Genbank accession number: AF010432, AF010431, AF010433

Genbank accession number: AF010432, AF010431, AF010433 Plant Molecular Biology 37: 1087–1088, 1998. © 1998 Kluwer Academic Publishers. Printed in Belgium. GenBank accession #: AF010432 1 2 1 Authors: Autino A ,SperisenC , Vendramin GG Address: Istituto Miglioramento Genetico Piante Forestali, Consiglio Nazionale delle Ricerche, Via Atto Vannucci 13, 50134 Firenze, Italy, phone: +39 55 461071; fax: +39 55 486604; E-mail: vendramin@imgpf.fi.cnr.it; Eidgenössische Forschungsanstalt für Wald, Schnee und Landschaft (WSL), Zurcherstrasse 111, CH - 8903 Birmensdorf, Switzerland, phone: +41 1 739241, fax: +41 1 7392215, E-mail: sperisen@wsl.ch Source of sequence: Norway spruce (Picea abies K.). Trivial name: Norway spruce chloroplast tandem repeat sequence (A) GG(A) G(A) . 18 3 3 Description: Sequence of a fragment of the chloroplast genome of Norway spruce amplified using the primer pair CACAAAAGGATTTTTTTTCAGTG/CGACGTGAGTAAGAATG GTTG (Pt63718, Mol Ecol 5 (1996) 595–598, Vendramin et al.) which contains an imperfect simple sequence repeat (SSR). Mononucleotide microsatellites are frequent in chloroplast genome of conifers. The sequence shows high sequence sim- ilarity with Pinus thunbergii chloroplast DNA (dbj|D17510|PINCPTRPG) encoding for rps19 gene. This SSR shows a high degree of length polymorphisms among and within populations of Norway spruce as well as of many other species of the genus Pinus. GenBank accession #: AF010431 1 2 1 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant Molecular Biology Springer Journals

Genbank accession number: AF010432, AF010431, AF010433

Loading next page...
 
/lp/springer_journal/genbank-accession-number-af010432-af010431-af010433-9ZA22REIXd
Publisher
Kluwer Academic Publishers
Copyright
Copyright © 1998 by Kluwer Academic Publishers
Subject
Life Sciences; Biochemistry, general; Plant Sciences; Plant Pathology
ISSN
0167-4412
eISSN
1573-5028
D.O.I.
10.1023/A:1017114227150
Publisher site
See Article on Publisher Site

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial