Genbank accession number: AF010432, AF010431, AF010433

Genbank accession number: AF010432, AF010431, AF010433 Plant Molecular Biology 37: 1087–1088, 1998. © 1998 Kluwer Academic Publishers. Printed in Belgium. GenBank accession #: AF010432 1 2 1 Authors: Autino A ,SperisenC , Vendramin GG Address: Istituto Miglioramento Genetico Piante Forestali, Consiglio Nazionale delle Ricerche, Via Atto Vannucci 13, 50134 Firenze, Italy, phone: +39 55 461071; fax: +39 55 486604; E-mail:; Eidgenössische Forschungsanstalt für Wald, Schnee und Landschaft (WSL), Zurcherstrasse 111, CH - 8903 Birmensdorf, Switzerland, phone: +41 1 739241, fax: +41 1 7392215, E-mail: Source of sequence: Norway spruce (Picea abies K.). Trivial name: Norway spruce chloroplast tandem repeat sequence (A) GG(A) G(A) . 18 3 3 Description: Sequence of a fragment of the chloroplast genome of Norway spruce amplified using the primer pair CACAAAAGGATTTTTTTTCAGTG/CGACGTGAGTAAGAATG GTTG (Pt63718, Mol Ecol 5 (1996) 595–598, Vendramin et al.) which contains an imperfect simple sequence repeat (SSR). Mononucleotide microsatellites are frequent in chloroplast genome of conifers. The sequence shows high sequence sim- ilarity with Pinus thunbergii chloroplast DNA (dbj|D17510|PINCPTRPG) encoding for rps19 gene. This SSR shows a high degree of length polymorphisms among and within populations of Norway spruce as well as of many other species of the genus Pinus. GenBank accession #: AF010431 1 2 1 Plant Molecular Biology Springer Journals

Genbank accession number: AF010432, AF010431, AF010433

Loading next page...
Kluwer Academic Publishers
Copyright © 1998 by Kluwer Academic Publishers
Life Sciences; Biochemistry, general; Plant Sciences; Plant Pathology
Publisher site
See Article on Publisher Site


Plant Molecular Biology 37: 1087–1088, 1998. © 1998 Kluwer Academic Publishers. Printed in Belgium. GenBank accession #: AF010432 1 2 1 Authors: Autino A ,SperisenC , Vendramin GG Address: Istituto Miglioramento Genetico Piante Forestali, Consiglio Nazionale delle Ricerche, Via Atto Vannucci 13, 50134 Firenze, Italy, phone: +39 55 461071; fax: +39 55 486604; E-mail:; Eidgenössische Forschungsanstalt für Wald, Schnee und Landschaft (WSL), Zurcherstrasse 111, CH - 8903 Birmensdorf, Switzerland, phone: +41 1 739241, fax: +41 1 7392215, E-mail: Source of sequence: Norway spruce (Picea abies K.). Trivial name: Norway spruce chloroplast tandem repeat sequence (A) GG(A) G(A) . 18 3 3 Description: Sequence of a fragment of the chloroplast genome of Norway spruce amplified using the primer pair CACAAAAGGATTTTTTTTCAGTG/CGACGTGAGTAAGAATG GTTG (Pt63718, Mol Ecol 5 (1996) 595–598, Vendramin et al.) which contains an imperfect simple sequence repeat (SSR). Mononucleotide microsatellites are frequent in chloroplast genome of conifers. The sequence shows high sequence sim- ilarity with Pinus thunbergii chloroplast DNA (dbj|D17510|PINCPTRPG) encoding for rps19 gene. This SSR shows a high degree of length polymorphisms among and within populations of Norway spruce as well as of many other species of the genus Pinus. GenBank accession #: AF010431 1 2 1


Plant Molecular BiologySpringer Journals

Published: Oct 6, 2004

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.

DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library


Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly


Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.


Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area








Save searches from
Google Scholar,

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles


20 pages / month

PDF Discount

20% off