Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer_journal/gastrin-inhibits-gastric-cancer-progression-through-activating-the-erk-sdwN0GZNwE
- Publisher
- Springer Journals
- Copyright
- Copyright © 2018 by The Author(s).
- Subject
- Medicine & Public Health; Oncology; Cancer Research; Immunology; Apoptosis
- eISSN
- 1756-9966
- DOI
- 10.1186/s13046-018-0782-7
- Publisher site
- See Article on Publisher Site
Abstract
Background: To test the hypothesis that activated extracellular signal-regulated kinase (ERK) regulates P65-miR23a/ 27a/24 axis in gastric cancer (GC) and the ERK-P65-miR23a/27a/24 axis plays an important role in the development of GC, and to evaluate the role of gastrin in GC progression and ERK-P65-miR23a/27a/24 axis. Methods: The component levels of the ERK-P65-miR23a/27a/24 axis in four fresh GC tissues, 101 paraffin-embedded GC tissues and four GC cell lines were determined by Western blotting, immunohistochemistry (IHC) or qRT-PCR. The effects of gastrin on GC were first evaluated by measuring gastrin serum levels in 30 healthy and 70 GC patients and performing a correlation analysis between gastrin levels and survival time in 27 GC patients after eight years of follow- up, then evaluated on GC cell lines, GC cell xenograft models, and patient-derived xenografts (PDX) mouse models. The roles of ERK-P65-miR23a/27a/24 axis in GC progression and in the effects of gastrin on GC were examined. Results: ERK- P65-miR23a/27a/24 axis was proved to be present in GC cells. The levels of components of ERK-P65- miR23a/27a/24 axis were decreased in GC tissue samples and PGC cells. The decreased levels of components of ERK-P65-miR23a/27a/24 axis were associated with poor prognosis of GC, and ERK-P65-miR23a/27a/24 axis played a suppressive role in GC progression. Low blood gastrin was correlated with poor prognosis of the GC patients and decreased expression of p-ERK and p-P65 in GC tissues. Gastrin inhibited proliferation of poorly-differentiated GC (PGC) cells through activating the ERK-P65-miR23a/27a/24 axis. Gastrin inhibited GC growth and enhanced the suppression of GC by cisplatin in mice or PGC cell culture models through activating the ERK-P65-miR23a/ 27a/24 axis or its components. Conclusions: ERK-P65-miR23a/27a/24 axis is down-regulated, leading to excess GC growth and poor prognosis of GC. Low gastrin promoted excess GC growth and contributed to the poor prognosis of the GC patients by down-regulating ERK-P65-miR23a/27a/24 axis. Gastrin inhibits gastric cancer growth through activating the ERK-P65-miR23a/27a/24 axis. Keywords: Gastric cancer, Gastrin, ERK, P65, miR23a/27a/24 cluster * Correspondence: fuguhu@263.net Li-Dong Zu, Xing-Chun Peng and Zhi Zeng contributed equally to this work. Pathology Center, Shanghai General Hospital/Faculty of Basic Medicine, Key Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of Education, Institutes of Medical Sciences, Shanghai Key Laboratory of Gastric Neoplasms, Shanghai Institute of Digestive Surgery, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China Pathology Center, Shanghai General Hospital/Faculty of Basic Medicine, Shanghai Jiao Tong University School of Medicine, No. 280, South Chong-Qing Road, Shanghai 200025, People’s Republic of China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 2 of 18 Background This cluster was the first downstream miRNA target Gastric cancer (GC) is the leading cause of cancer-related implicated in regulating the development of myeloid ver- mortality worldwide and remains a considerable health sus lymphoid cells [28]. Recently, altered expression of burden throughout the world. Surgery is the only curative the miR23a/27a/24 cluster was found to be associated treatment. For locally advanced disease, adjuvant or neo- with solid tumors [29], and P65 is phosphorylated by the adjuvant therapy is usually implemented in combination MAPK pathway [11–13], suggesting a potential associ- with surgery. Outcomes in metastatic disease are poor, ation between the terminal Ser/Thr kinase ERK and the with median survival being around 1 year. Despite pro- P65-miR23a/27a/24 cluster. gress in deciphering its development, challenges with GC Gastrin, a peptide hormone, is synthesized in the G treatment remain. Many patients have inoperable disease cells of the antrum; however, gastrin expression also is at diagnosis or have recurrent disease after resection with found in many gastric adenocarcinomas of the stomach curative intent [1–4]. corpus. Gastrin’s actions are mediated through the Gastric cancer is histologically classified into diffuse and G-protein-coupled receptor cholecystokinin-B (CCK-B) intestinal types, termed PGC (poorly-differentiated GC) on parietal and enterochromaffin cells of the gastric and WGC (well-differentiated GC), respectively [1–4]. body. In a previous study, we have shown that gastrin Chronic atrophic gastritis (CAG) and WGC are developed inhibits PGC growth in vitro and in vivo [30]. Several after over-time inflammatory and wound-healing re- studies based on clinical observation or animal models sponses triggered by chronic gastric injury of any etiology of hypergastrinemia have shown that gastrin promoted [5]. Molecular studies have demonstrated that progression tumor growth, and there is no precise assessment of of WGC and PGC may have different molecular patholo- how gastrin contributes to GC progression in humans gies, although the underlying mechanisms are not com- [31–34].Whether and how gastrin affects GC cells pletely understood. To achieve good prognosis of GC remains controversial [35–37]. therapy, elucidation of mechanism for GC pathogenesis is In this study, we hypothesized that activated ERK imperative. regulated P65-miR23a/27a/24 axis in GC and the The NF-κB P65 subunit (P65) is expressed in nearly all ERK-P65-miR23a/27a/24 axis played an important role cell types [6], and is known to regulate the expression of in GC progression. We tested this hypothesis and evalu- many genes that are involved in a variety of cellular ated the role of gastrin in GC progression and modulat- responses including inflammation, immunity, cell prolifer- ing ERK-P65-miR23a/27a/24 axis. Our data indicated ation and apoptosis [7–10]. The transcriptional activity of that gastrin inhibited GC progression and activated P65 is enhanced by ERK signaling-mediated phosphoryl- ERK-P65-miR23a/27a/24 axis which functioned as a GC ation (p-P65), which also increases P65 protein stability suppressor. Gastrin and the ERK-P65-miR23a/27a/24 [11–13]. P65 was once considered to be an oncogene in axis could be a potential drug target for PGC treatment. several types of solid tumors [14–16]. Extracellular signal-regulated kinase 1 and 2 (ERK1/2) are serine/threo- Methods nine kinases and part of the Ras-Raf-MEK-ERK signal Human tissue samples (mitogen-activated protein kinase (MAPK) signal path- Human gastric cancer tissue samples and para-tumor way) transduction cascade, transmitting signals from cell tissue samples were obtained from the Department of surface receptors to regulate proliferation, differentiation, Digestive Surgery, Ruijin Hospital, School of Medicine, and survival programs. They also play a central role in the Shanghai Jiao Tong University. These samples were development of human cancer [17]. ERK signaling is acti- immediately frozen in tubes and stored in liquid nitro- vated in more than 30% of human cancers, most fre- gen after surgical resection on the PGC patients diag- quently via RAS (rat sarcoma virus) and BRAF (v-Raf nosed by clinical pathologists. Four GC samples with murine sarcoma viral oncogene homolog B) mutations upfront neoadjuvant chemotherapy were collected from [18–20]. Inhibitors targeting ERK signaling can be used as Pathology Center, Shanghai General Hospital/Faculty of cancer therapeutic agents [21–23]. More than 29 kinds of Basic Medicine, Shanghai Jiao Tong University School of kinase inhibitors have been developed to treat various can- Medicine. Peripheral blood samples were collected from cers, including the BRAF inhibitors vemurafenib and dab- GC patients treated at Ruijin Hospital and Lishui rafenib of ERK signaling and the MEK (Mitogen-activated Hospital, Zhejiang province during 2009–2010. These protein kinase kinase) inhibitor trametinib [24–26]. patients had not received chemotherapy or radiotherapy In our previous study, we have shown that p-P65 binds before surgery. Venous blood (3 ml) was collected from to the promoter region of the miR23a/27a/24 cluster fasting patients into endotoxin- and pyrogen-free test and potently up-regulates miR-23a, miR-27a, and tubes. Serum samples were further collected to Eppen- miR-24 expression that is linked to differentiation of dorf tubes and stored at − 80 °C until analysis. Patient erythroid-directed hemopoietic stem cells (HSC) [27]. survival was followed up through visiting until October Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 3 of 18 2016.Written informed consent was obtained from each normal gastric epithelium tissues were inserted in the patient. This study was approved by the Ethics Commit- four corners and in the center of each slide. Upon tee of Shanghai Jiao Tong University School of Hematoxylin and Eosin staining, TMA was examined by Medicine. two senior pathologists for diagnosis of WGCs and PGCs. Tumor histological classification was assessed Xenograft GC nude mice model according to the World Health Organization criteria. Female athymic BALB/c nude mice (6–8 weeks old) TNM (tumor, node, metastasis) staging was classified were purchased from Shanghai Experimental Animal according to the manual of the International Union Center, Chinese Academy of Science. The nude mice Against Cancer/American Joint Committee on Cancer were subcutaneously injected with 5×10 SGC7901 cells (2010). suspended in PBS (phosphate buffer saline) and grew until the tumors reached ~ 200 mm . These mice were Cell culture randomly divided into five groups and treated with LPS Human GC lines (SGC7901, AGS, MKN45, and MKN28) (lipopolysaccharide, 1 mg/kg/3d, enterocoelia), BA were purchased from the Cell Bank of the Shanghai Insti- (Betulinic acid, 20 mg/kg/3d, intragastric), miRNA tute for Biological Science (Shanghai, China) and cultured mimics (10 μg/week/mouse, tumor), gastrin (2 mg/kg, in RPMI-1640 (Hyclone, Thermo Fisher, USA) medium twice/day, subcutaneous), and PBS once daily (n = 6 for supplemented with 10% fetal bovine serum (FBS) each group) for 14 days. These mice were also randomly (Hyclone) and 1% penicillin/streptomycin (Invitrogen, divided into four groups and treated with ERK inhibitor Carlsbad, CA, USA) at 37 °C in a humidified atmosphere PD98059 (10 mg/kg/day, once per 3 days, Selleck), P65 with 5% CO . All cells used in the experiments were in inhibitor PN (Parthenolide, 4 mg/kg/day, once per day, the exponential growth phase. Selleck), miR23a/27a/24 inhibitors (10 μg/week/mouse, GenePharma), and the vehicle control for 14 days. All Determination of relative miRNA levels using quantitative mice were sacrificed after anesthesia and tumor size and real time PCR (qRT-PCR) weight were measured. Tumor volume was calculated, Total RNA was extracted from cells or GC tissue 2 3 V = length×width /2 mm . The experiments were samples after homogenization using Trizol reagent approved by the animal research committee in Shanghai (Invitrogen) according to the manufacturer’sinstruc- Jiao Tong University. tions, and were reverse transcribed (TaKaRa) into cDNA with specific RT primers. The relative miRNA GC patient-derived xenograft (PDX) mice model levels were analyzed by qRT-PCR using a One Step Patient-derived tumor tissues were collected in culture SYBR PrimeScript™ RT-PCR Kit II (TaKaRa) and an medium and kept on ice for engraftment within 24 h of ABI 7500 fast fluorescence temperature cycler. U6 resection. Necrotic and supporting tissues were carefully was used for normalization. The relative levels of −ΔΔCt removed using a surgical blade. A piece of tissue ap- each microRNA were calculated using the 2 proximately 20–30 mg in weight was cut and implanted method after normalization. All experiments were re- subcutaneously into the flank region of athymic nude fe- peated three times. The primer sequences were: male mice using a trocar. GC PDX mice were randomly divided into two groups and treated by subcutaneous in- U6 RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAA jection with gastrin (2 mg/kg) or 100 μl PBS twice daily. ATATG Gastrin (pGlu-GPWLEEEEEAWGWMDF-NH2, desig- miR-23a CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGA RT AATCC nated as Gastrin) was obtained from China Peptides (Shanghai, China). The experiments were approved by miR-27a CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCG RT GAACT the animal research committee in Shanghai Jiao Tong miR-24 RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTGTTCCT University. U6 ACACTCCAGCTGGGCGCAAATTCGTGAAGC forward Tissue microarray assay GC tissue microarray (TMA) assay was performed in miR-23a ACACTCCAGCTGGGATCACATTGCCAGGG forward our lab by following the published procedure [38]. To miR-27a ACACTCCAGCTGGGTTCACAGTGGCTAAG prepare TMA, a total of 101 GC specimens (35 WGC forward and 66 PGC tissue samples and their corresponding nor- miR-24 ACACTCCAGCTGGGTGGCTCAGTTCAGCAG mal para-tumor tissues) were included and duplicate forward 1.0 mm cores were collected by punching each paraffin universal CTCAACTGGTGTCGTGGAGTCGG tumor or para-tumor tissue sample block in the training reverse cohort or the validation cohorts. As a control, the Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 4 of 18 Western blotting expression in gastric carcinoma, deparaffinized slides were Whole cell lysates were prepared in RIPA buffer (Thermo treated with 3% H O and subjected to antigen retrieval 2 2 Scientific) with phenylmethylsulfonyl fluoride and protease using 0.01 M citric buffer solution (pH 6.0). After overnight inhibitors and centrifuged. Supernatants were aliquoted, incubation with the indicated primary antibody at 4 °C, the mixed with loading buffer, resolved by 10% sodium dodecyl slides were incubated for 15 min at room temperature with sulfate–polyacrylamide gel electrophoresis and then horseradish peroxidase-labeled polymer conjugated to a transferred onto polyvinylidenedifluoride membranes secondary antibody (Max Vision™ Kit) and incubated with (Millipore, Billerica, MA). After blocked with 5% skim milk diaminobenizidine (DAB) for 2 min. The slides were then in TBST (Tris-buffered Saline with Tween 20) at room counterstained with Hematoxylin and Eosin. Appropriate temperature for 1 h, the membranes were incubated with positive and negative controls were tested in parallel. All different primary antibodies, including anti-ERK, slides were evaluated by three independent observers who anti-p-ERK, anti-P65, anti-p-P65, anti-cyclin D1 were unaware of the disease outcome. For ERK1/2 and (1:1000,Cell Signaling Technology, Danvers, MA, USA), P65, less than 10% of expression was considered to be “loss” and anti-GAPDH (1:5000, Yeason, China) in 5% milk/TBST (−), and more than 10% of expression was designated (+). buffer at 4 °C overnight, and then probed with horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG In situ hybridization (1:5000, Jackson Immunoresearch Laboratories, West Frozen tissue sections were first digested with 5 mg/ml Grove, PA,USA)for1h.After washing with TBST, the proteinase K at room temperature for 5 min and then membrane was developed with enhanced chemiluminescent loaded onto a Ventana Discovery Ultra unit. The tissue plus substrate (Merck Millipore, Billerica, MA, USA) and slides were incubated with double digoxidenin (DIG)- the signal was recorded by Fluorchem E System (Protein labeled mercury LNA (locked nucleic acid) miR-23a-3p Simple, Santa Clara, CA, USA). probe, miR-27a-3p probe, miR-24-3p probe, or U6 snRNA probe (Exiqon) at 45 °C for 2 h. The digoxigenin label was In vitro cell proliferation assay then detected with a polyclonal anti-DIG antibody conju- The cell proliferation assay was performed using a gated with alkaline phosphatase using NBT-BCIP (nitroblue CCK-8 (Cell Counting Kit-8) kit (Dojindo, Japan). GC tetrazolium/5-Bromo-4-Chloro-3-Indolyl Phosphate) as the cells (MKN28, SGC7901, AGS, and MKN45) were substrate. The signal intensities for miR-23a, miR-27a, seeded at a density of 2 × 10 cells per well into 96-well miR-24, and U6 were quantified using the Image-Pro Plus plates with each well containing 100 μl medium. After software package (Media Cybernetics) as reported previ- culture for 24 h, the GC cells were treated with lipopoly- ously [39]. saccharides (LPS), PD98059, betulinic acid (BA), and parthenolide (PN) (Sigma Chemical Co., St. Louis, MO, Reporter gene assay USA), and incubated for desired duration. The OD value Human Cyclin D1 3′-untranslated region (UTR) of each well was measured at 450 nm. containing putative miR-23a, miR-24 and miR-27a bind- The cell proliferation was also assayed by cell counting ing sites was amplified by PCR from human genomic with trypan blue. SGC7901 cells were seeded into DNA and digested with restricted enzyme Not I and 12-well plates. After desired treatment, the cells were Xba I, and then cloned into pRL-TK (Promega). 293 T washed twice with PBS and treated with trypsin at 37 °C cells were co-transfected with this plasmid andmiR-23a, for 1 min. RPMI 1640 containing 10% FBS was added, miR-24, miR-27a mimics, or the siRNA control and in- mixed, and centrifuged. The cells were resuspended with cubated for 48 h. Cells were collected for the luciferase RPMI 1640 containing 0.4% trypan blue and counted in activity assay using a dual-luciferase reporter assay a blood cell counting chamber. system (Promega) according to the manufacturer’s in- structions. The pGL-3 plasmid (firefly) was also cotrans- ELISA (enzyme linked immunosorbent assay) fected as an endogenous control for normalization. Gastrin levels were determined using a Human Gastrin ELISA kit (Shanghai yuan Mu Biotechnology Co., Ltd., Statistical analysis Shanghai, China) following the manufacturer’s procedure. Statistical analysis was performed using SPSS 19.0 The enzyme-catalyzed reaction was stopped with 2 M software system (SPSS Inc., Chicago, IL, USA). H SO and read using a microplate reader (Thermo Fisher 2 4 Student’s t-test was performed for continuous vari- Scientific, Waltham, MA, USA) at 450 nm. ables and a chi-square test was used to analyze the differences of categorical variables. Univariate survival Immunohistochemistry analysis was carried out by the Kaplan-Meier method Tumor specimens were fixed in 10% formalin overnight and evaluated using the log-rank test. P <0.05 was and embedded in paraffin. To observe ERK1/2 and P65 considered significant. Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 5 of 18 Results than 4 cm in diameter, WGC tissues, and intestinal type ERK regulated P65 activity and miR23a/27a/24 levels in GC tissues (Additional file 1: Tables S1 and Additional GC cells file 2: Table S2). These data suggested that high levels of To examine whether ERK regulates P65-miR23a/27a/24 the components of the ERK-P65-miR23a/27a/24 axis in GC, we treated GC cells with the ERK inhibitor were associated with good prognosis of GC. PD98059 [40] or ERK activator LPS [41] and determined the levels of p-ERK, p-P65, miR-23a, miR-27a, and Suppression of GC growth by ERK-P65-miR23a/27a/24 miR-24. The results showed that p-ERK, p-P65 miR-23a, axis miR-27a and miR-24 levels were decreased in MKN28 To examine whether the components of the cells (WGC cells) after PD98059 treatment (Fig. 1a-b). ERK-P65-miR23a/27a/24 axis regulated GC growth, we They were increased in PGC cells (SGC7901, AGS, and first treated PGC cells (SGC7901) cells with LPS or the MKN45) after LPS treatment (Fig. 1c-d). The results P65 activator BA [42] and WGC cells (MKN28) with the suggested the presence of ERK-P65-miR23a/27a/24 axis ERK inhibitor PD98059 or the P65 inhibitor PN [43] in GC and ERK regulated P65 activity and miR23a/27a/ and determined the changes in cell proliferation and 24 levels in GC cells. Cyclin D1 expression. The results showed that LPS and BA up-regulated p-ERK and p-P65 levels as expected, The levels of components of ERK-P65-miR23a/27a/24 axis and proliferation of SGC7901 cells and Cyclin D1 were decreased in GC tissue samples and PGC cells and expression were inhibited by both LPS and BA (Fig. 4a associated with poor prognosis of GC and c). PD98059 or PN decreased p-ERK and p-P65 To examine the potential association of the levels as expected and enhanced cell proliferation and ERK-P65-miR23a/27a/24 axis with GC progression, we Cyclin D1 expression (Fig. 4b and d). Further, in order determined the levels of the components of to exclude the off-target effect of PD98059 on p38 and ERK-P65-miR23a/27a/24 axis in the GC tissue samples and JNK pathway, we examined the effect of ERK specific PGC and WGC cells using Western blotting, qRT-PCR, inhibitor LY3214996 on the proliferation of MKN45 IHC and in situ hybridization microarrays. The results cells. The results showed that LY3214996 promoted the showed that ERK, p-ERK, P65, p-P65, miR-23a, miR-27a, proliferation of MKN45 GC cells (Additional file 3: and miR-24 levels were significantly decreased in fresh Figure S1). tumor tissues from four PGC patients, compared with We transfected SGC7901 cells with miR-23a, miR-27a, those of the para-GC tissues (Fig. 2a-c). ERK and P65 were and miR-24 mimics and found that these mimics inhibited highly expressed in non-cancer gastric epithelium and cell proliferation and Cyclin D1 expression of SGC7901 WGC tissues, but were significantly decreased in PGC cells (Fig. 4e, I and II). We transfected MKN28 cells with tissues (Fig. 2d). ERK and P65 were more frequently miR-23a, miR-27a, and miR-24 inhibitors and found that expressed in WGC than PGCs (Fig. 2e), so did with miR- these inhibitors promoted cell proliferation and Cyclin D1 NAs miR-23a, miR-27a, and miR-24 in non-cancer and expression of MKN28 cells (Fig. 4e, III and IV). These re- WGC tissues than PGC tissues (Fig. 2f and g). Consist- sults suggested that the ERK-P65-miR23a/27a/24 axis ently, both ERK mRNA and protein and p-ERK pro- played a suppressive role in GC progression. tein levels were lower in PGC cells (SGC7001, AGS, and MKN45) than those in WGC cells (MKN28) Low blood gastrin was correlated with poor prognosis of (Fig. 3a). So did with P65and p-P65 protein levels, the GC patients and decreased expression of p-ERK and whereas P65 mRNA levels were slightly changed (Fig. p-P65 in GC tissues 3b). pri-miR23a/27a/24, pre-miR23a/27a/24, miR-23a, To determine whether the ERK-P65-miR23a/27a/24 miR-27a, and miR-24 levels were significantly lower axis mediated suppression of PGC growth by gastrin, in PGCcells than WGCcells (Fig. 3c, d). These we first measured serum gastrin levels in GC patients results indicated that the levels of components of using ELISA. The results showed that the serum gas- ERK-P65-miR23a/27a/24 axis were decreased in GC trin levels were lower in patients with antrum GC tissue samples and PGC cells, compared with the and higher in patients with fundus GC than those of para-tumor tissues and WGC, respectively, suggesting the healthy control groups (Fig. 5a). The serum gas- that the ERK-P65-miR23a/27a/24 axis was associated trin levels were lower in the diffuse GC subtype than with GC progression. intestinal subtype (Fig. 5b). Larger tumors were found We further performed an association analysis between in the groups of GC patients with lower gastrin levels the levels of components of ERK-P65-miR23a/27a/24 (Fig. 5c). GC patients with higher levels of gastrin axis and clinicopathological characteristics of GC had a longer overall survival (OS) time than those patients. The results showed that ERK and P65 expres- with lower gastrin levels (Fig. 5d). There was no sig- sion were more frequently found in tumors not more nificant difference in the overall survival between the Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 6 of 18 Fig. 1 ERK regulated P65 activity and miR23a/27a/24 levels in GC cells. The p-P65 level (a) and miR-23a, miR-27a and miR-24 levels (b) were decreased in MKN28 cells after PD98059 treatment. The p-P65 level (c) and miR-23a, miR-27a and miR-24 levels (d) were increased in PGC cells (SGC7901, AGS and MKN45) after LPS treatment. Protein levels were determined using Western blotting (a and c) with Vinculin as a loading control. MicroRNA levels were determined using qRT-PCR with U6 as a normalization control (b and d). The fold change was calculated using the −ΔΔCt 2 method. *, compared with the control, p<0.05. All experiments were repeated three times patients with antrum GC and those with GC of other lo- the paraffin-embedded tissues of GC patients by IHC. The cations (Fig. 5e). These data suggested that low serum gas- results showed that higher frequencies of p-ERK and trin was correlated with poor prognosis of the GC p-P65 expression were found in GC tissues of the patients patients. We further examined p-ERK and p-P65 levels in with the higher serum gastrin levels (Fig. 5f and g). Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 7 of 18 Fig. 2 The levels of the components of ERK-P65-miR23a/27a/24 axis were decreased in GC tissue samples. a The relative ERK, P65, p-ERK, and p- P65 protein levels in GC tissue samples, which were determined by Western blotting and quantification of density of the bands in using Image J software (b). Each band was normalized to GAPDH in the same tissue. The levels of ERK, P65, p-ERK, and p-P65 in tumor tissues were normalized to those para-tumor tissues. *, compared to the para-tumor tissues, p<0.05. c The miR-23a, miR-27a and miR-24 levels in GC tissue samples, which −ΔΔCt were determined using qRT-PCR and normalized to U6. Fold-change was calculated using the 2 method. The p values were analyzed using GraphPad 5.0 software. *, comparison between the tumor and para-tumor tissues, p<0.05. d The expression of ERK and P65 in human gastric tissue samples. ERK and P65 expression were analyzed using immunohistochemistry on a microarray of human normal, WGC, and PGC tissues using anti-ERK and anti-P65 antibodies. Representative microscopic images (Scale bar, 100 μm) of staining were shown. e Relative frequency of positive ERK and P65 expression in WGC and PGC tissues. f The relative miR-23a, miR-27a and miR-24levels in human gastric tissue samples. The microRNA levels were analyzed using in situ hybridization on a microarray of human normal, WGC, and PGC tissues using pertained probes. Representative microscopic images (Scale bar, 100 μm) of staining. g Relative frequency of positivemiR-23a, miR-27a and miR-24 expression in WGC and PGC tissues Gastrin inhibited proliferation of PGC cells through gastrin, we next treated SGC7901 cells with gastrin and activating the ERK-P65-miR23a/27a/24 axis determined p-ERK and p-P65 levels using Western blot- To further determine whether the ERK-P65-miR23a/ ting, and miR-23a, miR-27a, and miR-24 levels using 27a/24 axis mediated suppression of PGC growth by qRT-PCR. The results showed that p-ERK and p-P65 Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 8 of 18 Fig. 3 The levels of the components of ERK-P65-miR23a/27a/24 axis were decreased in PGC and WGC cells. a The ERK1/2 and b P65mRNA and protein levels in PGC and WGC cells, which were determined using qRT-PCR and Western blotting, respectively. The mRNA levels were normalized to GAPDH. The experiments were repeated three times. *, compared with the MKN28 group, p<0.05. c, d The pre-miR23a/27a/24, miR-23a, miR-27a, and −ΔΔCt miR-24 levels in PGC and WGC cells, which were determined using qRT-PCR and normalized to U6. Fold-change was calculated using the 2 method. *, compared with the MKN28 group, p<0.05. All experiments were repeated three times levels (Fig. 6a) and miR-23a, miR-27a, and miR-24 levels and miR-24 levels in tumor tissues. The results showed (Fig. 6b) were increased, and proliferation of SGC7901 that the tumor volume and weight were significantly cells and Cyclin D1 expression were inhibited (Fig. 6c) inhibited (Fig. 7a-c), p-ERK, P65, p-P65, miR-23a, in SGC7901 cells after gastrin treatment. There was a miR-27a, and miR-24 levels in tumor tissues were good pairing between these three miRNAs and cyclin significantly increased(Fig. 7d and e) in mice after treat- D1 3’ UTR (Fig. 6d). The miR-23a, miR-24 and miR-27a ment with gastrin, LPS, BA, and miRNA mimics. The mimics suppressed luciferase activity ofCCND1 3′-UTR tumor volumes were significantly increased in mice after reporter gene after cotransfection into HEK293T cells by PD98059, PN and miR23a/27a/24 inhibitors treat- (Fig. 6e). We also treated MKN45 cells with gastrin and ment (Fig. 8a and b). Co-treatment of mice with gastrin determined p-ERK and p-P65 levels using Western blot- and PD98059, PN, or miR23a/27a/24 inhibitors resulted ting and found the consistent results with those of significant decreases in the tumor volumes, compared SGC7901 cells (Additional file 4: Figure S2A and B). with the vehicle control groups (Fig. 8c and d). We also These results suggested that inhibition of PGC cells pro- examined the effects of gastrin on the PGC PDX model. liferation by gastrin was probably mediated by activation The results showed that the tumor volume and weight of the ERK-P65-miR23a/27a/24 axis. were significantly decreased (Fig. 8e-g)and thetumor tissue p-ERK, P65, and p-P65 levels were increased Gastrin inhibited GC growth through activating the ERK- (Fig. 8h) in the PGC PDX mice after gastrin treatment, P65-miR23a/27a/24 axis in mice compared with the vehicle control group. These data To determine whether the ERK-P65-miR23a/27a/24 axis supported that gastrin inhibited GC growth through mediated suppression of PGC growth by gastrin in vivo, activating the ERK-P65-miR23a/27a/24 axis in mice. we treated a subcutaneous xenograft GC mouse model with gastrin, LPS, BA, and miRNA mimics, or with Gastrin enhanced the suppression of GC by cisplatin in PD98059, PN, miR23a/27a/24 inhibitors, and their com- mice model bination with gastrin, then examined the tumor volume To determine whether gastrin enhances the suppression and weight, ERK, p-ERK, P65, p-P65, miR-23a, miR-27a, of GC by cisplatin, we first treated SGC7901 cells with Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 9 of 18 Fig. 4 Modulators of ERK-P65-miR23a/27a/24 axis regulated GC proliferation. The p-ERK and Cyclin D1 levels and proliferation of SGC7901 (a) and MKN28 (b) cells were modulated by LPS (a) and PD98059 (b). The p-P65 and Cyclin D1 levels and proliferation of SGC7901 (c)and MKN28(d)cells were modulated by BA (c)and PN (d). The Cyclin D1 levels and proliferation of SGC7901 (e-I, II) and those of MKN28 (E-III, IV) were modulated by miR23a/27a/ 24 mimics (e-I, II) and miR23a/27a/24 inhibitors (e-III, IV). SGC7901 and MKN28 cells were treated with the modulators as indicated for 48 h. The p-ERK, Cyclin D1, and p-P65 protein levels were determined using Western blotting. Proliferation of SGC7901 and MKN28 cells were determined by living cell counting. *, compared with the control group, p<0.05. All experiments were repeated three times gastrin, cisplatin, and the combination, and examined resulted in more significant increases in the levels of proliferation of SGC7901 cells. The results showed that ERK, p-ERK, P65, and p-P65, compared with that of treatment with both gastrin and cisplatin resulted in treatment with cisplatin (Fig. 9b). We also treated the more significant suppression of SGC7901 cells PGC PDX mice with cisplatin and the combination of proliferation, compared with that of treatment with gastrin and cisplatin, and examined the tumor volume cisplatin, gastrin, or vehicle alone (Fig. 9a). It also and weight as well as miR-23a, miR-27a and miR-24 Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 10 of 18 Fig. 5 (See legend on next page.) Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 11 of 18 (See figure on previous page.) Fig. 5 Low blood gastrin was correlated with GC poor prognosis and increased p-ERK and p-P65 expression. a Serum gastrin levels in GC patients, which were determined using ELISA. Normal, n = 30; Antrum, n = 22; Body, n = 28; Fundus, n =22. b Serum gastrin levels of the patients with diffuse tumors (n = 15) and those arising from intestinal sinuses (n =4). c Differential GC tumor sizes in GC patients with high (n = 10) and low (n =10) serum gastrin levels. d Differential overall survival of GC patients with high (n =9) and low (n = 18) serum gastrin levels, as revealed by Kaplan-Meier plots. p value was calculated by a log-rank test. e Differential overall survival of GC patients with antrum (n = 9) and other locations (n = 18), as revealed by Kaplan-Meier plots. p value was calculated by a log-rank test. f, g The association between serum gastrin levels and p-ERK and p-P65 expression in GC tissues. The levels of p-ERK (f) and p-P65 (g) in GC tissue samples were determined using IHC. The representative images of 4 patients were showed. Scale bar = 50 μm. p-ERK was expressed in 11 out of 13 patients with high serum gastrin, and in 12 out of 32 patients with low serum gastrin. p-P65 was expressed in 12 out of 13 patients with high serum gastrin, and in 12 out of 32 patients with low serum gastrin expression in the tumor tissues. The results showed that Discussion treatment with both gastrin and cisplatin resulted in In the current study, we have confirmed the presence of decreases in the tumor size and tumor weight (Fig. 9c-e), ERK- P65-miR23a/27a/24 axis in GC cells and found that increases in miR-23a, miR-27a and miR-24 levels (Fig. 9f), the levels of components of ERK-P65-miR23a/27a/24 axis compared with treatment with cisplatin alone. In addition, are decreased in GC tissue samples and PGC cells. The de- effective neoadjuvant chemotherapy with Oxaliplatin and creased levels of components of ERK-P65-miR23a/27a/24 Tegafur clinically led to the up-regulation of p-ERK and axis are associated with poor prognosis of GC, and p-P65 in GC tissues (Fig. 9g). These results suggested that ERK-P65-miR23a/27a/24 axis plays a suppressive role in gastrin enhanced the suppression of GC by cisplatin in GC progression. These data support that ERK-P65-miR23a/ mice model probably through the ERK-P65-miR23a/27a/ 27a/24 axis is down-regulated, leading to excess GC growth 24 axis. and poor prognosis of GC. Further, we showed that low Fig. 6 Gastrin inhibited GC cell proliferation through activating the ERK-P65-miR23a/27a/24 axis in vitro. The p-ERK, p-P65 (a), and miR-23a, miR- 27a, and miR-24 (b) levels were increased and cyclin D1 levels and proliferation of SGC7901 cells (c) were decreased after gastrin treatment. SGC7901 cells − 7 were treated with 10 mol/L gastrin for indicated duration. The p-ERK, p-P65, and cyclin D1 levels were determined using Western blotting. MicroRNA −ΔΔCt levels were determined by qRT-PCR and normalized to U6. The fold change was calculated using the 2 method. Proliferation of SGC7901 cells were determined by living cell counting. d Sequence alignment between cyclin D1 (CCND1) 3’ UTR and miR-23a, miR-27a, and miR-24 using Vector NTI 6.0 software. e The miR-23a, miR-24, and miR-27a mimics suppressed luciferase activity ofCCND1 3′-UTR reporter gene after cotransfectionin to HEK293T cells. Renilla luciferase reporter gene was used as normalization control for transfection efficiency. *, compared with the control group, p<0.05. All experiments were repeated three times Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 12 of 18 Fig. 7 Gastrin and ERK-P65-miR23a/27a/24 axis activators inhibited growth of SGC7901 tumor tissues in mice. a The tumor tissues isolated from mice xenografted with SGC7901 cells (5 × 10 ) and then treated with LPS, BA, miR23a/27a/24 mimics, and gastrin for 12 days. The volume (b) and weight (c) of tumor tissues were measured. Protein levels were determined using Western blotting (d). MicroRNA levels were determined using −ΔΔCt qRT-PCR with U6 as a normalization control. The fold change was calculated using the 2 method (e). *, compared with the control, p<0.05. The experiments were repeated three times blood gastrin was correlated with poor prognosis of the GC for leukemia that allowed the development of protein patients and decreased expression of p-ERK and p-P65 in kinase inhibitors such as imatinib and dasatinib that are GC tissues. Gastrin inhibited proliferation of PGC cells therapeutically effective [27]. In the current study, we through activating the ERK-P65-miR23a/27a/24 axis. Gas- confirmed the presence of ERK-P65-miR23a/27a/24 axis trin inhibited GC growth and enhanced the suppression of in GC cells. The decreased levels of components of GC by cisplatin in mice or PGC cell culture models through ERK-P65-miR23a/27a/24 axis are associated with poor activating the ERK-P65-miR23a/27a/24 axis or its compo- prognosis of GC, and ERK-P65-miR23a/27a/24 axis nents. These data suggested that low gastrin promoted plays a suppressive role in GC progression. It has been excess GC growth and contributed to the poor prognosis of shown that AE1 was expressed in GC cells and is associ- the GC patients by down-regulating ERK-P65-miR23a/27a/ ated with GC pathogenesis by promoting sequestration 24 axis. of P16 in the cytoplasm and promoting alkalization of In a recent study, we found that P65 upregulated GC cells [44]. miR23a/27a/24 expression. Sustained activation of P65 In the current study, we showed that low blood gastrin and up-regulation of miR23a/27a/24expression silenced was correlated with poor prognosis of the GC patients. the expression of anion exchanger 1 (AE1), a major Gastrin inhibited GC growth and enhanced the membrane protein in RBC. The absence of AE1 is asso- suppression of GC by cisplatin in mice or PGC cell ciated with differentiation arrest of erythroleukemia culture models. This is consistent with our previous K562 cells. This pathogenesis provided a molecular basis study that gastrin inhibits PGC growth in vitro and in Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 13 of 18 Fig. 8 Gastrin inhibited tumor growth induced byERK-P65-miR23a/27a/24 axis inhibitors in a PDX mice model. a, c The tumor tissues isolated from mice xenografted with SGC7901 cells (5 × 10 ) and then treated with PD98059, PN, and miR23a/27a/24 inhibitors (a) or combination with Gastrin for 11 days (c). The volume of tumor tissues was measured (b, d). e-h The tumor tissues isolated from PDX mice models treated either with gastrin (2 mg/ kg, subcutaneous injection, twice a day) or 100 μl PBS/mouse/day (e). The volume (f) and weight (g) of the tumor tissues were measured. ERK, P65, p-ERK, and p-P65 protein levels were determined using Western blotting (h). *, compared with the control group, p<0.05. All measurements were repeated three times vivo [30]. Several studies have shown that gastrin much preferred to located in distal stomach in the Eastern promotes tumor growth based on clinical observation or where the production and secretion of gastrin were animal models of hypergastrinemia [31–34]. This is destroyed, leading to the lower serum gastrin level in different from our findings in the current study. Asian. The prevalence of diffuse histology is higher in the Therefore, the effects of gastrin on GC progression Western GC patients. There was a significant association remains controversial [35–37], probably due to of higher serum gastrin level and intestinal metaplasia inconsistent factors such as specimens, ethnics, genetic [45]. Our results showed that serum gastrin level was background, and environmental factors. Gastric cancer is lower in diffuse type GC. The environmental factors and a heterogeneous disease with a variety of predisposing and dietary habits between the Eastern and Western people etiologic factors, and there is difference between “Eastern” are quite different, resulting differences in the prevalence and “Western” gastric cancer, including histology, tumor of obesity, diabetes, and tobacco use, which are associated location, baseline patient characteristics, environmental with increased perioperative complications in gastric and dietary factors, and Helicobacter pylori status. A cancer as well as many other tumors [46, 47]. The much higher incidence of tumors located in the proximal profiling of cancer mutation genes has identified third of the stomach was found in the Western, while significant differences in APC, ARIDIA, KMT2A, Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 14 of 18 Fig. 9 Gastrin enhanced the inhibitory effect of cisplatin GC growth. a-b GC cells were treated with gastrin (1 nM), cisplatin (2 mM) or combination. The media containing indicated drugs were replaced every day. The cell proliferation was determined by a CCK-8 assay (a), and the protein levels were determined using Western blotting (b). c-f The tumor tissues isolated from mice xenografted with SGC7901 cells (5 × 10 )and then treated with PD98059, PN, and miR23a/27a/24 inhibitors for 11 days (Gastrin and cisplatin vs cisplatin,14 day) (c). Thevolume(d)and weight (e) of the tumor tissues were measured. The miR-23a, miR-27a and miR-24 levels were determined by qRT-PCR. f *, compared with the control group, p<0.05. g Changes of p-ERK and p-P65 levels in GC tissues of patients after treatment with Oxaliplatin and Tegafur. The p-ERK and p-P65 levels were determined by IHC. The representative images of 4 patients were showed. Scale bar = 50 μm PIK3CA, and PTEN genes between GC patients of Asian sizes (Fig. 5c) and poor prognosis (Fig. 5d) of the GC pa- and Caucasian [48]. The in-depth mechanistic investiga- tients. These data suggested that the gastrin levels were tions on gastric cancer biology and/or host factors are associated with the locations or types of GC and corre- necessary to fully understand the difference between the lated with the prognosis (Fig. 5a-d). It is highly reasonable Western GC and the Eastern GC. to speculate that locations of GC could be associated with Since gastrin was dominantly synthesized in the G cells the prognosis of GC. To test this hypothesis, we analyzed of the antrum, the secretion of gastrin was destroyed in differential overall survival of GC patients with antrum patients with antrum GC, resulting in decreased gastrin and other locations using Kaplan-Meier plots, and found levels, as we observed that low gastrin levels in patients that there was no significant difference in the overall sur- with antrum GC and up-regulated gastin levels in patients vival between the patients with antrum GC and those with with other sites (body and fundus) of GC due to the com- GC of other locations (Fig. 5e). Whether the location of pensatory effects (Fig. 5a and b). This was consistent with GC is correlated with the prognosis of GC deserves fur- the other published results [45]. We then investigated and ther investigation by including more GC patients in the found that low blood gastrin was correlated with tumor future study. Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 15 of 18 To investigate the underlying mechanism for gastrin upon molecular classifications, including the EBV to inhibit GC progression found in this study, we (Epstein-Barr virus), MSI (microsatellite instability), GS showed that ERK-P65-miR23a/27a/24 axis was (genomically stable), and CIN (chromosomal instability) down-regulated in GC, leading to excess GC growth and types [83]. It is very intriguing to investigate the poor prognosis of GC and that gastrin inhibited GC association and the underlying molecular mechanism of growth and enhanced the suppression of GC by cisplatin gastrin with the TCGA GC types in our future studies. in mice or PGC cell culture models in the current study. Consistently, we found that low blood gastrin was corre- Conclusions lated with poor prognosis of the GC patients and de- Collectively, we have found that ERK-P65-miR23a/27a/24 creased expression of p-ERK and p-P65 in GC tissues. axis is down-regulated in GC, which may play a role in Gastrin activated the ERK-P65-miR23a/27a/24 axis and excess GC growth and poor prognosis of GC. Low gastrin inhibited proliferation of PGC cells. Further, gastrin acti- promotes excess GC growth and contributes to the poor vated the ERK-P65-miR23a/27a/24 axis or its compo- prognosis of the GC patients by down-regulating nents and inhibited GC growth and enhanced the ERK-P65-miR23a/27a/24 axis. Gastrin inhibits GC pro- suppression of GC by cisplatin in mice or PGC cell gression and activates ERK-P65-miR23a/27a/24 axis culture models. This observation is consistent with the which functions as a GC suppressor. Gastrin and the previous studies showing that miR-27a suppresses ERK-P65-miR23a/27a/24 axis could be a potential drug ZBTB10/RINZF genes expression [49] and ZBTB10/ target for PGC therapy. RINZF inhibits the Sp1-depedent transcription of gastrin [50]. It seems that gastrin and miR-27a are mutually Additional files up-regulated. These data support that ERK-P65-miR23a/ 27a/24 axis mediates the suppressive effects of gastrin Additional file 1: Table S1. Association of ERK expression and clinicopathological features of GC. (DOC 44 kb) on GC growth, providing a mechanism for gastrin to in- Additional file 2: Table S2. Association of P65 expression and hibit GC progression. How gastrin activates the clinicopathological features of GC. (DOC 49 kb) ERK-P65-miR23a/27a/24 axis or its components remains Additional file 3: Figure S1. LY3214996 promoted the proliferation of to be investigated in the future. MKN45 cells. (TIF 44 kb) Cisplatin is a first-line chemotherapeutic agent for GC Additional file 4: Figure S2. Gastrin inhibited the proliferation of treatment [51–54]. However, it is very toxic and confer MKN45 cells. (TIF 66 kb) great adverse side effects when applied to GC treatment [55, 56]. In the current study, we found that gastrin Abbreviations enhanced the suppressive effects of cisplatin on GC in AE1: Anion exchanger 1; BA: Betulinic acid; BRAF: v-Raf murine sarcoma viral oncogene homolog B; CAG: Chronic atrophic gastritis; CCK-8: Cell Counting comparison with treatment with gastrin or cisplatin Kit-8; CCK-B: Cholecystokinin-B; CIN: Chromosomal instability; alone. Therefore, a gastrin-cisplatin combination therapy DAB: Diaminobenizidine; DIG: Digoxidenin; EBV: Epstein-Barr virus; would promote efficacy and reduce toxicity of cisplatin ELISA: Enzyme linked immunosorbent assay; ERK: Extracellular signal- regulated kinase; FBS: Fetal bovine serum; GC: Gastric cancer; therapy of GC by allowing lower cisplatin doses to be GS: Genomically stable; HSC: Hemopoietic stem cells; used. IHC: Immunohistochemistry; LNA: Locked nucleic acid; It has been shown that several signaling pathways are LPS: Lipopolysaccharides; MAPK: Mitogen-activated protein kinase; MEK: Mitogen-activated protein kinase kinase; MSI: Microsatellite instability; involved in GC progression, including MAPK (ERK, JNK, NBT-BCIP: Nitroblue tetrazolium/5-Bromo-4-Chloro-3-Indolyl Phosphate; P38) [57–59], PI3K-Akt-mTOR [60–64], AMPK-mTOR OS: Overall survival; PBS: Phosphate buffer saline; PDX: Patient-derived [65, 66], COX-2/NF-κB[67–70], Wnt signaling pathways xenografts; PGC: Poorly-differentiated GC; PN: Parthenolide; qRT- PCR: Quantitative real time PCR; RAS: Rat sarcoma virus; TBST: Tris-buffered [71–74]. Non-coding RNAs including miRNA and lncRNA Saline with Tween 20; TCGA: The Cancer Genome Atlas; TMA: Tissue play important roles in gastric cancer progression or drug microarray; TNM: Tumor, node, metastasis; WGC: Well-differentiated GC resistance. They may also serve as biomarker for diagnosis or targeted therapy of GC, such as miR-21 [75–82]. For Acknowledgements We give our sincere gratitude to Dr. Xinsheng Gu who gave us so much the first time, we found that ERK-P65-miR23a/27a/24 axis useful advices on writing and improving the manuscript. We also give our is involved in GC progression, providing an additional thanks to Dr. Bing-Ya Liu from Ruijin Hospital for providing some fresh GC mechanism or target to investigate novel approaches for specimens. GC therapy. Funding In the current study, we classified the GC patients into This work was supported in part by the National Natural Science Foundation intestine, diffuse, and mixed type using the classic of China (NO81372637; NO81602535), National Basic Research Program of Lauren method and investigated the role of gastrin in China (973 Program) (NO2013CB910903), National Key Technology R&D Program of China (NO2014BAI09B03), Key Projects in Shanghai Science & GC growth and development. The Cancer Genome Technology Pillar Program for Biomedicine (NO14431904700), First Round Atlas (TCGA) project has mapped a genomic landscape of3-year Action Plan to promote clinical skills and clinical innovation in of GC and described four groups of gastric cancer based Municipal Hospitals of Shanghai (16CR2039B), and Shanghai hospital Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 16 of 18 development center emerging advanced technology joint research project protein phosphatase 4-mediated NF-kappaB p65 Thr dephosphorylation. (SHDC12014105). J Biol Chem. 2004;279(25):26143–8. 13. Tang CH, Tsai CC. CCL2 increases MMP-9 expression and cell motility in Availability of data and materials human chondrosarcoma cells via the Ras/Raf/MEK/ERK/NF-kappaB signaling All data generated or analyzed during this study are included in this published pathway. Biochem Pharmacol. 2012;83(3):335–44. article [and its supplementary information files]. Additional datasets used and/or 14. McCall P, Bennett L, Ahmad I, Mackenzie LM, Forbes IW, Leung HY, Sansom analysed during the current study are available from the corresponding author OJ, Orange C, Seywright M, Underwood MA, et al. NFkappaB signalling is on reasonable request. upregulated in a subset of castrate-resistant prostate cancer patients and correlates with disease progression. Br J Cancer. 2012;107(9):1554–63. Authors’ contributions 15. Seavey MM, Lu LD, Stump KL, Wallace NH, Hockeimer W, O'Kane TM, Ruggeri GF conceived and designed the study. LZ, XP, ZZ, JW, and LM performed the BA, Dobrzanski P. Therapeutic efficacy of CEP-33779, a novel selective JAK2 experiments and collected data; YY, WS, and CH performed the data analysis; inhibitor, in a mouse model of colitis-induced colorectal cancer. Mol Cancer All authors discussed and interpreted the data. LZ wrote the manuscript. All Ther. 2012;11(4):984–93. authors reviewed and edited the manuscript. All authors read and approved 16. Switzer CH, Cheng RY, Ridnour LA, Murray MC, Tazzari V, Sparatore A, Del the final manuscript. Soldato P, Hines HB, Glynn SA, Ambs S, et al. Dithiolethiones inhibit NF-kappaB activity via covalent modification in human estrogen receptor-negative breast Ethics approval and consent to participate cancer. Cancer Res. 2012;72(9):2394–404. Inclusion of human participants, and use of human data and human tissue 17. Kolch W. Coordinating ERK/MAPK signalling through scaffolds and inhibitors. in this study were approved by the Ethics Committee of Shanghai Jiao Tong Nat Rev Mol Cell Biol. 2005;6(11):827–37. University School of Medicine. The use of animals in this study was approved 18. Peng SB, Henry JR, Kaufman MD, Lu WP, Smith BD, Vogeti S, Rutkoski TJ, by the animal research committee in Shanghai Jiao Tong University. Wise S, Chun L, Zhang Y, et al. Inhibition of RAF isoforms and active dimers Approval number A-2016-036. by LY3009120 leads to anti-tumor activities in RAS or BRAF mutant cancers. Cancer Cell. 2015;28(3):384–98. Competing interests 19. Hong DS, Cabanillas ME, Wheler J, Naing A, Tsimberidou AM, Ye L, The authors declare that they have no competing interests. Busaidy NL, Waguespack SG, Hernandez M, El Naggar AK, et al. Inhibition of the Ras/Raf/MEK/ERK and RET kinase pathways with the combination of the multikinase inhibitor sorafenib and the Publisher’sNote farnesyltransferase inhibitor tipifarnib in medullary and differentiated Springer Nature remains neutral with regard to jurisdictional claims in thyroid malignancies. J Clin Endocrinol Metab. 2011;96(4):997–1005. published maps and institutional affiliations. 20. Desideri E, Cavallo AL, Baccarini M. Alike but different: RAF paralogs and their signaling outputs. Cell. 2015;161(5):967–70. Author details 1 21. Caunt CJ, Sale MJ, Smith PD, Cook SJ. MEK1 and MEK2 inhibitors and Pathology Center, Shanghai General Hospital/Faculty of Basic Medicine, Key cancer therapy: the long and winding road. Nat Rev Cancer. 2015; Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of 15(10):577–92. Education, Institutes of Medical Sciences, Shanghai Key Laboratory of Gastric 22. Samatar AA, Poulikakos PI. Targeting RAS-ERK signalling in cancer: promises Neoplasms, Shanghai Institute of Digestive Surgery, Ruijin Hospital, Shanghai 2 and challenges. Nat Rev Drug Discov. 2014;13(12):928–42. Jiao Tong University School of Medicine, Shanghai, China. Department of 23. Chen YN, LaMarche MJ, Chan HM, Fekkes P, Garcia-Fortanet J, Acker Pathology, Renmin Hospital of Wuhan University, Wuhan, China. 3 MG,Antonakos B,Chen CH,Chen Z,Cooke VG, etal. Allosteric Department of Digestive Medicine, Ningbo No. 2 Hospital, Ningbo 315010, 4 inhibition of SHP2 phosphatase inhibits cancers driven by receptor China. Pathology Center, Shanghai General Hospital/Faculty of Basic tyrosine kinases. Nature. 2016;535(7610):148–52. Medicine, Shanghai Jiao Tong University School of Medicine, No. 280, South 24. Corcoran RB, Atreya CE, Falchook GS, Kwak EL, Ryan DP, Bendell JC, Chong-Qing Road, Shanghai 200025, People’s Republic of China. Hamid O, Messersmith WA, Daud A, Kurzrock R, et al. Combined BRAF and MEK inhibition with Dabrafenib and Trametinib in BRAF V600- Received: 15 January 2018 Accepted: 1 May 2018 mutant colorectal Cancer. J Clin Oncol: official J Am Society Clin Oncol. 2015;33(34):4023–31. 25. Tiacci E, Park JH, De Carolis L, Chung SS, Broccoli A, Scott S, Zaja F, Devlin S, References Pulsoni A, Chung YR, et al. Targeting mutant BRAF in relapsed or refractory 1. Shimizu D, Kanda M, Kodera Y. Review of recent molecular landscape hairy-cell leukemia. N Engl J Med. 2015;373(18):1733–47. knowledge of gastric cancer. Histol Histopathol. 2018;33(1):11–26. 26. Chapman PB, Solit DB, Rosen N. Combination of RAF and MEK inhibition for 2. Van Cutsem E, Sagaert X, Topal B, Haustermans K, Prenen H. Gastric cancer. the treatment of BRAF-mutated melanoma: feedback is not encouraged. Lancet. 2016;388(10060):2654–64. Cancer Cell. 2014;26(5):603–4. 3. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer 27. Zhang YC, Ye H, Zeng Z, Chin YE, Huang YN, Fu GH. The NF-kappaB p65/ statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108. miR-23a-27a-24 cluster is a target for leukemia treatment. Oncotarget. 2015; 4. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016; 6(32):33554–67. 66(1):7–30. 28. Kong KY, Owens KS, Rogers JH, Mullenix J, Velu CS, Grimes HL, Dahl R. MIR- 5. Watanabe T, Tada M, Nagai H, Sasaki S, Nakao M. Helicobacter pylori 23A microRNA cluster inhibits B-cell development. Exp Hematol. 2010;38(8): infection induces gastric cancer in mongolian gerbils. Gastroenterology. 629–640 e621. 1998;115(3):642–8. 29. Chhabra R, Dubey R, Saini N. Cooperative and individualistic functions of 6. Jacobs MD, Harrison SC. Structure of an IkappaBalpha/NF-kappaB complex. the microRNAs in the miR-23a~27a~24-2 cluster and its implication in Cell. 1998;95(6):749–58. human diseases. Mol Cancer. 2010;9:232. 7. Perkins ND. The diverse and complex roles of NF-kappaB subunits in cancer. 30. Cui Y, Li SB, Peng XC, Wu J, Fu GH. Trastuzumab inhibits growth of HER2- Nat Rev Cancer. 2012;12(2):121–32. negative gastric Cancer cells through gastrin-initialized CCKBR signaling. Dig 8. Zhang Q, Lenardo MJ, Baltimore D. 30 years of NF-kappaB: a blossoming of Dis Sci. 2015;60(12):3631–41. relevance to human pathobiology. Cell. 2017;168(1–2):37–57. 31. Fossmark R, Martinsen TC, Bakkelund KE, Kawase S, Waldum HL. ECL-cell 9. Oeckinghaus A, Hayden MS, Ghosh S. Crosstalk in NF-kappaB signaling derived gastric cancer in male cotton rats dosed with the H2-blocker pathways. Nat Immunol. 2011;12(8):695–708. loxtidine. Cancer Res. 2004;64(10):3687–93. 10. Ben-Neriah Y, Karin M. Inflammation meets cancer, with NF-kappaB as the matchmaker. Nat Immunol. 2011;12(8):715–23. 32. Morton M, Prendergast C, Barrett TD. Targeting gastrin for the treatment of 11. Zhao P, Elks CM, Stephens JM. The induction of lipocalin-2 protein gastric acid related disorders and pancreatic cancer. Trends Pharmacol Sci. expression in vivo and in vitro. J Biol Chem. 2014;289(9):5960–9. 2011;32(4):201–5. 12. Yeh PY, Yeh KH, Chuang SE, Song YC, Cheng AL. Suppression of MEK/ERK 33. Smith JP, Nadella S, Osborne N. Gastrin and gastric Cancer. Cell Mol signaling pathway enhances cisplatin-induced NF-kappaB activation by Gastroenterol Hepatol. 2017;4(1):75–83. Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 17 of 18 34. Waldum HL, Sagatun L, Mjones P. Gastrin and gastric Cancer. Front 54. Mahlberg R, Lorenzen S, Thuss-Patience P, Heinemann V, Pfeiffer P, Endocrinol (Lausanne). 2017;8:1. Mohler M. New perspectives in the treatment of advanced gastric 35. Tomita H, Takaishi S, Menheniott TR, Yang X, Shibata W, Jin G, Betz KS, Cancer: S-1 as a novel oral 5-FU therapy in combination with cisplatin. Kawakami K, Minamoto T, Tomasetto C, et al. Inhibition of gastric Chemotherapy. 2017;62(1):62–70. carcinogenesis by the hormone gastrin is mediated by suppression of TFF1 55. Su X, Dong C, Zhang J, Su L, Wang X, Cui H, Chen Z. Combination epigenetic silencing. Gastroenterology. 2011;140(3):879–91. therapy of anti-cancer bioactive peptide with cisplatin decreases chemotherapy dosing and toxicity to improve the quality of life in 36. Rao SV, Solum G, Niederdorfer B, Norsett KG, Bjorkoy G, Thommesen L. xenograft nude mice bearing human gastric cancer. Cell Biosci. 2014; Gastrin activates autophagy and increases migration and survival of gastric 4(1):7. adenocarcinoma cells. BMC Cancer. 2017;17(1):68. 37. Kun Z, Hanqing G, Hailing T, Yuan Y, Jun Z, Lingxia Z, Kun H, Xin Z. Gastrin 56. Welz S, Hehr T, Kollmannsberger C, Bokemeyer C, Belka C, Budach W. Renal enhances autophagy and promotes gastric carcinoma proliferation via toxicity of adjuvant chemoradiotherapy with cisplatin in gastric cancer. Int J inducing AMPKalpha. Oncol Res. 2017;25:1399–407. Radiat Oncol Biol Phys. 2007;69(5):1429–35. 38. Melincovici CS, Mihu CM, Marginean M, Bosca AB, Coneac A, Moldovan I, 57. Li W, Fan M, Chen Y, Zhao Q, Song C, Yan Y, Jin Y, Huang Z, Lin C, Wu J. Crisan M. The prognostic significance of p53, Bax, Bcl-2 and cyclin E protein Melatonin induces cell apoptosis in AGS cells through the activation of JNK overexpression in colon cancer - an immunohistochemical study using the and P38 MAPK and the suppression of nuclear factor-kappa B: a novel tissue microarray technique. Romanian J Morphol Embryol. 2016;57(1):81–9. therapeutic implication for gastric Cancer. Cellular physiology and 39. Ling H, Pickard K, Ivan C, Isella C, Ikuo M, Mitter R, Spizzo R, Bullock MD, biochemistry : international journal of experimental cellular physiology, Braicu C, Pileczki V, et al. The clinical and biological significance of MIR-224 biochemistry, and pharmacology. 2015;37(6):2323–38. 58. Jiang X, Zhu X, Huang W, Xu H, Zhao Z, Li S, Li S, Cai J, Cao J. Garlic-derived expression in colorectal cancer metastasis. Gut. 2016;65(6):977–89. organosulfur compound exerts antitumor efficacy via activation of MAPK 40. Zelivianski S, Spellman M, Kellerman M, Kakitelashvilli V, Zhou XW, Lugo E, pathway and modulation of cytokines in SGC-7901 tumor-bearing mice. Int Lee MS, Taylor R, Davis TL, Hauke R, et al. ERK inhibitor PD98059 enhances Immunopharmacol. 2017;48:135–45. docetaxel-induced apoptosis of androgen-independent human prostate 59. Yang M, Huang CZ. Mitogen-activated protein kinase signaling pathway and cancer cells. Int J Cancer. 2003;107(3):478–85. invasion and metastasis of gastric cancer. World J Gastroenterol. 2015;21(41): 41. Zhu YN, Yang YF, Ono S, Zhong XG, Feng YH, Ren YX, Ni J, Fu YF, Tang W, 11673–9. Zuo JP. Differential expression of inducible nitric oxide synthase and IL-12 between peritoneal and splenic macrophages stimulated with LPS plus IFN- 60. Tapia O, Riquelme I, Leal P, Sandoval A, Aedo S, Weber H, Letelier P, Bellolio gamma is associated with the activation of extracellular signal-related E, Villaseca M, Garcia P, et al. The PI3K/AKT/mTOR pathway is activated in kinase. Int Immunol. 2006;18(6):981–90. gastric cancer with potential prognostic and predictive significance. 42. Parrondo R, de las Pozas A, Reiner T, Rai P, Perez Stable C. NF-kappaB Virchows Arch. 2014;465(1):25–33. activation enhances cell death by antimitotic drugs in human prostate 61. Feng LM, Wang XF, Huang QX. Thymoquinone induces cytotoxicity and cancer cells. Mol Cancer. 2010;9:182. reprogramming of EMT in gastric cancer cells by targeting PI3K/Akt/mTOR pathway. J Biosci. 2017;42(4):547–54. 43. Zhang S, Lin ZN, Yang CF, Shi X, Ong CN, Shen HM. Suppressed NF-kappaB 62. Li NA, Wang W, Xu B, Gong H. miR-196b regulates gastric cancer cell and sustained JNK activation contribute to the sensitization effect of proliferation and invasion via PI3K/AKT/mTOR signaling pathway. Oncol Lett. parthenolide to TNF-alpha-induced apoptosis in human cancer cells. 2016;11(3):1745–9. Carcinogenesis. 2004;25(11):2191–9. 44. Shen WW, Wu J, Cai L, Liu BY, Gao Y, Chen GQ, Fu GH. Expression of anion 63. Li Y, Liu Y, Shi F, Cheng L, She J. Knockdown of Rap1b enhances apoptosis exchanger 1 sequestrates p16 in the cytoplasm in gastric and colonic and autophagy in gastric Cancer cells via the PI3K/Akt/mTOR pathway. adenocarcinoma. Neoplasia. 2007;9(10):812–9. Oncol Res. 2016;24(5):287–93. 45. Kim BC, Jung SW, Kim JB, Han AR, Jang SI, Park SH, Lee MS, Yoon JH, Baik 64. Riquelme I, Tapia O, Espinoza JA, Leal P, Buchegger K, Sandoval A, Bizama C, GH, Jang HJ, et al. Serum gastrin levels in different stages of distal gastric Araya JC, Peek RM, Roa JC. The gene expression status of the PI3K/AKT/ carcinogenesis: is there a role for serum gastrin in tumor growth? Turk J mTOR pathway in gastric Cancer tissues and cell lines. Pathol Oncol Res. Gastroenterol. 2014;25(6):611–8. 2016;22(4):797–805. 65. Yu Y, Hou L, Song H, Xu P, Sun Y, Wu K. Akt/AMPK/mTOR pathway was 46. Kutsenko A, Ladenheim MR, Kim N, Nguyen P, Chen V, Jayasekera C, Yang involved in the autophagy induced by vitamin E succinate in human gastric JD, Kumari R, Roberts L, Nguyen MH. Increased prevalence of metabolic risk cancer SGC-7901 cells. Mol Cell Biochem. 2017;424(1–2):173–83. factors in Asian Americans with hepatocellular carcinoma. J Clin Gastroenterol. 2017;51(4):384–90. 66. Han G, Gong H, Wang Y, Guo S, Liu K. AMPK/mTOR-mediated inhibition of 47. Ko KP, Shin A, Cho S, Park SK, Yoo KY. Environmental contributions to survivin partly contributes to metformin-induced apoptosis in human gastrointestinal and liver cancer in the Asia-Pacific region. J Gastroenterol gastric cancer cell. Cancer Biol Ther. 2015;16(1):77–87. Hepatol. 2018;33(1):111–20. 67. Yang H, Huang S, Wei Y, Cao S, Pi C, Feng T, Liang J, Zhao L, Ren G. 48. Jia F, Teer JK, Knepper TC, Lee JK, Zhou HH, He YJ, McLeod HL. Discordance Curcumin enhances the anticancer effect of 5-fluorouracil against gastric of somatic mutations between Asian and Caucasian patient populations Cancer through down-regulation of COX-2 and NF- kappaB signaling with gastric Cancer. Mol Diagn Ther. 2017;21(2):179–85. pathways. J Cancer. 2017;8(18):3697–706. 68. Chen Z, Liu M, Liu X, Huang S, Li L, Song B, Li H, Ren Q, Hu Z, Zhou Y, et al. 49. Scott GK, Mattie MD, Berger CE, Benz SC, Benz CC. Rapid alteration of COX-2 regulates E-cadherin expression through the NF-kappaB/snail microRNA levels by histone deacetylase inhibition. Cancer Res. 2006;66(3): 1277–81. signaling pathway in gastric cancer. Int J Mol Med. 2013;32(1):93–100. 69. Li YS, Wu LP, Li KH, Liu YP, Xiang R, Zhang SB, Zhu LY, Zhang LY. 50. Tillotson LG, RIN ZF. A novel zinc finger gene, encodes proteins that Involvement of nuclear factor kappaB (NF-kappaB) in the downregulation of bind to the CACC element of the gastrin promoter. J Biol Chem. 1999; 274(12):8123–8. cyclooxygenase-2 (COX-2) by genistein in gastric cancer cells. J Int Med Res. 2011;39(6):2141–50. 51. Nakayama I, Chin K, Matsushima T, Takahari D, Ogura M, Shinozaki E, Suenaga M, Ozaka M, Wakatsuki T, Ichimura T, et al. Retrospective 70. Wu CY, Wang CJ, Tseng CC, Chen HP, Wu MS, Lin JT, Inoue H, Chen GH. comparison of S-1 plus cisplatin versus S-1 monotherapy for the treatment Helicobacter pylori promote gastric cancer cells invasion through a NF- of advanced gastric cancer patients with positive peritoneal cytology but kappaB and COX-2-mediated pathway. World J Gastroenterol. 2005;11(21): without gross peritoneal metastasis. Int J Clin Oncol. 2017;22(6):1060–8. 3197–203. 52. Jiang XY, Zhu XS, Xu HY, Zhao ZX, Li SY, Li SZ, Cai JH, Cao JM. Diallyl 71. Pan KF, Liu WG, Zhang L, You WC, Lu YY. Mutations in components of the Wnt trisulfide suppresses tumor growth through the attenuation of Nrf2/Akt signaling pathway in gastric cancer. World J Gastroenterol. 2008;14(10):1570–4. and activation of p38/JNK and potentiates cisplatin efficacy in gastric 72. Ye J, Xu J, Li Y, Huang Q, Huang J, Wang J, Zhong W, Lin X, Chen W. cancer treatment. Acta Pharmacol Sin. 2017;38(7):1048–58. DDAH1 mediates gastric cancer cell invasion and metastasis via Wnt/beta- catenin signaling pathway. Mol Oncol. 2017;11(9):1208–24. 53. Jia L, Ren S, Li T, Wu J, Zhou X, Zhang Y, Liu W. Effects of combined simultaneous and sequential Endostar and cisplatin treatment in a mice 73. Wu F, Li J, Guo N, Wang XH, Liao YQ. MiRNA-27a promotes the proliferation model of gastric Cancer peritoneal metastases. Gastroenterol Res Pract. and invasion of human gastric cancer MGC803 cells by targeting SFRP1 via 2017;2017:2920384. Wnt/beta-catenin signaling pathway. Am J Cancer Res. 2017;7(3):405–16. Zu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:115 Page 18 of 18 74. Sun GL, Li Z, Wang WZ, Chen Z, Zhang L, Li Q, Wei S, Li BW, Xu JH, Chen L, et al. miR-324-3p promotes gastric cancer development by activating Smad4-mediated Wnt/beta-catenin signaling pathway. J Gastroenterol. 2018;53(6):725–739. 75. Hao NB, He YF, Li XQ, Wang K, Wang RL. The role of miRNA and lncRNA in gastric cancer. Oncotarget. 2017;8(46):81572–82. 76. Xu Q, Liu JW, Yuan Y. Comprehensive assessment of the association between miRNA polymorphisms and gastric cancer risk. Mutat Res Rev Mutat Res. 2015; 763:148–60. 77. Wang QX, Zhu YQ, Zhang H, Xiao J. Altered MiRNA expression in gastric cancer: a systematic review and meta-analysis. Cell Physiol Biochem. 2015; 35(3):933–44. 78. Shin VY, Chu KM. MiRNA as potential biomarkers and therapeutic targets for gastric cancer. World J Gastroenterol. 2014;20(30):10432–9. 79. Irmak-Yazicioglu MB. Mechanisms of MicroRNA deregulation and MicroRNA targets in gastric Cancer. Oncol Res Treat. 2016;39(3):136–9. 80. Dehghanzadeh R, Jadidi-Niaragh F, Gharibi T, Yousefi M. MicroRNA-induced drug resistance in gastric cancer. Biomed Pharmacother. 2015;74:191–9. 81. Karimi Kurdistani Z, Saberi S, Tsai KW, Mohammadi M. MicroRNA-21: mechanisms of oncogenesis and its application in diagnosis and prognosis of gastric Cancer. Arch Iran Med. 2015;18(8):524–36. 82. Wang Z, Cai Q, Jiang Z, Liu B, Zhu Z, Li C. Prognostic role of microRNA-21 in gastric cancer: a meta-analysis. Med Sci Monit. 2014;20:1668–74. 83. Cancer Genome Atlas Research. N: comprehensive molecular characterization of gastric adenocarcinoma. Nature. 2014;513(7517):202–9.
Journal
Journal of Experimental & Clinical Cancer Research – Springer Journals
Published: Jun 4, 2018