Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata

Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata Eur J Plant Pathol (2018) 151:689–701 https://doi.org/10.1007/s10658-017-1403-6 Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata Moslem Papizadeh & Anne D. van Diepeningen & Hamid Reza Zamanizadeh & Farkhondeh Saba & Hossein Ramezani Accepted: 14 December 2017 /Published online: 15 January 2018 The Author(s) 2018. This article is an open access publication Abstract Two Fusarium strains, isolated from Aspara- weeks in Asparagus officinalis seedlings. In comparison gus in Italy and Musa in Vietnam respectively, proved to mild disease symptoms were observed by the same be members of an undescribed clade within the Fusar- strains on Musa acuminata seedlings. ium solani species complex based on phylogenetic spe- cies recognition on ITS, partial RPB2 and EF-1α gene Keywords Fusarium solani species complex fragments. Macro- and micro-morphological investiga- Asparagus officinalis pathogen Musa acuminata tions followed with physiological studies done on this pathogen new species: Fusarium ershadii sp. nov can be distin- guished by its conidial morphology. Both isolates of Fusarium ershadii were shown to be pathogenic to the Introduction monocot Asparagus officinalis when inoculated on roots and induced hollow root symptoms within two Fusiform or banana-shaped multicelled conidia are proba- bly the best known characteristic of the large Ascomycete genus Fusarium.Withinthegenuswefindmanyplant M. Papizadeh F. Saba pathogens, saprobes, mycotoxin producers, and an in- Microorganisms Bank, Iranian Biological Resource Center (IBRC), Academic Center for Education, Culture and Research creasing number of human pathogens (e.g. Salah et al. (ACECR), Tehran, Iran 2015; van Diepeningen et al. 2014). For a long time, sections were recognized within the genus based on mor- A. D. van Diepeningen phological characters. Nowadays, subdivisions within Fu- CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584CT, Utrecht, The Netherlands sariumaremadeinspeciescomplexesconsistingofsibling species with limited to no morphological variation, which A. D. van Diepeningen (*) can be best discriminated based on sequence data. A plea BU Biointeractions and Plant Health, Wageningen University and has been made to keep most of the Fusarium species Research, Droevendaalsesteeg 1, 6708PB, Wageningen, The Netherlands complexes of these agriculturally and for human health e-mail: anne.vandiepeningen@wur.nl important species under the well-known genus denomina- tor Fusarium rather than splitting the genus in nine or more H. R. Zamanizadeh different genera (Geiser et al. 2013). Department of Plant Pathology, College of Agriculture, Science and Research Branch, Islamic Azad University, Tehran, Iran One of the more basal clades within the genus Fu- sarium according to Geiser et al. (2013)isthe Fusari- H. Ramezani um solani species complex (FSSC), centered on recent- Plants Bank, Iranian Biological Resource Center (IBRC), ly epitypified Fusarium solani (Schroers et al. 2016). Academic Center for Education, Culture and Research (ACECR), Tehran, Iran However, Lombard et al. (2015) revisited various 690 Eur J Plant Pathol (2018) 151:689–701 genera of Nectriaceae and suggested renaming the Materials and methods Fusarium solani species complex as Neocosmospora (Lombard et al. 2015), but we prefer to use Geiser’s Macroscopic and microscopic morphology proposal for a large Fusarium genus including virtually all Fusarium species of importance in plant pathology, Morphological characteristics and growth rates were medical mycology, mycotoxicology and basic re- studied on potato dextrose agar (PDA), synthetic nutri- search, and thus better recognized (Geiser et al. ent agar (SNA), and carnation leaf agar (CLA). Digital 2013). Members of FSSC are capable of causing dis- images of the colonies were documented and studied ease on many agricultural important crops – often foot after 7 days of incubation at 25 °C, with and without UV and root rots - and are the most commonly observed (longer incubation up to a month was considered if etiological agents of human fusarioses (Coleman 2015; needed). Inoculations were performed using a dense O'Donnell et al. 2008). inoculum stock which was prepared from a 10-day-old Within the plant pathogenic fusaria it is common to colony on CLA medium. Macroscopic properties were talk about formae speciales describing the host plant studied on 10-day-old colonies. Slide cultures were species of an isolate. Host-specific virulence factors that mounted in a droplet of lactic acid or water to be studied determine the host or host range are usually located on with an Olympus BX51 microscope equipped with a dispensable supernumerary chromosomes. Within the DP25 digital imaging camera. Size of various structures Fusarium oxysporum species complex, host specificity was determined by averaging the measurements of 25– and these supernumerary chromosomes were found to 30 samples of each structure (Short et al. 2013). have been horizontally exchanged between different lineages and species (Baayen et al. 2000; Ma et al. Growth rates 2013). However, formae speciales in FSSC seem to correspond to biologically and phylogenetically distinct Single conidia of isolates, grown on Carnation Leaf Agar species (Coleman 2015). (CLA) (Fisher et al. 1982), were transferred to the center of Based on multi-locus sequence analyses of core 8.5 cm Potato Dextrose Agar (PDA) and Oatmeal agar genome genes and regions, dozens of different phy- (OA) plates and incubated in growth chambers at 25 °C logenetic lineages within the FSSC can be recognized and30°C. After72h,colonydiameters weremeasured (O'Donnelletal. 2008;Short et al. 2013; Zhang et al. using a ruler and the average growth rate per isolates was 2006). Slowly, more of these lineages are described calculated and expressed as colony growth rate per 24 h. with Latin binomials and/or with more data regarding Additionally, cardinal growth temperatures were deter- their ecological niches are published. Examples are mined on PDA plates that were mid-point inoculated and the recent description of Fusarium petroliphilum incubated at 5, 10, 15, 20, 25, 28, 30, 34, 37 and 40 °C for (FSSC clade-1) and F. keratoplasticum (FSSC clade 7 days and any hyphal growth was studied under the light −2) (Short et al. 2013) and the epitypification of the microscope (objective lenses 4X and 10X). The colony potato dry rot pathogen F. solani sensu stricto diameter was measured after 7 days (Hujslová et al. 2013; (FSSC-clade-5) (Schroers et al. 2016). Fusarium Selbmann et al. 2008). keratoplasticum, a common inhabitant of soil, drain- Also, PDA and MEA media of different acidity age systems and other antropogenic substrates, was (pH 3–8.5) were prepared in duplicate using a 2 M stock recently suggested to be recombining, potentially solution of HCl or NaOH (Hujslová et al. 2013; even via heterothallic sex (Short et al. 2013;Short Selbmann et al. 2008). Plates were inoculated (single- and O'Donnell 2014). A remarkable finding as ‘Fu- point) and incubated at 28 °C for 10 days and diameter sarium solani´ is generally considered homothallic or of the colonies was measured (Hujslová et al. 2013; asexual (O'Donnell et al. 2008). Selbmann et al. 2008). In this paper we describe a new species within FSSC that also forms a monophyletic clade based on multiple Primers for molecular identification and phylogenetic loci. The strains were isolated from the monocots aspar- analysis agus and banana and proved especially pathogenic on the first host. The new species was characterized mor- Primers ITS1 (TCCGTAGGTGAACCTGCGG) and phologically and phylogenetically. ITS4 (TCCTCCGCTTATTGATATGC) were used to Eur J Plant Pathol (2018) 151:689–701 691 amplify the ITS fragment (approximately 600 bp), primers UsingtheMEGAv.7.0.9package,sequenceswerealigned EF1 (ATGGGTAAGGARGACAAGAC) and EF2 withsequencesobtainedfromtheonlinedatabasesofCBS, (GGARGTACCAGTSATCATGTT) were used to amplify NBRC, and GenBank (http://www.ncbi.nlm.nih.gov/). a nearly 720 bp fragment of the coding gene for EF-1α, According to the results gained from the similarity primers RPB2-5F (GAYGAYMGWGATCAYTTYGG) assessments (CBS, Fusarium MLST, and NCBI), and RPB2-7R (CCCATWGCYTGCTTMCCCAT) were sequences were aligned with the multiple sequence used to amplify a nearly 1200 bp fragment of the coding alignment tool; Multiple sequence Alignment using Fast gene for RPB2 (Geiser et al. 2013,; O'Donnell et al. 2007, Fourier Transform (MAFFT), available at the European O'Donnell et al. 2008.;Shortetal. 2011; Zhang et al. Bioinformatics Institute (EMBL-EBI) (Katoh et al. 2009, 2006). McWilliam et al. 2013). Alignments were manually im- proved in MEGA v. 7.0.9 and Bioedit v. 7.0.5.3 packages DNA extraction and polymerase chain reaction (default settings) (Tamura et al. 2011; Kumar et al. 2016). The flanking regions were excluded from the analysis. The DNAwas extracted using a manual purification proce- alignments were checked visually and finally the resulting dure as described (Papizadeh et al. 2017a,; Saba et al. multiple sequence alignments were used for phylogenetic 2016). All the PCR amplifications were performed in a assessments. Concatenated multi-locus sequence align- MyCycler™ thermal cycler system (BIORAD, USA). ments were prepared with the BioEdit 7.0.5.3 package. The 50 μl PCR mixtures were prepared with 1 μl DNA Phylogenetic trees were rooted with Fusarium staphyleae suspension, 5 μl of PCR buffer (Fermentas), 10 mmol strain NRRL 22316. Phylogenetic analyses were per- of dNTPs, 2.5 mM MgSO4, and 10 pmole of each of the formed for each dataset as well as with combined align- primers, 5 U of PFU DNA polymerase, 0.5 μlofabso- ments consisting of ITS, EF-1α, and RPB2 regions. lute DMSO, and appropriate volume of DDW. A hot- The online tool Findmodel (http://www.hiv.lanl. start procedure (3 min, 94 °C) was used before the gov/content/sequence/findmodel/findmodel. html) was enzyme addition to prevent nonspecific annealing of used to determine the best nucleotide substitution model. the primers. All the PCR reactions for amplification of Maximumlikelihood(ML)distanceanalysiswasconduct- the ITS, and EF-1α fragments entailed 35 cycles (94 °C ed with the MEGA v. 7.0.9 package (Tamura et al. 2011) for 45 s, 56 °C for ITS [50 °C for EF-1α] for 50 s, 72 °C with the GTR + GAMMA substitution models. The ro- for 95 s, plus one additional cycle with a final 7 min bustness of the trees was evaluated by 1000 bootstrap chain elongation). For amplification of the selected replications. Bayesian analyses were conducted with fragment of the RPB2 gene the PCR conditions includ- MrBayes v3.2.1 (Huelsenbeck and Ronqvist 2001)exe- ed: (1) hot start with 95 °C for 5 min; (2) 30 cycles of cuted on XSEDE (Extreme Science and Engineering Dis- 1 min at 95 °C, 2 min at 55 °C (or 50 °C), an increase of covery Environment) through the CIPRES Science Gate- 1°C/5sto72°C,and2minat 72°C;and(3)a10-min wayv3.3(Milleretal. 2010) in two parallel runs, using the incubation at 72 °C, respectively. The PCR products default settings but with these adjustments: general time were sequenced by Genfanavaran Biotech Corporation reversible (GTR) model of DNA substitution as the best fit (O’Donnell et al. 2007). The DNA sequences deter- and a gamma distribution rate variation across sites mined for this study were submitted to GenBank, and (HuelsenbeckandRonqvist2001).Thismodelwaschosen the accession numbers for strain CBS 115.40 = IBRC- astheresultfromapretestwithMrModeltest2.2(Nylander M 30232 are: KX503270 (RPB2), KX503269 (EF- 2004). After this was determined, the GTR + I + G model, 1α), KX503267 (ITS). The accession numbers for as the best nucleotide substitution model, was used for the strain CBS 139505 = IBRC-M 30096 KX503268 combined ITS, EF-1α,andRPB2dataset, andaMCMC (ITS). heated chain was set with a temperature value of 0.05. The number of chains, number of generations, and sample Sequence analysis frequencies were set respectively at 4, 50,000,000, and 1000. Chain convergence was determined using Tracer Each of the DNA fragments was sequenced on both direc- v1.5 (http://tree.bio.ed.ac.uk/software/tracer/)toconfirm tions using the same primers which were used for PCR sufficiently large ESS values (>200). The sampled trees amplification. Sequences were assembled and edited with weresubsequentlysummarizedafteromittingthefirst25% a trial version of Geneious software (www.geneious.com). of trees as burn-in using the Bsump^ and Bsumt^ 692 Eur J Plant Pathol (2018) 151:689–701 commands implemented in MrBayes (Rambaut and morphology and in multi-locus sequence analyses and Drummond 2009). Trees were visualized and edited using we describe them here as Fusarium ershadii. FigTreev1.4.2 (Rambaut2008). Theconcatenated aligned Morphological features of F. ershadii are shown in dataset for ITS, EF-1α and RPB2 used in the analysis has Table 1 and Fig. 2. Strains of F. ershadii,likeother been submitted with the TreeBASE under the submission members of FSSC have septate, filiform conidiophores ID 21561 (Papizadeh et al. 2017b). incorporating microconidia-bearing terminal monophialides. Although true macroconidia, character- Phytopathogenicity tests istic of FSSC members, were not detected in dark nor under UV, some conidia, around 20 μm inlengthand 3- Strains of Fusarium ershadii (CBS 115.40 and CBS septate, were observed which may be assumed to be 139505) were grown on PDA for a week, the surface of macroconidia (e.g. Fig 2 g and o). Chlamydospores the medium was removed using a sterile scalpel, and the were formed (e.g. Fig 2 s and t), sometimes directly mycelial material was added to 25 ml of sterile 0.05% from the mostly 1-septate conidia. tween80 solution. The suspension was vortexed for Strains (CBS 115.40 and CBS 139505) showed the 20 min and then filtered through sterile cotton cloth to same macro- and micromorphology on agar plates with remove hyphae. Thereafter, conidia were counted using a little to no pigmentation on the used media. Morpholog- haemocytometer and a suspension with an approximate ical characters are summarized in the species descrip- density of 1.2 × 10 /ml was prepared. Roots of 11 months tions (Fig. 2). No growth was detected on MEA medium old Asparagus officinalis (Accession IBRC P1006759 of at 5 °C. Hence, 10 °C was recorded as the lowest the Iranian Biological Reference Centre) seedlings, grown temperature that the strains could grow. The strains did in greenhouse (25 °C and 12-h photoperiod), were washed not grow at 40 °C and after a period at temperatures of 42 °C or higher they lost viability and were unable to in sterile water. Then, the roots of different seedlings were inoculated by immersion for a minute in the suspension of grow at growth-permitting temperatures. The optimum the conidia of strains CBS 115.40 and IBRC-M 30096, temperature for growth was between 28 and 30 °C. The respectively. All tests were done in triplicate. Triplicate un- optimum pH value for growth was 6 (Table 1). inoculated seedlings were used as control. Finally, all the seedlings were potted in sterilized-soil. Pots were incubat- Molecular Identification and phylogenetic analysis edin a quarantined space in thegreenhouse forthree weeks and were examined and photographed in 3-day intervals. Sequences of three loci, EF-1α, RPB2, and ITS frag- The same procedure was performed on two months old ments, of Fusarium ershadii were studied in combina- Musa acuminata (IBRC P1011416) seedlings produced tion with sequences of FSSC isolates already available by tissue culture. in the Fusarium MLST and GenBank databases (Fig. 1). The sequence identity in EF-1α fragments of 110 strains Results Table 1 Growth profile of Fusarium ershadii Phenotypic characterization pH Colony Diam. (mm) Temp. Colony Diam. (mm) Strain CBS 115.40 was isolated by Bugnicourt in 1936 3 No growth 5 No growth from Musa sapientum in Tonkin, Vietnam and was de- 3.5 12 10 7 posited in the CBS collection in 1940. The strain used to 429 15 28 bethetypestrainofCylindrocarpontonkinense,arelative 546 20 39 of Cylindrocarpon lichenicola. In 2002, Summerbell and 5.5 56 25 57 Schroers showed that C. lichenicola falls within the 658 28 59 FSSC, while it was noted that CBS 115.40 was a clearly 757 30 59 distinct species also within the same Fusarium solani 7.2 56 34 22 species complex (Summerbell and Schroers 2002). More 852 37 19 recently CBS 139505 was isolated from diseased 8.5 43 40 No growth Aspagarus in Italy. Both strains proved to match in Eur J Plant Pathol (2018) 151:689–701 693 belonging to FSSC was about 56% (pairwise identity and the formation of empty areas void of plant material. ~95%). For the ITS fragment sequence identity was These symptoms are comparable to the symptoms of around 64–68% (pairwise identity ~96.5%) and for Fusarium crown and root rot in asparagus, normally RPB2 fragment 70–71% (pairwise identity ~97.5%). attributed to Fusarium oxysporum f.sp. asparagi, Phylogenies performed on the combined set of ITS, F. proliferatum, unspecified F. solani,and F. redolens EF-1α and RPB2 fragments and individual fragments (Elmer 2015). In comparison, inoculation of roots of resulted similar tree topologies. The analyses placed banana plants (Musa acuminata IBRC P1011416) with F. ershadii into a distinct clade (MLST group FSSC the same strains, resulted in a reduced growth but not to 9c) (Fig. 1). As is shown in Fig. 1, the posterior proba- the level that was seen on Asparagus plants (Fig. 3d-e). bility support for the F. ershadii clade was 0.9992/97% ML bootstrap value. The remainder of the tree was similar to that described for the FSSC (O’Donnell Taxonomy et al. 1998)(Table 2). Fusarium ershadii Papizadeh, van Diepeningen, & Phytopathogenicity Zamanizadeh, sp. nov. (Figs. 1 and 2). Mycobank: MB 817602. We tested our two strains for pathogenicity on the two Type: Vietnam, Tonkin, isolated from Musa host plants they were isolated from. The same pathologic sapientum, 1936, collected by F. Bugnicourt. (holotype: results were seen on the triplicate inoculated plants of IBRC-H 2025, a dried culture) [Ex-type: CBS T T Asparagus officinalis and Musa acuminata.Our 115.40 =IBRC-M30232 preserved in a metabolically phytopathogenicity tests showed that the inoculation of inactive state (cryopreserved)]. roots of Asparagus plants (Asparagus officinalis IBRC Additional strain: CBS 139505 = IBRC-M 30096. P1006759) with strains CBS 139505 and CBS 115.40 led Sequences from ex-type culture, CBS 115.40: ITS to a severely reduced growth within 10 days (Figure. 3). (KX503267), EF-1α (KX503269), RPB2 (KX503270) Furthermore, the roots showed clearly ‘hollow root’-like and from strain CBS 139505 = IBRC-M 30096: ITS symptoms with strong pigmentation within root tissues (KX503268). Fig. 1 Phylogenetic relationships with maximum likelihood and In blocks species with latin binomials are indicated, but the ma- Bayesian inference methods under the GTR + I + G model of jority of clades within FSSC do not have them yet. Clade 9c; evolution between Fusarium ershadii and the other members of Fusarium ershadii, Clade 5; Fusarium solani senso stricto, Clade FSSC based on the concatenated data of EF1-α, ITS and RPB2 2; F. keratoplasticum,Clade1; F. Petroliphylum. As outgroup (ML tree shown). At the branch tips the strain identifiers are given. Fusarium staphyleae NRRL 22316 was used 694 Eur J Plant Pathol (2018) 151:689–701 Table 2 Strains and sequences used in this study Species complexes of Fusarium Strain number Sequence Accession Numbers Reference RPB2 ITS EF1-α Fusarium ershadii (9c) CBS 115.40 KX503270.1 KX503267.1 KX503269.1 This study Fusarium ershadii (9c) CBS 139505 KX503268.1 This study Fusarium ershadii (9c) NRRL 46676 GU250731.1 GU250669.1 GU250546.1 Balmas et al. (2010) FSSC 9b NRRL 46615 GU250728.1 GU250666.1 GU250543.1 Balmas et al. (2010) FSSC 9d FRC S-2484 JN235906.1 JN235291.1 JN235721.1 Short et al. (2011) FSSC 9d FRC S-2542 JN235907.1 JN235292.1 JN235722.1 Short et al. (2011) FSSC 9d FRC S-2543 JN235908.1 JN235293.1 JN235723.1 Short et al. (2011) FSSC 9a FRC S-2519 JN235911.1 JN235296.1 JN235726.1 Short et al. (2011) FSSC 9a FRC S-2485 JN235909.1 JN235294.1 JN235724.1 Short et al. (2011) FSSC 9a FRC S-2491 JN235912.1 JN235297.1 JN235727.1 Short et al. (2011) FSSC 9a FRC S-2530 JN235910.1 JN235295.1 JN235725.1 Short et al. (2011) FSSC 9a FRC S-2531 JN235913.1 JN235298.1 JN235728.1 Short et al. (2011) FSSC 9a NRRL 32755 HM347159.1 DQ094534.1 DQ247073.1 Zhang et al. (2006) FSSC 9a NRRL 43811 EF470092.1 EF453204.1 EF453053.1 O'Donnell et al. (2007) FSSC 9e CBS 222.49 JX435259.1 JX435209.1 JX435159.1 Debourgogne et al. (2012) FSSC 9e FRC S-2540 JN235914.1 JN235299.1 JN235729.1 Short et al. (2011) FSSC 9e FRC S-2541 JN235915.1 JN235300.1 JN235730.1 Short et al. (2011) FSSC 5 FRC S-2446 JN235917.1 JN235302.1 JN235732.1 Short et al. (2011) FSSC 5 FRC S-2538 JN235942.1 JN235327.1 JN235757.1 Short et al. (2011) FSSC 5 CBS 131775 JX237778.1 JX162380.1 JX118990.1 Zhang et al. (2006) FSSC 5 NRRL 28679 EU329556.1 DQ094385.1 DQ246912.1 Zhang et al. (2006) FSSC 5 NRRL 43468 EF469980.1 EF453093.1 EF452941.1 O'Donnell et al. (2007) FSSC 5 NRRL 22779 EU329526.1 DQ094333.1 DQ246848.1 Zhang et al. (2006) FSSC 5 NRRL 32810 EU329624.1 DQ094577.1 DQ247118.1 Zhang et al. (2006) FSSC 5 NRRL 25083 JF740882.1 JF741044.1 JF740714.1 O'Donnell et al. (2012) FSSC 5 NRRL 44896 GU170584.1 GU170639.1 GU170619.1 Migheli et al. (2010) FSSC 5 NRRL 22783 EU329529.1 DQ094335.1 DQ246851.1 O'Donnell et al. (2007) FSSC 5 NRRL 43527 EF470003.1 EF453116.1 EF452964.1 O'Donnell et al. (2007) FSSC 5 NRRL 25388 EU329535.1 DQ094341.1 DQ246858.1 Zhang et al. (2006) FSSC 22 NRRL 22163 EU329496.1 AF178394.1 AF178328.1 O'Donnell et al. (2008) FSSC 23 NRRL 22400 EU329509.1 DQ094303.1 AF178343.1 O'Donnell et al. (2008) FSSC 34 NRRL 46703 EU329661.1 EU329712.1 HM347126.1 O'Donnell et al. (2010) F. keratoplasticum (FSSC 2) FRC S-2427 JN235885.1 JN235270.1 JN235700.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2374 JN235767.1 JN235152.1 JN235582.1 Short et al. (2011) F. keratoplasticum (FSSC 2) NRRL 28014 EF470139.1 DQ094354.1 DQ246872.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43649 EU329639.1 EF453132.1 EF452980.1 O'Donnell et al. (2007) F. keratoplasticum (FSSC 2) FRC S-2407 JN235898.1 JN235283.1 JN235713.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2477 JN235897.1 JN235282.1 JN235712.1 Short et al. (2011) F. keratoplasticum (FSSC 2) NRRL 22641 EU329521.1 DQ094328.1 DQ246843.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 22645 EU329523.1 DQ094330.1 DQ246845.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 52715 JF741123.1 JF740912.1 JF740797.1 O'Donnell et al. (2012) Eur J Plant Pathol (2018) 151:689–701 695 Table 2 (continued) Species complexes of Fusarium Strain number Sequence Accession Numbers Reference RPB2 ITS EF1-α F. keratoplasticum (FSSC 2) NRRL 32711 EU329597.1 DQ094493.1 DQ247031.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43373 EF469959.1 EF453072.1 EF452920.1 O'Donnell et al. (2007) F. keratoplasticum (FSSC 2) NRRL 32780 EU329617.1 DQ094551.1 DQ247090.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32959 EU329634.1 DQ094632.1 DQ247178.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 22640 EU329520.1 DQ094327.1 DQ246842.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 46437 GU170588.1 GU170643.1 GU170623.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 46438 GU170589.1 GU170644.1 GU170624.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 22661 EU329524.1 DQ094331.1 DQ246846.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 22791 EU329530.1 DQ094337.1 DQ246853.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 28561 EU329552.1 DQ094375.1 DQ246902.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 25391 EU329536.1 DQ094343.1 DQ246860.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 28550 EU329547.1 DQ094365.1 DQ246891.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32862 EU329631.1 DQ094621.1 DQ247167.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 53132 GU170598.1 GU170654.1 GU170634.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 31165 EU329562.1 DQ094394.1 DQ246921.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 46443 GU170591.1 GU170646.1 GU170626.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 32707 EU329595.1 DQ094490.1 DQ247027.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32710 EU329596.1 DQ094492.1 DQ247030.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32838 EU329627.1 EU329681.1 DQ247144.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43433 DQ790561.1 DQ790517.1 DQ790473.1 Chang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43458 EF470172.1 EU329686.1 DQ790511.1 Chang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43490 DQ790573.1 DQ790529.1 DQ790485.1 Chang et al. (2006) F. keratoplasticum (FSSC 2) FRC S-2394 JN235887.1 JN235272.1 JN235702.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2478 JN235888.1 JN235273.1 JN235703.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2496 JN235891.1 JN235276.1 JN235706.1 Short et al. (2011) (FSSC 2) FRC S-2552 JN235846.1 JN235231.1 JN235661.1 Short et al. (2011) F. keratoplasticum F. keratoplasticum (FSSC 2) FRC S-2369 JN235758.1 JN235143.1 JN235573.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2411 JN235772.1 JN235157.1 JN235587.1 Short et al. (2011) F. keratoplasticum (FSSC 2) NRRL 52704 JF741112.1 JF740908.1 JF740786.1 O'Donnell et al. (2012) F. keratoplasticum (FSSC 2) FRC S-2509 JN235788.1 JN235173.1 JN235603.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2406 JN235789.1 JN235174.1 JN235604.1 Short et al. (2011) F. striatum (FSSC 21) NRRL 22101 EU329490.1 AF178398.1 AF178333.1 Chehri (2014) F. petroliphilum (FSSC 1) FRC S-2383 JN235858.1 JN235243.1 JN235673.1 Short et al. (2011) F. petroliphilum (FSSC 1) FRC S-2522 JN235921.1 JN235306.1 JN235736.1 Short et al. (2011) F. petroliphilum (FSSC 1) NRRL 32304 EU329568.1 DQ094402.1 DQ246932.1 Zhang et al. (2006) F. petroliphilum (FSSC 1) FRC S-2536 JN235937.1 JN235322.1 JN235752.1 Short et al. (2011) F. petroliphilum (FSSC 1) FRC S-2462 JN235938.1 JN235323.1 JN235753.1 Short et al. (2011) F. petroliphilum (FSSC 1) NRRL 46440 GU170590.1 GU170645.1 GU170625.1 Migheli et al. (2010) F. petroliphilum (FSSC 1) NRRL 46604 GU170594.1 GU170649.1 GU170629.1 Migheli et al. (2010) FSSC 25 NRRL 22389 EU329506.1 DQ094314.1 AF178340.1 Chehri (2017) FSSC 18 NRRL 31158 DQ094389.1 DQ246916.1 Zhang et al. (2006) 696 Eur J Plant Pathol (2018) 151:689–701 Table 2 (continued) Species complexes of Fusarium Strain number Sequence Accession Numbers Reference RPB2 ITS EF1-α FSSC 37 NRRL 25137 JF741084.1 JF740899.1 JF740757.1 Sandoval-Denis et al. (2018) FSSC 29 NRRL 28008 EF470135.1 DQ094350.1 DQ246868.1 Zhang et al. (2006) FSSC 25 NRRL 31169 KR673999.1 DQ094396.1 DQ246923.1 Zhang et al. (2006) FSSC 26 NRRL 28541 EU329542.1 EU329674.1 DQ246882.1 Zhang et al. (2006) FSSC 28 NRRL 32437 EU329581.1 DQ094446.1 DQ246979.1 Zhang et al. (2006) FSSC 27 NRRL 37625 EU329637.1 EU329684.1 FJ240353.1 O'Donnell et al. (2008) FSSC 12 NRRL 22642 EU329522.1 DQ094329.1 DQ246844.1 Zhang et al. (2006) FSSC 39 FRC S-2432 JN235941.1 JN235326.1 JN235756.1 Short et al. (2011) FSSC 7 NRRL 43502 DQ790576.1 DQ790532.1 DQ790488.1 Chang et al. (2006) FSSC 15 NRRL 28009 EF470136.1 DQ094351.1 DQ246869.1 Zhang et al. (2006) FSSC 11 NRRL 45880 EU329640.1 EU329689.1 FJ240352.1 O'Donnell et al. (2008) FSSC 6 NRRL 43489 DQ790572.1 DQ790528.1 DQ790484.1 Chang et al. (2006) FSSC 14 NRRL 22611 DQ094326.1 EU329518.1 DQ246841.1 Zhang et al. (2006) FSSC 13 NRRL 22586 EU329516.1 DQ094312.1 AF178353.1 O'Donnell et al. (2009) FSSC 17 NRRL 22157 EU329493.1 DQ094306.1 AF178359.1 O'Donnell et al. (2009) FSSC 10 NRRL 22153 EU329492.1 DQ094302.1 AF178346.1 O'Donnell et al. (2009) FSSC 32 NRRL 22570 EU329513.1 AF178422.1 AF178360.1 O'Donnell et al. (2009) FSSC 33 NRRL 22178 EU329498.1 DQ094313.1 AF178334.1 O'Donnell et al. (2009) F. ambrosium (FSSC 19) NRRL 20438 JX171584.1 DQ094315.1 AF178332.1 O'Donnell et al. (2009) F. ambrosium (FSSC 19) NRRL 22354 EU329504.1 DQ094316.1 AF178338.1 O'Donnell et al. (2009) FSSC 30 NRRL 22579 EU329515.1 AF178415.1 AF178352.1 O'Donnell et al. (2009) F. illudens NRRL 22090 JX171601.1 AF178393.1 AF178326.1 O'Donnell et al. (2009) F. staphyleae NRRL 22316 JX171609.1 AF178423.1 AF178361.1 O'Donnell et al. (2009) Etymology. Species epithet ershadii is selected in Growth rate on potato dextrose agar (PDA), 0.43 −1 honor of Prof. Djafar Ershad for his contribution to cmday ; c-d. Growth rate on synthetic nutrient agar mycology in Iran. Conidia 12–20 μm in length, thick-walled, 1–3 septate Fig. 2 Morphological properties of Fusarium ershadii (strain CBS oval, predominantly 1-septate oval (k-m & o), with little 115.40 and CBS 139505). a-b. Fast-growing 10-day old colony on distinction in size between micro and macroconidia. Reni- oatmeal agar (OA) front and back side, growth rate approx. 0.45 cmday-1; c-d. Ten-day old colony on potato dextrose agar (PDA) form microconidia rarely detected (m). Conidiophores front and back side, growth rate approx. 0.43 cmday-1; e-f. Ten- elongate(50–130μm), filiform,1–3septate,incorporating day old colony on synthetic nutrient agar (SNA) front and back microconidia-bearing terminal monophialides (i & j). side, growth rate approx. 0.43 cmday-1: the strain has covered the Chlamydospores smooth-walled (p-s) or verrucose- whole plate area with thin mycelium; g. Germinating microconidium (PDA 1000×, cotton-blue stained); h. Single verroculose (u), mostly intercalary, but also terminal. Sin- chlamydospore; i-j. Monophialidic conidiophores of aerial gular intercalary chlamydospores globose to subglobose mycelium; K-l. 1-septate oval Microconidia, (PDA 1000×, with or without supporting cells (4.5–7.5μmindiam)(h,q cotton-blue stained); m. 1-septate reniform microconidium; n. & r). Pairs (n) and clusters of 2–4 celled globose to pairs of chlamydospores; o. 1–3 septate oval microconidia; p-w various forms of chlamydospores; x. Chlamydospore formed on subglobose smooth-walled chlamydospores (4.5–7.5 μm microconidium. All scale bars 10 μm in diam) with (p-w) or without supporting cells (s). Culture characteristics- Colonies fast-growing, −1 growth rate on oatmeal agar (OA), 0.45 cmday ;a-b. Eur J Plant Pathol (2018) 151:689–701 697 698 Eur J Plant Pathol (2018) 151:689–701 Fig. 3 Phytopathogenicity of Fusarium ershadii strains on As- of the Musa acuminata with strains of Fusarium ershadii.The paragus officinalis (A, B, and C) and Musa acuminata (D and E). pathogenicity test after one (D1) and two weeks (D2), from right; Hollow root disease symptoms in Asparagus officinalis induced un-inoculated, inoculated with CBS 139505, and inoculated with by inoculation of Fusarium ershadii strains (un-inoculated; A1, CBS 115.40. Musa acuminata seedlings, from left; un-inoculated, B1, and C1, inoculated; A2, B2, and C2). Inoculation of the roots inoculated with CBS 139505, and inoculated with CBS 115.40 −1 (SNA) 0.43 cmday ; e-f. The strain has covered the seems to occur at least in North-America, Europe and Asia Petri dish with thin mycelium. Colonies attaining as a saprobe and as a pathogen. Here we have shown that 29 mm diam. in 7 d on PDA at 20 °C, 57 mm diam. at the new species is a strong pathogen on Asparagus 25 °C, 59 mm diam. at 28–30 °C, 22 mm diam. at 34 °C, officinalis and a weak pathogen on Musa acuminata. and 19 mm at 37 °C. Fungus did not grow at 5 and 40 °C Genealogical concordance phylogenetic species rec- and it became unviable at 42 °C. Incubating under an ognition (GCPSR) (Taylor et al. 2000) is based on the alternating day/night 12 h photoperiod. The fungus concordance of multiple gene genealogies. In this study grew at a broad range of pH (3.5–8.5), while the opti- three loci; EF-1α,RPB2,andITS,were used for mum growth occurred at pH values between 5.5 and 6.5. GCPSR analyses, singly and concatenated. The EF-1α and RPB2 fragments used have high levels of variation and are suitable barcodes for Fusarium (e.g. Al-Hatmi et al. 2016), while ITS is the general DNA barcode for Discussion fungi (Schoch et al. 2012), all three barcodes have the Fusarium ershadii forms a well-supported monophyletic benefit that public repositories like Genbank contain lineage within clade 9 of FSSC and can be distinguished large numbers of them for fungi of the genus Fusarium. from all other species in this group based on DNA se- Sequence analysis of the combined set of ITS, EF-1α quence comparisons and morphology. Fusarium ershadii and RPB2 showed similar results gained from each Eur J Plant Pathol (2018) 151:689–701 699 fragment individually. Besides, according to the se- pathogens not only of humans and other animals, but quence identity and average pairwise identity values also a diverse range of plants. Based on sequence anal- gained from the sequence analysis of EF-1α,RPB2, yses, several additional strains were identified in and ITS fragments, it can be inferred that the ITS frag- Genbank as members of F. ershadii. The origins of these ment has a significant resolution in FSSC and it is quite strains indicate a worldwide spread as saprobes and/or different from what is seen in other species complexes pathogens, as they include soil isolates from Sardinia, of Fusarium (Papizadeh et al. 2015 and Papizadeh et al. Italy (Balmas et al. 2010), a corn root isolate from 2016). Such a different resolution power of ITS frag- Illionois, USA (Zhang et al. 2006), and a Chinese isolate ment in FSSC conforms to the fact that FSSC forms a from sugar beet (Cao and Wu, unpublished results). basal clade in the genus Fusarium with a significant Fusarium ershadii also has a special niche causing phylogenic distance from the other clades of the genus. hollow root disease in Asparagus plants. It may have Additionally, although EF-1α fragment, as the most potential as a pathogen of other monocots such as ba- variable fragment in FSSC, is recommended as the first nana and maize. Formae speciales, specialized on cer- choice for species delimitation in FSSC, the comple- tain host crops in FSSC, are assumed to correspond to mentary effects of ITS and RPB-2 fragments should not biologically and phylogenetically distinct species be neglected, because they cause a higher robustness in (Coleman 2015), whereas within the Fusarium phylogeny studies which can be inferred from the boot- oxysporum species complex host specificity encoded strap and posterior probability values. on supernumerary chromosomes were found to have In general, the growth profile of F. ershadii seems to been horizontally exchanged between different lineages be similar to that of F. keratoplasticum (FSSC 2), and species (Baayen et al. 2000;Ma et al. 2013). F. petroliphilum (FSSC 1), and F. solani s.s. (FSSC 5) The Fusarium solani species complex is one of the (Short et al. 2013;Schroersetal. 2016). The optimum more basal clades within the genus Fusarium according temperature for growth of Fusarium ershadii is 28– to the concept of Geiser et al. (2013); or, following 30 °C, this temperature varies little in the described Lombard et al. (2015) the clade would be called clades of FSSC (Short et al. 2013). Besides, growth rate Neocosmospora (Lombard et al. 2015). The FSSC con- studies on a pH gradient of showed that Fusarium tain several members causing root rots and hollow roots ershadii can growwellinpHvaluesbetween 3.5 and and as Fusarium is the better known genus, we adhere to 8.5. However, the optimum pH was around 6 and a the first concept of a large monophyletic genus Fusar- higher growth rate was recorded in mildly alkaline pH ium and adhere to Fusarium ershadii for this new As- conditions (7.2–8.5) in comparison to mildly acidic pH paragus pathogen. values (4–5). While CBS 114.50 was first considered to be a close relative of F. lichenicola previously called Acknowledgements This work was performed at the Filamen- tous Fungi and Yeasts Collection, Microorganisms bank, IBRC Cylindrocarpon lichenicola (Summerbell and Schroers and CBS-KNAW Fungal Biodiversity Centre, cooperatively. 2002),F.ershadii proves to be closer to the type species Great thanks for generous guides of Richard C. Summerbell, of F. solani than to F. lichenicola (lineage 16). David M. Geiser and Kerry O’Donnell. Morphologically,formingadiverserangeofchlamydo- spores is a character which can be assumed as one of the Open Access This article is distributed under the terms of the main characteristics of FSSC. F. keratoplasticum and Creative Commons Attribution 4.0 International License (http:// F. petroliphilum have also been described with such chla- creativecommons.org/licenses/by/4.0/), which permits unrestrict- ed use, distribution, and reproduction in any medium, provided mydospores (Short et al. 2013). No sporodichia were de- you give appropriate credit to the original author(s) and the source, tected to compare the morphology of sporodochial conidia provide a link to the Creative Commons license, and indicate if of Fusarium ershadii to the other members of FSSC. changes were made. Interestingly, aerial conidia of F. ershadii were 12–20 μm in length which is shorter than those of F. keratoplasticum, F. falciforme, F. petroliphilum and F. solani s.s. However, References morphology and dimension of these conidia are highly similar to those of F. keratoplasticum. Al-Hatmi, A. M., van den Ende, A. H., Stielow, J. B., van Members of FSSC are cosmopolitan soil-borne hy- Diepeningen, A. D., Seifert, K. A., McCormick, W., phomycetes. These fusaria are also detected as Assabgui, R., Gräfenhan, T., de Hoog, G. S., & Levesque, 700 Eur J Plant Pathol (2018) 151:689–701 C. A. (2016). Evaluation of two novel barcodes for species Lombard, L., van der Merwe, N. A., Groenewald, J. Z., & Crous, recognition of opportunistic pathogens in Fusarium. Fungal P. W. (2015). Generic concepts in Nectriaceae. Studies in Biology, 120(2), 231–245. Mycology, 80,189–245. Baayen, R. P., O'Donnell, K., Bonants, P. J., Cigelnik, E., Kroon, Ma, L. J., Geiser, D. M., Proctor, R. H., Rooney, A. P., O'Donnell, L. P., Roebroeck, E. J., & Waalwijk, C. (2000). Gene K., Trail, F., Gardiner, D. M., Manners, J. M., & Kazan, K. Genealogies and AFLPAnalyses in the Fusarium oxysporum (2013). Fusarium pathogenomics. Annual Review of Complex Identify Monophyletic and Nonmonophyletic Microbiology, 67,399–416. Formae Speciales Causing Wilt and Rot Disease. McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y.M., Phytopathology, 90(8), 891–900. Buso, N., Cowley, A.P. & Lopez, R. (2013). Analysis tool web services from the EMBL-EBI. Nucleic Acids Research, Balmas, V., Migheli, Q., Scherm, B., Garau, P., O'Donnell, K., 41,597–600. Ceccherelli, G., Kang, S., & Geiser, D. M. (2010). Multilocus Migheli, Q., Balmas, V., Harak, H., Sanna, S., Scherm, B., Aoki, phylogenetics show high levels of endemic fusaria inhabiting T., & O'Donnell, K. (2010). Molecular phylogenetic diversity Sardinian soils (Tyrrhenian Islands). Mycologia, 102(4), of dermatologic and other human pathogenic fusarial isolates 803–812. from hospitals in northern and central Italy. Journal of Chang, D. C., Grant, G. B., O'Donnell, K., Wannemuehler, K. A., Clinical Microbiology, 48(4), 1076–1084. Noble-Wang, J., Rao, C. Y., Jacobson, L. M., Crowell, C. S., Miller, M.A., Pfeiffer, W., Schwartz, T., (2010). Creating the Sneed, R. S., Lewis, F. M., Schaffzin, J. K., Kainer, M. A., CIPRES Science Gateway for inference of large phylogenetic Genese, C. A., Alfonso, E. C., Jones, D. B., Srinivasan, A., trees in Proceedings of the Gateway Computing Fridkin, S. K., & Park, B. J. (2006). Multistate outbreak of Environments Workshop (GCE), 14 Nov. 2010, New Fusarium keratitis associated with use of a contact lens Orleans, LA. 1–8. solution. JAMA, 296(8), 953–963. Nylander, J.A.A. (2004) MrModeltest 2. Program distributed by Chehri, K. (2014). Molecular phylogeny of the Fusarium solani the author. Evolutionary Biology Centre. Uppsale: Uppsala species complex (FSSC) isolated from soils in Iran. Botany, Univ. AQ16 92(11), 815–820. O’Donnell, K., Kistler, H. C., Cigelnik, E. & Ploetz, R. C. (1998). Chehri, K. (2017). Molecular identification of entomopathogenic Multiple evolutionary origins of the fungus causing Panama Fusarium species associated with Tribolium species in stored disease of banana: concordant evidence from nuclear and grains. Journal of Invertebrate Pathology, 144,1–6. mitochondrial gene genealogies. Proceedings of the Coleman, J. J. (2015). The Fusarium solani species complex: National Academy of Sciences of the United States of ubiquitous pathogens of agricultural importance. Molecular America, 95,2044–2049. Plant Pathology. https://doi.org/10.1111/mpp.12289. O'Donnell, K., Sarver, B. A., Brandt, M., Chang, D. C., Noble- Debourgogne, A., Gueidan, C., de Hoog, S., Lozniewski, A., & Wang, J., Park, B. J., Sutton, D. A., Benjamin, L., Lindsley, Machouart, M. (2012). Comparison of two DNA sequence- M.,Padhye,A.,Geiser,D.M.,&Ward,T. J.(2007). based typing schemes for the Fusarium solani Species Phylogenetic diversity and microsphere array-based genotyp- Complex and proposal of a new consensus method. Journal ing of human pathogenic Fusaria, including isolates from the of Microbiological Methods, 91(1), 65–72. multistate contact lens-associated U.S. keratitis outbreaks of Elmer, W. H. (2015). Management of Fusarium crown and root rot 2005 and 2006. Journal of Clinical Microbiology, 45(7), of Asparagus. Crop Protection, 73,2–6. 2235–2248. Fisher, N. L., Burgess, L. W., Toussoun, T. A., & Nelson, P. E. O'Donnell, K., Sutton, D. A., Fothergill, A., McCarthy, D., (1982). Carnation leaves as a substrate and for preserving Rinaldi, M. G., Brandt, M. E., Zhang, N., & Geiser, D. M. cultures of Fusarium species. Phytopathology, 72,151–153. (2008). Molecular phylogenetic diversity, multilocus haplo- Geiser, D. M., Aoki, T., Bacon, C. W., et al. (2013). One Fungus, type nomenclature, and in vitro antifungal resistance within One Name: Defining the genus Fusarium in a scientifically the Fusarium solani species complex. Journal of Clinical robust way that preserves longstanding use. Phytopathology, Microbiology, 46(8), 2477–2490. 103,400–408. O'Donnell, K., Sutton, D. A., Rinaldi, M. G., Gueidan, C., Crous, Huelsenbeck, J. P., & Ronqvist, F. (2001). MrBayes: Bayesian P. W., & Geiser, D. M. (2009). Novel multilocus sequence inference of phylogeny. Bioinformatics, 17,754–755. typing scheme reveals high genetic diversity of human path- https://doi.org/10.1093/bioinformatics/17.8.754. ogenic members of the Fusarium incarnatum-F. equiseti and Hujslová, M., Kubátová, A., Kostovčík, M. & Kolařík, M. (2013). F. chlamydosporum species complexes within the United Acidiella bohemica gen. et sp. nov. and Acidomyces spp. States. Journal of Clinical Microbiology, 47(12), 3851–3861. (Teratosphaeriaceae), the indigenous inhabitants of extremely O'Donnell, K., Sutton, D. A., Rinaldi, M. G., Sarver, B. A., acidic soils in Europe. Fungal Diversity, 58,33–45. Balajee, S. A., Schroers, H. J., Summerbell, R. C., Robert, Katoh, K., Asimenos, G. & Toh, H. (2009). Bioinformatics for V. A., Crous, P. W., Zhang, N., Aoki, T., Jung, K., Park, J., DNA sequence analysis. In Posada, D. (Ed.) Bioinformatics Lee, Y. H., Kang, S., Park, B., & Geiser, D. M. (2010). for DNA sequence analysis, methods in molecular biology, Internet-accessible DNA sequence database for identifying Methods in Molecular Biology (pp. 39–64). Totowa, NJ: fusaria from human and animal infections. Journal of Humana Press, Springer. Clinical Microbiology, 48(10), 3708–3718. Kumar, S., Stecher, G. & Tamura, K. (2016). MEGA7: Molecular O'Donnell, K., Humber, R. A., Geiser, D. M., Kang, S., Park, B., Evolutionary Genetics Analysis version 7.0 for bigger Robert, V. A., Crous, P. W., Johnston, P. R., Aoki, T., Rooney, datasets. Molecular Biology and Evolution, 33(7), 1870– A. P., & Rehner, S. A. (2012). Phylogenetic diversity of 1874. insecticolous fusaria inferred from multilocus DNA sequence Eur J Plant Pathol (2018) 151:689–701 701 data and their molecular identification via FUSARIUM-ID Schroers, H. J., Samuels, G. J., Zhang, N., Short, D. P. G., Juba, J. and Fusarium MLST. Mycologia, 104(2), 427–445. H., & Geiser, D. M. (2016). Epitypification of Fusisporium (Fusarium) solani and its assignment to a common phyloge- Papizadeh, M., Soudi, M. R., Amoozegar, M. A., & Shazadeh netic species in the Fusarium solani species complex. Fazeli, S. A. (2015). A Comparative Analysis on ITS, RPB-2 Mycologia. https://doi.org/10.3852/15-255. and EF1α Fragments, Aiming Species Delimitation in Selbmann, L., de Hoog, G.S., Zucconi, L., Isola, D., Ruisi, S., Fusarium Solani Species Complex (FSSC). Current Gerrits, A.H.G., Ende, V.A., Ruibal, C., De Leo, F., Urzì, C. Medical Mycology., 1(S1), 33. & Onofri, S. (2008). Drought meets acid: three new genera in Papizadeh, M., Zamanizadeh, H. R., Zabihi, S. S., Soudi, M. R., a dothidealean clade of extremotolerant fungi. Studies in Amoozegar, M. A., & Shahzadeh Fazeli, S. A. (2016). Mycology, 61,1–20. Highlighted by GCPSR studies: is Fusarium solani a Short, D. P., O'Donnell, K., Zhang, N., Juba, J. H., & Geiser, D. M. Fusarium yet? Iranian Plant Protection Congress., 22,138. (2011). Widespread occurrence of diverse human pathogenic Papizadeh, M., Roayaei Ardakani, M., & Motamedi, H. (2017a). typesofthe fungus Fusarium detected in plumbing drains. Growth-phase dependent biodesulfurization of JournalofClinicalMicrobiology, 49(12), 4264–4272. dibenzothiophene by Enterobacter sp. strain NISOC-03. Short, D. P., O'Donnell, K., Thrane, U., Nielsen, K. F., Zhang, N., Pollution., 3,101–111. Juba, J. H., & Geiser, D. M. (2013). Phylogenetic relation- Papizadeh, M., Soudi, M. R., Amini, L., Wijayawardene, N. N., & ships among members of the Fusarium solani species com- Hyde, K. D. (2017b). Pyrenochaetopsis tabarestanensis plex in human infections and the descriptions of (Cucurbitariaceae, Pleosporales), a new species isolated from F. keratoplasticum sp. nov.and F. petroliphilum stat. nov. rice farms in north Iran. Phytotaxa., 297(1), 15–28. Fungal Genetics and Biology, 53,59–70. Rambaut, A. (2008) FigTree v1.1.1: Tree figure drawing tool. Short, D. P., O'Donnell, K., & Geiser, D. M. (2014). Clonality, Available: http://tree.bio.ed.ac.uk/software /figtree/. recombination, and hybridization in the plumbing-inhabiting Accessed 20 June 2008. human pathogen Fusarium keratoplasticum inferred from Rambaut A, Drummond AJ. (2009). Tracer v1.5. Available from multilocus sequencetyping. BMC Evolutionary Biology, 14,91. http://beast.bio.ed.ac.uk/Tracer. Summerbell, R. C., & Schroers, H. J. (2002). Analysis of phylo- Saba, F., Papizadeh, M., Khansha, J., Sedghi, M., Rasooli, M., genetic relationship of Cylindrocarpon lichenicola and Amoozegar, M. A., Soudi, M. R., & Shahzadeh Fazeli, S. A. Acremonium falciforme to the Fusarium solani species com- (2016). A rapid and reproducible genomic DNA extraction plex and a review of similarities in the spectrum of opportu- protocol for sequence-based identifications of archaea, bac- nistic infections caused by these fungi. Journal of Clinical teria, cyanobacteria, diatoms, fungi, and green algae. Journal Microbiology, 40(8), 2866–2875. of Medical Bacteriology., 5(3–4), 22–28. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Salah, H., Al-Hatmi, A. M., Theelen, B., Abukamar, M., Hashim, Kumar, S. (2011). MEGA5: Molecular evolutionary genetics S., van Diepeningen, A. D., Lass-Florl, C., Boekhout, T., analysis using maxi-mum likelihood, evolutionary distance, Almaslamani, M., & Taj-Aldeen, S. J. (2015). Phylogenetic and maximum parsimony methods. Molecular Biology and diversity of human pathogenic Fusarium and emergence of Evolution, 28,2731–2739. uncommon virulent species. Journal of Infection., 15(63– Taylor, J. W., Jacobson, D. J., Kroken, S., Kasuga, T., Geiser, D. 4453), 00264 –00269. https://doi.org/10.1016/j. M., Hibbett, D. S., & Fisher, M. C. (2000). Phylogenetic jinf.2015.08.011. species recognition and species concepts in fungi. Fungal Sandoval-Denis, M., Guarnaccia, V., Polizzi, G., & Crous, P. W. Genetics and Biology, 31(1), 21–32. (2018). Symptomatic Citrus trees reveal a new pathogenic van Diepeningen, A. D., Al-Hatmi, A. M. S., Brankovics, B., & de lineage in Fusarium and two new Neocosmospora species. Hoog, G. S. (2014). Taxonomy and Clinical Spectra of Persoonia, 40,1–25. Fusarium Species: Where Do We Stand in 2014? Current Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., Spouge, J. Clinical Microbiology Reports, 1,10–18. L., Levesque, C. A., Chen, W., & Fungal Barcoding Zhang, N., O'Donnell, K., Sutton, D. A., Nalim, F. A., Summerbell, Consortium. (2012). Nuclear ribosomal internal transcribed R. C., Padhye, A. A., & Geiser, D. M. (2006). Members of the spacer (ITS) region as a universal DNA barcode marker for Fusarium solani species complex that cause infections in both Fungi. Proceedings of the National Academy of Sciences humans andplants are commoninthe environment. Journal of (PNAS), 109(16), 6241–6246. Clinical Microbiology, 44(6), 2186–2190. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png European Journal of Plant Pathology Springer Journals

Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata

Free
13 pages

Loading next page...
 
/lp/springer_journal/fusarium-ershadii-sp-nov-a-pathogen-on-asparagus-officinalis-and-musa-AELF9y0zr9
Publisher
Springer Netherlands
Copyright
Copyright © 2018 by The Author(s)
Subject
Life Sciences; Plant Pathology; Plant Sciences; Ecology; Agriculture; Life Sciences, general
ISSN
0929-1873
eISSN
1573-8469
D.O.I.
10.1007/s10658-017-1403-6
Publisher site
See Article on Publisher Site

Abstract

Eur J Plant Pathol (2018) 151:689–701 https://doi.org/10.1007/s10658-017-1403-6 Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata Moslem Papizadeh & Anne D. van Diepeningen & Hamid Reza Zamanizadeh & Farkhondeh Saba & Hossein Ramezani Accepted: 14 December 2017 /Published online: 15 January 2018 The Author(s) 2018. This article is an open access publication Abstract Two Fusarium strains, isolated from Aspara- weeks in Asparagus officinalis seedlings. In comparison gus in Italy and Musa in Vietnam respectively, proved to mild disease symptoms were observed by the same be members of an undescribed clade within the Fusar- strains on Musa acuminata seedlings. ium solani species complex based on phylogenetic spe- cies recognition on ITS, partial RPB2 and EF-1α gene Keywords Fusarium solani species complex fragments. Macro- and micro-morphological investiga- Asparagus officinalis pathogen Musa acuminata tions followed with physiological studies done on this pathogen new species: Fusarium ershadii sp. nov can be distin- guished by its conidial morphology. Both isolates of Fusarium ershadii were shown to be pathogenic to the Introduction monocot Asparagus officinalis when inoculated on roots and induced hollow root symptoms within two Fusiform or banana-shaped multicelled conidia are proba- bly the best known characteristic of the large Ascomycete genus Fusarium.Withinthegenuswefindmanyplant M. Papizadeh F. Saba pathogens, saprobes, mycotoxin producers, and an in- Microorganisms Bank, Iranian Biological Resource Center (IBRC), Academic Center for Education, Culture and Research creasing number of human pathogens (e.g. Salah et al. (ACECR), Tehran, Iran 2015; van Diepeningen et al. 2014). For a long time, sections were recognized within the genus based on mor- A. D. van Diepeningen phological characters. Nowadays, subdivisions within Fu- CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584CT, Utrecht, The Netherlands sariumaremadeinspeciescomplexesconsistingofsibling species with limited to no morphological variation, which A. D. van Diepeningen (*) can be best discriminated based on sequence data. A plea BU Biointeractions and Plant Health, Wageningen University and has been made to keep most of the Fusarium species Research, Droevendaalsesteeg 1, 6708PB, Wageningen, The Netherlands complexes of these agriculturally and for human health e-mail: anne.vandiepeningen@wur.nl important species under the well-known genus denomina- tor Fusarium rather than splitting the genus in nine or more H. R. Zamanizadeh different genera (Geiser et al. 2013). Department of Plant Pathology, College of Agriculture, Science and Research Branch, Islamic Azad University, Tehran, Iran One of the more basal clades within the genus Fu- sarium according to Geiser et al. (2013)isthe Fusari- H. Ramezani um solani species complex (FSSC), centered on recent- Plants Bank, Iranian Biological Resource Center (IBRC), ly epitypified Fusarium solani (Schroers et al. 2016). Academic Center for Education, Culture and Research (ACECR), Tehran, Iran However, Lombard et al. (2015) revisited various 690 Eur J Plant Pathol (2018) 151:689–701 genera of Nectriaceae and suggested renaming the Materials and methods Fusarium solani species complex as Neocosmospora (Lombard et al. 2015), but we prefer to use Geiser’s Macroscopic and microscopic morphology proposal for a large Fusarium genus including virtually all Fusarium species of importance in plant pathology, Morphological characteristics and growth rates were medical mycology, mycotoxicology and basic re- studied on potato dextrose agar (PDA), synthetic nutri- search, and thus better recognized (Geiser et al. ent agar (SNA), and carnation leaf agar (CLA). Digital 2013). Members of FSSC are capable of causing dis- images of the colonies were documented and studied ease on many agricultural important crops – often foot after 7 days of incubation at 25 °C, with and without UV and root rots - and are the most commonly observed (longer incubation up to a month was considered if etiological agents of human fusarioses (Coleman 2015; needed). Inoculations were performed using a dense O'Donnell et al. 2008). inoculum stock which was prepared from a 10-day-old Within the plant pathogenic fusaria it is common to colony on CLA medium. Macroscopic properties were talk about formae speciales describing the host plant studied on 10-day-old colonies. Slide cultures were species of an isolate. Host-specific virulence factors that mounted in a droplet of lactic acid or water to be studied determine the host or host range are usually located on with an Olympus BX51 microscope equipped with a dispensable supernumerary chromosomes. Within the DP25 digital imaging camera. Size of various structures Fusarium oxysporum species complex, host specificity was determined by averaging the measurements of 25– and these supernumerary chromosomes were found to 30 samples of each structure (Short et al. 2013). have been horizontally exchanged between different lineages and species (Baayen et al. 2000; Ma et al. Growth rates 2013). However, formae speciales in FSSC seem to correspond to biologically and phylogenetically distinct Single conidia of isolates, grown on Carnation Leaf Agar species (Coleman 2015). (CLA) (Fisher et al. 1982), were transferred to the center of Based on multi-locus sequence analyses of core 8.5 cm Potato Dextrose Agar (PDA) and Oatmeal agar genome genes and regions, dozens of different phy- (OA) plates and incubated in growth chambers at 25 °C logenetic lineages within the FSSC can be recognized and30°C. After72h,colonydiameters weremeasured (O'Donnelletal. 2008;Short et al. 2013; Zhang et al. using a ruler and the average growth rate per isolates was 2006). Slowly, more of these lineages are described calculated and expressed as colony growth rate per 24 h. with Latin binomials and/or with more data regarding Additionally, cardinal growth temperatures were deter- their ecological niches are published. Examples are mined on PDA plates that were mid-point inoculated and the recent description of Fusarium petroliphilum incubated at 5, 10, 15, 20, 25, 28, 30, 34, 37 and 40 °C for (FSSC clade-1) and F. keratoplasticum (FSSC clade 7 days and any hyphal growth was studied under the light −2) (Short et al. 2013) and the epitypification of the microscope (objective lenses 4X and 10X). The colony potato dry rot pathogen F. solani sensu stricto diameter was measured after 7 days (Hujslová et al. 2013; (FSSC-clade-5) (Schroers et al. 2016). Fusarium Selbmann et al. 2008). keratoplasticum, a common inhabitant of soil, drain- Also, PDA and MEA media of different acidity age systems and other antropogenic substrates, was (pH 3–8.5) were prepared in duplicate using a 2 M stock recently suggested to be recombining, potentially solution of HCl or NaOH (Hujslová et al. 2013; even via heterothallic sex (Short et al. 2013;Short Selbmann et al. 2008). Plates were inoculated (single- and O'Donnell 2014). A remarkable finding as ‘Fu- point) and incubated at 28 °C for 10 days and diameter sarium solani´ is generally considered homothallic or of the colonies was measured (Hujslová et al. 2013; asexual (O'Donnell et al. 2008). Selbmann et al. 2008). In this paper we describe a new species within FSSC that also forms a monophyletic clade based on multiple Primers for molecular identification and phylogenetic loci. The strains were isolated from the monocots aspar- analysis agus and banana and proved especially pathogenic on the first host. The new species was characterized mor- Primers ITS1 (TCCGTAGGTGAACCTGCGG) and phologically and phylogenetically. ITS4 (TCCTCCGCTTATTGATATGC) were used to Eur J Plant Pathol (2018) 151:689–701 691 amplify the ITS fragment (approximately 600 bp), primers UsingtheMEGAv.7.0.9package,sequenceswerealigned EF1 (ATGGGTAAGGARGACAAGAC) and EF2 withsequencesobtainedfromtheonlinedatabasesofCBS, (GGARGTACCAGTSATCATGTT) were used to amplify NBRC, and GenBank (http://www.ncbi.nlm.nih.gov/). a nearly 720 bp fragment of the coding gene for EF-1α, According to the results gained from the similarity primers RPB2-5F (GAYGAYMGWGATCAYTTYGG) assessments (CBS, Fusarium MLST, and NCBI), and RPB2-7R (CCCATWGCYTGCTTMCCCAT) were sequences were aligned with the multiple sequence used to amplify a nearly 1200 bp fragment of the coding alignment tool; Multiple sequence Alignment using Fast gene for RPB2 (Geiser et al. 2013,; O'Donnell et al. 2007, Fourier Transform (MAFFT), available at the European O'Donnell et al. 2008.;Shortetal. 2011; Zhang et al. Bioinformatics Institute (EMBL-EBI) (Katoh et al. 2009, 2006). McWilliam et al. 2013). Alignments were manually im- proved in MEGA v. 7.0.9 and Bioedit v. 7.0.5.3 packages DNA extraction and polymerase chain reaction (default settings) (Tamura et al. 2011; Kumar et al. 2016). The flanking regions were excluded from the analysis. The DNAwas extracted using a manual purification proce- alignments were checked visually and finally the resulting dure as described (Papizadeh et al. 2017a,; Saba et al. multiple sequence alignments were used for phylogenetic 2016). All the PCR amplifications were performed in a assessments. Concatenated multi-locus sequence align- MyCycler™ thermal cycler system (BIORAD, USA). ments were prepared with the BioEdit 7.0.5.3 package. The 50 μl PCR mixtures were prepared with 1 μl DNA Phylogenetic trees were rooted with Fusarium staphyleae suspension, 5 μl of PCR buffer (Fermentas), 10 mmol strain NRRL 22316. Phylogenetic analyses were per- of dNTPs, 2.5 mM MgSO4, and 10 pmole of each of the formed for each dataset as well as with combined align- primers, 5 U of PFU DNA polymerase, 0.5 μlofabso- ments consisting of ITS, EF-1α, and RPB2 regions. lute DMSO, and appropriate volume of DDW. A hot- The online tool Findmodel (http://www.hiv.lanl. start procedure (3 min, 94 °C) was used before the gov/content/sequence/findmodel/findmodel. html) was enzyme addition to prevent nonspecific annealing of used to determine the best nucleotide substitution model. the primers. All the PCR reactions for amplification of Maximumlikelihood(ML)distanceanalysiswasconduct- the ITS, and EF-1α fragments entailed 35 cycles (94 °C ed with the MEGA v. 7.0.9 package (Tamura et al. 2011) for 45 s, 56 °C for ITS [50 °C for EF-1α] for 50 s, 72 °C with the GTR + GAMMA substitution models. The ro- for 95 s, plus one additional cycle with a final 7 min bustness of the trees was evaluated by 1000 bootstrap chain elongation). For amplification of the selected replications. Bayesian analyses were conducted with fragment of the RPB2 gene the PCR conditions includ- MrBayes v3.2.1 (Huelsenbeck and Ronqvist 2001)exe- ed: (1) hot start with 95 °C for 5 min; (2) 30 cycles of cuted on XSEDE (Extreme Science and Engineering Dis- 1 min at 95 °C, 2 min at 55 °C (or 50 °C), an increase of covery Environment) through the CIPRES Science Gate- 1°C/5sto72°C,and2minat 72°C;and(3)a10-min wayv3.3(Milleretal. 2010) in two parallel runs, using the incubation at 72 °C, respectively. The PCR products default settings but with these adjustments: general time were sequenced by Genfanavaran Biotech Corporation reversible (GTR) model of DNA substitution as the best fit (O’Donnell et al. 2007). The DNA sequences deter- and a gamma distribution rate variation across sites mined for this study were submitted to GenBank, and (HuelsenbeckandRonqvist2001).Thismodelwaschosen the accession numbers for strain CBS 115.40 = IBRC- astheresultfromapretestwithMrModeltest2.2(Nylander M 30232 are: KX503270 (RPB2), KX503269 (EF- 2004). After this was determined, the GTR + I + G model, 1α), KX503267 (ITS). The accession numbers for as the best nucleotide substitution model, was used for the strain CBS 139505 = IBRC-M 30096 KX503268 combined ITS, EF-1α,andRPB2dataset, andaMCMC (ITS). heated chain was set with a temperature value of 0.05. The number of chains, number of generations, and sample Sequence analysis frequencies were set respectively at 4, 50,000,000, and 1000. Chain convergence was determined using Tracer Each of the DNA fragments was sequenced on both direc- v1.5 (http://tree.bio.ed.ac.uk/software/tracer/)toconfirm tions using the same primers which were used for PCR sufficiently large ESS values (>200). The sampled trees amplification. Sequences were assembled and edited with weresubsequentlysummarizedafteromittingthefirst25% a trial version of Geneious software (www.geneious.com). of trees as burn-in using the Bsump^ and Bsumt^ 692 Eur J Plant Pathol (2018) 151:689–701 commands implemented in MrBayes (Rambaut and morphology and in multi-locus sequence analyses and Drummond 2009). Trees were visualized and edited using we describe them here as Fusarium ershadii. FigTreev1.4.2 (Rambaut2008). Theconcatenated aligned Morphological features of F. ershadii are shown in dataset for ITS, EF-1α and RPB2 used in the analysis has Table 1 and Fig. 2. Strains of F. ershadii,likeother been submitted with the TreeBASE under the submission members of FSSC have septate, filiform conidiophores ID 21561 (Papizadeh et al. 2017b). incorporating microconidia-bearing terminal monophialides. Although true macroconidia, character- Phytopathogenicity tests istic of FSSC members, were not detected in dark nor under UV, some conidia, around 20 μm inlengthand 3- Strains of Fusarium ershadii (CBS 115.40 and CBS septate, were observed which may be assumed to be 139505) were grown on PDA for a week, the surface of macroconidia (e.g. Fig 2 g and o). Chlamydospores the medium was removed using a sterile scalpel, and the were formed (e.g. Fig 2 s and t), sometimes directly mycelial material was added to 25 ml of sterile 0.05% from the mostly 1-septate conidia. tween80 solution. The suspension was vortexed for Strains (CBS 115.40 and CBS 139505) showed the 20 min and then filtered through sterile cotton cloth to same macro- and micromorphology on agar plates with remove hyphae. Thereafter, conidia were counted using a little to no pigmentation on the used media. Morpholog- haemocytometer and a suspension with an approximate ical characters are summarized in the species descrip- density of 1.2 × 10 /ml was prepared. Roots of 11 months tions (Fig. 2). No growth was detected on MEA medium old Asparagus officinalis (Accession IBRC P1006759 of at 5 °C. Hence, 10 °C was recorded as the lowest the Iranian Biological Reference Centre) seedlings, grown temperature that the strains could grow. The strains did in greenhouse (25 °C and 12-h photoperiod), were washed not grow at 40 °C and after a period at temperatures of 42 °C or higher they lost viability and were unable to in sterile water. Then, the roots of different seedlings were inoculated by immersion for a minute in the suspension of grow at growth-permitting temperatures. The optimum the conidia of strains CBS 115.40 and IBRC-M 30096, temperature for growth was between 28 and 30 °C. The respectively. All tests were done in triplicate. Triplicate un- optimum pH value for growth was 6 (Table 1). inoculated seedlings were used as control. Finally, all the seedlings were potted in sterilized-soil. Pots were incubat- Molecular Identification and phylogenetic analysis edin a quarantined space in thegreenhouse forthree weeks and were examined and photographed in 3-day intervals. Sequences of three loci, EF-1α, RPB2, and ITS frag- The same procedure was performed on two months old ments, of Fusarium ershadii were studied in combina- Musa acuminata (IBRC P1011416) seedlings produced tion with sequences of FSSC isolates already available by tissue culture. in the Fusarium MLST and GenBank databases (Fig. 1). The sequence identity in EF-1α fragments of 110 strains Results Table 1 Growth profile of Fusarium ershadii Phenotypic characterization pH Colony Diam. (mm) Temp. Colony Diam. (mm) Strain CBS 115.40 was isolated by Bugnicourt in 1936 3 No growth 5 No growth from Musa sapientum in Tonkin, Vietnam and was de- 3.5 12 10 7 posited in the CBS collection in 1940. The strain used to 429 15 28 bethetypestrainofCylindrocarpontonkinense,arelative 546 20 39 of Cylindrocarpon lichenicola. In 2002, Summerbell and 5.5 56 25 57 Schroers showed that C. lichenicola falls within the 658 28 59 FSSC, while it was noted that CBS 115.40 was a clearly 757 30 59 distinct species also within the same Fusarium solani 7.2 56 34 22 species complex (Summerbell and Schroers 2002). More 852 37 19 recently CBS 139505 was isolated from diseased 8.5 43 40 No growth Aspagarus in Italy. Both strains proved to match in Eur J Plant Pathol (2018) 151:689–701 693 belonging to FSSC was about 56% (pairwise identity and the formation of empty areas void of plant material. ~95%). For the ITS fragment sequence identity was These symptoms are comparable to the symptoms of around 64–68% (pairwise identity ~96.5%) and for Fusarium crown and root rot in asparagus, normally RPB2 fragment 70–71% (pairwise identity ~97.5%). attributed to Fusarium oxysporum f.sp. asparagi, Phylogenies performed on the combined set of ITS, F. proliferatum, unspecified F. solani,and F. redolens EF-1α and RPB2 fragments and individual fragments (Elmer 2015). In comparison, inoculation of roots of resulted similar tree topologies. The analyses placed banana plants (Musa acuminata IBRC P1011416) with F. ershadii into a distinct clade (MLST group FSSC the same strains, resulted in a reduced growth but not to 9c) (Fig. 1). As is shown in Fig. 1, the posterior proba- the level that was seen on Asparagus plants (Fig. 3d-e). bility support for the F. ershadii clade was 0.9992/97% ML bootstrap value. The remainder of the tree was similar to that described for the FSSC (O’Donnell Taxonomy et al. 1998)(Table 2). Fusarium ershadii Papizadeh, van Diepeningen, & Phytopathogenicity Zamanizadeh, sp. nov. (Figs. 1 and 2). Mycobank: MB 817602. We tested our two strains for pathogenicity on the two Type: Vietnam, Tonkin, isolated from Musa host plants they were isolated from. The same pathologic sapientum, 1936, collected by F. Bugnicourt. (holotype: results were seen on the triplicate inoculated plants of IBRC-H 2025, a dried culture) [Ex-type: CBS T T Asparagus officinalis and Musa acuminata.Our 115.40 =IBRC-M30232 preserved in a metabolically phytopathogenicity tests showed that the inoculation of inactive state (cryopreserved)]. roots of Asparagus plants (Asparagus officinalis IBRC Additional strain: CBS 139505 = IBRC-M 30096. P1006759) with strains CBS 139505 and CBS 115.40 led Sequences from ex-type culture, CBS 115.40: ITS to a severely reduced growth within 10 days (Figure. 3). (KX503267), EF-1α (KX503269), RPB2 (KX503270) Furthermore, the roots showed clearly ‘hollow root’-like and from strain CBS 139505 = IBRC-M 30096: ITS symptoms with strong pigmentation within root tissues (KX503268). Fig. 1 Phylogenetic relationships with maximum likelihood and In blocks species with latin binomials are indicated, but the ma- Bayesian inference methods under the GTR + I + G model of jority of clades within FSSC do not have them yet. Clade 9c; evolution between Fusarium ershadii and the other members of Fusarium ershadii, Clade 5; Fusarium solani senso stricto, Clade FSSC based on the concatenated data of EF1-α, ITS and RPB2 2; F. keratoplasticum,Clade1; F. Petroliphylum. As outgroup (ML tree shown). At the branch tips the strain identifiers are given. Fusarium staphyleae NRRL 22316 was used 694 Eur J Plant Pathol (2018) 151:689–701 Table 2 Strains and sequences used in this study Species complexes of Fusarium Strain number Sequence Accession Numbers Reference RPB2 ITS EF1-α Fusarium ershadii (9c) CBS 115.40 KX503270.1 KX503267.1 KX503269.1 This study Fusarium ershadii (9c) CBS 139505 KX503268.1 This study Fusarium ershadii (9c) NRRL 46676 GU250731.1 GU250669.1 GU250546.1 Balmas et al. (2010) FSSC 9b NRRL 46615 GU250728.1 GU250666.1 GU250543.1 Balmas et al. (2010) FSSC 9d FRC S-2484 JN235906.1 JN235291.1 JN235721.1 Short et al. (2011) FSSC 9d FRC S-2542 JN235907.1 JN235292.1 JN235722.1 Short et al. (2011) FSSC 9d FRC S-2543 JN235908.1 JN235293.1 JN235723.1 Short et al. (2011) FSSC 9a FRC S-2519 JN235911.1 JN235296.1 JN235726.1 Short et al. (2011) FSSC 9a FRC S-2485 JN235909.1 JN235294.1 JN235724.1 Short et al. (2011) FSSC 9a FRC S-2491 JN235912.1 JN235297.1 JN235727.1 Short et al. (2011) FSSC 9a FRC S-2530 JN235910.1 JN235295.1 JN235725.1 Short et al. (2011) FSSC 9a FRC S-2531 JN235913.1 JN235298.1 JN235728.1 Short et al. (2011) FSSC 9a NRRL 32755 HM347159.1 DQ094534.1 DQ247073.1 Zhang et al. (2006) FSSC 9a NRRL 43811 EF470092.1 EF453204.1 EF453053.1 O'Donnell et al. (2007) FSSC 9e CBS 222.49 JX435259.1 JX435209.1 JX435159.1 Debourgogne et al. (2012) FSSC 9e FRC S-2540 JN235914.1 JN235299.1 JN235729.1 Short et al. (2011) FSSC 9e FRC S-2541 JN235915.1 JN235300.1 JN235730.1 Short et al. (2011) FSSC 5 FRC S-2446 JN235917.1 JN235302.1 JN235732.1 Short et al. (2011) FSSC 5 FRC S-2538 JN235942.1 JN235327.1 JN235757.1 Short et al. (2011) FSSC 5 CBS 131775 JX237778.1 JX162380.1 JX118990.1 Zhang et al. (2006) FSSC 5 NRRL 28679 EU329556.1 DQ094385.1 DQ246912.1 Zhang et al. (2006) FSSC 5 NRRL 43468 EF469980.1 EF453093.1 EF452941.1 O'Donnell et al. (2007) FSSC 5 NRRL 22779 EU329526.1 DQ094333.1 DQ246848.1 Zhang et al. (2006) FSSC 5 NRRL 32810 EU329624.1 DQ094577.1 DQ247118.1 Zhang et al. (2006) FSSC 5 NRRL 25083 JF740882.1 JF741044.1 JF740714.1 O'Donnell et al. (2012) FSSC 5 NRRL 44896 GU170584.1 GU170639.1 GU170619.1 Migheli et al. (2010) FSSC 5 NRRL 22783 EU329529.1 DQ094335.1 DQ246851.1 O'Donnell et al. (2007) FSSC 5 NRRL 43527 EF470003.1 EF453116.1 EF452964.1 O'Donnell et al. (2007) FSSC 5 NRRL 25388 EU329535.1 DQ094341.1 DQ246858.1 Zhang et al. (2006) FSSC 22 NRRL 22163 EU329496.1 AF178394.1 AF178328.1 O'Donnell et al. (2008) FSSC 23 NRRL 22400 EU329509.1 DQ094303.1 AF178343.1 O'Donnell et al. (2008) FSSC 34 NRRL 46703 EU329661.1 EU329712.1 HM347126.1 O'Donnell et al. (2010) F. keratoplasticum (FSSC 2) FRC S-2427 JN235885.1 JN235270.1 JN235700.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2374 JN235767.1 JN235152.1 JN235582.1 Short et al. (2011) F. keratoplasticum (FSSC 2) NRRL 28014 EF470139.1 DQ094354.1 DQ246872.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43649 EU329639.1 EF453132.1 EF452980.1 O'Donnell et al. (2007) F. keratoplasticum (FSSC 2) FRC S-2407 JN235898.1 JN235283.1 JN235713.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2477 JN235897.1 JN235282.1 JN235712.1 Short et al. (2011) F. keratoplasticum (FSSC 2) NRRL 22641 EU329521.1 DQ094328.1 DQ246843.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 22645 EU329523.1 DQ094330.1 DQ246845.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 52715 JF741123.1 JF740912.1 JF740797.1 O'Donnell et al. (2012) Eur J Plant Pathol (2018) 151:689–701 695 Table 2 (continued) Species complexes of Fusarium Strain number Sequence Accession Numbers Reference RPB2 ITS EF1-α F. keratoplasticum (FSSC 2) NRRL 32711 EU329597.1 DQ094493.1 DQ247031.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43373 EF469959.1 EF453072.1 EF452920.1 O'Donnell et al. (2007) F. keratoplasticum (FSSC 2) NRRL 32780 EU329617.1 DQ094551.1 DQ247090.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32959 EU329634.1 DQ094632.1 DQ247178.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 22640 EU329520.1 DQ094327.1 DQ246842.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 46437 GU170588.1 GU170643.1 GU170623.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 46438 GU170589.1 GU170644.1 GU170624.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 22661 EU329524.1 DQ094331.1 DQ246846.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 22791 EU329530.1 DQ094337.1 DQ246853.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 28561 EU329552.1 DQ094375.1 DQ246902.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 25391 EU329536.1 DQ094343.1 DQ246860.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 28550 EU329547.1 DQ094365.1 DQ246891.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32862 EU329631.1 DQ094621.1 DQ247167.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 53132 GU170598.1 GU170654.1 GU170634.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 31165 EU329562.1 DQ094394.1 DQ246921.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 46443 GU170591.1 GU170646.1 GU170626.1 Migheli et al. (2010) F. keratoplasticum (FSSC 2) NRRL 32707 EU329595.1 DQ094490.1 DQ247027.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32710 EU329596.1 DQ094492.1 DQ247030.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 32838 EU329627.1 EU329681.1 DQ247144.1 Zhang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43433 DQ790561.1 DQ790517.1 DQ790473.1 Chang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43458 EF470172.1 EU329686.1 DQ790511.1 Chang et al. (2006) F. keratoplasticum (FSSC 2) NRRL 43490 DQ790573.1 DQ790529.1 DQ790485.1 Chang et al. (2006) F. keratoplasticum (FSSC 2) FRC S-2394 JN235887.1 JN235272.1 JN235702.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2478 JN235888.1 JN235273.1 JN235703.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2496 JN235891.1 JN235276.1 JN235706.1 Short et al. (2011) (FSSC 2) FRC S-2552 JN235846.1 JN235231.1 JN235661.1 Short et al. (2011) F. keratoplasticum F. keratoplasticum (FSSC 2) FRC S-2369 JN235758.1 JN235143.1 JN235573.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2411 JN235772.1 JN235157.1 JN235587.1 Short et al. (2011) F. keratoplasticum (FSSC 2) NRRL 52704 JF741112.1 JF740908.1 JF740786.1 O'Donnell et al. (2012) F. keratoplasticum (FSSC 2) FRC S-2509 JN235788.1 JN235173.1 JN235603.1 Short et al. (2011) F. keratoplasticum (FSSC 2) FRC S-2406 JN235789.1 JN235174.1 JN235604.1 Short et al. (2011) F. striatum (FSSC 21) NRRL 22101 EU329490.1 AF178398.1 AF178333.1 Chehri (2014) F. petroliphilum (FSSC 1) FRC S-2383 JN235858.1 JN235243.1 JN235673.1 Short et al. (2011) F. petroliphilum (FSSC 1) FRC S-2522 JN235921.1 JN235306.1 JN235736.1 Short et al. (2011) F. petroliphilum (FSSC 1) NRRL 32304 EU329568.1 DQ094402.1 DQ246932.1 Zhang et al. (2006) F. petroliphilum (FSSC 1) FRC S-2536 JN235937.1 JN235322.1 JN235752.1 Short et al. (2011) F. petroliphilum (FSSC 1) FRC S-2462 JN235938.1 JN235323.1 JN235753.1 Short et al. (2011) F. petroliphilum (FSSC 1) NRRL 46440 GU170590.1 GU170645.1 GU170625.1 Migheli et al. (2010) F. petroliphilum (FSSC 1) NRRL 46604 GU170594.1 GU170649.1 GU170629.1 Migheli et al. (2010) FSSC 25 NRRL 22389 EU329506.1 DQ094314.1 AF178340.1 Chehri (2017) FSSC 18 NRRL 31158 DQ094389.1 DQ246916.1 Zhang et al. (2006) 696 Eur J Plant Pathol (2018) 151:689–701 Table 2 (continued) Species complexes of Fusarium Strain number Sequence Accession Numbers Reference RPB2 ITS EF1-α FSSC 37 NRRL 25137 JF741084.1 JF740899.1 JF740757.1 Sandoval-Denis et al. (2018) FSSC 29 NRRL 28008 EF470135.1 DQ094350.1 DQ246868.1 Zhang et al. (2006) FSSC 25 NRRL 31169 KR673999.1 DQ094396.1 DQ246923.1 Zhang et al. (2006) FSSC 26 NRRL 28541 EU329542.1 EU329674.1 DQ246882.1 Zhang et al. (2006) FSSC 28 NRRL 32437 EU329581.1 DQ094446.1 DQ246979.1 Zhang et al. (2006) FSSC 27 NRRL 37625 EU329637.1 EU329684.1 FJ240353.1 O'Donnell et al. (2008) FSSC 12 NRRL 22642 EU329522.1 DQ094329.1 DQ246844.1 Zhang et al. (2006) FSSC 39 FRC S-2432 JN235941.1 JN235326.1 JN235756.1 Short et al. (2011) FSSC 7 NRRL 43502 DQ790576.1 DQ790532.1 DQ790488.1 Chang et al. (2006) FSSC 15 NRRL 28009 EF470136.1 DQ094351.1 DQ246869.1 Zhang et al. (2006) FSSC 11 NRRL 45880 EU329640.1 EU329689.1 FJ240352.1 O'Donnell et al. (2008) FSSC 6 NRRL 43489 DQ790572.1 DQ790528.1 DQ790484.1 Chang et al. (2006) FSSC 14 NRRL 22611 DQ094326.1 EU329518.1 DQ246841.1 Zhang et al. (2006) FSSC 13 NRRL 22586 EU329516.1 DQ094312.1 AF178353.1 O'Donnell et al. (2009) FSSC 17 NRRL 22157 EU329493.1 DQ094306.1 AF178359.1 O'Donnell et al. (2009) FSSC 10 NRRL 22153 EU329492.1 DQ094302.1 AF178346.1 O'Donnell et al. (2009) FSSC 32 NRRL 22570 EU329513.1 AF178422.1 AF178360.1 O'Donnell et al. (2009) FSSC 33 NRRL 22178 EU329498.1 DQ094313.1 AF178334.1 O'Donnell et al. (2009) F. ambrosium (FSSC 19) NRRL 20438 JX171584.1 DQ094315.1 AF178332.1 O'Donnell et al. (2009) F. ambrosium (FSSC 19) NRRL 22354 EU329504.1 DQ094316.1 AF178338.1 O'Donnell et al. (2009) FSSC 30 NRRL 22579 EU329515.1 AF178415.1 AF178352.1 O'Donnell et al. (2009) F. illudens NRRL 22090 JX171601.1 AF178393.1 AF178326.1 O'Donnell et al. (2009) F. staphyleae NRRL 22316 JX171609.1 AF178423.1 AF178361.1 O'Donnell et al. (2009) Etymology. Species epithet ershadii is selected in Growth rate on potato dextrose agar (PDA), 0.43 −1 honor of Prof. Djafar Ershad for his contribution to cmday ; c-d. Growth rate on synthetic nutrient agar mycology in Iran. Conidia 12–20 μm in length, thick-walled, 1–3 septate Fig. 2 Morphological properties of Fusarium ershadii (strain CBS oval, predominantly 1-septate oval (k-m & o), with little 115.40 and CBS 139505). a-b. Fast-growing 10-day old colony on distinction in size between micro and macroconidia. Reni- oatmeal agar (OA) front and back side, growth rate approx. 0.45 cmday-1; c-d. Ten-day old colony on potato dextrose agar (PDA) form microconidia rarely detected (m). Conidiophores front and back side, growth rate approx. 0.43 cmday-1; e-f. Ten- elongate(50–130μm), filiform,1–3septate,incorporating day old colony on synthetic nutrient agar (SNA) front and back microconidia-bearing terminal monophialides (i & j). side, growth rate approx. 0.43 cmday-1: the strain has covered the Chlamydospores smooth-walled (p-s) or verrucose- whole plate area with thin mycelium; g. Germinating microconidium (PDA 1000×, cotton-blue stained); h. Single verroculose (u), mostly intercalary, but also terminal. Sin- chlamydospore; i-j. Monophialidic conidiophores of aerial gular intercalary chlamydospores globose to subglobose mycelium; K-l. 1-septate oval Microconidia, (PDA 1000×, with or without supporting cells (4.5–7.5μmindiam)(h,q cotton-blue stained); m. 1-septate reniform microconidium; n. & r). Pairs (n) and clusters of 2–4 celled globose to pairs of chlamydospores; o. 1–3 septate oval microconidia; p-w various forms of chlamydospores; x. Chlamydospore formed on subglobose smooth-walled chlamydospores (4.5–7.5 μm microconidium. All scale bars 10 μm in diam) with (p-w) or without supporting cells (s). Culture characteristics- Colonies fast-growing, −1 growth rate on oatmeal agar (OA), 0.45 cmday ;a-b. Eur J Plant Pathol (2018) 151:689–701 697 698 Eur J Plant Pathol (2018) 151:689–701 Fig. 3 Phytopathogenicity of Fusarium ershadii strains on As- of the Musa acuminata with strains of Fusarium ershadii.The paragus officinalis (A, B, and C) and Musa acuminata (D and E). pathogenicity test after one (D1) and two weeks (D2), from right; Hollow root disease symptoms in Asparagus officinalis induced un-inoculated, inoculated with CBS 139505, and inoculated with by inoculation of Fusarium ershadii strains (un-inoculated; A1, CBS 115.40. Musa acuminata seedlings, from left; un-inoculated, B1, and C1, inoculated; A2, B2, and C2). Inoculation of the roots inoculated with CBS 139505, and inoculated with CBS 115.40 −1 (SNA) 0.43 cmday ; e-f. The strain has covered the seems to occur at least in North-America, Europe and Asia Petri dish with thin mycelium. Colonies attaining as a saprobe and as a pathogen. Here we have shown that 29 mm diam. in 7 d on PDA at 20 °C, 57 mm diam. at the new species is a strong pathogen on Asparagus 25 °C, 59 mm diam. at 28–30 °C, 22 mm diam. at 34 °C, officinalis and a weak pathogen on Musa acuminata. and 19 mm at 37 °C. Fungus did not grow at 5 and 40 °C Genealogical concordance phylogenetic species rec- and it became unviable at 42 °C. Incubating under an ognition (GCPSR) (Taylor et al. 2000) is based on the alternating day/night 12 h photoperiod. The fungus concordance of multiple gene genealogies. In this study grew at a broad range of pH (3.5–8.5), while the opti- three loci; EF-1α,RPB2,andITS,were used for mum growth occurred at pH values between 5.5 and 6.5. GCPSR analyses, singly and concatenated. The EF-1α and RPB2 fragments used have high levels of variation and are suitable barcodes for Fusarium (e.g. Al-Hatmi et al. 2016), while ITS is the general DNA barcode for Discussion fungi (Schoch et al. 2012), all three barcodes have the Fusarium ershadii forms a well-supported monophyletic benefit that public repositories like Genbank contain lineage within clade 9 of FSSC and can be distinguished large numbers of them for fungi of the genus Fusarium. from all other species in this group based on DNA se- Sequence analysis of the combined set of ITS, EF-1α quence comparisons and morphology. Fusarium ershadii and RPB2 showed similar results gained from each Eur J Plant Pathol (2018) 151:689–701 699 fragment individually. Besides, according to the se- pathogens not only of humans and other animals, but quence identity and average pairwise identity values also a diverse range of plants. Based on sequence anal- gained from the sequence analysis of EF-1α,RPB2, yses, several additional strains were identified in and ITS fragments, it can be inferred that the ITS frag- Genbank as members of F. ershadii. The origins of these ment has a significant resolution in FSSC and it is quite strains indicate a worldwide spread as saprobes and/or different from what is seen in other species complexes pathogens, as they include soil isolates from Sardinia, of Fusarium (Papizadeh et al. 2015 and Papizadeh et al. Italy (Balmas et al. 2010), a corn root isolate from 2016). Such a different resolution power of ITS frag- Illionois, USA (Zhang et al. 2006), and a Chinese isolate ment in FSSC conforms to the fact that FSSC forms a from sugar beet (Cao and Wu, unpublished results). basal clade in the genus Fusarium with a significant Fusarium ershadii also has a special niche causing phylogenic distance from the other clades of the genus. hollow root disease in Asparagus plants. It may have Additionally, although EF-1α fragment, as the most potential as a pathogen of other monocots such as ba- variable fragment in FSSC, is recommended as the first nana and maize. Formae speciales, specialized on cer- choice for species delimitation in FSSC, the comple- tain host crops in FSSC, are assumed to correspond to mentary effects of ITS and RPB-2 fragments should not biologically and phylogenetically distinct species be neglected, because they cause a higher robustness in (Coleman 2015), whereas within the Fusarium phylogeny studies which can be inferred from the boot- oxysporum species complex host specificity encoded strap and posterior probability values. on supernumerary chromosomes were found to have In general, the growth profile of F. ershadii seems to been horizontally exchanged between different lineages be similar to that of F. keratoplasticum (FSSC 2), and species (Baayen et al. 2000;Ma et al. 2013). F. petroliphilum (FSSC 1), and F. solani s.s. (FSSC 5) The Fusarium solani species complex is one of the (Short et al. 2013;Schroersetal. 2016). The optimum more basal clades within the genus Fusarium according temperature for growth of Fusarium ershadii is 28– to the concept of Geiser et al. (2013); or, following 30 °C, this temperature varies little in the described Lombard et al. (2015) the clade would be called clades of FSSC (Short et al. 2013). Besides, growth rate Neocosmospora (Lombard et al. 2015). The FSSC con- studies on a pH gradient of showed that Fusarium tain several members causing root rots and hollow roots ershadii can growwellinpHvaluesbetween 3.5 and and as Fusarium is the better known genus, we adhere to 8.5. However, the optimum pH was around 6 and a the first concept of a large monophyletic genus Fusar- higher growth rate was recorded in mildly alkaline pH ium and adhere to Fusarium ershadii for this new As- conditions (7.2–8.5) in comparison to mildly acidic pH paragus pathogen. values (4–5). While CBS 114.50 was first considered to be a close relative of F. lichenicola previously called Acknowledgements This work was performed at the Filamen- tous Fungi and Yeasts Collection, Microorganisms bank, IBRC Cylindrocarpon lichenicola (Summerbell and Schroers and CBS-KNAW Fungal Biodiversity Centre, cooperatively. 2002),F.ershadii proves to be closer to the type species Great thanks for generous guides of Richard C. Summerbell, of F. solani than to F. lichenicola (lineage 16). David M. Geiser and Kerry O’Donnell. Morphologically,formingadiverserangeofchlamydo- spores is a character which can be assumed as one of the Open Access This article is distributed under the terms of the main characteristics of FSSC. F. keratoplasticum and Creative Commons Attribution 4.0 International License (http:// F. petroliphilum have also been described with such chla- creativecommons.org/licenses/by/4.0/), which permits unrestrict- ed use, distribution, and reproduction in any medium, provided mydospores (Short et al. 2013). No sporodichia were de- you give appropriate credit to the original author(s) and the source, tected to compare the morphology of sporodochial conidia provide a link to the Creative Commons license, and indicate if of Fusarium ershadii to the other members of FSSC. changes were made. Interestingly, aerial conidia of F. ershadii were 12–20 μm in length which is shorter than those of F. keratoplasticum, F. falciforme, F. petroliphilum and F. solani s.s. However, References morphology and dimension of these conidia are highly similar to those of F. keratoplasticum. Al-Hatmi, A. M., van den Ende, A. H., Stielow, J. B., van Members of FSSC are cosmopolitan soil-borne hy- Diepeningen, A. D., Seifert, K. A., McCormick, W., phomycetes. These fusaria are also detected as Assabgui, R., Gräfenhan, T., de Hoog, G. S., & Levesque, 700 Eur J Plant Pathol (2018) 151:689–701 C. A. (2016). Evaluation of two novel barcodes for species Lombard, L., van der Merwe, N. A., Groenewald, J. Z., & Crous, recognition of opportunistic pathogens in Fusarium. Fungal P. W. (2015). Generic concepts in Nectriaceae. Studies in Biology, 120(2), 231–245. Mycology, 80,189–245. Baayen, R. P., O'Donnell, K., Bonants, P. J., Cigelnik, E., Kroon, Ma, L. J., Geiser, D. M., Proctor, R. H., Rooney, A. P., O'Donnell, L. P., Roebroeck, E. J., & Waalwijk, C. (2000). Gene K., Trail, F., Gardiner, D. M., Manners, J. M., & Kazan, K. Genealogies and AFLPAnalyses in the Fusarium oxysporum (2013). Fusarium pathogenomics. Annual Review of Complex Identify Monophyletic and Nonmonophyletic Microbiology, 67,399–416. Formae Speciales Causing Wilt and Rot Disease. McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y.M., Phytopathology, 90(8), 891–900. Buso, N., Cowley, A.P. & Lopez, R. (2013). Analysis tool web services from the EMBL-EBI. Nucleic Acids Research, Balmas, V., Migheli, Q., Scherm, B., Garau, P., O'Donnell, K., 41,597–600. Ceccherelli, G., Kang, S., & Geiser, D. M. (2010). Multilocus Migheli, Q., Balmas, V., Harak, H., Sanna, S., Scherm, B., Aoki, phylogenetics show high levels of endemic fusaria inhabiting T., & O'Donnell, K. (2010). Molecular phylogenetic diversity Sardinian soils (Tyrrhenian Islands). Mycologia, 102(4), of dermatologic and other human pathogenic fusarial isolates 803–812. from hospitals in northern and central Italy. Journal of Chang, D. C., Grant, G. B., O'Donnell, K., Wannemuehler, K. A., Clinical Microbiology, 48(4), 1076–1084. Noble-Wang, J., Rao, C. Y., Jacobson, L. M., Crowell, C. S., Miller, M.A., Pfeiffer, W., Schwartz, T., (2010). Creating the Sneed, R. S., Lewis, F. M., Schaffzin, J. K., Kainer, M. A., CIPRES Science Gateway for inference of large phylogenetic Genese, C. A., Alfonso, E. C., Jones, D. B., Srinivasan, A., trees in Proceedings of the Gateway Computing Fridkin, S. K., & Park, B. J. (2006). Multistate outbreak of Environments Workshop (GCE), 14 Nov. 2010, New Fusarium keratitis associated with use of a contact lens Orleans, LA. 1–8. solution. JAMA, 296(8), 953–963. Nylander, J.A.A. (2004) MrModeltest 2. Program distributed by Chehri, K. (2014). Molecular phylogeny of the Fusarium solani the author. Evolutionary Biology Centre. Uppsale: Uppsala species complex (FSSC) isolated from soils in Iran. Botany, Univ. AQ16 92(11), 815–820. O’Donnell, K., Kistler, H. C., Cigelnik, E. & Ploetz, R. C. (1998). Chehri, K. (2017). Molecular identification of entomopathogenic Multiple evolutionary origins of the fungus causing Panama Fusarium species associated with Tribolium species in stored disease of banana: concordant evidence from nuclear and grains. Journal of Invertebrate Pathology, 144,1–6. mitochondrial gene genealogies. Proceedings of the Coleman, J. J. (2015). The Fusarium solani species complex: National Academy of Sciences of the United States of ubiquitous pathogens of agricultural importance. Molecular America, 95,2044–2049. Plant Pathology. https://doi.org/10.1111/mpp.12289. O'Donnell, K., Sarver, B. A., Brandt, M., Chang, D. C., Noble- Debourgogne, A., Gueidan, C., de Hoog, S., Lozniewski, A., & Wang, J., Park, B. J., Sutton, D. A., Benjamin, L., Lindsley, Machouart, M. (2012). Comparison of two DNA sequence- M.,Padhye,A.,Geiser,D.M.,&Ward,T. J.(2007). based typing schemes for the Fusarium solani Species Phylogenetic diversity and microsphere array-based genotyp- Complex and proposal of a new consensus method. Journal ing of human pathogenic Fusaria, including isolates from the of Microbiological Methods, 91(1), 65–72. multistate contact lens-associated U.S. keratitis outbreaks of Elmer, W. H. (2015). Management of Fusarium crown and root rot 2005 and 2006. Journal of Clinical Microbiology, 45(7), of Asparagus. Crop Protection, 73,2–6. 2235–2248. Fisher, N. L., Burgess, L. W., Toussoun, T. A., & Nelson, P. E. O'Donnell, K., Sutton, D. A., Fothergill, A., McCarthy, D., (1982). Carnation leaves as a substrate and for preserving Rinaldi, M. G., Brandt, M. E., Zhang, N., & Geiser, D. M. cultures of Fusarium species. Phytopathology, 72,151–153. (2008). Molecular phylogenetic diversity, multilocus haplo- Geiser, D. M., Aoki, T., Bacon, C. W., et al. (2013). One Fungus, type nomenclature, and in vitro antifungal resistance within One Name: Defining the genus Fusarium in a scientifically the Fusarium solani species complex. Journal of Clinical robust way that preserves longstanding use. Phytopathology, Microbiology, 46(8), 2477–2490. 103,400–408. O'Donnell, K., Sutton, D. A., Rinaldi, M. G., Gueidan, C., Crous, Huelsenbeck, J. P., & Ronqvist, F. (2001). MrBayes: Bayesian P. W., & Geiser, D. M. (2009). Novel multilocus sequence inference of phylogeny. Bioinformatics, 17,754–755. typing scheme reveals high genetic diversity of human path- https://doi.org/10.1093/bioinformatics/17.8.754. ogenic members of the Fusarium incarnatum-F. equiseti and Hujslová, M., Kubátová, A., Kostovčík, M. & Kolařík, M. (2013). F. chlamydosporum species complexes within the United Acidiella bohemica gen. et sp. nov. and Acidomyces spp. States. Journal of Clinical Microbiology, 47(12), 3851–3861. (Teratosphaeriaceae), the indigenous inhabitants of extremely O'Donnell, K., Sutton, D. A., Rinaldi, M. G., Sarver, B. A., acidic soils in Europe. Fungal Diversity, 58,33–45. Balajee, S. A., Schroers, H. J., Summerbell, R. C., Robert, Katoh, K., Asimenos, G. & Toh, H. (2009). Bioinformatics for V. A., Crous, P. W., Zhang, N., Aoki, T., Jung, K., Park, J., DNA sequence analysis. In Posada, D. (Ed.) Bioinformatics Lee, Y. H., Kang, S., Park, B., & Geiser, D. M. (2010). for DNA sequence analysis, methods in molecular biology, Internet-accessible DNA sequence database for identifying Methods in Molecular Biology (pp. 39–64). Totowa, NJ: fusaria from human and animal infections. Journal of Humana Press, Springer. Clinical Microbiology, 48(10), 3708–3718. Kumar, S., Stecher, G. & Tamura, K. (2016). MEGA7: Molecular O'Donnell, K., Humber, R. A., Geiser, D. M., Kang, S., Park, B., Evolutionary Genetics Analysis version 7.0 for bigger Robert, V. A., Crous, P. W., Johnston, P. R., Aoki, T., Rooney, datasets. Molecular Biology and Evolution, 33(7), 1870– A. P., & Rehner, S. A. (2012). Phylogenetic diversity of 1874. insecticolous fusaria inferred from multilocus DNA sequence Eur J Plant Pathol (2018) 151:689–701 701 data and their molecular identification via FUSARIUM-ID Schroers, H. J., Samuels, G. J., Zhang, N., Short, D. P. G., Juba, J. and Fusarium MLST. Mycologia, 104(2), 427–445. H., & Geiser, D. M. (2016). Epitypification of Fusisporium (Fusarium) solani and its assignment to a common phyloge- Papizadeh, M., Soudi, M. R., Amoozegar, M. A., & Shazadeh netic species in the Fusarium solani species complex. Fazeli, S. A. (2015). A Comparative Analysis on ITS, RPB-2 Mycologia. https://doi.org/10.3852/15-255. and EF1α Fragments, Aiming Species Delimitation in Selbmann, L., de Hoog, G.S., Zucconi, L., Isola, D., Ruisi, S., Fusarium Solani Species Complex (FSSC). Current Gerrits, A.H.G., Ende, V.A., Ruibal, C., De Leo, F., Urzì, C. Medical Mycology., 1(S1), 33. & Onofri, S. (2008). Drought meets acid: three new genera in Papizadeh, M., Zamanizadeh, H. R., Zabihi, S. S., Soudi, M. R., a dothidealean clade of extremotolerant fungi. Studies in Amoozegar, M. A., & Shahzadeh Fazeli, S. A. (2016). Mycology, 61,1–20. Highlighted by GCPSR studies: is Fusarium solani a Short, D. P., O'Donnell, K., Zhang, N., Juba, J. H., & Geiser, D. M. Fusarium yet? Iranian Plant Protection Congress., 22,138. (2011). Widespread occurrence of diverse human pathogenic Papizadeh, M., Roayaei Ardakani, M., & Motamedi, H. (2017a). typesofthe fungus Fusarium detected in plumbing drains. Growth-phase dependent biodesulfurization of JournalofClinicalMicrobiology, 49(12), 4264–4272. dibenzothiophene by Enterobacter sp. strain NISOC-03. Short, D. P., O'Donnell, K., Thrane, U., Nielsen, K. F., Zhang, N., Pollution., 3,101–111. Juba, J. H., & Geiser, D. M. (2013). Phylogenetic relation- Papizadeh, M., Soudi, M. R., Amini, L., Wijayawardene, N. N., & ships among members of the Fusarium solani species com- Hyde, K. D. (2017b). Pyrenochaetopsis tabarestanensis plex in human infections and the descriptions of (Cucurbitariaceae, Pleosporales), a new species isolated from F. keratoplasticum sp. nov.and F. petroliphilum stat. nov. rice farms in north Iran. Phytotaxa., 297(1), 15–28. Fungal Genetics and Biology, 53,59–70. Rambaut, A. (2008) FigTree v1.1.1: Tree figure drawing tool. Short, D. P., O'Donnell, K., & Geiser, D. M. (2014). Clonality, Available: http://tree.bio.ed.ac.uk/software /figtree/. recombination, and hybridization in the plumbing-inhabiting Accessed 20 June 2008. human pathogen Fusarium keratoplasticum inferred from Rambaut A, Drummond AJ. (2009). Tracer v1.5. Available from multilocus sequencetyping. BMC Evolutionary Biology, 14,91. http://beast.bio.ed.ac.uk/Tracer. Summerbell, R. C., & Schroers, H. J. (2002). Analysis of phylo- Saba, F., Papizadeh, M., Khansha, J., Sedghi, M., Rasooli, M., genetic relationship of Cylindrocarpon lichenicola and Amoozegar, M. A., Soudi, M. R., & Shahzadeh Fazeli, S. A. Acremonium falciforme to the Fusarium solani species com- (2016). A rapid and reproducible genomic DNA extraction plex and a review of similarities in the spectrum of opportu- protocol for sequence-based identifications of archaea, bac- nistic infections caused by these fungi. Journal of Clinical teria, cyanobacteria, diatoms, fungi, and green algae. Journal Microbiology, 40(8), 2866–2875. of Medical Bacteriology., 5(3–4), 22–28. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Salah, H., Al-Hatmi, A. M., Theelen, B., Abukamar, M., Hashim, Kumar, S. (2011). MEGA5: Molecular evolutionary genetics S., van Diepeningen, A. D., Lass-Florl, C., Boekhout, T., analysis using maxi-mum likelihood, evolutionary distance, Almaslamani, M., & Taj-Aldeen, S. J. (2015). Phylogenetic and maximum parsimony methods. Molecular Biology and diversity of human pathogenic Fusarium and emergence of Evolution, 28,2731–2739. uncommon virulent species. Journal of Infection., 15(63– Taylor, J. W., Jacobson, D. J., Kroken, S., Kasuga, T., Geiser, D. 4453), 00264 –00269. https://doi.org/10.1016/j. M., Hibbett, D. S., & Fisher, M. C. (2000). Phylogenetic jinf.2015.08.011. species recognition and species concepts in fungi. Fungal Sandoval-Denis, M., Guarnaccia, V., Polizzi, G., & Crous, P. W. Genetics and Biology, 31(1), 21–32. (2018). Symptomatic Citrus trees reveal a new pathogenic van Diepeningen, A. D., Al-Hatmi, A. M. S., Brankovics, B., & de lineage in Fusarium and two new Neocosmospora species. Hoog, G. S. (2014). Taxonomy and Clinical Spectra of Persoonia, 40,1–25. Fusarium Species: Where Do We Stand in 2014? Current Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., Spouge, J. Clinical Microbiology Reports, 1,10–18. L., Levesque, C. A., Chen, W., & Fungal Barcoding Zhang, N., O'Donnell, K., Sutton, D. A., Nalim, F. A., Summerbell, Consortium. (2012). Nuclear ribosomal internal transcribed R. C., Padhye, A. A., & Geiser, D. M. (2006). Members of the spacer (ITS) region as a universal DNA barcode marker for Fusarium solani species complex that cause infections in both Fungi. Proceedings of the National Academy of Sciences humans andplants are commoninthe environment. Journal of (PNAS), 109(16), 6241–6246. Clinical Microbiology, 44(6), 2186–2190.

Journal

European Journal of Plant PathologySpringer Journals

Published: Jan 15, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off