesion. Pellet of azide-modified C2C12 cells (2.0 × 10 ) was suspended with taining 100 µM of Ac ManNAz was added to the dish and incubated at 37 °C for 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES buffer and cells were com- 3 days. Cells were collected by usual trypsin treatment and centrifuged (1000 rpm, pletely dispersed by gentle pipetting. The cell dispersions were put onto collagen- 3 min), then supernatant was removed. The pellet of azide-modified cells was type I-coated glass bottom dish and incubated at 37 °C for 1 h. Two mL of DMEM suspended with CELLBANKER (Wako Pure Chemical) and added to cryotube. The was added on the gels and cultured at 37 °C in a humidified atmosphere containing tube was gradually cooled in BICELL (NIHON FREEZER), then stored −80 °C. 5.0% CO . After 24 h, adhesion of the gels onto the surface of dish was examined by After that, azide-modified cells were thawed and the cells (2.0 × 10 ) was suspended dish inverting method. After that, 1 mL of trypsin solution was added to dish and NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 9 | | | ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 incubated at 37 °C for 10 min, then adhesion of the gel onto surface of dish was References examined. The harvested gel was gently washed with DMEM twice and put onto 1. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse new collagen-coated dish, then cultured at 37 °C in a humidified atmosphere embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676 containing 5.0% CO . After 24 h, adhesion of the gel onto surface of dish was 2 (2006). examined. To prepare C2C12 cells-encapsulating control physical gels, azide- 2. Mizushima, N. & Komatsu, M. Autophagy: renovation of cells and tissues. Cell modified C2C12 cells (2.0 × 10 ) were well suspended with 100 µL of bAlg solution 147, 728–741 (2011). (2%, w/v) in HEPES buffer in the presence of CaCl solution (0.5%). Moreover, 3. Chaffer, C. L. & Weinberg, R. A. A perspective on cancer cell metastasis. bAlg physical gels (2%, w/v) without cells were also prepared in the presence of Science 331, 1559–1564 (2011). CaCl solution as control gels. After 24 h, adhesion of the control gels onto the 4. Akira, S., Uematsu, S. & Takeuchi, O. Pathogen recognition and innate surface of dish was examined by dish inverting method. immunity. Cell 124, 783–801 (2006). 5. Engler, A. J., Sen, S., Sweeney, H. L. & Discher, D. E. Matrix control of stem cell fate. Cell 126, 645–647 (2006). In vivo preparation of cell cross-linked hydrogels. All animal experiments and 6. Langer, R. & Vacanti, J. P. Tissue engineering. Science 260, 920–926 (1993). all experimental protocols were approved by Konan University, and conformed to the Guidelines for the Care and Use of Laboratory Animals published by the 7. Neri, D. & Supuran, C. T. Interfering with pH regulation in tumours as a therapeutic strategy. Nat. Rev. Drug. Discov. 10, 767–777 (2011). National Institutes of Health. Female nude mice (ICR-nu/nu) at 4 weeks of age were purchased from Charles River. To generate retroviruses encoding Lifeact-GFP 8. Tabar, V. & Studer, L. Pluripotent stem cells in regenerative medicine: for the visualization of F-actin structures, the nucleotide sequence 5′- challenges and recent progress. Nat. Rev. Genet. 15,82–92 (2014). ATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCA 9. Ding, K., Alemdaroglu, F. E., Börsch, M., Berger, R. & Herrmann, A. AAGGAAGAA-3′, which encodes the Lifeact peptide, was subcloned into the Engineering the structural properties of DNA block copolymer micelles by pBabe blast vector containing a C-terminal GFP tag. pBabe Lifeact-GFP blast was molecular recognition. Angew. Chem. Int. Ed. 46, 1172–1175 (2007). cotransfected with psi-2 helper plasmid into human kidney 293 T cells (ATCC) 10. Chinen, A. B., Guan, C. M. & Mirkin, C. A. Spherical nucleic acid nanoparticle using the HilyMax transfection reagent (Dojindo, Kumamoto, Japan). Forty-eight conjugates enhance G-quadruplex formation and increase serum protein hours after transfection, the supernatant was collected and then used to infect interactions. Angew. Chem. Int. Ed. 54, 527–531 (2015). −1 C2C12 cells in the presence of 8 μgmL polybrene (Sigma). Infected C2C12 cells 11. Miyata, T., Asami, N. & Tadashi, U. A reversibly antigen-responsive hydrogel. −1 were selected using 3 μgmL blasticidin (Invitrogen, Carlsbad, CA) for 3 days. Nature 399, 766–769 (1999). Nude mice (ICR-nu/nu, 6 weeks old, female) were anesthetized with isoflurane. 12. Dirks, A. J., Nolte, R. J. M. & Cornelissen, J. J. L. M. Protein-polymer hybrid Azide-modified C2C12 cells constitutively expressing Lifeact-GFP (4.0 × 10 cells) amphiphiles. Adv. Mater. 20, 3953–3957 (2008). were suspended with 200 μL of bAlg-DBCO solution and immediately injected 13. Cobo, I., Li, M., Sumerlin, B. S. & Perrier, S. Smart hybrid materials by subcutaneously into the muscle layer of the back of each mouse. After a pre- conjugation of responsive polymers to biomacromolecules. Nat. Mat. 14, determined time, the mice were killed, the hydrogels were excised, and the 143–159 (2015). hydrogels were analyzed. 14. Lee, H. et al. Hyaluronate-gold nanoparticle/tocilizumab complex for the treatment of rheumatoid arthritis. ACS Nano 8, 4790–4798 (2014). Transplantation of cell cross-linked hydrogels in a mouse model of skeletal 15. Jewett, J. C. & Bertozzi, C. R. Cu-free click cycloaddition reactions in chemical muscle injury. Nude mice (BALB/c-nu/nu, 5 weeks old, female) were anesthetized biology. Chem. Soc. Rev. 39, 1272–1279 (2010). with isoflurane. The skin of the hind limb was opened, and the femoral muscle was 16. Agarwal, P., Beahm, B. J., Shieh, P. & Bertozzi, C. R. Systemic fluorescence gently exposed. In host femoral muscle, a local injury imaging of zebrafish glycans with bioorthogonal chemistry. Angew. Chem. Int. (ca. 7 mm long, 4 mm wide, and 5 mm deep) was created by removing skeletal Ed. 54, 11504–11510 (2015). muscle fibers. The skin was then carefully closed and the incision was sutured (4/ 17. Letschert, S. et al. Super-resolution imaging of plasma membrane glycans. 0 silk). One day after the surgery, 250 μL of CxGels precursor solution, Lifeact- Angew. Chem. Int. Ed. 53, 10921–10924 (2014). GFP-expressing N -C2C12 cells (5.0 × 10 ) suspended with bAlg-DBCO solution, 3 18. Chen, X. & Varki, A. Advances in the biology and chemistry of sialic acids. was injected into the injury site using a syringe with a 26-gauge needle. As control ACS Chem. Biol. 5, 163–176 (2010). gels, physically cross-linked bAlg gels encapsulating Lifeact-GFP-expressing N (+) 19. Adak, A. K., Yu, C.-C., Liang, C.-F. & Lin, C.-C. Synthesis of sialic acid- C2C12 cells (5.0 × 10 ) were prepared in the presence of CaCl solution (0.5%), containing saccharides. Curr. Opin. Chem. Biol. 17, 1030–1038 (2013). then the gels were transplanted into the injury site. After transplantation, the 20. Chang, P. V. et al. Copper-free click chemistry in living animals. Proc. Natl muscle strength of the injured hind limbs was quantitatively measured every day Acad. Sci. USA 107, 1821–1826 (2010). using a grip-strength meter (MELQUEST, GMP-100B). Values are average of three 21. Luchansky, S. J. & Bertozzi, C. R. Azido sialic acids can modulate cell-surface separate experiments in triplicate and are expressed as mean ± SD. At the end of interactions. Chembiochem 5, 1706–1709 (2004). the experiment (after 15 days), the injury site was carefully opened and the 22. Lee, K. Y. & Mooney, D. J. Alginate: properties and biomedical applications. regenerated skeletal muscle tissues were analyzed by CLSM observation. Prog. Polym. Sci. 37, 106–126 (2012). 23. Ishihara, K. et al. Hemocompatibility of human whole blood on polymers with Preparation of tissue cross-linked hydrogels. Female mice (ICR) at 5 weeks of a phospholipid polar group and its mechanism. J. Biomed. Mater. Res. 26, age were purchased from Charles River. In total 6 mg of AC ManNAz was dis- 4 1543–1552 (1992). solved in PBS/DMSO mixture (42/58, v/v). Mice were anesthetized using iso- 24. Saeui, C. T., Urias, E., Li, L., Mathew, M. P. & Yarema, K. J. Metabolic flurane, then 200 μLofAC ManNAz solution was administrated by intraperitoneal 4 glycoengineering bacteria for therapeutic, recombinant protein, and injection. This administration was carried out for continuous 7 days. The mice metabolite production applications. Glycoconj. J. 32, 425–441 (2015). were killed and heart, lung, kidney, and femoral muscle were excised carefully. 25. Gong, J. P. Friction and lubrication of hydrogels-its richness and complexity. These tissues were shredded and suspended with 500 µL of FITC-labeled bAlg- Soft Matter 2, 544–552 (2006). DBCO (0.1%) in DMEM, incubated at 37 °C for 30 min for biorthogonal click 26. Carré, A., Mittal, K. L. Surface and Interfacial Aspects of Cell Adhesion (CRC reaction. After that, tissues were centrifuged and washed with PBS twice, then Press, 2010). tissues were re-suspended with 1 mL of Live Cell Imaging Solution and observed by 27. Zhang, B. et al. Biodegradable scaffold with built-in vasculature for organ-on- CLSM. For preparation of tissue cross-linked hydrogels, these tissues were shred- a-chip engineering and direct surgical anastomosis. Nat. Mater. 15, 669–678 ded and washed with PBS twice. Pellet of azide-modified tissue was suspended with (2016). 100 µL of bAlg-DBCO solution (2%, w/v) in HEPES buffer and completely dis- 28. Wagner, I. et al. A dynamic multi-organ-chip for long-term cultivation and persed by gentle pipetting. The tissue dispersion solution was added into test tube substance testing proven by 3D human liver and skin tissue co-culture. Lab. and incubated at 37 °C for 1 h. Gel formation was checked by usual test tube Chip. 13, 3538–3547 (2013). inverting methods. 29. Carosio, S. et al. Generation of ex vivo-vascularized Muscle Engineered Tissue (X-MET). Sci. Rep. 3, 1420 (2013). Data availability. The authors declare that the data supporting the findings of this 30. Zhao, X. et al. Labeling of enveloped virus via metabolic incorporation of study are available within the paper and its supplementary information files. azido sugars. Bioconjugate Chem. 26, 1868–1872 (2015). 31. Memmel, E., Homann, A., Oelschlaeger, T. A. & Seibel, J. Metabolic glycoengineering of Staphylococcus aureus reduces its adherence to human Received: 22 January 2016 Accepted: 1 May 2018 T24 bladder carcinoma cells. Chem. Commun. 49, 7301–7303 (2013). Acknowledgements This work was supported by JSPS KAKENHI Grant Number 15K13791. We thank Prof. Keiko Kawauchi, Konan University, for providing technical support to engineer Lifeact- GFP-expressing cells. 10 NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications | | | NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04699-3 ARTICLE Author contributions Open Access This article is licensed under a Creative Commons K.N. designed this study, performed experiments, and wrote the paper. A.T. and Y.K. Attribution 4.0 International License, which permits use, sharing, performed experiments and analyzed the data. adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party Additional information material in this article are included in the article’s Creative Commons license, unless Supplementary Information accompanies this paper at https://doi.org/10.1038/s41467- indicated otherwise in a credit line to the material. If material is not included in the 018-04699-3. article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from Competing interests: The authors declare no competing interests. the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/. Reprints and permission information is available online at http://npg.nature.com/ reprintsandpermissions/ © The Author(s) 2018 Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. NATURE COMMUNICATIONS (2018) 9:2195 DOI: 10.1038/s41467-018-04699-3 www.nature.com/naturecommunications 11 | | |

Journal

Nature CommunicationsSpringer Journals

Published: Jun 6, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off