Functionalized Nano-adsorbent for Affinity Separation of Proteins

Functionalized Nano-adsorbent for Affinity Separation of Proteins Thiol-functionalized silica nanospheres (SiO -SH NSs) with an average diameter of 460 nm were synthesized through a hydrothermal route. Subsequently, the prepared SiO -SH NSs were modified by SnO quantum dots to afford SnO / 2 2 2 SiO composite NSs possessing obvious fluorescence, which could be used to trace the target protein. The SnO /SiO 2 2 2 NSs were further modified by reduced glutathione (GSH) to obtain SnO /SiO -GSH NSs, which can specifically separate 2 2 glutathione S-transferase-tagged (GST-tagged) protein. Moreover, the peroxidase activity of glutathione peroxidase 3 (GPX3) separated from SnO /SiO -GSH NSs in vitro was evaluated. Results show that the prepared SnO /SiO -GSH NSs 2 2 2 2 exhibit negligible nonspecific adsorption, high concentration of protein binding (7.4 mg/g), and good reused properties. In the meantime, the GST-tagged GPX3 separated by these NSs can retain its redox state and peroxidase activity. Therefore, the prepared SnO /SiO -GSH NSs might find promising application in the rapid 2 2 separation and purification of GST-tagged proteins. Keywords: Silica nanospheres, SnO , Affinity separation, Peroxidase activity, Redox state Background protein solubility. These drawbacks, fortunately, could be The easy separation and purification of proteins are very overcame by applying nanomaterials to assist the separation important in xenobiotic biotransformation, drug metabol- and purification of the target proteins [15–19]. For example, ism, biosynthesis of prostaglandins and steroid hormones, magnetic SiO -NiO nanocomposite is capable of separating and degradation of aromatic amino acids [1–6]. The sepa- His-tagged proteins [20]. Nanomaterials, nevertheless, still rated proteins can be used for antigen and vaccine produc- have short legs in the separation of various proteins be- tion, molecular immunology and structural, and cause they are often inactive to visualization and fluores- biochemical and cell biological studies. Glutathione S-trans- cence techniques which can be used as sensitive ferase (GST) represents a major group of detoxification iso- biomolecular and medical diagnostic tools to combat bio- enzymes which can be used in GST gene fusion system and logical warfare [21–23]. In this sense, it is imperative to medicine effect targeting field or as tumor markers [7, 8]. find nanomaterials with fluorescent responses so as to Various methods such as precipitation, chromatography, promote their application in the separation and purifica- ultrafiltration, and dialysis are currently available for purify- tion of recombinant protein like glutathione peroxidase 3 ing various proteins, and in particular, affinity separation (GPX3). based on the natural biological affinity between biological We pay particular attention to nanoscale SnO quantum macromolecules and complementary ligands is of extraor- dots (QDs), because, as an n-type wide-bandgap (3.6 eV) dinary significance [9–14]. The successful production and semiconductor with good chemical stability and biocom- purification of full-length, soluble, and natural fusion pro- patibility, SnO exhibits optical absorbance in visible spec- teins, however, are still retarded by various obstacles such as tral region. Herein, we establish a smart pathway to the need for pretreatment to remove the cell debris and col- introduce fluorescent SnO QDs onto the surface of silica loid contaminants, a relatively long operation time, and nanospheres (NSs), hoping to develop a desired SnO / SiO nanostructure with potential application in the sep- aration and purification of GST-tagged proteins. Firstly, * Correspondence: zhaoyb902@henu.edu.cn; zhangzj09@126.com 1 thiol-functionalized silica nanospheres (SiO -SH NSs) Engineering Research Center for Nanomaterials, Henan University, Kaifeng 475004, China were prepared through a hydrothermal route. Resultant Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Zou et al. Nanoscale Research Letters (2018) 13:165 Page 2 of 8 SiO -SH NSs were compounded with SnO quantum (30 mL) to obtain SnO /SiO -SH NSs for three times, 2 2 2 2 dots to afford SiO /SnO composite NSs possessing which was dispersed in water (0.12 g/mL). 2 2 obvious fluorescence absorption. The SiO /SnO NSs 2 2 were further modified by reduced glutathione (GSH) Surface Modification of SnO /SiO -SH NSs 2 2 to obtain SiO /SnO -GSH NSs with potential for the Four milliliters of 0.12 g/mL SnO /SiO -SH NSs was 2 2 2 2 affinity separation of GST-tagged protein. The ability washed with PBS (0.01 mol/L, pH = 7.4) for three times. and the peroxidase activity of the prepared SnO / These SnO /SiO -SH NSs were added into 30 mL 16. 2 2 2 SiO -GSH NSs in separating GST-tagged proteins 7 mg/mL GSH solution and oscillated at 37 °C for 24 h were evaluated by SDS-PAGE analysis. (120 rev/min) with a constant temperature oscillator. At the end of oscillation, the mixed solution was centri- Experimental fuged to provide SnO /SiO -GSH NSs; then, the precipi- 2 2 Material and Methods tate was fully washed with 30 mL PBS (0.01 mol/L, pH Hexadecyltrimethyl ammonium bromide (CTAB), tin (IV) = 7.4) for three times to remove excessive GSH via phys- chloride (SnCl ), triethylamine (TEA), and isopropanol were ical adsorption, thereby affording desired SnO /SiO - 4 2 2 provided by Tianjin Kermel Chemicals Reagent Company GSH NSs. The resultant SnO /SiO -GSH NSs were 2 2 (Tianjin, China). AgNO was purchased from Tianjin added into alcohol (25%, v/v) and stored at 4 °C. Fuchen Technology Development Co., Ltd. (Tianjin, China). 3-Mercaptopropyl-trimethoxysilane (MPS) was offered by Separation of GST-Tagged Proteins Alfa-Aesar (Shanghai, China). Tetraethyl orthosilicate The mixed proteins were collected from the cell lysate (TEOS) was supplied by Tianjin Fuchen Chemicals (Tianjin, of Escherichia coli, which is by water lysis (concentration China). Dihydronicotinamide adenine dinuclectide phos- 0.01 mol/L, pH 7.4). For in vitro protein expression, the phate (NADPH), thioredoxin, and thioredoxin reductase protein region containing the coding sequence of gluta- were obtained from Sigma (Beijing, China). Glutathione thione peroxidase 3 (GPX3, amino acids 37–206), Open Sepharose 4B (Stockholm, USA) was from GE Healthcare. stomata 1 (OST1), and ABA insensitive 2 (ABI2, amino Dithiothreitol (DTT) was available from Aladdin Industrial acids 100–423) in Arabidopsis thaliana was cloned and Corporation (Inalco SPA, Italy). All chemical reagents were inserted in frame into the plasmid pGEX-6p1 (GPX3 of analytical reagent and used without any further was used as control). pGEX-GPX3, pGEX-OST1, and purification. pGEX-ABI2 constructs were introduced into E. coli BL21 (DE3) cells. The recombinant GST-tagged proteins Preparation of SnO Quantum Dots were purified using Glutathione Sepharose 4B and In a typical synthesis [24], 3.5 g SnCl ·5H O was added SnO /SiO -GSH NSs. The primers used for cloning the 4 2 2 2 into 50 mL H O, then 5 mL ammonia was added into genes were as follows: for GPX3, forward primer, 5′-G the solution under stirring. Subsequently, the precipita- ATGGATCCTCGCCATCGACGGTGGAACAA-3′; re- tion obtained by centrifugation was washed with deion- verse primer, 5′- CACCTCGAGTCAAGCAGATGCC ized water for several times to remove the excessive Cl AATAGCTT-3′; for OST1, forward primer, 5′- GCCGA ions. Thirty milliliters of deionized water was added into ATTCATGGATCGACCAGCAGTGA-3′; reverse pri- the obtained precipitate, and then, the pH of the mer, 5′- CCCGTCGACTCACATTGCGTACACAATC- solution was adjusted to be 12 by 2 mol/L ammonia. 3′; for ABI2, forward primer, 5′- GCGGAATTCGA The mixed solution was transferred into a Teflon-lined GAGTAGAAGTCTGTTTG-3′; reverse primer, 5′-GC stainless steel autoclave, sealed and heated at 150 °C for GCTCGAGTCAATTCAAGGATTTGCTC-3′. 24 h. Upon completion of heating, the mixed solution After being washed with PBS solution (0.01 mol/L, was cooled, centrifuged, and fully washed with ethanol- pH = 7.4), the prepared SnO /SiO -GSH NSs were dir- 2 2 isopropanol (volume ratio 1:1) to obtain SnO QDs. ectly introduced into 1000 μL E. coli lysate and shaken at 4 °C for 2 h (rotation speed: 90 rev/min) to allow the Preparation of SnO /SiO -SH NSs SnO /SiO -GSH NSs to capture GST-tagged proteins. 2 2 2 2 In a typical synthesis, 0.2 g SnO QDs and 0.09 g CTAB Upon completion of shaking, these NSs were isolated were dissolved in the mixed solvent of H O (42.5 mL) from the solution by centrifugation and fully washed and absolute alcohol (7 mL) under magnetic stirring with PBS solution to remove any residual uncaptured (200 G, r = 180 mm). Into resultant solution was added proteins. The GST-tagged protein-bound SnO /SiO - 2 2 2.7 mL TEA under additional 20 min of stirring. The GSH NSs were washed with 300 μL and 0.5 mol/L GSH mixed solution was heated at 60 °C for 5 h while 3.5 mL solution for three times to disassociate GST-tagged pro- TEOS and 0.35 mL of MPS were slowly dropped, teins from their surface. Separately collected protein followed by centrifuging (12,800 G, r = 180 mm) and solutions were detected by sodium dodecylsulfate poly- fully washing with HCl-ethanol (30 mL) and water acrylamide gel electrophoresis (SDS-PAGE). The Zou et al. Nanoscale Research Letters (2018) 13:165 Page 3 of 8 concentration of the separated proteins was determined GPX3 was used for in vitro analysis of redox states. Ex- by BCA protein Assay Kit. The SnO /SiO -GSH NSs tracts were evaluated by nonreducing 15% SDS-PAGE gel. 2 2 can be reused to separate the target proteins for several times by the same method. Characterization The morphology and composition of the prepared SnO /SiO -GSH NSs were analyzed by transmission 2 2 Measurement of Glutathione Peroxidase Activity electron microscopy (TEM, JEM-2010, Japan), scanning The separated GPX3 activity was measured by the spectro- electron microscopy (SEM, JSM 5600LV, Japan), X-ray metric determination of NADPH consumption at 340 nm diffraction (XRD, X’ Pert Philips, Holland), and fluores- as described by Delaunay et al. [25]. The GST tag was cut cence spectrometer (FL, FluoroSENS, Britain, at the off by PreScission protease from GST-tagged GPX3, and excitation wavelength of 260 nm). The separated GST- then, the GPX3 was used for activity analysis. Firstly, 98 μL tagged proteins were detected with sodium dodecylsul- reaction buffer solution (including 100 mmol/L Tris-Cl, 0. fate polyacrylamide gel electrophoresis (SDS-PAGE, 3mmol/LNADPH,1.34 μmol/L thioredoxin, and 0. Power PAC 300, China), with the preconcentration volt- 18 μmol/L thioredoxin reductase from E. coli lysate) was age of 70 V and the separation voltage of 120 V. The added into a tube; after mixing completely, 1.35 μmol puri- constant temperature oscillator was from Shanghai fied GPX3 was added into the resultant reaction buffer solu- ChemStar Instruments, Co., Ltd. (ATS-03M2R, China). tion. Then, the mixed solution was added into 2 μLH O 2 2 The concentration of the separated proteins was deter- (5 mmol/L) to initiate the reaction and NADPH consump- mined by BCA protein Assay Kit (Beijing CoWin tion at 340 nm was collected by the spectrometric Biotech, China). determination. Results and Discussion Analysis of Redox States of Purified GPX3 TEM, SEM, XRD, and Fluorescent Analyses of SnO QDs The GST tag was cut off from GST-tagged GPX3 by Pre- and SnO /SiO -GSH NSs 2 2 Scission protease. The separated GPX3 was treated with Figure 1 gives the high-resolution TEM (HRTEM) images 5mmol/LH O and 1 mmol/L DTT for 10 min to change and XRD pattern of the synthesized SnO QDs. It can be 2 2 2 the redox states of the purified GPX3. The resultant seen that the synthesized SnO QDs are of spherical shape a b c d Fig. 1 TEM (a), HRTEM (b) images, selected area electron diffraction pattern (c) and XRD pattern (d) of prepared SnO QDs 2 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 4 of 8 and have an average diameter of 5 nm, which exhibits a 23° (JCPDS card no. 76-0933), which indicates that narrow particle size distribution (Fig. 1a), and their lattice SnO possessing visible light response has been success- spacing of (110) plane is 0.29 nm (Fig. 1b). The well- fully introduced onto the surface of SiO NSs. Figure 3b resolved lattice image demonstrates that the prepared shows the fluorescent spectrum of SnO /SiO -GSH NSs 2 2 SnO QDs have a highly ordered crystalline structure. at 368 nm. It can be seen that SnO /SiO -GSH displays 2 2 2 Corresponding selected area electron diffraction pattern intense fluorescent emission, which is attributed to oxy- of SnO QDs (Fig. 1c) can be indexed to a single Cassiter- gen vacancies of SnO . Figure 3c gives the fluorescence 2 2 ite phase, which is consistent with the relevant XRD pat- imaging of SnO /SiO -GSH NSs when these NSs are 2 2 tern (Fig. 1d). Namely, the characteristic peaks at 2 theta used to separate GST-tagged GPX3 in E. coil lysate. It = 26.6° (110), 33.9° (101), 38.0° (200), 51.8° (211), 65.9° can be seen that there are obvious green fluorescence (301), and 78.7° (321) are consistent with the standard where the prepared SnO /SiO -GSH NSs are used. It in- 2 2 XRD data of Cassiterite SnO (JCPDS card no. 41-1445). dicates that SnO was modified on the surface of SiO 2 2 2 Besides, the intense XRD peaks indicate that the prepared and the SnO /SiO -GSH NSs have good fluorescence 2 2 SnO QDs are well crystallized, and the absence of other properties. characteristic peaks suggests that they do not contain hematite or hydroxide impurities. SDS-PAGE Analysis Figure 2 gives the SEM and TEM images of SnO / To estimate the ability of the prepared SnO /SiO -GSH 2 2 2 SiO -GSH NSs. It can be seen that the prepared SnO / NSs in separating GST-tagged proteins, we conducted 2 2 SiO -GSH NSs are of a spherical shape and have an aver- SDS-PAGE analysis. Figure 4 shows the SDS-PAGE ana- age diameter of about 430 nm, and their surface seems to lysis result of the GST-tagged GPX3 separated by SnO / be somewhat rough (Fig. 2a, b). In the meantime, it can be SiO -GSH NSs. It can be seen that the SnO /SiO -GSH 2 2 2 seen that the SnO QDs (about 5–15 nm) are modified on NSs can efficiently enrich target proteins from E. coli lys- the surface of SiO microspheres (Fig. 2c, d), which is con- ate, and in particular, the quantity of the disassociated sistent with the corresponding SEM images. It is indicated proteins tends to increase with incremental concentration that the SnO and silica NSs have been aggregated. of GSH in the range of 10–100 mmol/L (lanes 3–6 in Fig. Figure 3a gives the XRD pattern of the synthesized 4a). It is clear that the target proteins can be separated SnO /SiO -GSH NSs. The major peaks at 2 theta = 110°, specifically by the prepared SnO /SiO -GSH NSs from the 2 2 2 2 101°, 200°, 211°, 301°, and 321° are consistent with those E. coli lysate and there was hardly any nonspecific. of SnO (Fig. 1d). Besides, SnO /SiO -GSH NSs show an In order to investigate the reused properties of the 2 2 2 intense characteristic peak of amorphous silica around prepared SnO /SiO -GSH NSs, we repeatedly used them 2 2 Fig. 2 SEM (a, b) and TEM (c, d) images of the prepared SnO /SiO -GSH NSs 2 2 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 5 of 8 Fig. 3 XRD pattern (a), fluorescence spectrum (b), and fluorescence imaging (c) of prepared SnO /SiO -GSH NSs 2 2 to separate GST-tagged GPX3. As shown in Fig. 4b(lane 1 To test the universality of the synthesized SnO /SiO - 2 2 refers to the marker, lane 2 refers to GST-GPX3-contained GSH NSs for purifying GST-tagged proteins, we selected E. coli lysate, lane 3 refers to 1st separation, lane 4 refers to three kinds of GST-tagged proteins (GST-tagged GPX3, 2nd separation, lane 5 refers to 3rd separation, and lane 6 GST-tagged OST1, and GST-tagged ABI2) to conduct refers to the fractions washed off from Glutathione Sephar- experiments. As shown in Fig. 5, GST-tagged GPX3, ose 4B), the synthesized SnO /SiO -GSH NSs exhibit spe- OST1, and ABI2 proteins can be separated specifically 2 2 cial selectivity towards GST-tagged GPX3 extracted from E. by SnO /SiO -GSH NSs from the E. coli lysate (lanes 3, 2 2 coli lysate, and their specificity and affinity remain un- 6, 9); then, we can get both GPX3 (cut off the GST tag affected after three cycles of repeat separation. from SnO /SiO -GSH NSs binding GST-tagged GPX3) 2 2 Fig. 4 SDS-PAGE analysis of purified GST-tagged proteins separated by SnO /SiO -GSH NSs. a Lane 1, marker; lane 2, E. coli lysate; lanes 3–6 refer 2 2 to the fractions washed off from the SnO /SiO -GSH NSs with different concentrations of GSH solution (lane 1, 10 mmol/L; lane 2, 20 mmol/L; lane 2 2 3, 50 mmol/L; lane 4, 100 mmol/L). b Lane 1, marker; lane 2, E. coli lysate; lane 3, 1st separation; lane 4, 2nd separation; lane 5, 3rd separation; and lane 6, the fractions washed off from the Glutathione Sepharose 4B Zou et al. Nanoscale Research Letters (2018) 13:165 Page 6 of 8 Fig. 5 SDS-PAGE analysis of the purified recombinant GPX3, OST1, and ABI2 proteins. Lanes 1, 4, and 7, E. coli lysate; lanes 2, 5, and 8, the proteins eluted from commercial Glutathione Sepharose 4B (GE Healthcare, USA); lanes 3, 6, and 9, the proteins eluted from SnO /SiO -GSH NSs; lane 10, the 2 2 marker; lanes 11 and 13, GPX3 obtained after the GST tag is cut off from Glutathione Sepharose 4B bound GST-GPX3 and SnO /SiO -GSH NSs bound 2 2 GST-tagged GPX3; lanes 12 and 14, GST tag eluted from Glutathione Sepharose 4B and SnO /SiO -GSH NSs 2 2 and GST tag eluted from SnO /SiO -GSH NSs (lane 13, Sepharose 4B (lanes 1 and 2) and SnO /SiO -GSH NSs 2 2 2 2 the GPX3; lane 14, the GST tag), which has a similar ef- (lanes 3 and 4) have the oxidized and reduced states, fect with Glutathione Sepharose 4B (lanes 2, 5, 8, 11, and the reduced GPX3 migrates more slowly than the 12). The concentrations of purified proteins by SnO / oxidized counterpart. This is well consistent with our SiO -GSH NSs were 7.4 mg/g (GST-tagged GPX3), 7. previous findings that GPX3 is present in oxidized and 1 mg/g (GST-tagged OST1), and 6.8 mg/g (GST-tagged reduced states in vitro, and its reduced and oxidized ABI2), which indicate that SnO /SiO -GSH NSs are forms can be separated as a result of modification of the 2 2 good to purify GST-tagged proteins from the E. coli lys- reduced Cys residues [26–28]. ate. In order to compare the binding capacity between the Figure 6b shows the assays of peroxidase activity of prepared SnO /SiO -GSH NSs and the other material, GPX3: line GPX3*, complete assay of the purified GPX3 2 2 Glutathione Sepharose 4B (purchased in Stockholm, USA) in the presence of Glutathione Sepharose 4B, thiore- was used as comparison experiment material. The total doxin, thioredoxin reductase, NADPH, and H O ; line 2 2 proteins purified by Glutathione Sepharose 4B were 7. GPX3, complete reaction among SnO /SiO -GSH NSs 2 2 1 mg/mL (GST-tagged GPX3), 6.9 mg/mL (GST-tagged separated GPX3, thioredoxin, thioredoxin reductase, OST1), and 5.6 mg/mL (GST-tagged ABI2), respectively. It NADPH, and H O ; line No GPX3, complete reaction in 2 2 can be seen that the binding capacity of the prepared the absence of GPX3; and line No Trx, complete reac- SnO /SiO -GSH NSs is higher than that of commodity 4B. tion in the absence of thioredoxin. Figure 6b shows the 2 2 glutathione peroxidase activity of the purified GPX3 sep- Analysis of Redox State and Peroxidase Activity of GST- arated from Glutathione Sepharose 4B and SnO /SiO - 2 2 Tagged GPX3 GSH NSs in vitro. It can be seen that, with thioredoxin In order to analyze the redox state and activity of GST- as the substrate, the purified GPX3 exhibits significant tagged GPX3 separated by the prepared SnO /SiO -GSH peroxidase activity, which indicates that the GPX3 sepa- 2 2 NSs, we cut off the GST tag to obtain the separated rated from SnO /SiO -GSH NSs is existent in the 2 2 GPX3. Figure 6a shows given in vitro assays of GPX3 natural state. redox state (corresponding to a representative gel from three independent experiments). Lanes 1 and 2 refer to Conclusions GPX3 obtained after the GST tag is cut off from Gluta- A facile method is established to fabricate silica- thione Sepharose 4B bound GST-tagged GPX3 (lane 1 is protected SnO QD nanospheres (SnO /SiO NSs). The 2 2 2 the oxidized GPX3 and lane 2 is the reduced GPX3); SnO /SiO NSs are further modified by glutathione to 2 2 lanes 3 and 4 refer to GPX3 obtained after the GST tag afford SnO /SiO -GSH NSs for the affinity separation of 2 2 is cut off from SnO /SiO -GSH bound GST-tagged glutathione S-transferase-tagged (GST-tagged) recom- 2 2 GPX3 (lane 3 is the oxidized GPX3 and lane 4 is the re- binant protein. Findings indicate that, in terms of the duced GPX3); lane 5 refers to the marker. As shown in ability to separate GST-tagged GPX3, GST-tagged LOV, Fig. 6a, the purified GPX3 separated from Glutathione and GST-tagged ABI2, the prepared SiO /SiO -GSH 2 2 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 7 of 8 ab Fig. 6 a In vitro assays of GPX3 redox state: lanes 1 and 3 (the oxidized GPX3) and 2 and 4 (the reduced GPX3) refer to GPX3 obtained after the GST tag is cut off from Glutathione Sepharose 4B and SnO /SiO -GSH bound GST-tagged GPX3, respectively; lane 5, marker. b Assays of peroxidase activity 2 2 of GPX3 NSs exhibit specific separation, high concentration of Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in protein binding, and good reused properties. Besides, published maps and institutional affiliations. the GPX3 separated from the GST-tagged GPX3 retains its redox states in vitro and GPX activity as well, which Author details Engineering Research Center for Nanomaterials, Henan University, Kaifeng means that the prepared SnO /SiO -GSH NSs might 2 2 475004, China. National & Local Joint Engineering Research Center for have a promising potential for the rapid separation and Applied Technology of Hybrid Nanomaterials, Henan University, Kaifeng purification of GST-tagged proteins. 475004, China. Collaborative Innovation Center of Nano Functional Materials and Applications of Henan Province, Henan University, Kaifeng 475004, China. Institute of Plant Stress Biology-State Key Laboratory of Cotton Abbreviations Biology, Henan University, Kaifeng 475004, China. ABI2: ABA insensitive 2; CTAB: Hexadecyltrimethyl ammonium bromide; DTT: Dithiothreitol; GPX3: Peroxidase activity of glutathione peroxidase 3; Received: 22 September 2017 Accepted: 16 April 2018 GSH: Reduced glutathione; GST-tagged: Glutathione S-transferase-tagged; MPS: 3-Mercaptopropyl-trimethoxysilane; NADPH: Dihydronicotinamide adenine dinuclectide phosphate; OST1: Open stomata 1; QDs: Quantum dots; SDS-PAGE: Sodium dodecylsulfate polyacrylamide gel electrophoresis; References SEM: Scanning electron microscopy; SiO -SH NSs: Thiol-functionalized silica 1. Seto H, Ogata Y, Murakami T, Hoshino Y, Miura Y (2012) Selective protein nanospheres; SnCl : Tin (IV) chloride; TEA: Triethylamine; TEM: Transmission separation using siliceous materials with a trimethoxysilane-containing electron microscopy; TEOS: Tetraethyl orthosilicate; XRD: X-ray diffraction glycopolymer. ACS Appl Mater Interfaces 4:411–417 2. Vilt ME, Ho WSW (2010) Selective separation of cephalexin from multiple component mixtures. Ind Eng Chem Res 49:12022–12030 Funding 3. Liu C, Monson CF, Yang T, Pace H, Cremer PS (2011) Protein separation by The authors acknowledge the financial support provided by the Scientific electrophoretic-electroosmotic focusing on supported lipid bilayers. Anal Research Fund Project of Henan University of China (grant no. 2015YBZR032), Chem 83:7876–7880 The project of scientific and technological breakthrough in Jiyuan of China 4. Steppert P, Burgstaller D, Klausberge M, Berger E, Aguilar PP, Schneider TA, (grant No. 17022011); The National Natural Science Foundation of China Kramberqer P, Tover A, Nöbauer K, Razzazi-Fazeli E, Junqbauer A (2016) (grant No. 21571051); Major science and technology project in Henan Purification of HIV-1 gag virus-like particles and separation of other province of China (grant No.181100310600), National Natural Science extracellular particles. J Chromatogr A 1455:93–101 Foundation of China (grant no. 9117002), Major State Basic Research Development Program of China (973 program, grant no. 2012CB114301), and 5. Yoshimatsu K, Yamazaki T, Hoshino Y, Rose PE, Epstein LF, Miranda LP, Open Fund of Key Laboratory for Monitoring and Remediation of Heavy Tagari P, Beierle JM, Yonamine Y, Shea KJ, Miura Y (2014) Epitope discovery Metal polluted Soil of Henan Province. for a synthetic polymer nanoparticle: a new strategy for developing a peptide tag. J Am Chem Soc 136:1194–1197 6. Yu H, Arata Y, Yonamine Y, Lee SH, Yamasaki A, Tsuhara R, Yano K, Shea KJ, Availability of Data and Materials Miura Y (2015) Preparation of nanogel-immobilized porous gel beads for All data are fully available without restriction. affinity separation of proteins: fusion of nano and micro gel materials. Polym J 47:220–225 7. Park SM, Jung HY, Chung KC, Rhim H, Park JH, Kim J (2002) Stress-induced Authors’ Contributions aggregation profiles of GST-alpha-synuclein fusion proteins: role of the C- XYZ, FBY, XS, and MMQ performed the design, analyzed the data, and terminal acidic tail of alpha-synuclein in protein thermosolubility and drafted the manuscript. YBZ and ZJZ guided the idea and the simulations stability. Biochemistry 41:4137–4146 and checked the figures. All authors read and approved the final manuscript. 8. Fujikawa Y, Urano Y, Komatsu T, Hanaoka K, Kojima H, Terai T, Inoue H, Nagano T (2008) Design and synthesis of highly sensitive fluorogenic Competing Interests substrates for glutathione S-transferase and application for activity imaging The authors declare that they have no competing interests. in living cells. J Am Chem Soc 130:14533–14543 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 8 of 8 9. Liu CM, Monson CF, Yang TL, Pace H, Cremer PS (2011) Protein separation by electrophoretic-electroosmotic focusing on supported lipid bilayers. Anal Chem 83:7876–7880 10. Cao N, Zou XY, Huang YQ, Zhao YB (2015) Preparation of NiFe O 2 4 architectures for affinity separation of histidine-tagged proteins. Mater Lett 144:161–164 11. Ying LQ, Branchaud BP (2011) Purification of tetracysteine-tagged proteins by affinity chromatography using a non-fluorescent, photochemically stable bisarsenical affinity ligand. Bioconjug Chem 22:987–992 12. Li JL, Yang YS, Mao Z, Huang WJ, Qiu T, Wu QZ (2016) Enhanced resolution of DNA separation using agarose gel electrophoresis doped with graphene oxide. Nanoscale Res Lett 11:404–409 13. Lee SH, Yu H, Randall A, Zeng Z, Baldi P, Doong RA, Shea KJ (2012) Engineered synthetic polymer nanoparticles as IgG affinity ligands. J Am Chem Soc 134:15765–15772 14. Yu H, Lee H, Miura Y (2014) Interaction between synthetic particles and biomacromolecules: fundamental study of nonspecific interaction and design of nanoparticles that recognize target molecules. Polym J 46:537–545 15. Oh BK, Park S, Millstone JE, Lee SW, Lee KB, Mirkin CA (2006) Separation of tricomponent protein mixtures with triblock nanorods. J Am Chem Soc 128: 11825–11829 16. Xu F, Geiger JH, Baker GL, Bruening ML (2011) Polymer brush-modified magnetic nanoparticles for His-tagged protein purification. Langmuir 27: 3106–3112 17. Sahu SK, Chakrabarty A, Bhattacharya D, Ghosh SK, Pramanik PJ (2011) Single step surface modification of highly stable magnetic nanoparticles for purification of His-tag proteins. Nanopart Res 13:2475–2484 18. Goyal G, Lee YB, Darvish A, Ahn CW, Kim MJ (2016) Hydrophilic and size- controlled graphene nanopores for protein detection. Nanotechnology 27: 495301–495312 19. Vereshchaqina TA, Fedorchak MA, Sharonova OM, Fomenko EV, Shishkina 2+ NN, Zhizhaev AM, Kudryavtsev AN, Frank LA, Anshits AG (2016) Ni -zeolite/ 2+ ferrosphere and Ni -silica/ferrosphere beads for magnetic affinity separation of histidine-tagged proteins. Dalton Trans 45:1582–1592 20. Kim BJ, Piao YZ, Lee N, Park YI, Lee IH, Lee JH, Paik SR, Hyeon T (2010) Magnetic nanocomposite spheres decorated with NiO nanoparticles for a magnetically recyclable protein separation system. Adv Mater 22:57–60 21. Johnsson N, Johnsson K (2007) Chemical tools for biomolecular imaging. ACS Chem Biol 2:31–38 22. Mathieu LV, Ludovic SL, Olivier D (2008) Reduction of self-quenching in fluorescent silica-coated silver nanoparticles. Plasmonics 3:33–40 23. Wang J, You M, Zhu G, Shukoor MI, Chen Z, Zhao Z, Altman MB, Yuan Q, Zhu Z, Chen Y, Huang CZ, Tan W (2013) Photosensitizer-gold nanorod composite for targeted multimodal therapy. Small 9:3678–3684 24. Li Z, Shen W, Wang Z, Xiang X, Zu X, Wei Q, Wang L (2009) Direct formation of SiO /SnO composite nanoparticles with high surface area and 2 2 high thermal stability by sol-gel-hydrothermal process. J Sol-Gel Sci Technol 49:196–201 25. Delaunay A, Pflieger D, Barrault M, Vinh J, Toledano MB (2002) A thiol peroxidase is an H O receptor and redox-transducer in gene activation. 2 2 Cell 111:471–481 26. Miao Y, Lv D, Wang P, Wang XC, Chen J, Miao C, Song CP (2006) An Arabidopsis glutathione peroxidase functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Plant Cell 18: 2749–2766 27. Inaba K, Ito K (2002) Paradoxical redox properties of DsbB and DsbA in the protein disulfide-introducing reaction cascade. EMBO J 21:2646–2654 28. Kishigami S, Akiyama Y, Ito K (1995) Redox states of DsbA in the periplasm of Escherichia coli. FEBS Lett 364:55–58 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nanoscale Research Letters Springer Journals

Functionalized Nano-adsorbent for Affinity Separation of Proteins

Free
8 pages
Loading next page...
 
/lp/springer_journal/functionalized-nano-adsorbent-for-affinity-separation-of-proteins-yYaONE9vG3
Publisher
Springer US
Copyright
Copyright © 2018 by The Author(s).
Subject
Materials Science; Nanotechnology; Nanotechnology and Microengineering; Nanoscale Science and Technology; Nanochemistry; Molecular Medicine
ISSN
1931-7573
eISSN
1556-276X
D.O.I.
10.1186/s11671-018-2531-4
Publisher site
See Article on Publisher Site

Abstract

Thiol-functionalized silica nanospheres (SiO -SH NSs) with an average diameter of 460 nm were synthesized through a hydrothermal route. Subsequently, the prepared SiO -SH NSs were modified by SnO quantum dots to afford SnO / 2 2 2 SiO composite NSs possessing obvious fluorescence, which could be used to trace the target protein. The SnO /SiO 2 2 2 NSs were further modified by reduced glutathione (GSH) to obtain SnO /SiO -GSH NSs, which can specifically separate 2 2 glutathione S-transferase-tagged (GST-tagged) protein. Moreover, the peroxidase activity of glutathione peroxidase 3 (GPX3) separated from SnO /SiO -GSH NSs in vitro was evaluated. Results show that the prepared SnO /SiO -GSH NSs 2 2 2 2 exhibit negligible nonspecific adsorption, high concentration of protein binding (7.4 mg/g), and good reused properties. In the meantime, the GST-tagged GPX3 separated by these NSs can retain its redox state and peroxidase activity. Therefore, the prepared SnO /SiO -GSH NSs might find promising application in the rapid 2 2 separation and purification of GST-tagged proteins. Keywords: Silica nanospheres, SnO , Affinity separation, Peroxidase activity, Redox state Background protein solubility. These drawbacks, fortunately, could be The easy separation and purification of proteins are very overcame by applying nanomaterials to assist the separation important in xenobiotic biotransformation, drug metabol- and purification of the target proteins [15–19]. For example, ism, biosynthesis of prostaglandins and steroid hormones, magnetic SiO -NiO nanocomposite is capable of separating and degradation of aromatic amino acids [1–6]. The sepa- His-tagged proteins [20]. Nanomaterials, nevertheless, still rated proteins can be used for antigen and vaccine produc- have short legs in the separation of various proteins be- tion, molecular immunology and structural, and cause they are often inactive to visualization and fluores- biochemical and cell biological studies. Glutathione S-trans- cence techniques which can be used as sensitive ferase (GST) represents a major group of detoxification iso- biomolecular and medical diagnostic tools to combat bio- enzymes which can be used in GST gene fusion system and logical warfare [21–23]. In this sense, it is imperative to medicine effect targeting field or as tumor markers [7, 8]. find nanomaterials with fluorescent responses so as to Various methods such as precipitation, chromatography, promote their application in the separation and purifica- ultrafiltration, and dialysis are currently available for purify- tion of recombinant protein like glutathione peroxidase 3 ing various proteins, and in particular, affinity separation (GPX3). based on the natural biological affinity between biological We pay particular attention to nanoscale SnO quantum macromolecules and complementary ligands is of extraor- dots (QDs), because, as an n-type wide-bandgap (3.6 eV) dinary significance [9–14]. The successful production and semiconductor with good chemical stability and biocom- purification of full-length, soluble, and natural fusion pro- patibility, SnO exhibits optical absorbance in visible spec- teins, however, are still retarded by various obstacles such as tral region. Herein, we establish a smart pathway to the need for pretreatment to remove the cell debris and col- introduce fluorescent SnO QDs onto the surface of silica loid contaminants, a relatively long operation time, and nanospheres (NSs), hoping to develop a desired SnO / SiO nanostructure with potential application in the sep- aration and purification of GST-tagged proteins. Firstly, * Correspondence: zhaoyb902@henu.edu.cn; zhangzj09@126.com 1 thiol-functionalized silica nanospheres (SiO -SH NSs) Engineering Research Center for Nanomaterials, Henan University, Kaifeng 475004, China were prepared through a hydrothermal route. Resultant Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Zou et al. Nanoscale Research Letters (2018) 13:165 Page 2 of 8 SiO -SH NSs were compounded with SnO quantum (30 mL) to obtain SnO /SiO -SH NSs for three times, 2 2 2 2 dots to afford SiO /SnO composite NSs possessing which was dispersed in water (0.12 g/mL). 2 2 obvious fluorescence absorption. The SiO /SnO NSs 2 2 were further modified by reduced glutathione (GSH) Surface Modification of SnO /SiO -SH NSs 2 2 to obtain SiO /SnO -GSH NSs with potential for the Four milliliters of 0.12 g/mL SnO /SiO -SH NSs was 2 2 2 2 affinity separation of GST-tagged protein. The ability washed with PBS (0.01 mol/L, pH = 7.4) for three times. and the peroxidase activity of the prepared SnO / These SnO /SiO -SH NSs were added into 30 mL 16. 2 2 2 SiO -GSH NSs in separating GST-tagged proteins 7 mg/mL GSH solution and oscillated at 37 °C for 24 h were evaluated by SDS-PAGE analysis. (120 rev/min) with a constant temperature oscillator. At the end of oscillation, the mixed solution was centri- Experimental fuged to provide SnO /SiO -GSH NSs; then, the precipi- 2 2 Material and Methods tate was fully washed with 30 mL PBS (0.01 mol/L, pH Hexadecyltrimethyl ammonium bromide (CTAB), tin (IV) = 7.4) for three times to remove excessive GSH via phys- chloride (SnCl ), triethylamine (TEA), and isopropanol were ical adsorption, thereby affording desired SnO /SiO - 4 2 2 provided by Tianjin Kermel Chemicals Reagent Company GSH NSs. The resultant SnO /SiO -GSH NSs were 2 2 (Tianjin, China). AgNO was purchased from Tianjin added into alcohol (25%, v/v) and stored at 4 °C. Fuchen Technology Development Co., Ltd. (Tianjin, China). 3-Mercaptopropyl-trimethoxysilane (MPS) was offered by Separation of GST-Tagged Proteins Alfa-Aesar (Shanghai, China). Tetraethyl orthosilicate The mixed proteins were collected from the cell lysate (TEOS) was supplied by Tianjin Fuchen Chemicals (Tianjin, of Escherichia coli, which is by water lysis (concentration China). Dihydronicotinamide adenine dinuclectide phos- 0.01 mol/L, pH 7.4). For in vitro protein expression, the phate (NADPH), thioredoxin, and thioredoxin reductase protein region containing the coding sequence of gluta- were obtained from Sigma (Beijing, China). Glutathione thione peroxidase 3 (GPX3, amino acids 37–206), Open Sepharose 4B (Stockholm, USA) was from GE Healthcare. stomata 1 (OST1), and ABA insensitive 2 (ABI2, amino Dithiothreitol (DTT) was available from Aladdin Industrial acids 100–423) in Arabidopsis thaliana was cloned and Corporation (Inalco SPA, Italy). All chemical reagents were inserted in frame into the plasmid pGEX-6p1 (GPX3 of analytical reagent and used without any further was used as control). pGEX-GPX3, pGEX-OST1, and purification. pGEX-ABI2 constructs were introduced into E. coli BL21 (DE3) cells. The recombinant GST-tagged proteins Preparation of SnO Quantum Dots were purified using Glutathione Sepharose 4B and In a typical synthesis [24], 3.5 g SnCl ·5H O was added SnO /SiO -GSH NSs. The primers used for cloning the 4 2 2 2 into 50 mL H O, then 5 mL ammonia was added into genes were as follows: for GPX3, forward primer, 5′-G the solution under stirring. Subsequently, the precipita- ATGGATCCTCGCCATCGACGGTGGAACAA-3′; re- tion obtained by centrifugation was washed with deion- verse primer, 5′- CACCTCGAGTCAAGCAGATGCC ized water for several times to remove the excessive Cl AATAGCTT-3′; for OST1, forward primer, 5′- GCCGA ions. Thirty milliliters of deionized water was added into ATTCATGGATCGACCAGCAGTGA-3′; reverse pri- the obtained precipitate, and then, the pH of the mer, 5′- CCCGTCGACTCACATTGCGTACACAATC- solution was adjusted to be 12 by 2 mol/L ammonia. 3′; for ABI2, forward primer, 5′- GCGGAATTCGA The mixed solution was transferred into a Teflon-lined GAGTAGAAGTCTGTTTG-3′; reverse primer, 5′-GC stainless steel autoclave, sealed and heated at 150 °C for GCTCGAGTCAATTCAAGGATTTGCTC-3′. 24 h. Upon completion of heating, the mixed solution After being washed with PBS solution (0.01 mol/L, was cooled, centrifuged, and fully washed with ethanol- pH = 7.4), the prepared SnO /SiO -GSH NSs were dir- 2 2 isopropanol (volume ratio 1:1) to obtain SnO QDs. ectly introduced into 1000 μL E. coli lysate and shaken at 4 °C for 2 h (rotation speed: 90 rev/min) to allow the Preparation of SnO /SiO -SH NSs SnO /SiO -GSH NSs to capture GST-tagged proteins. 2 2 2 2 In a typical synthesis, 0.2 g SnO QDs and 0.09 g CTAB Upon completion of shaking, these NSs were isolated were dissolved in the mixed solvent of H O (42.5 mL) from the solution by centrifugation and fully washed and absolute alcohol (7 mL) under magnetic stirring with PBS solution to remove any residual uncaptured (200 G, r = 180 mm). Into resultant solution was added proteins. The GST-tagged protein-bound SnO /SiO - 2 2 2.7 mL TEA under additional 20 min of stirring. The GSH NSs were washed with 300 μL and 0.5 mol/L GSH mixed solution was heated at 60 °C for 5 h while 3.5 mL solution for three times to disassociate GST-tagged pro- TEOS and 0.35 mL of MPS were slowly dropped, teins from their surface. Separately collected protein followed by centrifuging (12,800 G, r = 180 mm) and solutions were detected by sodium dodecylsulfate poly- fully washing with HCl-ethanol (30 mL) and water acrylamide gel electrophoresis (SDS-PAGE). The Zou et al. Nanoscale Research Letters (2018) 13:165 Page 3 of 8 concentration of the separated proteins was determined GPX3 was used for in vitro analysis of redox states. Ex- by BCA protein Assay Kit. The SnO /SiO -GSH NSs tracts were evaluated by nonreducing 15% SDS-PAGE gel. 2 2 can be reused to separate the target proteins for several times by the same method. Characterization The morphology and composition of the prepared SnO /SiO -GSH NSs were analyzed by transmission 2 2 Measurement of Glutathione Peroxidase Activity electron microscopy (TEM, JEM-2010, Japan), scanning The separated GPX3 activity was measured by the spectro- electron microscopy (SEM, JSM 5600LV, Japan), X-ray metric determination of NADPH consumption at 340 nm diffraction (XRD, X’ Pert Philips, Holland), and fluores- as described by Delaunay et al. [25]. The GST tag was cut cence spectrometer (FL, FluoroSENS, Britain, at the off by PreScission protease from GST-tagged GPX3, and excitation wavelength of 260 nm). The separated GST- then, the GPX3 was used for activity analysis. Firstly, 98 μL tagged proteins were detected with sodium dodecylsul- reaction buffer solution (including 100 mmol/L Tris-Cl, 0. fate polyacrylamide gel electrophoresis (SDS-PAGE, 3mmol/LNADPH,1.34 μmol/L thioredoxin, and 0. Power PAC 300, China), with the preconcentration volt- 18 μmol/L thioredoxin reductase from E. coli lysate) was age of 70 V and the separation voltage of 120 V. The added into a tube; after mixing completely, 1.35 μmol puri- constant temperature oscillator was from Shanghai fied GPX3 was added into the resultant reaction buffer solu- ChemStar Instruments, Co., Ltd. (ATS-03M2R, China). tion. Then, the mixed solution was added into 2 μLH O 2 2 The concentration of the separated proteins was deter- (5 mmol/L) to initiate the reaction and NADPH consump- mined by BCA protein Assay Kit (Beijing CoWin tion at 340 nm was collected by the spectrometric Biotech, China). determination. Results and Discussion Analysis of Redox States of Purified GPX3 TEM, SEM, XRD, and Fluorescent Analyses of SnO QDs The GST tag was cut off from GST-tagged GPX3 by Pre- and SnO /SiO -GSH NSs 2 2 Scission protease. The separated GPX3 was treated with Figure 1 gives the high-resolution TEM (HRTEM) images 5mmol/LH O and 1 mmol/L DTT for 10 min to change and XRD pattern of the synthesized SnO QDs. It can be 2 2 2 the redox states of the purified GPX3. The resultant seen that the synthesized SnO QDs are of spherical shape a b c d Fig. 1 TEM (a), HRTEM (b) images, selected area electron diffraction pattern (c) and XRD pattern (d) of prepared SnO QDs 2 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 4 of 8 and have an average diameter of 5 nm, which exhibits a 23° (JCPDS card no. 76-0933), which indicates that narrow particle size distribution (Fig. 1a), and their lattice SnO possessing visible light response has been success- spacing of (110) plane is 0.29 nm (Fig. 1b). The well- fully introduced onto the surface of SiO NSs. Figure 3b resolved lattice image demonstrates that the prepared shows the fluorescent spectrum of SnO /SiO -GSH NSs 2 2 SnO QDs have a highly ordered crystalline structure. at 368 nm. It can be seen that SnO /SiO -GSH displays 2 2 2 Corresponding selected area electron diffraction pattern intense fluorescent emission, which is attributed to oxy- of SnO QDs (Fig. 1c) can be indexed to a single Cassiter- gen vacancies of SnO . Figure 3c gives the fluorescence 2 2 ite phase, which is consistent with the relevant XRD pat- imaging of SnO /SiO -GSH NSs when these NSs are 2 2 tern (Fig. 1d). Namely, the characteristic peaks at 2 theta used to separate GST-tagged GPX3 in E. coil lysate. It = 26.6° (110), 33.9° (101), 38.0° (200), 51.8° (211), 65.9° can be seen that there are obvious green fluorescence (301), and 78.7° (321) are consistent with the standard where the prepared SnO /SiO -GSH NSs are used. It in- 2 2 XRD data of Cassiterite SnO (JCPDS card no. 41-1445). dicates that SnO was modified on the surface of SiO 2 2 2 Besides, the intense XRD peaks indicate that the prepared and the SnO /SiO -GSH NSs have good fluorescence 2 2 SnO QDs are well crystallized, and the absence of other properties. characteristic peaks suggests that they do not contain hematite or hydroxide impurities. SDS-PAGE Analysis Figure 2 gives the SEM and TEM images of SnO / To estimate the ability of the prepared SnO /SiO -GSH 2 2 2 SiO -GSH NSs. It can be seen that the prepared SnO / NSs in separating GST-tagged proteins, we conducted 2 2 SiO -GSH NSs are of a spherical shape and have an aver- SDS-PAGE analysis. Figure 4 shows the SDS-PAGE ana- age diameter of about 430 nm, and their surface seems to lysis result of the GST-tagged GPX3 separated by SnO / be somewhat rough (Fig. 2a, b). In the meantime, it can be SiO -GSH NSs. It can be seen that the SnO /SiO -GSH 2 2 2 seen that the SnO QDs (about 5–15 nm) are modified on NSs can efficiently enrich target proteins from E. coli lys- the surface of SiO microspheres (Fig. 2c, d), which is con- ate, and in particular, the quantity of the disassociated sistent with the corresponding SEM images. It is indicated proteins tends to increase with incremental concentration that the SnO and silica NSs have been aggregated. of GSH in the range of 10–100 mmol/L (lanes 3–6 in Fig. Figure 3a gives the XRD pattern of the synthesized 4a). It is clear that the target proteins can be separated SnO /SiO -GSH NSs. The major peaks at 2 theta = 110°, specifically by the prepared SnO /SiO -GSH NSs from the 2 2 2 2 101°, 200°, 211°, 301°, and 321° are consistent with those E. coli lysate and there was hardly any nonspecific. of SnO (Fig. 1d). Besides, SnO /SiO -GSH NSs show an In order to investigate the reused properties of the 2 2 2 intense characteristic peak of amorphous silica around prepared SnO /SiO -GSH NSs, we repeatedly used them 2 2 Fig. 2 SEM (a, b) and TEM (c, d) images of the prepared SnO /SiO -GSH NSs 2 2 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 5 of 8 Fig. 3 XRD pattern (a), fluorescence spectrum (b), and fluorescence imaging (c) of prepared SnO /SiO -GSH NSs 2 2 to separate GST-tagged GPX3. As shown in Fig. 4b(lane 1 To test the universality of the synthesized SnO /SiO - 2 2 refers to the marker, lane 2 refers to GST-GPX3-contained GSH NSs for purifying GST-tagged proteins, we selected E. coli lysate, lane 3 refers to 1st separation, lane 4 refers to three kinds of GST-tagged proteins (GST-tagged GPX3, 2nd separation, lane 5 refers to 3rd separation, and lane 6 GST-tagged OST1, and GST-tagged ABI2) to conduct refers to the fractions washed off from Glutathione Sephar- experiments. As shown in Fig. 5, GST-tagged GPX3, ose 4B), the synthesized SnO /SiO -GSH NSs exhibit spe- OST1, and ABI2 proteins can be separated specifically 2 2 cial selectivity towards GST-tagged GPX3 extracted from E. by SnO /SiO -GSH NSs from the E. coli lysate (lanes 3, 2 2 coli lysate, and their specificity and affinity remain un- 6, 9); then, we can get both GPX3 (cut off the GST tag affected after three cycles of repeat separation. from SnO /SiO -GSH NSs binding GST-tagged GPX3) 2 2 Fig. 4 SDS-PAGE analysis of purified GST-tagged proteins separated by SnO /SiO -GSH NSs. a Lane 1, marker; lane 2, E. coli lysate; lanes 3–6 refer 2 2 to the fractions washed off from the SnO /SiO -GSH NSs with different concentrations of GSH solution (lane 1, 10 mmol/L; lane 2, 20 mmol/L; lane 2 2 3, 50 mmol/L; lane 4, 100 mmol/L). b Lane 1, marker; lane 2, E. coli lysate; lane 3, 1st separation; lane 4, 2nd separation; lane 5, 3rd separation; and lane 6, the fractions washed off from the Glutathione Sepharose 4B Zou et al. Nanoscale Research Letters (2018) 13:165 Page 6 of 8 Fig. 5 SDS-PAGE analysis of the purified recombinant GPX3, OST1, and ABI2 proteins. Lanes 1, 4, and 7, E. coli lysate; lanes 2, 5, and 8, the proteins eluted from commercial Glutathione Sepharose 4B (GE Healthcare, USA); lanes 3, 6, and 9, the proteins eluted from SnO /SiO -GSH NSs; lane 10, the 2 2 marker; lanes 11 and 13, GPX3 obtained after the GST tag is cut off from Glutathione Sepharose 4B bound GST-GPX3 and SnO /SiO -GSH NSs bound 2 2 GST-tagged GPX3; lanes 12 and 14, GST tag eluted from Glutathione Sepharose 4B and SnO /SiO -GSH NSs 2 2 and GST tag eluted from SnO /SiO -GSH NSs (lane 13, Sepharose 4B (lanes 1 and 2) and SnO /SiO -GSH NSs 2 2 2 2 the GPX3; lane 14, the GST tag), which has a similar ef- (lanes 3 and 4) have the oxidized and reduced states, fect with Glutathione Sepharose 4B (lanes 2, 5, 8, 11, and the reduced GPX3 migrates more slowly than the 12). The concentrations of purified proteins by SnO / oxidized counterpart. This is well consistent with our SiO -GSH NSs were 7.4 mg/g (GST-tagged GPX3), 7. previous findings that GPX3 is present in oxidized and 1 mg/g (GST-tagged OST1), and 6.8 mg/g (GST-tagged reduced states in vitro, and its reduced and oxidized ABI2), which indicate that SnO /SiO -GSH NSs are forms can be separated as a result of modification of the 2 2 good to purify GST-tagged proteins from the E. coli lys- reduced Cys residues [26–28]. ate. In order to compare the binding capacity between the Figure 6b shows the assays of peroxidase activity of prepared SnO /SiO -GSH NSs and the other material, GPX3: line GPX3*, complete assay of the purified GPX3 2 2 Glutathione Sepharose 4B (purchased in Stockholm, USA) in the presence of Glutathione Sepharose 4B, thiore- was used as comparison experiment material. The total doxin, thioredoxin reductase, NADPH, and H O ; line 2 2 proteins purified by Glutathione Sepharose 4B were 7. GPX3, complete reaction among SnO /SiO -GSH NSs 2 2 1 mg/mL (GST-tagged GPX3), 6.9 mg/mL (GST-tagged separated GPX3, thioredoxin, thioredoxin reductase, OST1), and 5.6 mg/mL (GST-tagged ABI2), respectively. It NADPH, and H O ; line No GPX3, complete reaction in 2 2 can be seen that the binding capacity of the prepared the absence of GPX3; and line No Trx, complete reac- SnO /SiO -GSH NSs is higher than that of commodity 4B. tion in the absence of thioredoxin. Figure 6b shows the 2 2 glutathione peroxidase activity of the purified GPX3 sep- Analysis of Redox State and Peroxidase Activity of GST- arated from Glutathione Sepharose 4B and SnO /SiO - 2 2 Tagged GPX3 GSH NSs in vitro. It can be seen that, with thioredoxin In order to analyze the redox state and activity of GST- as the substrate, the purified GPX3 exhibits significant tagged GPX3 separated by the prepared SnO /SiO -GSH peroxidase activity, which indicates that the GPX3 sepa- 2 2 NSs, we cut off the GST tag to obtain the separated rated from SnO /SiO -GSH NSs is existent in the 2 2 GPX3. Figure 6a shows given in vitro assays of GPX3 natural state. redox state (corresponding to a representative gel from three independent experiments). Lanes 1 and 2 refer to Conclusions GPX3 obtained after the GST tag is cut off from Gluta- A facile method is established to fabricate silica- thione Sepharose 4B bound GST-tagged GPX3 (lane 1 is protected SnO QD nanospheres (SnO /SiO NSs). The 2 2 2 the oxidized GPX3 and lane 2 is the reduced GPX3); SnO /SiO NSs are further modified by glutathione to 2 2 lanes 3 and 4 refer to GPX3 obtained after the GST tag afford SnO /SiO -GSH NSs for the affinity separation of 2 2 is cut off from SnO /SiO -GSH bound GST-tagged glutathione S-transferase-tagged (GST-tagged) recom- 2 2 GPX3 (lane 3 is the oxidized GPX3 and lane 4 is the re- binant protein. Findings indicate that, in terms of the duced GPX3); lane 5 refers to the marker. As shown in ability to separate GST-tagged GPX3, GST-tagged LOV, Fig. 6a, the purified GPX3 separated from Glutathione and GST-tagged ABI2, the prepared SiO /SiO -GSH 2 2 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 7 of 8 ab Fig. 6 a In vitro assays of GPX3 redox state: lanes 1 and 3 (the oxidized GPX3) and 2 and 4 (the reduced GPX3) refer to GPX3 obtained after the GST tag is cut off from Glutathione Sepharose 4B and SnO /SiO -GSH bound GST-tagged GPX3, respectively; lane 5, marker. b Assays of peroxidase activity 2 2 of GPX3 NSs exhibit specific separation, high concentration of Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in protein binding, and good reused properties. Besides, published maps and institutional affiliations. the GPX3 separated from the GST-tagged GPX3 retains its redox states in vitro and GPX activity as well, which Author details Engineering Research Center for Nanomaterials, Henan University, Kaifeng means that the prepared SnO /SiO -GSH NSs might 2 2 475004, China. National & Local Joint Engineering Research Center for have a promising potential for the rapid separation and Applied Technology of Hybrid Nanomaterials, Henan University, Kaifeng purification of GST-tagged proteins. 475004, China. Collaborative Innovation Center of Nano Functional Materials and Applications of Henan Province, Henan University, Kaifeng 475004, China. Institute of Plant Stress Biology-State Key Laboratory of Cotton Abbreviations Biology, Henan University, Kaifeng 475004, China. ABI2: ABA insensitive 2; CTAB: Hexadecyltrimethyl ammonium bromide; DTT: Dithiothreitol; GPX3: Peroxidase activity of glutathione peroxidase 3; Received: 22 September 2017 Accepted: 16 April 2018 GSH: Reduced glutathione; GST-tagged: Glutathione S-transferase-tagged; MPS: 3-Mercaptopropyl-trimethoxysilane; NADPH: Dihydronicotinamide adenine dinuclectide phosphate; OST1: Open stomata 1; QDs: Quantum dots; SDS-PAGE: Sodium dodecylsulfate polyacrylamide gel electrophoresis; References SEM: Scanning electron microscopy; SiO -SH NSs: Thiol-functionalized silica 1. Seto H, Ogata Y, Murakami T, Hoshino Y, Miura Y (2012) Selective protein nanospheres; SnCl : Tin (IV) chloride; TEA: Triethylamine; TEM: Transmission separation using siliceous materials with a trimethoxysilane-containing electron microscopy; TEOS: Tetraethyl orthosilicate; XRD: X-ray diffraction glycopolymer. ACS Appl Mater Interfaces 4:411–417 2. Vilt ME, Ho WSW (2010) Selective separation of cephalexin from multiple component mixtures. Ind Eng Chem Res 49:12022–12030 Funding 3. Liu C, Monson CF, Yang T, Pace H, Cremer PS (2011) Protein separation by The authors acknowledge the financial support provided by the Scientific electrophoretic-electroosmotic focusing on supported lipid bilayers. Anal Research Fund Project of Henan University of China (grant no. 2015YBZR032), Chem 83:7876–7880 The project of scientific and technological breakthrough in Jiyuan of China 4. Steppert P, Burgstaller D, Klausberge M, Berger E, Aguilar PP, Schneider TA, (grant No. 17022011); The National Natural Science Foundation of China Kramberqer P, Tover A, Nöbauer K, Razzazi-Fazeli E, Junqbauer A (2016) (grant No. 21571051); Major science and technology project in Henan Purification of HIV-1 gag virus-like particles and separation of other province of China (grant No.181100310600), National Natural Science extracellular particles. J Chromatogr A 1455:93–101 Foundation of China (grant no. 9117002), Major State Basic Research Development Program of China (973 program, grant no. 2012CB114301), and 5. Yoshimatsu K, Yamazaki T, Hoshino Y, Rose PE, Epstein LF, Miranda LP, Open Fund of Key Laboratory for Monitoring and Remediation of Heavy Tagari P, Beierle JM, Yonamine Y, Shea KJ, Miura Y (2014) Epitope discovery Metal polluted Soil of Henan Province. for a synthetic polymer nanoparticle: a new strategy for developing a peptide tag. J Am Chem Soc 136:1194–1197 6. Yu H, Arata Y, Yonamine Y, Lee SH, Yamasaki A, Tsuhara R, Yano K, Shea KJ, Availability of Data and Materials Miura Y (2015) Preparation of nanogel-immobilized porous gel beads for All data are fully available without restriction. affinity separation of proteins: fusion of nano and micro gel materials. Polym J 47:220–225 7. Park SM, Jung HY, Chung KC, Rhim H, Park JH, Kim J (2002) Stress-induced Authors’ Contributions aggregation profiles of GST-alpha-synuclein fusion proteins: role of the C- XYZ, FBY, XS, and MMQ performed the design, analyzed the data, and terminal acidic tail of alpha-synuclein in protein thermosolubility and drafted the manuscript. YBZ and ZJZ guided the idea and the simulations stability. Biochemistry 41:4137–4146 and checked the figures. All authors read and approved the final manuscript. 8. Fujikawa Y, Urano Y, Komatsu T, Hanaoka K, Kojima H, Terai T, Inoue H, Nagano T (2008) Design and synthesis of highly sensitive fluorogenic Competing Interests substrates for glutathione S-transferase and application for activity imaging The authors declare that they have no competing interests. in living cells. J Am Chem Soc 130:14533–14543 Zou et al. Nanoscale Research Letters (2018) 13:165 Page 8 of 8 9. Liu CM, Monson CF, Yang TL, Pace H, Cremer PS (2011) Protein separation by electrophoretic-electroosmotic focusing on supported lipid bilayers. Anal Chem 83:7876–7880 10. Cao N, Zou XY, Huang YQ, Zhao YB (2015) Preparation of NiFe O 2 4 architectures for affinity separation of histidine-tagged proteins. Mater Lett 144:161–164 11. Ying LQ, Branchaud BP (2011) Purification of tetracysteine-tagged proteins by affinity chromatography using a non-fluorescent, photochemically stable bisarsenical affinity ligand. Bioconjug Chem 22:987–992 12. Li JL, Yang YS, Mao Z, Huang WJ, Qiu T, Wu QZ (2016) Enhanced resolution of DNA separation using agarose gel electrophoresis doped with graphene oxide. Nanoscale Res Lett 11:404–409 13. Lee SH, Yu H, Randall A, Zeng Z, Baldi P, Doong RA, Shea KJ (2012) Engineered synthetic polymer nanoparticles as IgG affinity ligands. J Am Chem Soc 134:15765–15772 14. Yu H, Lee H, Miura Y (2014) Interaction between synthetic particles and biomacromolecules: fundamental study of nonspecific interaction and design of nanoparticles that recognize target molecules. Polym J 46:537–545 15. Oh BK, Park S, Millstone JE, Lee SW, Lee KB, Mirkin CA (2006) Separation of tricomponent protein mixtures with triblock nanorods. J Am Chem Soc 128: 11825–11829 16. Xu F, Geiger JH, Baker GL, Bruening ML (2011) Polymer brush-modified magnetic nanoparticles for His-tagged protein purification. Langmuir 27: 3106–3112 17. Sahu SK, Chakrabarty A, Bhattacharya D, Ghosh SK, Pramanik PJ (2011) Single step surface modification of highly stable magnetic nanoparticles for purification of His-tag proteins. Nanopart Res 13:2475–2484 18. Goyal G, Lee YB, Darvish A, Ahn CW, Kim MJ (2016) Hydrophilic and size- controlled graphene nanopores for protein detection. Nanotechnology 27: 495301–495312 19. Vereshchaqina TA, Fedorchak MA, Sharonova OM, Fomenko EV, Shishkina 2+ NN, Zhizhaev AM, Kudryavtsev AN, Frank LA, Anshits AG (2016) Ni -zeolite/ 2+ ferrosphere and Ni -silica/ferrosphere beads for magnetic affinity separation of histidine-tagged proteins. Dalton Trans 45:1582–1592 20. Kim BJ, Piao YZ, Lee N, Park YI, Lee IH, Lee JH, Paik SR, Hyeon T (2010) Magnetic nanocomposite spheres decorated with NiO nanoparticles for a magnetically recyclable protein separation system. Adv Mater 22:57–60 21. Johnsson N, Johnsson K (2007) Chemical tools for biomolecular imaging. ACS Chem Biol 2:31–38 22. Mathieu LV, Ludovic SL, Olivier D (2008) Reduction of self-quenching in fluorescent silica-coated silver nanoparticles. Plasmonics 3:33–40 23. Wang J, You M, Zhu G, Shukoor MI, Chen Z, Zhao Z, Altman MB, Yuan Q, Zhu Z, Chen Y, Huang CZ, Tan W (2013) Photosensitizer-gold nanorod composite for targeted multimodal therapy. Small 9:3678–3684 24. Li Z, Shen W, Wang Z, Xiang X, Zu X, Wei Q, Wang L (2009) Direct formation of SiO /SnO composite nanoparticles with high surface area and 2 2 high thermal stability by sol-gel-hydrothermal process. J Sol-Gel Sci Technol 49:196–201 25. Delaunay A, Pflieger D, Barrault M, Vinh J, Toledano MB (2002) A thiol peroxidase is an H O receptor and redox-transducer in gene activation. 2 2 Cell 111:471–481 26. Miao Y, Lv D, Wang P, Wang XC, Chen J, Miao C, Song CP (2006) An Arabidopsis glutathione peroxidase functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Plant Cell 18: 2749–2766 27. Inaba K, Ito K (2002) Paradoxical redox properties of DsbB and DsbA in the protein disulfide-introducing reaction cascade. EMBO J 21:2646–2654 28. Kishigami S, Akiyama Y, Ito K (1995) Redox states of DsbA in the periplasm of Escherichia coli. FEBS Lett 364:55–58

Journal

Nanoscale Research LettersSpringer Journals

Published: May 30, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off