Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Infestation of shore crab gills by a free-living mussel species

Infestation of shore crab gills by a free-living mussel species Mar Biodiv (2018) 48:1241–1246 DOI 10.1007/s12526-016-0631-x SHORT COMMUNICATION 1 2 1 3 Rowan Poulter & P. Graham Oliver & Chris Hauton & Trystan Sanders & 1,4 Benjamin J. Ciotti Received: 24 March 2016 /Revised: 13 December 2016 /Accepted: 28 December 2016 /Published online: 24 January 2017 The Author(s) 2017. This article is published with open access at Springerlink.com Abstract Parasitic and commensal species can impact the intriguing case of a normally free-living prey species infesting structure and function of ecological communities and are typ- its predator. ically highly specialized to overcome host defences. Here, we . . . report multiple instances of a normally free-living species, the Keywords Commensal Infestation Mussel-bound . . blue mussel Mytilus edulis Linnaeus, 1758, inhabiting the Parasite Predator–prey interaction Shore crab branchial chamber of the shore crab Carcinus maenas (Linnaeus, 1758) collected from widely separated geographi- cal locations. A total of 127 C. maenas were examined from Introduction four locations in the English Channel, one location in the Irish Sea and two locations at the entrance of the Baltic Sea. The While parasitism and commensalism typically require a high branchial chambers of three crabs (one from the English level of specialisation, free-living non-specialists are occa- Channel and two from Gullmar Fjord, Sweden) were infested sionally found to colonise other species (Rohde 1984). For with mussels resembling the genus Mytilus. Sequencing at the the coloniser this can offer both benefits, by increasing dis- Me15/16 locus on the polyphenolic adhesive protein gene persal, providing access to food, removing waste products and confirmed the identity as M. edulis. Bivalve infestation always offering protection (Key et al. 1996;Wahl 1989;Walker occurred in larger red male individuals. Up to 16 mussels, 1974), and disadvantages, by exposing them to stressful envi- ranging from 2 to 11 mm in shell length, were found in each ronmental conditions (Bruce 1989) and antifouling mecha- individual, either wedged between gill lamellae or attached to nisms of the host. Successful colonisation can also have neg- the branchial chamber inner wall. This is one of the first re- ative implications for the host, such as reduced reproductive ports of a bivalve inhabiting crustacean gills and is an success and survival rates (Minchella 1985). Through impacts on host or coloniser populations, these instances of colonisa- tion have the potential to influence the structure and function of ecological communities (Hatcher et al. 2006; Mouritsen Communicated by V. Urgorri and Poulin 2005;Poulin 1999; Poulin and Mouritsen 2006). Certain taxa have managed to overcome anti-fouling * Benjamin J. Ciotti grooming structures and behaviours in order to colonise the benjamin.j.ciotti@gmail.com exoskeleton and branchial chambers of crustaceans (Bauer 1989). Commensal barnacles Octolasmis spp. infest branchial Ocean and Earth Science, National Oceanography Centre Southampton, University of Southampton, European Way, chambers and gills of numerous crustacean species (Gannon Southampton SO14 3ZH, UK and Wheatly 1992; Santos and Bueno 2002; Walker 1974). National Museum of Wales, Cardiff CF10 3NP, Wales Bopyrid parasites (e.g. Pseudione spp.) inhabit branchial chambers of decapod crustaceans (Boyko et al. 2012; Marine Ecology, GEOMAR Helmholz Centre for Ocean Research, Kiel, Germany McDermott 1991; Mori et al. 1999). Crustacean branchial chambers also host a variety of protozoa, helminths and crus- School of Biological and Marine Sciences, Plymouth University, Plymouth PL4 8AA, UK taceans, most of which are small and highly specialised for 1242 Mar Biodiv (2018) 48:1241–1246 survival and reproduction within the host (Shields 1992). carapace was then carefully removed and gills were examined However, aside from one observation of blue mussel Mytilus with the naked eye. The number and location of bivalves edulis Linnaeus, 1758, post-larvae on Paralithodes inhabiting the gill chamber were recorded. Samples of bi- camtschaticus (Tilesius, 1815) gills (Jansen et al. 1998), we valves encountered were fixed in Bouin’s solution and stored are not aware of any examples of bivalves inhabiting the in- in alcohol (Gullmar Fjord) or frozen at −80 °C (Newton’s ternal structures or branchial chambers of crustaceans. Cove) for genotyping. Bivalves, principally those belonging to the superfamily Asmallpiece(ca.0.1mm ) of gill tissue from each attached Galeommatoidea, certainly have the potential to associate mussel was extracted for genotyping using the Me15/16 locus with a range of invertebrates, including echinoids, holothu- on the polyphenolic adhesive protein gene, which is diagnostic rians, polychaetes, sipunculans, echiurids, brachiopods and for species of the genus Mytilus (Inoue et al. 1995). DNA was crustaceans (Li et al. 2012). In some cases, bivalves inhabit extracted using the DNeasy Blood & Tissue Kit (Qiagen, internal structures of other organisms, such as the respiratory Manchester, UK) according to the manufacturer’s protocol. chamber of polychaetes (Rosewater 1984) or the oesophagus Formalin-fixed/alcohol-preserved tissue was washed twice in of holothurians (Bristow et al. 2010), or are embedded in the phosphate-buffered saline prior to DNA extraction. The target tissues of sessile organisms such as ascidians (Bodger and sequence was amplified by polymerase chain reaction (PCR) Allen 2008). Associations with crustaceans are mostly restrict- using sense primer Me15 5′- CCAGTATACAAACC ed to the burrows or undersides of burrowing forms such as TGTGAAGA -3 ′ and antisense primer Me16 5 ′- Upogebia sp., Squilla sp. and Lysiosquilla sp. (Li et al. 2012). TGTTGTCTTAATAGGTTTGTAAGA-3′ (Inoue et al. Isaeva et al. (2001) found that the free-living bivalves Mytilus 1995). PCR was performed with the GoTaq G2 Flexi DNA trossulus Gould, 1850, and Hiatella arctica (Linnaeus, 1767) Polymerase kit (Promega, Southampton, UK). Reactions were could be facultative epibionts on Hemigrapsus sanguineus set upina 50-μl volume containing 1X GoTaq Flexi Buffer, (De Haan, 1835) when normal cleaning behaviour was 2.5 mM MgCl , 0.2 mM deoxyribonucleotide phosphates mix, interrupted by rhizocephalan parasites. Overall, however, as- 0.5 μM of sense and antisense primers and 1.25 U of GoTaq sociation with decapod crabs is rare and, again, limited to G2 Flexi DNA polymerase. The reaction mix was pre-heated external attachment (Boss 1965;Goto et al. 2007;Katoand at 95 °C for 2 min, then subjected to 35 temperature cycles Itani 1995; Kosuge and Itani 1994; Lützen and Takahashi followed by a final extension step of 5 min at 72 °C. Each cycle 2003;Morton 1972). While bivalves are able to form com- consisted of30s at 95 °C, 30s at 56 °C and 30s at 72 °C. mensal relationships with a wide range of hosts, this associa- Twenty microlitres of each PCR product was subjected to elec- tion is largely restricted to the Galeommatoidea, and there are trophoresis (72 V for 40 min) against a 100-bp DNA ladder few records of such interactions between Mytiloidea and other (New England BioLabs, Hitchin, UK) on 2% agarose/TAE gel −1 free-living invertebrates. containing 0.5 μgml ethidium bromide. Gels were We provide one of the first documented examples of a visualised under UV radiation to reveal clear amplicons of bivalve inhabiting the branchial chamber of a brachyuran ca. 180 bp. Amplicons were excised with a scalpel, extracted crustacean. We report multiple instances of the normally with a QIAquick Gel Extraction Kit (Qiagen) and eluted with free-living M. edulis in the branchial chamber of the shore 30 μl sterile water. Two microlitres of the extract was cloned crab Carcinus maenas (Linnaeus, 1758) collected from wide- using the pGEM -T Easy Vector System (Promega) following ly separated geographical locations. the manufacturer’s protocol. Four successful transformants for each sample were grown overnight at 37 °C in Luria broth −1 containing 100 μgml ampicillin. Cultures were centrifuged Materials and methods at 1000 xG for 10 min, and DNAwas extracted from the pellet using a QIAprep Spin Miniprep Kit (Qiagen). Purified plas- C. maenas were collected from seven sites between mids were subject to conventional Sanger sequencing using November 2014 and March 2015 (Table 1). Between 15 and standard M13 primers (Source BioScience, Oxford, UK). 22 crabs were sampled from each location using baited lines or traps. Individuals from Menai Straits, Mudeford Quay, Swanwick Jetty, Weymouth Harbour and Newton’sCove Results were stored in full-salinity aquarium tanks for a maximum of 2 weeks prior to examination. Individuals from Kiel Fjord Bivalves were found in the branchial chambers of C. maenas and Gullmar Fjord were stored in ambient water from collec- from widely separated populations (Table 1). At Gullmar tion locations for a maximum of 5 weeks prior to examination. Fjord, Sweden, bivalves were found in two (out of 20 sam- The mass, carapace width (CW), sex and any external signs pled) C. maenas individuals. One of the infested C. maenas of damage or disease were recorded for each crab. The colour contained six bivalves, while the second contained 16 bi- of the legs, claws and carapace underside was also noted. The valves and had died during holding. Bivalves were located Mar Biodiv (2018) 48:1241–1246 1243 Table 1 Summary of Carcinus maenas populations sampled and bivalve infestations observed Site Location Date Collection Collection No. Mean % % No. No. a b depth (m) method crabs CW ±1 Male Red crabs bivalves examined SD (mm) infested Swanwick Jetty, UK 50° 53' 16" N Nov-14 0–1.0 Line 20 37.4 ± 7.8 55 5 0 0 1° 17' 46" W Mudeford Quay, UK 50° 43' 30" N Nov-14 0–1.5 Line 20 41.5 ± 9.3 40 40 0 0 1° 44' 23" W Weymouth Harbour, UK 50° 36' 28" N Nov-14 0–0.5 Line 15 37.8 ± 5.4 27 20 0 0 2° 26' 59" W Newton’s Cove, UK 50° 36' 15" N Nov-14 0–1.0 Line 15 49.0 ± 6.0 100 80 1 1 2° 27' 01" W Gullmar Fjord, Sweden 58° 15' 28" N Nov-14 0–15 Trap 20 69.0 ± 3.9 100 68 2 22 11° 27' 28" E Menai Straits, UK 53° 13' 39" N Dec-14 <4.0 Trap 15 57.6 ± 4.8 100 40 0 0 4° 09' 18" W Kiel Fjord, Germany 54° 25' 22" N Mar-15 0–2.0 Trap 22 57.7 ± 5.4 N/A N/A 0 0 10° 12' 09" E CW = Carapace width Crab colouration classified as red or green in both right and left branchial chambers around the fifth gill, caught at the sites where infested crabs occurred (Table 1). either wedged between gill lamellae or attached to the sur- Gills on which bivalves were attached appeared to be wasted rounding branchial chamber wall (Fig. 1). The size of and were entangled by byssal threads. infesting bivalves varied considerably within any one Sequencing at the Me15/Me16 locus confirmed that C. maenas, ranging from 2.0 to 11.0 mm in shell length. At infesting bivalves at both Gullmar Fjord and Newton’s Cove Newton’s Cove, a single bivalve was found in one of the 20 were M. edulis, rather than other locally occurring, morpho- C. maenas individuals sampled. This bivalve had a shell logically similar congeners Mytilus galloprovincialis length of 6.7 mm and was wedged between lamellae on the Lamarck, 1819 or M. trossulus. One mussel specimen from posterior ninth gill. No bivalves were observed in the other each of the two sites was genotyped. A 180-bp fragment was five C. maenas populations examined (Table 1). amplified in all cases, consistent with M. edulis, but not Many of the crabs inspected were missing limbs or bore M. galloprovincialis (126 bp) or M. trossulus (168 bp) signs of black spot disease, but mussel infestations did not (Inoue et al. 1995). Consensus sequences for these four appear to be particularly associated with disease or with other clones, generated through Clustal Omega alignment parasites, such as rhizocephalans. Infested crabs from both (www.ebi.ac.uk/Tools/msa/clustalo), were identical for the Newton’s Cove (CW = 60 mm) and Gullmar Fjord two mussel specimens, indicating genetic similarity between (CW = 74 mm and 80 mm) were the largest crabs captured the mussels infesting Newton’s Cove and Gullmar Fjord at their respective sites. Infested crabs always had red crabs. A BLAST search (blast.ncbi.nlm.nih.gov/Blast.cgi) of colouration, although most crabs caught were this colour this consensus sequence found a >99% identity (179 of 180 (Table 1). All infested crabs were male, as were all other crabs bases) to bases 1169 to 1348 of the M. edulis gene for Fig. 1 Photograph of Mytilus edulis infestations on Carcinus maenas gills from Gullmar Fjord: a view of M. edulis (arrows)in C. maenas branchial chamber after removing the carapace, and b detail of M. edulis embedded between gill lamellae 1244 Mar Biodiv (2018) 48:1241–1246 polyphenolic adhesive protein (GenBank accession number larval M. edulis have been found in the red king crab X54422.1). Alignment of the sequence against diagnostic se- P. camtschaticus, but details of the size of the mussels and quences for the three Mytilus congeners (Santaclara et al. the permanence of attachment to the gills were not documented 2006) indicated clear sequence homology with M. edulis over (Jansen et al. 1998). Therefore, our observation establishes that M. galloprovincialis or M. trossulus (Fig. 2). gills of marine animals can be subject to substantial infestation by large mussels and is, to our knowledge, only the second documented example of a bivalve inhabiting crustacean gills. Discussion Assuming that growth rates in branchial chambers are sim- ilar to those in the wild, the sizes of the mussels suggest they We report multiple instances of M. edulis inhabiting the bran- were from the previous spring spawning period occuring around March to May (Chipperfield 1953). M. edulis exhibits chial chamber of C. maenas. M. edulis were found in three fully mature male C. maenas individuals, one from the a two-stage settlement, with pediveliger larvae settling prefer- entially on filamentous substrata in high-flow areas, separate English Channel and two from Gullmar Fjord. Colonising mussels varied in size, but included some adults. Mussels from any adults, before releasing and drifting to a suitable adult habitat (Bayne 1964; Eyster and Pechenik 1987). The were found both on the inner carapace and attached directly to the gill, despite the suggestion by MacKenzie et al. (1974) veliger larvae most likely entered the branchial chamber acci- that gill surfaces are an unsuitable site for mussel attachment. dentally in the inhalant respiratory current of C. maenas and Our results, and similar observations of the pedunculate bar- temporarily adhered to the gills (Walker 1974). Only the lar- nacle Octolasmis mülleri (Coker, 1902) on gills of the blue vae that immediately attached to the gills would remain in the crab Callinectes sapidus Rathbun, 1896 (Walker 1974), sug- branchial chamber, as reversal of the respiratory current, gest that crustacean gills are a viable attachment site for inter- aimed to clean debris from the gills, would remove any unat- tached individuals (Walker 1974). Once the pediveligers meta- nal commensal species. To our knowledge, this is the first report of such an association between M. edulis and morphosed (0.26–0.35 mm) and grew to the post-larval dis- persal size (2.0–2.5 mm) (Bayne 1964), it is unlikely that they C. maenas. Our observation adds to growing evidence that M. edulis, would be able to leave the crustacean branchial chamber. although typically a free living organism, sometimes colo- Alternatively, C. maenas could encounter drifting pediveligers nizes other species. M. edulis larvae have been reported in in large numbers whilst feeding on mussel beds (Lane et al. the gill chambers of haddock Melanogrammus aeglefinus 1985). The accidental inhalation of these post-larval forms (Linnaeus, 1758) and cod Gadus morhua Linnaeus, 1758 could lead to entanglement of the byssus thread around the gills (MacKenzie et al. 1974); however, upon close inspection, and subsequent new thread production and settlement, similar the mussels were found to be attached to a parasitic copepod, to the proposed settlement of M. galloprovincialis on the fish Lernaeocera sp., and not the gill surface itself (MacKenzie parasite Mothocya epimerica Costa, 1851, within the branchial chamber of Atherina boyeri Risso, 1810 (Öktener et al. 2014). et al. 1974). Bruno (1987) later found post-veliger larvae, thought to be M. edulis, attached to and embedded in the gills Settled pediveliger larvae in juvenile crabs are likely to be dislodged during ecdysis, before reaching maturity (Shields of farmed Atlantic salmon Salmo salar Linnaeus, 1758. Post- 10 20 30 40 50 ....|....|....|....|....|....|....|....|....|....| Mytilus from C. maenas consensus CAAGTTATTCGGCACCATATAAACCACCAACATACCAACCACTCAAAAAG DQ640586.1| M. edulis CAAGTTATTCGGCACCATATAAACCACCAACATACCAACCACTCAAAAAG DQ640588.1| M. trossulus CAAGTTATTCGTCACCATATAAACCACCAACATACCAACCACTCAAAAAG DQ640590.1| M. galloprovincialis --------------------------CCAGTATACAAACCTGTGAAGACA 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....| Mytilus from C. maenas consensus AAAGTGGACTATCGTCCTACGAAAAGTTATCCGCCAACATATGGATCAAA DQ640586.1| M. edulis AAAGTGGACTATCGTCCTACGAAAAGTTATCCGCCAACATATGGATCAAA DQ640588.1| M. trossulus AAA-----CCAATGGACTAT-AATAGTTCTCCGCCAACATATGGATCAAA DQ640590.1| M. galloprovincialis AG------TTATCATCCTACGAATAGTTATCCGCCAACATATGGATCAAA 110 120 130 ....|....|....|....|....|....|.... Mytilus from C. maenas consensus GACAAACTATCTGCCACTTGCAAAGAAGCTGTCA DQ640586.1| M. edulis GACAAACTATCTGCCACTTGCAAAGAAGCTGTCA DQ640588.1| M. trossulus GACAAACTATCT------TGCAAAGAAGCTGTCA DQ640590.1| M. galloprovincialis GACAAACTATCTGCCACTTGCAAAGAAGCTGTCA Fig. 2 Clustal Omega sequence alignment (www.ebi.ac.uk/Tools/msa/ for four clones from two mussels found in the branchial chamber of clustalo) of a diagnostic region of the polyphenolic adhesive protein C. maenas at Newton’s Cove and Gullmar Fjord. Reference sequences gene from bivalves found in Carcinus maenas against reference were originally published by Santaclara et al. (2006), and are listed with sequences for Mytilus congeners: M. edulis, M. trossulus and GenBank accession numbers. M. galloprovincialis. The consensus sequence represents 100% identity Mar Biodiv (2018) 48:1241–1246 1245 1992), but the prolonged intermoult period of mature crabs previous colonisation. Initial colonisation could promote fur- would favour the development of infestations (Bauer 1989). ther settlement due to gregarious settlement behaviour New exoskeletons created during moults are always green in (Petersen 1984) or interference with gill cleaning function. appearance, while red crabs will have spent an extended peri- In this way, establishment of a single individual could result od in intermoult, increasing the chances of mussel colonisa- in further infestation and a rapid deterioration in fitness of the tion (Styrishave et al. 2004). These red crabs are often the host. larger males (CW > 60 mm) (Reid et al. 1994), which reduce Although M. edulis could be acting as a facultative moulting frequency in order to devote energy to reproduction commensal or parasite of C. maenas, it seems more likely (Styrishave et al. 2004). that this is a case of accidental colonisation, with negative Sampling timing may explain why observations of outcomes for the coloniser. Certainly, mussels would be M. edulis infestations in C. maenas are rare. C. maenas pop- well protected from predators inside C. maenas and can ulations are commonly sampled during the spring, summer likely survive to maturity, which is normally attained dur- and autumn months while crabs inhabit shallow sublittoral ing the first year of life (Seed 1969). Since M. edulis is a regions (Atkinson and Parsons 1973). Much of this period suspension feeder, food delivery could be enhanced by would be prior to M. edulis settlement or when larvae are very high flows associated with active irrigation of the gill small and easily overlooked. From late autumn, mature surfaces by the crab. However, the extensive multi-stage C. maenas populations migrate offshore (Atkinson and life-cycle of M. edulis (Bayne 1964), coupled with the Parsons 1973), so any mature adults infested with M. edulis risks of moulting and mortality of C. maenas during large would not be sampled. Our sampling time of November to infestations, makes it unlikely that reproduction, and December allowed for the collection of mature adults just therefore fitness, would be improved over a free-living prior to offshore migration after spring-spawned M. edulis mode of life. had sufficient time to grow. This is the first report of M. edulis colonising C. maenas While consequences of colonisation by M. edulis for branchial chambers and only the second time such an associ- C. maenas are unknown, it seems unlikely to provide ation has been documented between a bivalve and a crusta- advantages. Presumably, M. edulis does not feed directly cean. Our finding opens several future lines of enquiry. on the tissue of the host, but the size and number of Because infestations are relatively rare, occurring in only colonising mussels would create other problems. 2.4% of individuals inspected, more extensive sampling of a Attachment of M. edulis to the gill and surrounding greater number of crabs at each site would be necessary to chamber and waste produced by the mussels could re- accurately establish the abundance and prevalence of mussels duce the respiratory efficiency by obstructing the venti- in branchial chambers. Further work is also necessary to fully latory stream, impairing gill movements, reducing the understand the physiological effects of the relationship, to exposed gill surface area and removing oxygen in the determine the ability of both M. edulis and C. maenas to inhalant water (Walker 1974; Gannon and Wheatly survive in the long term, and therefore to assess ecological 1992). M. edulis could also obstruct or functionally im- consequences. Finally, the environmental conditions or bio- pair cleaning appendages, further reducing gill efficiency logical scenarios that promote mussel infestations require in- due to fouling (Santos and Bueno 2002) and increasing vestigation. The association between M. edulis and C. maenas the likelihood of further infestation. Although moulting could have important ecological implications and provides an might occur when M. edulis are small, and could be an intriguing example of a prey species infesting a predatory important defence against colonisation (Bauer 1989; host. Walker 1974), large infestations could present a consid- erable obstruction to moulting. The fact that the only deceased crab at Gullmar Fjord happened to be one of the two infested individuals suggests that consequences Acknowledgements The authors thank S. Dupont, B. Lundve, E. could be lethal for the host. Morgan and J. Projecto-Garcia for assistance with crab collection and Mussels colonising C. maenas at Gullmar Fjord were high- dissection, and two anonymous reviewers for comments on the manu- script. Work was supported by funding from the UK Natural Environment ly aggregated in just two individuals. Unless growth rates of Research Council (NERC) under grant NE/J007951/1. colonising mussels were highly variable, these aggregations did not originate from a mass colonisation event, since they consisted of a wide size range of individuals. Reproduction Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http:// within the host seems unlikely, because this would require creativecommons.org/licenses/by/4.0/), which permits unrestricted long adult residence times and successful retention of off- use, distribution, and reproduction in any medium, provided you give spring. Instead, we suggest that aggregated distributions result appropriate credit to the original author(s) and the source, provide a link from increased chances of subsequent settlement following to the Creative Commons license, and indicate if changes were made. 1246 Mar Biodiv (2018) 48:1241–1246 Li J, Foighil DÓ, Middelfart P (2012) The evolutionary ecology of biotic References association in a megadiverse bivalve superfamily: sponsorship re- quired for permanent residency in sediment. PLoS One 7:e42121 Atkinson RJA, Parsons AJ (1973) Seasonal patterns of migrations and Lützen J, Takahashi T (2003) Arthritica japonica, sp. nov. (Bivalvia: locomotor rhythmicity in populations of Carcinus. Neth J Sea Res 7: Galeommatoidea: Leptonidae), a commensal with the pinnotherid 81–93 crab Xenophthalmus pinnotheroides White, 1846. Yuriyagai 9:11– Bauer RT (1989) Decapod crustacean grooming: Functional morphology, adaptive value, and phylogenetic significance. In: Felgenhauer BE, MacKenzie K, Smith JW, Wootten R (1974) The case of mussel bound Watling L, Thistle AB (eds) Functional morphology of feeding and fish. Scott Fish Bull 41 grooming in crustacea. A. A. Balkema, Rotterdam, pp 49–74 McDermott JJ (1991) Incidence and host-parasite relationship of Leidya Bayne BL (1964) Primary and secondary settlement in Mytilus edulis L. bimini (Crustacea, Isopoda, Bopyridae) in the Brachyuran Crab (Mollusca). J Anim Ecol 33:513–523 Pachygrapsus transversus from Bermuda. Ophelia 33:71–95 Bodger PM, Allen JA (2008) The ecology and life cycle of a population Minchella DJ (1985) Host life-history variation in response to parasitism. of Modiolarca tumida (Hanley, 1843) (Bivalvia: Mytilidae) of the Parasitology 90:205–216 coast off north-eastern England. J Molluscan Stud 74:97–101 Mori M, Orecchia S, Biagi F (1999) The occurrence of the bopyrid par- Boss KJ (1965) A new mollusk (Bivalvia, Erycinidae) commensal on the asite Pseudione crenulata G.O. Sars (Isopoda, Epicaridea) in the stomatopod crustacean Lysiosquilla. Am Mus Novit 2215:1–11 branchial chamber of Munida tenuimana G.O. Sars (Crustacea: Boyko CB, Williams JD, Markham JC (2012) Recent and fossil Isopoda Anomura) from North Tyrrhenian Sea. Doriana 7:1–5 Bopyridae parasitic on squat lobsters and porcelain crabs Morton B (1972) Some aspects of the functional morphology and biology (Crustacea: Anomura: Chirostyloidea and Galatheoidea), with notes of Pseudopythina subsinuata (Bivalvia: Leptonacea) commensal on on nomenclature and biogeography. Zootaxa 1–35 stomatopod crustaceans. J Zool 166:79–96 Bristow GA, Berland B, Schander C, Vo DT (2010) A new endosymbi- Mouritsen KN, Poulin R (2005) Parasites boosts biodiversity and changes otic bivalve (Heterodonta: Galeommatoidea), from pacific holothu- animal community structure by trait-mediated indirect effects. Oikos rians. J Parasitol 96:532–534 108:344–350 Bruce L (1989) Invertebrates associated with the thinstripe hermit Öktener A, Oliver PG, Çakir DT (2014) Mytilus (Mollusca, Bivalvia) Clibanarius vittatus (Bosc) (Crustacea: Decapoda: Diogenidae) epibiontic on the fish parasite Mothocya epimerica (Crustacea, from the Barrier Islands of Mississippi. Gulf Res Rep 8:213–217 Isopoda) in the Sea of Marmara, Turkey. J Conchol 41:759–763 Bruno DW (1987) The risk to farmed Atlantic salmon, Salmo sala L., from marine mussels growing on net cages. Bull Eur Assoc Fish Petersen JH (1984) Larval settlement behavior in competing species: Pathol 7:121–123 Mytilus californianus Conrad and M. edulis L. J Exp Mar Biol Chipperfield PNJ (1953) Observations on the breeding and settlement of Ecol 82:147–159 Mytilus edulis (L.) in British waters. J Mar Biol Assoc UK 32:449– Poulin R (1999) The functional importance of parasites in animal com- munities: many roles at many levels? Int J Parasitol 29:903–914 Eyster LS, Pechenik JA (1987) Attachment of Mytilus edulis L. larvae on Poulin R, Mouritsen KN (2006) Climate change, parasitism and the struc- algal and byssal filaments is enhanced by water agitation. J Exp Mar ture of intertidal ecosystems. J Helminthol 80:183–191 Biol Ecol 114:99–110 Reid DG, Abelló P, Warman CG, Naylor E (1994) Size-related mating Gannon AT, Wheatly MG (1992) Physiological effects of an success in the shore crab Carcinus maenas (Crustacea: Brachyura). J ectocommensal gill barnacle, Octolasmis muelleri, on gas exchange Zool 232:397–407 in the blue crab Callinectes sapidus.J Crustac Biol 12:11–18 Rohde K (1984) Zoogeography of marine parasites. Helgol Meeresunters Goto R, Hamamura Y, Kato M (2007) Obligate commensalism of 37:35–52 Curvemysella paula (Bivalvia : Galeommatidae) with hermit crabs. Rosewater J (1984) A new species of leptonacean bivalve from off north- Mar Biol 151:1615–1622 western Peru (Heterodonta, Veneroida, Lasaeidae). Veliger 27:81– Hatcher MJ, Dick JTA, Dunn AM (2006) How parasites affect interac- tions between competitors and predators. Ecol Lett 9:1253–1271 Santaclara FJ, Espiñeira M, Cabado AG, Aldasoro A, Gonzalez-Lavín N, Inoue K, Waite JH, Matsuoka M, Odo S, Harayama S (1995) Interspecific Vieites JM (2006) Development of a method for the genetic identi- variations in adhesive protein sequences of Mytilus edulis, fication of mussel species belonging to Mytilus, Perna, Aulacomya, M. galloprovincialis,and M. trossulus.BiolBull 189:370–375 and other genera. J Agric Food Chem 54:8461–8470 Isaeva V, Kulikova C, Kasyanov V (2001) Bivalve molluscs, Mytilus Santos C, Bueno SLS (2002) Infestation by Octolasmis lowei (Cirripedia trossulus and Hiatella arctica, as facultative epibionts of the crab, : Poecilasmatidae) in Callinectes danae and Callinectes ornatus emigrapsus sanguineus, infestedbythe rhizocephalan, Sacculina (Decapoda : Portunidae) from São Sebastião, Brazil. J Crustac polygenea. J Mar Biol Assoc UK 81:891–892 Biol 22:241–248 Jansen PA, MacKenzie K, Hemmingsen W (1998) Some parasites and Seed R (1969) The ecology of Mytilus edulis L. (Lamellibranchiata) on commensals of red king crabs, Paralithodes camtschaticus exposed rocky shores. Oecologia 3:277–316 (Tilesius), in the Barents Sea. Bull Eur Assoc Fish Pathol 18:46–49 Shields JD (1992) Parasites and symbionts of the crab Portunus pelagicus Kato M, Itani G (1995) Commensalism of a bivalve, Peregrinamor from Moreton Bay, eastern Australia. J Crustac Biol 12:94–100 ohshimai, with a Thalassinidean burrowing shrimp, Upogebia Styrishave B, Rewitz K, Andersen O (2004) Frequency of moulting by major. J Mar Biol Assoc UK 75:941–947 shore crabs Carcinus maenas (L.) changes their colour and their Key MM, Jeffries WB, Voris HK, Yang CM (1996) Epizoic bryozoans, success in mating and physiological performance. J Exp Mar Biol horseshoe crabs, and other mobile benthic substrates. Bull Mar Sci Ecol 313:317–336 58:368–384 Kosuge T, Itani G (1994) A record of the crab associated bivalve, Wahl M (1989) Marine epibiosis. I. Fouling and antifouling: some basic Pseudopythina macrophthalmensis from Iriomote Island, aspects. Mar Ecol Prog Ser 58:175–189 Okinawa, Japan. Jpn J Malacol 53:241–244 Walker G (1974) The occurrence, distribution and attachment of the pe- Lane DJW, Beaumont AR, Hunter JR (1985) Byssus drifting and the dunculate barnacle Octolasmis mülleri (Coker) on the gills of crabs, drifting threads of the young post-larval mussel Mytilus edulis. particularly the blue crab, Callinectes sapidus Rathbun. Biol Bull Mar Biol 84:301–308 147:678–689 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Marine Biodiversity Springer Journals

Infestation of shore crab gills by a free-living mussel species

Download PDF
6 pages

Loading next page...
1
 
/lp/springer_journal/infestation-of-shore-crab-gills-by-a-free-living-mussel-species-DHSKaAN5sf

References (53)

Publisher
Springer Journals
Copyright
Copyright © 2017 by The Author(s)
Subject
Life Sciences; Biodiversity; Freshwater & Marine Ecology; Plant Systematics/Taxonomy/Biogeography; Animal Systematics/Taxonomy/Biogeography
ISSN
1867-1616
eISSN
1867-1624
DOI
10.1007/s12526-016-0631-x
Publisher site
See Article on Publisher Site

Abstract

Mar Biodiv (2018) 48:1241–1246 DOI 10.1007/s12526-016-0631-x SHORT COMMUNICATION 1 2 1 3 Rowan Poulter & P. Graham Oliver & Chris Hauton & Trystan Sanders & 1,4 Benjamin J. Ciotti Received: 24 March 2016 /Revised: 13 December 2016 /Accepted: 28 December 2016 /Published online: 24 January 2017 The Author(s) 2017. This article is published with open access at Springerlink.com Abstract Parasitic and commensal species can impact the intriguing case of a normally free-living prey species infesting structure and function of ecological communities and are typ- its predator. ically highly specialized to overcome host defences. Here, we . . . report multiple instances of a normally free-living species, the Keywords Commensal Infestation Mussel-bound . . blue mussel Mytilus edulis Linnaeus, 1758, inhabiting the Parasite Predator–prey interaction Shore crab branchial chamber of the shore crab Carcinus maenas (Linnaeus, 1758) collected from widely separated geographi- cal locations. A total of 127 C. maenas were examined from Introduction four locations in the English Channel, one location in the Irish Sea and two locations at the entrance of the Baltic Sea. The While parasitism and commensalism typically require a high branchial chambers of three crabs (one from the English level of specialisation, free-living non-specialists are occa- Channel and two from Gullmar Fjord, Sweden) were infested sionally found to colonise other species (Rohde 1984). For with mussels resembling the genus Mytilus. Sequencing at the the coloniser this can offer both benefits, by increasing dis- Me15/16 locus on the polyphenolic adhesive protein gene persal, providing access to food, removing waste products and confirmed the identity as M. edulis. Bivalve infestation always offering protection (Key et al. 1996;Wahl 1989;Walker occurred in larger red male individuals. Up to 16 mussels, 1974), and disadvantages, by exposing them to stressful envi- ranging from 2 to 11 mm in shell length, were found in each ronmental conditions (Bruce 1989) and antifouling mecha- individual, either wedged between gill lamellae or attached to nisms of the host. Successful colonisation can also have neg- the branchial chamber inner wall. This is one of the first re- ative implications for the host, such as reduced reproductive ports of a bivalve inhabiting crustacean gills and is an success and survival rates (Minchella 1985). Through impacts on host or coloniser populations, these instances of colonisa- tion have the potential to influence the structure and function of ecological communities (Hatcher et al. 2006; Mouritsen Communicated by V. Urgorri and Poulin 2005;Poulin 1999; Poulin and Mouritsen 2006). Certain taxa have managed to overcome anti-fouling * Benjamin J. Ciotti grooming structures and behaviours in order to colonise the benjamin.j.ciotti@gmail.com exoskeleton and branchial chambers of crustaceans (Bauer 1989). Commensal barnacles Octolasmis spp. infest branchial Ocean and Earth Science, National Oceanography Centre Southampton, University of Southampton, European Way, chambers and gills of numerous crustacean species (Gannon Southampton SO14 3ZH, UK and Wheatly 1992; Santos and Bueno 2002; Walker 1974). National Museum of Wales, Cardiff CF10 3NP, Wales Bopyrid parasites (e.g. Pseudione spp.) inhabit branchial chambers of decapod crustaceans (Boyko et al. 2012; Marine Ecology, GEOMAR Helmholz Centre for Ocean Research, Kiel, Germany McDermott 1991; Mori et al. 1999). Crustacean branchial chambers also host a variety of protozoa, helminths and crus- School of Biological and Marine Sciences, Plymouth University, Plymouth PL4 8AA, UK taceans, most of which are small and highly specialised for 1242 Mar Biodiv (2018) 48:1241–1246 survival and reproduction within the host (Shields 1992). carapace was then carefully removed and gills were examined However, aside from one observation of blue mussel Mytilus with the naked eye. The number and location of bivalves edulis Linnaeus, 1758, post-larvae on Paralithodes inhabiting the gill chamber were recorded. Samples of bi- camtschaticus (Tilesius, 1815) gills (Jansen et al. 1998), we valves encountered were fixed in Bouin’s solution and stored are not aware of any examples of bivalves inhabiting the in- in alcohol (Gullmar Fjord) or frozen at −80 °C (Newton’s ternal structures or branchial chambers of crustaceans. Cove) for genotyping. Bivalves, principally those belonging to the superfamily Asmallpiece(ca.0.1mm ) of gill tissue from each attached Galeommatoidea, certainly have the potential to associate mussel was extracted for genotyping using the Me15/16 locus with a range of invertebrates, including echinoids, holothu- on the polyphenolic adhesive protein gene, which is diagnostic rians, polychaetes, sipunculans, echiurids, brachiopods and for species of the genus Mytilus (Inoue et al. 1995). DNA was crustaceans (Li et al. 2012). In some cases, bivalves inhabit extracted using the DNeasy Blood & Tissue Kit (Qiagen, internal structures of other organisms, such as the respiratory Manchester, UK) according to the manufacturer’s protocol. chamber of polychaetes (Rosewater 1984) or the oesophagus Formalin-fixed/alcohol-preserved tissue was washed twice in of holothurians (Bristow et al. 2010), or are embedded in the phosphate-buffered saline prior to DNA extraction. The target tissues of sessile organisms such as ascidians (Bodger and sequence was amplified by polymerase chain reaction (PCR) Allen 2008). Associations with crustaceans are mostly restrict- using sense primer Me15 5′- CCAGTATACAAACC ed to the burrows or undersides of burrowing forms such as TGTGAAGA -3 ′ and antisense primer Me16 5 ′- Upogebia sp., Squilla sp. and Lysiosquilla sp. (Li et al. 2012). TGTTGTCTTAATAGGTTTGTAAGA-3′ (Inoue et al. Isaeva et al. (2001) found that the free-living bivalves Mytilus 1995). PCR was performed with the GoTaq G2 Flexi DNA trossulus Gould, 1850, and Hiatella arctica (Linnaeus, 1767) Polymerase kit (Promega, Southampton, UK). Reactions were could be facultative epibionts on Hemigrapsus sanguineus set upina 50-μl volume containing 1X GoTaq Flexi Buffer, (De Haan, 1835) when normal cleaning behaviour was 2.5 mM MgCl , 0.2 mM deoxyribonucleotide phosphates mix, interrupted by rhizocephalan parasites. Overall, however, as- 0.5 μM of sense and antisense primers and 1.25 U of GoTaq sociation with decapod crabs is rare and, again, limited to G2 Flexi DNA polymerase. The reaction mix was pre-heated external attachment (Boss 1965;Goto et al. 2007;Katoand at 95 °C for 2 min, then subjected to 35 temperature cycles Itani 1995; Kosuge and Itani 1994; Lützen and Takahashi followed by a final extension step of 5 min at 72 °C. Each cycle 2003;Morton 1972). While bivalves are able to form com- consisted of30s at 95 °C, 30s at 56 °C and 30s at 72 °C. mensal relationships with a wide range of hosts, this associa- Twenty microlitres of each PCR product was subjected to elec- tion is largely restricted to the Galeommatoidea, and there are trophoresis (72 V for 40 min) against a 100-bp DNA ladder few records of such interactions between Mytiloidea and other (New England BioLabs, Hitchin, UK) on 2% agarose/TAE gel −1 free-living invertebrates. containing 0.5 μgml ethidium bromide. Gels were We provide one of the first documented examples of a visualised under UV radiation to reveal clear amplicons of bivalve inhabiting the branchial chamber of a brachyuran ca. 180 bp. Amplicons were excised with a scalpel, extracted crustacean. We report multiple instances of the normally with a QIAquick Gel Extraction Kit (Qiagen) and eluted with free-living M. edulis in the branchial chamber of the shore 30 μl sterile water. Two microlitres of the extract was cloned crab Carcinus maenas (Linnaeus, 1758) collected from wide- using the pGEM -T Easy Vector System (Promega) following ly separated geographical locations. the manufacturer’s protocol. Four successful transformants for each sample were grown overnight at 37 °C in Luria broth −1 containing 100 μgml ampicillin. Cultures were centrifuged Materials and methods at 1000 xG for 10 min, and DNAwas extracted from the pellet using a QIAprep Spin Miniprep Kit (Qiagen). Purified plas- C. maenas were collected from seven sites between mids were subject to conventional Sanger sequencing using November 2014 and March 2015 (Table 1). Between 15 and standard M13 primers (Source BioScience, Oxford, UK). 22 crabs were sampled from each location using baited lines or traps. Individuals from Menai Straits, Mudeford Quay, Swanwick Jetty, Weymouth Harbour and Newton’sCove Results were stored in full-salinity aquarium tanks for a maximum of 2 weeks prior to examination. Individuals from Kiel Fjord Bivalves were found in the branchial chambers of C. maenas and Gullmar Fjord were stored in ambient water from collec- from widely separated populations (Table 1). At Gullmar tion locations for a maximum of 5 weeks prior to examination. Fjord, Sweden, bivalves were found in two (out of 20 sam- The mass, carapace width (CW), sex and any external signs pled) C. maenas individuals. One of the infested C. maenas of damage or disease were recorded for each crab. The colour contained six bivalves, while the second contained 16 bi- of the legs, claws and carapace underside was also noted. The valves and had died during holding. Bivalves were located Mar Biodiv (2018) 48:1241–1246 1243 Table 1 Summary of Carcinus maenas populations sampled and bivalve infestations observed Site Location Date Collection Collection No. Mean % % No. No. a b depth (m) method crabs CW ±1 Male Red crabs bivalves examined SD (mm) infested Swanwick Jetty, UK 50° 53' 16" N Nov-14 0–1.0 Line 20 37.4 ± 7.8 55 5 0 0 1° 17' 46" W Mudeford Quay, UK 50° 43' 30" N Nov-14 0–1.5 Line 20 41.5 ± 9.3 40 40 0 0 1° 44' 23" W Weymouth Harbour, UK 50° 36' 28" N Nov-14 0–0.5 Line 15 37.8 ± 5.4 27 20 0 0 2° 26' 59" W Newton’s Cove, UK 50° 36' 15" N Nov-14 0–1.0 Line 15 49.0 ± 6.0 100 80 1 1 2° 27' 01" W Gullmar Fjord, Sweden 58° 15' 28" N Nov-14 0–15 Trap 20 69.0 ± 3.9 100 68 2 22 11° 27' 28" E Menai Straits, UK 53° 13' 39" N Dec-14 <4.0 Trap 15 57.6 ± 4.8 100 40 0 0 4° 09' 18" W Kiel Fjord, Germany 54° 25' 22" N Mar-15 0–2.0 Trap 22 57.7 ± 5.4 N/A N/A 0 0 10° 12' 09" E CW = Carapace width Crab colouration classified as red or green in both right and left branchial chambers around the fifth gill, caught at the sites where infested crabs occurred (Table 1). either wedged between gill lamellae or attached to the sur- Gills on which bivalves were attached appeared to be wasted rounding branchial chamber wall (Fig. 1). The size of and were entangled by byssal threads. infesting bivalves varied considerably within any one Sequencing at the Me15/Me16 locus confirmed that C. maenas, ranging from 2.0 to 11.0 mm in shell length. At infesting bivalves at both Gullmar Fjord and Newton’s Cove Newton’s Cove, a single bivalve was found in one of the 20 were M. edulis, rather than other locally occurring, morpho- C. maenas individuals sampled. This bivalve had a shell logically similar congeners Mytilus galloprovincialis length of 6.7 mm and was wedged between lamellae on the Lamarck, 1819 or M. trossulus. One mussel specimen from posterior ninth gill. No bivalves were observed in the other each of the two sites was genotyped. A 180-bp fragment was five C. maenas populations examined (Table 1). amplified in all cases, consistent with M. edulis, but not Many of the crabs inspected were missing limbs or bore M. galloprovincialis (126 bp) or M. trossulus (168 bp) signs of black spot disease, but mussel infestations did not (Inoue et al. 1995). Consensus sequences for these four appear to be particularly associated with disease or with other clones, generated through Clustal Omega alignment parasites, such as rhizocephalans. Infested crabs from both (www.ebi.ac.uk/Tools/msa/clustalo), were identical for the Newton’s Cove (CW = 60 mm) and Gullmar Fjord two mussel specimens, indicating genetic similarity between (CW = 74 mm and 80 mm) were the largest crabs captured the mussels infesting Newton’s Cove and Gullmar Fjord at their respective sites. Infested crabs always had red crabs. A BLAST search (blast.ncbi.nlm.nih.gov/Blast.cgi) of colouration, although most crabs caught were this colour this consensus sequence found a >99% identity (179 of 180 (Table 1). All infested crabs were male, as were all other crabs bases) to bases 1169 to 1348 of the M. edulis gene for Fig. 1 Photograph of Mytilus edulis infestations on Carcinus maenas gills from Gullmar Fjord: a view of M. edulis (arrows)in C. maenas branchial chamber after removing the carapace, and b detail of M. edulis embedded between gill lamellae 1244 Mar Biodiv (2018) 48:1241–1246 polyphenolic adhesive protein (GenBank accession number larval M. edulis have been found in the red king crab X54422.1). Alignment of the sequence against diagnostic se- P. camtschaticus, but details of the size of the mussels and quences for the three Mytilus congeners (Santaclara et al. the permanence of attachment to the gills were not documented 2006) indicated clear sequence homology with M. edulis over (Jansen et al. 1998). Therefore, our observation establishes that M. galloprovincialis or M. trossulus (Fig. 2). gills of marine animals can be subject to substantial infestation by large mussels and is, to our knowledge, only the second documented example of a bivalve inhabiting crustacean gills. Discussion Assuming that growth rates in branchial chambers are sim- ilar to those in the wild, the sizes of the mussels suggest they We report multiple instances of M. edulis inhabiting the bran- were from the previous spring spawning period occuring around March to May (Chipperfield 1953). M. edulis exhibits chial chamber of C. maenas. M. edulis were found in three fully mature male C. maenas individuals, one from the a two-stage settlement, with pediveliger larvae settling prefer- entially on filamentous substrata in high-flow areas, separate English Channel and two from Gullmar Fjord. Colonising mussels varied in size, but included some adults. Mussels from any adults, before releasing and drifting to a suitable adult habitat (Bayne 1964; Eyster and Pechenik 1987). The were found both on the inner carapace and attached directly to the gill, despite the suggestion by MacKenzie et al. (1974) veliger larvae most likely entered the branchial chamber acci- that gill surfaces are an unsuitable site for mussel attachment. dentally in the inhalant respiratory current of C. maenas and Our results, and similar observations of the pedunculate bar- temporarily adhered to the gills (Walker 1974). Only the lar- nacle Octolasmis mülleri (Coker, 1902) on gills of the blue vae that immediately attached to the gills would remain in the crab Callinectes sapidus Rathbun, 1896 (Walker 1974), sug- branchial chamber, as reversal of the respiratory current, gest that crustacean gills are a viable attachment site for inter- aimed to clean debris from the gills, would remove any unat- tached individuals (Walker 1974). Once the pediveligers meta- nal commensal species. To our knowledge, this is the first report of such an association between M. edulis and morphosed (0.26–0.35 mm) and grew to the post-larval dis- persal size (2.0–2.5 mm) (Bayne 1964), it is unlikely that they C. maenas. Our observation adds to growing evidence that M. edulis, would be able to leave the crustacean branchial chamber. although typically a free living organism, sometimes colo- Alternatively, C. maenas could encounter drifting pediveligers nizes other species. M. edulis larvae have been reported in in large numbers whilst feeding on mussel beds (Lane et al. the gill chambers of haddock Melanogrammus aeglefinus 1985). The accidental inhalation of these post-larval forms (Linnaeus, 1758) and cod Gadus morhua Linnaeus, 1758 could lead to entanglement of the byssus thread around the gills (MacKenzie et al. 1974); however, upon close inspection, and subsequent new thread production and settlement, similar the mussels were found to be attached to a parasitic copepod, to the proposed settlement of M. galloprovincialis on the fish Lernaeocera sp., and not the gill surface itself (MacKenzie parasite Mothocya epimerica Costa, 1851, within the branchial chamber of Atherina boyeri Risso, 1810 (Öktener et al. 2014). et al. 1974). Bruno (1987) later found post-veliger larvae, thought to be M. edulis, attached to and embedded in the gills Settled pediveliger larvae in juvenile crabs are likely to be dislodged during ecdysis, before reaching maturity (Shields of farmed Atlantic salmon Salmo salar Linnaeus, 1758. Post- 10 20 30 40 50 ....|....|....|....|....|....|....|....|....|....| Mytilus from C. maenas consensus CAAGTTATTCGGCACCATATAAACCACCAACATACCAACCACTCAAAAAG DQ640586.1| M. edulis CAAGTTATTCGGCACCATATAAACCACCAACATACCAACCACTCAAAAAG DQ640588.1| M. trossulus CAAGTTATTCGTCACCATATAAACCACCAACATACCAACCACTCAAAAAG DQ640590.1| M. galloprovincialis --------------------------CCAGTATACAAACCTGTGAAGACA 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....| Mytilus from C. maenas consensus AAAGTGGACTATCGTCCTACGAAAAGTTATCCGCCAACATATGGATCAAA DQ640586.1| M. edulis AAAGTGGACTATCGTCCTACGAAAAGTTATCCGCCAACATATGGATCAAA DQ640588.1| M. trossulus AAA-----CCAATGGACTAT-AATAGTTCTCCGCCAACATATGGATCAAA DQ640590.1| M. galloprovincialis AG------TTATCATCCTACGAATAGTTATCCGCCAACATATGGATCAAA 110 120 130 ....|....|....|....|....|....|.... Mytilus from C. maenas consensus GACAAACTATCTGCCACTTGCAAAGAAGCTGTCA DQ640586.1| M. edulis GACAAACTATCTGCCACTTGCAAAGAAGCTGTCA DQ640588.1| M. trossulus GACAAACTATCT------TGCAAAGAAGCTGTCA DQ640590.1| M. galloprovincialis GACAAACTATCTGCCACTTGCAAAGAAGCTGTCA Fig. 2 Clustal Omega sequence alignment (www.ebi.ac.uk/Tools/msa/ for four clones from two mussels found in the branchial chamber of clustalo) of a diagnostic region of the polyphenolic adhesive protein C. maenas at Newton’s Cove and Gullmar Fjord. Reference sequences gene from bivalves found in Carcinus maenas against reference were originally published by Santaclara et al. (2006), and are listed with sequences for Mytilus congeners: M. edulis, M. trossulus and GenBank accession numbers. M. galloprovincialis. The consensus sequence represents 100% identity Mar Biodiv (2018) 48:1241–1246 1245 1992), but the prolonged intermoult period of mature crabs previous colonisation. Initial colonisation could promote fur- would favour the development of infestations (Bauer 1989). ther settlement due to gregarious settlement behaviour New exoskeletons created during moults are always green in (Petersen 1984) or interference with gill cleaning function. appearance, while red crabs will have spent an extended peri- In this way, establishment of a single individual could result od in intermoult, increasing the chances of mussel colonisa- in further infestation and a rapid deterioration in fitness of the tion (Styrishave et al. 2004). These red crabs are often the host. larger males (CW > 60 mm) (Reid et al. 1994), which reduce Although M. edulis could be acting as a facultative moulting frequency in order to devote energy to reproduction commensal or parasite of C. maenas, it seems more likely (Styrishave et al. 2004). that this is a case of accidental colonisation, with negative Sampling timing may explain why observations of outcomes for the coloniser. Certainly, mussels would be M. edulis infestations in C. maenas are rare. C. maenas pop- well protected from predators inside C. maenas and can ulations are commonly sampled during the spring, summer likely survive to maturity, which is normally attained dur- and autumn months while crabs inhabit shallow sublittoral ing the first year of life (Seed 1969). Since M. edulis is a regions (Atkinson and Parsons 1973). Much of this period suspension feeder, food delivery could be enhanced by would be prior to M. edulis settlement or when larvae are very high flows associated with active irrigation of the gill small and easily overlooked. From late autumn, mature surfaces by the crab. However, the extensive multi-stage C. maenas populations migrate offshore (Atkinson and life-cycle of M. edulis (Bayne 1964), coupled with the Parsons 1973), so any mature adults infested with M. edulis risks of moulting and mortality of C. maenas during large would not be sampled. Our sampling time of November to infestations, makes it unlikely that reproduction, and December allowed for the collection of mature adults just therefore fitness, would be improved over a free-living prior to offshore migration after spring-spawned M. edulis mode of life. had sufficient time to grow. This is the first report of M. edulis colonising C. maenas While consequences of colonisation by M. edulis for branchial chambers and only the second time such an associ- C. maenas are unknown, it seems unlikely to provide ation has been documented between a bivalve and a crusta- advantages. Presumably, M. edulis does not feed directly cean. Our finding opens several future lines of enquiry. on the tissue of the host, but the size and number of Because infestations are relatively rare, occurring in only colonising mussels would create other problems. 2.4% of individuals inspected, more extensive sampling of a Attachment of M. edulis to the gill and surrounding greater number of crabs at each site would be necessary to chamber and waste produced by the mussels could re- accurately establish the abundance and prevalence of mussels duce the respiratory efficiency by obstructing the venti- in branchial chambers. Further work is also necessary to fully latory stream, impairing gill movements, reducing the understand the physiological effects of the relationship, to exposed gill surface area and removing oxygen in the determine the ability of both M. edulis and C. maenas to inhalant water (Walker 1974; Gannon and Wheatly survive in the long term, and therefore to assess ecological 1992). M. edulis could also obstruct or functionally im- consequences. Finally, the environmental conditions or bio- pair cleaning appendages, further reducing gill efficiency logical scenarios that promote mussel infestations require in- due to fouling (Santos and Bueno 2002) and increasing vestigation. The association between M. edulis and C. maenas the likelihood of further infestation. Although moulting could have important ecological implications and provides an might occur when M. edulis are small, and could be an intriguing example of a prey species infesting a predatory important defence against colonisation (Bauer 1989; host. Walker 1974), large infestations could present a consid- erable obstruction to moulting. The fact that the only deceased crab at Gullmar Fjord happened to be one of the two infested individuals suggests that consequences Acknowledgements The authors thank S. Dupont, B. Lundve, E. could be lethal for the host. Morgan and J. Projecto-Garcia for assistance with crab collection and Mussels colonising C. maenas at Gullmar Fjord were high- dissection, and two anonymous reviewers for comments on the manu- script. Work was supported by funding from the UK Natural Environment ly aggregated in just two individuals. Unless growth rates of Research Council (NERC) under grant NE/J007951/1. colonising mussels were highly variable, these aggregations did not originate from a mass colonisation event, since they consisted of a wide size range of individuals. Reproduction Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http:// within the host seems unlikely, because this would require creativecommons.org/licenses/by/4.0/), which permits unrestricted long adult residence times and successful retention of off- use, distribution, and reproduction in any medium, provided you give spring. Instead, we suggest that aggregated distributions result appropriate credit to the original author(s) and the source, provide a link from increased chances of subsequent settlement following to the Creative Commons license, and indicate if changes were made. 1246 Mar Biodiv (2018) 48:1241–1246 Li J, Foighil DÓ, Middelfart P (2012) The evolutionary ecology of biotic References association in a megadiverse bivalve superfamily: sponsorship re- quired for permanent residency in sediment. PLoS One 7:e42121 Atkinson RJA, Parsons AJ (1973) Seasonal patterns of migrations and Lützen J, Takahashi T (2003) Arthritica japonica, sp. nov. (Bivalvia: locomotor rhythmicity in populations of Carcinus. Neth J Sea Res 7: Galeommatoidea: Leptonidae), a commensal with the pinnotherid 81–93 crab Xenophthalmus pinnotheroides White, 1846. Yuriyagai 9:11– Bauer RT (1989) Decapod crustacean grooming: Functional morphology, adaptive value, and phylogenetic significance. In: Felgenhauer BE, MacKenzie K, Smith JW, Wootten R (1974) The case of mussel bound Watling L, Thistle AB (eds) Functional morphology of feeding and fish. Scott Fish Bull 41 grooming in crustacea. A. A. Balkema, Rotterdam, pp 49–74 McDermott JJ (1991) Incidence and host-parasite relationship of Leidya Bayne BL (1964) Primary and secondary settlement in Mytilus edulis L. bimini (Crustacea, Isopoda, Bopyridae) in the Brachyuran Crab (Mollusca). J Anim Ecol 33:513–523 Pachygrapsus transversus from Bermuda. Ophelia 33:71–95 Bodger PM, Allen JA (2008) The ecology and life cycle of a population Minchella DJ (1985) Host life-history variation in response to parasitism. of Modiolarca tumida (Hanley, 1843) (Bivalvia: Mytilidae) of the Parasitology 90:205–216 coast off north-eastern England. J Molluscan Stud 74:97–101 Mori M, Orecchia S, Biagi F (1999) The occurrence of the bopyrid par- Boss KJ (1965) A new mollusk (Bivalvia, Erycinidae) commensal on the asite Pseudione crenulata G.O. Sars (Isopoda, Epicaridea) in the stomatopod crustacean Lysiosquilla. Am Mus Novit 2215:1–11 branchial chamber of Munida tenuimana G.O. Sars (Crustacea: Boyko CB, Williams JD, Markham JC (2012) Recent and fossil Isopoda Anomura) from North Tyrrhenian Sea. Doriana 7:1–5 Bopyridae parasitic on squat lobsters and porcelain crabs Morton B (1972) Some aspects of the functional morphology and biology (Crustacea: Anomura: Chirostyloidea and Galatheoidea), with notes of Pseudopythina subsinuata (Bivalvia: Leptonacea) commensal on on nomenclature and biogeography. Zootaxa 1–35 stomatopod crustaceans. J Zool 166:79–96 Bristow GA, Berland B, Schander C, Vo DT (2010) A new endosymbi- Mouritsen KN, Poulin R (2005) Parasites boosts biodiversity and changes otic bivalve (Heterodonta: Galeommatoidea), from pacific holothu- animal community structure by trait-mediated indirect effects. Oikos rians. J Parasitol 96:532–534 108:344–350 Bruce L (1989) Invertebrates associated with the thinstripe hermit Öktener A, Oliver PG, Çakir DT (2014) Mytilus (Mollusca, Bivalvia) Clibanarius vittatus (Bosc) (Crustacea: Decapoda: Diogenidae) epibiontic on the fish parasite Mothocya epimerica (Crustacea, from the Barrier Islands of Mississippi. Gulf Res Rep 8:213–217 Isopoda) in the Sea of Marmara, Turkey. J Conchol 41:759–763 Bruno DW (1987) The risk to farmed Atlantic salmon, Salmo sala L., from marine mussels growing on net cages. Bull Eur Assoc Fish Petersen JH (1984) Larval settlement behavior in competing species: Pathol 7:121–123 Mytilus californianus Conrad and M. edulis L. J Exp Mar Biol Chipperfield PNJ (1953) Observations on the breeding and settlement of Ecol 82:147–159 Mytilus edulis (L.) in British waters. J Mar Biol Assoc UK 32:449– Poulin R (1999) The functional importance of parasites in animal com- munities: many roles at many levels? Int J Parasitol 29:903–914 Eyster LS, Pechenik JA (1987) Attachment of Mytilus edulis L. larvae on Poulin R, Mouritsen KN (2006) Climate change, parasitism and the struc- algal and byssal filaments is enhanced by water agitation. J Exp Mar ture of intertidal ecosystems. J Helminthol 80:183–191 Biol Ecol 114:99–110 Reid DG, Abelló P, Warman CG, Naylor E (1994) Size-related mating Gannon AT, Wheatly MG (1992) Physiological effects of an success in the shore crab Carcinus maenas (Crustacea: Brachyura). J ectocommensal gill barnacle, Octolasmis muelleri, on gas exchange Zool 232:397–407 in the blue crab Callinectes sapidus.J Crustac Biol 12:11–18 Rohde K (1984) Zoogeography of marine parasites. Helgol Meeresunters Goto R, Hamamura Y, Kato M (2007) Obligate commensalism of 37:35–52 Curvemysella paula (Bivalvia : Galeommatidae) with hermit crabs. Rosewater J (1984) A new species of leptonacean bivalve from off north- Mar Biol 151:1615–1622 western Peru (Heterodonta, Veneroida, Lasaeidae). Veliger 27:81– Hatcher MJ, Dick JTA, Dunn AM (2006) How parasites affect interac- tions between competitors and predators. Ecol Lett 9:1253–1271 Santaclara FJ, Espiñeira M, Cabado AG, Aldasoro A, Gonzalez-Lavín N, Inoue K, Waite JH, Matsuoka M, Odo S, Harayama S (1995) Interspecific Vieites JM (2006) Development of a method for the genetic identi- variations in adhesive protein sequences of Mytilus edulis, fication of mussel species belonging to Mytilus, Perna, Aulacomya, M. galloprovincialis,and M. trossulus.BiolBull 189:370–375 and other genera. J Agric Food Chem 54:8461–8470 Isaeva V, Kulikova C, Kasyanov V (2001) Bivalve molluscs, Mytilus Santos C, Bueno SLS (2002) Infestation by Octolasmis lowei (Cirripedia trossulus and Hiatella arctica, as facultative epibionts of the crab, : Poecilasmatidae) in Callinectes danae and Callinectes ornatus emigrapsus sanguineus, infestedbythe rhizocephalan, Sacculina (Decapoda : Portunidae) from São Sebastião, Brazil. J Crustac polygenea. J Mar Biol Assoc UK 81:891–892 Biol 22:241–248 Jansen PA, MacKenzie K, Hemmingsen W (1998) Some parasites and Seed R (1969) The ecology of Mytilus edulis L. (Lamellibranchiata) on commensals of red king crabs, Paralithodes camtschaticus exposed rocky shores. Oecologia 3:277–316 (Tilesius), in the Barents Sea. Bull Eur Assoc Fish Pathol 18:46–49 Shields JD (1992) Parasites and symbionts of the crab Portunus pelagicus Kato M, Itani G (1995) Commensalism of a bivalve, Peregrinamor from Moreton Bay, eastern Australia. J Crustac Biol 12:94–100 ohshimai, with a Thalassinidean burrowing shrimp, Upogebia Styrishave B, Rewitz K, Andersen O (2004) Frequency of moulting by major. J Mar Biol Assoc UK 75:941–947 shore crabs Carcinus maenas (L.) changes their colour and their Key MM, Jeffries WB, Voris HK, Yang CM (1996) Epizoic bryozoans, success in mating and physiological performance. J Exp Mar Biol horseshoe crabs, and other mobile benthic substrates. Bull Mar Sci Ecol 313:317–336 58:368–384 Kosuge T, Itani G (1994) A record of the crab associated bivalve, Wahl M (1989) Marine epibiosis. I. Fouling and antifouling: some basic Pseudopythina macrophthalmensis from Iriomote Island, aspects. Mar Ecol Prog Ser 58:175–189 Okinawa, Japan. Jpn J Malacol 53:241–244 Walker G (1974) The occurrence, distribution and attachment of the pe- Lane DJW, Beaumont AR, Hunter JR (1985) Byssus drifting and the dunculate barnacle Octolasmis mülleri (Coker) on the gills of crabs, drifting threads of the young post-larval mussel Mytilus edulis. particularly the blue crab, Callinectes sapidus Rathbun. Biol Bull Mar Biol 84:301–308 147:678–689

Journal

Marine Biodiversity – Springer Journals

Published: Jan 24, 2017

There are no references for this article.