Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer

Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell... Background: Breast cancer (BC) is highly heterogeneous with ~ 60–70% of estrogen receptor positive BC patient’s response to anti-hormone therapy. Estrogen receptors (ERs) play an important role in breast cancer progression and treatment. Estrogen related receptors (ERRs) are a group of nuclear receptors which belong to orphan nuclear receptors, which have sequence homology with ERs and share target genes. Here, we investigated the possible role and clinicopathological importance of ERRβ in breast cancer. Methods: Estrogen related receptor β (ERRβ) expression was examined using tissue microarray slides (TMA) of Breast Carcinoma patients with adjacent normal by immunohistochemistry and in breast cancer cell lines. In order to investigate whether ERRβ is a direct target of ERα, we investigated the expression of ERRβ in short hairpin ribonucleic acid knockdown of ERα breast cancer cells by western blot, qRT-PCR and RT-PCR. We further confirmed the binding of ERα by electrophoretic mobility shift assay (EMSA), chromatin immunoprecipitation (ChIP), Re-ChIP and luciferase assays. Fluorescence-activated cell sorting analysis (FACS) was performed to elucidate the role of ERRβ in cell cycle regulation. A Kaplan-Meier Survival analysis of GEO dataset was performed to correlate the expression of ERRβ with survival in breast cancer patients. Results: Tissue microarray (TMA) analysis showed that ERRβ is significantly down-regulated in breast carcinoma tissue samples compared to adjacent normal. ER + ve breast tumors and cell lines showed a significant expression of ERRβ compared to ER-ve tumors and cell lines. Estrogen treatment significantly induced the expression of ERRβ and it was ERα dependent. Mechanistic analyses indicate that ERα directly targets ERRβ through estrogen response element and ERRβ cip also mediates cell cycle regulation through p18, p21 and cyclin D1 in breast cancer cells. Our results also showed the up-regulation of ERRβ promoter activity in ectopically co-expressed ERα and ERRβ breast cancer cell lines. Fluorescence- activated cell sorting analysis (FACS) showed increased G0/G1 phase cell population in ERRβ overexpressed MCF7 cells. Furthermore, ERRβ expression was inversely correlated with overall survival in breast cancer. Collectively our results suggest cell cycle and tumor suppressor role of ERRβ in breast cancer cells which provide a potential avenue to target ERRβ signaling pathway in breast cancer. Conclusion: Our results indicate that ERRβ is a negative regulator of cell cycle and a possible tumor suppressor in breast cancer. ERRβ could be therapeutic target for the treatment of breast cancer. Keywords: Breast cancer, Estrogen receptor α (ERα), Estrogen related receptor β (ERRβ), Estrogen/17beta-estradiol (E2), Promoter, Tissue microarray (TMA), ChIP, Re-ChIP, Fluorescence-activated cell sorting analysis (FACS) * Correspondence: sandipkmishra@hotmail.com Cancer Biology Lab, Institute of Life Sciences, Nalco Square, Chandrasekharpur, Bhubaneswar, Odisha 751023, India Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 2 of 15 Background through estrogen in breast cancer. We demonstrated Breast cancer (BC) is the second leading cause of deaths the elevated levels of ERRβ in normal breast tissues and in women worldwide. The occurrence rate of male BC is ER + ve breast tumors compared to breast carcinoma rare; it is the most predominant cancer in women in and ER-ve breast tumors respectively. We also demon- United States (US) [1]. It has been estimated that 2,52,710 strated that ectopic expression of ERRβ causes signifi- cip new cases and 40,610 deaths are expected in women cant up-regulation of p18 and p21 in breast cancer during the year 2017 in U.S alone [2]. BC has been cells and also arrest cell cycle in G0/G1 phase. Thus recently classified based on molecular patterns of gene our data, suggest the tumor suppressor role of ERRβ expression into different subtypes [3]. Luminal subtype which provide therapeutic potential to ERRβ signaling which is characterized by the presence of estrogen recep- pathway. tor (ER) comprises ~ 60–70% of BC and responds better to endocrine therapy i.e.; tamoxifen [4]. However, due to Methods lack of therapy ER negative BC demands to identify mo- Tissue microarray lecular targets that might have therapeutic importance. Breast cancer tissue microarray slides (Cat No. BR ERs are a group of nuclear receptors regulated by ster- 243v, BR 246a) were purchased from US Biomax oid hormone estrogen (E2). ERs are of three types; ERα, (Rockville, MD, USA). The slides were stained by ERβ and ERγ [5]. In the presence of E2, ERs either as a anti-ERRβ antibody at 1:50 dilution (sc-68879, Santa homodimer or heterodimer bind to estrogen response Cruz, Dallas, TX, USA) and were further processed elements (ERE) present in the target gene promoter to using ABC system (Vector Laboratories, Bulingame, regulate its transcriptional activity [6–9]. ERα and ERβ CA, USA) as described previously [38]. The images expresses widely in different tissues including brain [10]. were captured under Leica microscope (Wetzlar, Although ERα causes cell migration, division, tumor Germany) using LAS EZ software version 2.1.0. The growth in response to E2 [11, 12], ERβ inhibits migration, slides were examined and scoring was done by an proliferation and invasion of breast cancer cells [13–15]. experienced pathologist. The intensity score was calcu- Besides being a key molecule in breast cancer pathogen- lated based on staining for ERRβ and was assigned from 0 esis, ERα plays an anti-inflammatory role in brain [16]. to 3 (0 indicating no staining; 1+ weakly stained; 2+ Estrogen related receptors (ERRs) are a group of moderately stained and 3+ strongly stained positively). nuclear receptors family having sequence homology The percentage of positively stained cells were scored with ERsand actastranscriptional regulators [17]. Un- as follows, 0- no positive staining; 1+, 1–25% positively like ERs, ERRs are lesser known affected by steroid hor- stained cells; 2+, 26–50% positively stained cells; 3+, mone estrogen. Since a decade after discovery, no 51–70% positively stained cells; 4+, > 70% positively natural ligand has been found for these receptors, stained cells. The composite score was calculated using hence called as orphan nuclear receptors [18, 19]. Es- both intensity score and the percentage of positive trogen related receptors (ERRs) share target genes with cells as it is a product of both scores. The composite ERs [20, 21]. Estrogen related receptors (ERRs) are also score range was given from 0 to 12. The samples of 3 types; ERRα,ERRβ and ERRγ [22–25]. ERRs scored < 3 were considered as low categorized; 3–5 recognize a short sequence referred as ERR- responsive moderately categorized; ≥ 6 highly categorized. The element (ERRE) on target gene promoter and regulate graph was plotted using composite scores using their transcriptional activity [26–29]. The distribution GraphPad Prism version 6.01. of ERRs varies, although ERRα expresses in various tis- sues such as kidney, skeletal muscle, intestinal tract etc, Cell culture and treatment but ERRγ restrict themselves mainly in heart and kid- Human estrogen receptor positive breast cancer cell ney [30, 31]. ERRα mediates cell proliferation through lines (MCF7 and T47D) and estrogen receptor negative pS2 [21] and plays an important role in regulation of breast cancer cell line (MDA-MB231) were purchased mitochondrial metabolism in breast cancer cells [29, from cell repository of National Center for Cell Sciences 32]. Knockdown of ERRα leads to cardiac arrest in mice (NCCS, Pune, India) and were cultured and maintained [33]. ERRβ expresses in early stages of mouse embry- as described previously [39]. MCF10A was a kind gift onic development [34]. Mutation in ERRβ leads to from Dr. Annapoorni Rangarajan (IISc, Bangalore, India) autosomal recessive non syndromic hearing impairment was maintained as previously described [40]. For estro- in mice [35]. ERRβ acts as tumor suppressor in prostate gen treatments, MCF7 and T47D cell lines were grown cip cancer by up-regulating p21 [36]. Recent studies have in phenol red free medium for 48 h prior to demonstrated the abrogated expression of ERRβ in 17beta-estradiol (E2) (Sigma-Aldrich, St. Louis, MO, breast cancer cells [37]. In this studywehavedemon- USA) treatment. MCF7 cells were treated with10 and strated that ERα regulates the expression of ERRβ 100 nM E2 concentrations for different time points 0, 6, Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 3 of 15 12, 24, 48 h. For inhibition studies, MCF7 cells were Scientific, Waltham, MA, USA) restriction enzymes for treated with 1 μM of tamoxifen (Sigma-Aldrich) [41], 4 h at 37 °C and purified. The restriction digested PCR 10 nM E2 individually and in combination with both for product and PGL3 vectors were ligated using T4 DNA 24 h prior to harvesting of cells. MCF7 cells were ligase (New England BioLabs, Inc., Ipswich, MA, USA) transfected with ERα shRNA (SHCLND-NM_000125, and clone was confirmed by sequencing and designated Sigma-Aldrich) and were culture and maintained for as pGL3-ERRβ. 48 h prior to further experiments. Total RNA isolation and real-time PCR Cloning of 5′ flanking region of ERRβ gene Total RNA was isolated from MCF7, T47D, MDA Genomic DNA was isolated from MCF7 cells as per the MB-231 and ERα KD cells using Tri reagent (Sig- standard protocol [42]. A 1014 bp genomic fragment of ma-Aldrich). A total of 500 ng was digested with the ERRβ gene, from − 988 to + 26 bp relative to the DNase-I enzyme (Sigma-Aldrich) and was subjected to start sequence of exon1 (designated as + 1) was ampli- cDNA synthesis using superscript II first strand fied by PCR using 50–100 nanograms of genomic DNA synthesis kit (Thermo Scientific). Reverse transcrip- as a template. The genomic fragment was amplified with tion PCR and Quantitative reverse transcription PCR KpnI and XhoI restriction sites using primer sequences was performed using primers provided in Table 1. provided in Table 1. The parameters of PCR reaction GAPDH was taken as an internal control and ΔΔCT were as follows: initial denaturation 95 °C for 5 min, values were calculated for Quantitative reverse tran- 35 cycles of 95 °C for 30 s, 56 °C for 30 s, 72 °C for scription PCR. The Quantitative reverse transcription 1 min and a final extension of 72 °C for 10 min. The PCR results were plotted using GraphPad Prism amplified samples were resolved in 0.8% (w/v) agarose version 6.01. gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. Preparation of cell extracts and western blotting Both the purified PCR product and PGL3 basic lucifer- The whole cell lysates from breast cancer cell lines ase vector were digested using KpnI and XhoI (Thermo (MCF10A, MCF7, T47D, MDA MB-231) were pre- pared using RIPA buffer (500 mM NaCl, 5 mM MgCl , 1% Na deoxycholate, 20 mM Tris-HCl (pH 8.0), 10% Table 1 List of primers glycerol, 1 mM EDTA, 100 mM EGTA, 0.1% NP40, 1% S.No Oligos Sequence (5′-3′) Triton X-100, 0.1 M Na VO , 1X Protease inhibitor). 3 4 1 ERRβ Promoter F ACAGGTACCTTGTACTCCAGTCTGGGCGA Approximately 20–40 microgram of protein was separated using 10–12% SDS-polyacrylamide gel and 2 ERRβ Promoter R ACACTCGAGATGTCCCTGACCACACCTCT transferred onto PVDF membrane (GE Healthcare Life 3 RT-ERα F AGCTCCTCCTCATCCTCTCC Sciences, Chalfont, UK). Blots were incubated with 5% 4 RT-ERα R TCTCCAGCAGCAGGTCATAG nonfat milk for blocking and were further incubated 5 RT-ERRβ F CTATGACGACAAGCTGGTGT with 1 μg each of subsequent antibodies ERα (8644, 6 RT-ERRβ R CCTCGATGTACATGGAATCG Cell signaling technology, Danvers, MA, USA), ERRβ cip 7 RT-p21 F GAGGCCGGGATGAGTTGGGAGGAG (Sc-68879, Santa Cruz) [37], α-tubulin (Sigma-Al- cip drich), cyclin D1 (2978, Cell Signaling Technology), 8 RT-p21 R CAGCCGGCGTTTGGAGTGGTAGAA cip p21 (2947, Cell Signaling Technology), p18 (2896, 9 RT-GAPDH F AAGATCATCAGCAATGCCTC Cell Signaling Technology) followed by corresponding 10 RT-GAPDH R CTCTTCCTCTTGTGCTCTTG HRP labeled secondary antibody. The blot was incu- 11 ERRβ EMSA Site 1F GGACAAAAATAAGGTCAAGTTTCTTTGTTA bated with ECL (Santa Cruz) for 5 min and visualized 12 ERRβ EMSA Site 1R TAACAAAGAAACTTGACCTTATTTTTGTCC in Chemidoc XRS+ molecular 228 imager (Bio-Rad, 13 ERRβ EMSA Site 2F ATTTAATGAGACAGGTCATTCATTCAGTCA Hercules, CA, USA). α-tubulin wasconsideredasa loading control. The western blot images were quanti- 14 ERRβ EMSA Site 2R TGACTGAATGAATGAATGACCTGTCTCAT TAAAT fied using Image J software (NIH, Bethesda, MD, USA). 15 ERRβ chip ERE Site CCAGTCTGGGCGACAAGAGTGAAACTC 1F 16 ERRβ chip ERE Site CCATTACAGTGGATTGTGGAG Electrophoretic mobility shift assay 1R The nuclear fractions were isolated as described 17 ERRβ chip ERE Site CTCCACAATCCACTGTAATGG previously [41] using CelLytic NuCLEAR Extraction Kit 2F (Sigma-Aldrich) and were stored at -80 °C for further 18 ERRβ chip ERE Site CCAACTACCAGGAGAATAGGAGCAC use. In-vitro DNA-protein interaction was carried out 1R using Electrophoretic mobility shift assay (EMSA). The Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 4 of 15 oligonucleotide sequences having ERE site present in the washing buffers i.e. Low salt buffer [0.1% (v/v) SDS, ERRβ promoter region were synthesized and were desig- 2 mM EDTA, 1% (v/v) Triton X-100, 20 mM Tris-HCl nated as ERRβ EMSA site 1 (− 888 to − 859) and ERRβ (pH 8.1) and 150 mM NaCl], High salt buffer [0.1% (v/ EMSA site 2 (− 822 to − 793). The forward strands of v) SDS, 1% (v/v) Triton X-100, 2 mM EDTA, 20 mM both EMSA site 1 and EMSA site 2 were labeled at 5′ Tris-HCl (pH 8.1) and 500 mM NaCl], LiCl salt buffer − 32 end with [γ P] ATP (BRIT, Hyderabad, India) using [0.25 M LiCl, 1% (v/v) NP-40, 1% (w/v) deoxycholic T4 polynucleotide kinase (Promega, Madison, USA). acid (sodium salt), 1 mM EDTA and 10 mM Tris-HCl The 5′ labeled oligonucleotides were annealed with un- (pH 8.1)], 1X TE [10 mM Tris-HCl (pH 8.1) and labeled reverse complementary strands incubating in an- 1 mM EDTA] and were eluted using elution buffer nealing buffer (1 M Tris-HCl (pH 7.5), 4 M NaCl, 0.5 M (1% (v/v)SDS,0.1 MNaHCO ). The eluted samples MgCl ). The annealed oligonucleotides were incubated and input were reverse crosslinked with 5 M NaCl for with nuclear extract for 20 min at RT in binding buffer 6 h at 65 °C followed by incubation with 0.5 M EDTA, [1 M Tris-HCl (pH 7.5), 50% (v/v) glycerol, 0.5 M 1 M Tris-HCl (pH 6.5) and proteinase K at 45 °C for EDTA, 1 M DTT, 50 mg/ml BSA, 4 M NaCl]. 1 h. ChIP elutes were purified using phenol/chloro- Poly(dI-dC) was used as a nonspecific competitor. For form and ethanol precipitated. DNA samples were fur- specific competition 100–150 fold excess unlabeled ERα ther used to perform PCR analyses to confirm the consensus oligonucleotides were added to the reaction binding of ERα and ERRβ on ERRβ promoter. The pri- 10 min prior to adding 0.2 pmoles radiolabeled oligonu- mer sequences used for ChIP PCR were provided in cleotides. The DNA-protein complexes were separated Table 1. in 6% polyacrylamide gel at 180 V for 1 h in 0.5X Tris-HCl/Borate/EDTA running buffer [40 mM Tris-Cl Re-ChIP (pH 8.3), 45 mM boric acid and 1 mM EDTA] and was Re-ChIP was performed as described previously with dried and autoradiographed. brief modifications [44]. The sonicated samples were incubated with 1 μg of anti-IgG (kch-504-250; Diage- Chromatin immunoprecipitation assay (ChIP) node) and anti-ERα (8644 s; Cell Signaling Technology) Chromatin immunoprecipitation was performed as antibodies. The antibody and protein complex was ex- prescribed previously with minor modifications [43]. tracted using protein A/G agarose beads (GE Healthcare MCF7 and T47D cells were grown in phenol red free Life Sciences), washed with Re-ChIP wash buffer (2 mM DMEM, RPMI-1640 (PAN Biotech GmbH, Aidenbach, EDTA, 500 mM NaCl, 0.1% (v/v) SDS, 1% (v/v) NP40) Germany) medium respectively, supplemented with and eluted with Re-ChIP elution buffer (1X TE, 2% SDS, 10% (v/v) charcoal treated FBS (PAN Biotech GmbH) 15 mM DTT). The eluted samples were further sub- for 48 h prior to E2 treatment. Cells were treated with jected to secondary immunoprecipitation with 1 μgof 100 nM E2 for 48 h, fixed with 1% (v/v) formaldehyde anti-ERRβ (Sc-68879, Santa Cruz) primary antibody. The 3− andwerewashedtwice with 1X PBS(10 mM PO , complex was extracted using protein A/G agarose beads 137 mM NaCl and 2.7 mM KCl). Cells were lysed in (GE Healthcare Life Sciences), washed with different SDS lysis buffer (1% (w/v)SDS,10mMEDTA, 50 mM buffers (Low salt buffer, High salt buffer, LiCl salt buffer, Tris-HCl (pH 8.1)) with protease inhibitor cocktail 1X TE) and eluted. The eluted samples were further sub- (Sigma-Aldrich) and were sonicated using Bioruptor jected to reverse crosslinking followed by phenol/chloro- ultrasonicator device (Diagenode S.A., Seraing, form/isoamyl alcohol DNA isolation. The DNA samples Belgium) at M2 amplitude strength. The sonicated were further used to perform PCR to confirm the bind- samples were subjected to pre-clearing with protein ing of ERα and ERRβ complex on the ERRβ promoter. A/G agarose beads (GE Healthcare Life Sciences). These pre-cleared samples were diluted with ChIP Transfection and luciferase assay dilution buffer (0.01% (w/v)SDS,1.1%(v/v) Triton MCF7 cells were grown in 24 well plates in phenol red X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl (pH 8.1), free DMEM supplemented with 10% (v/v) charcoal 167 mM NaCl) and divided into two equal parts IgG treated fetal bovine serum 48 h prior to estrogen (E2) and IP, 50 μl was taken as input and was stored at treatment. Cells were transfected with pGL3-ERRβ, -80 °C. The IgG and IP were incubated with 1 μgof pEGFP-ERα [41], pEYFP C1-ERRβ [37], pRL-Renilla anti-IgG (Diagenode), anti-ERα (8644 s; Cell Signaling luciferase construct (Promega) in different combina- Technology) and anti-ERRβ (sc-68879, Santa Cruz) tions using jetPRIME-polyplus-transfection reagent antibodies respectively. The protein-antibody complex (Polyplus transfection, New York, NY, USA) according was extracted by incubating the samples with protein to manufacture protocol. Post 24 h transfection cells A/G agarose beads. The protein-antibody-bead com- were treated with 100 nM E2 and vehicle and were plex was extracted, washed with series of different allowed to grow for 24 h. Luciferase assay was Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 5 of 15 performed using Dual luciferase assay detection kit and survival of breast cancer patients. As Kaplan-Meier (Promega) according to manufacture protocol. Lucif- survival analyses showed a significant overall survival in erase readings were obtained and were normalized patients with high ERRβ expression (p = 0.027382) sug- with Renilla luciferase activity. The graph was plotted gesting the anti-tumorigenic role in breast cancer (Fig. 1d) with normalized readings using GraphPad Prism soft- [47]. Thus our results indicate that ERRβ expression is ware version 6.01. decreased in breast carcinoma patients, breast cancer cell lines and also has pathological implications in Fluorescence-activated cell sorting analyses (FACS) for breast cancer. cell cycle MCF7 Cells (3 × 10 )weregrown in6well plates in ERRβ expression is ERα dependent Dulbecco’s Modified Eagle Medium supplemented To define the role of ERRβ in breast carcinogenesis, with 10% charcoal treated fetal bovine serum at 37 °C we elucidated the expression of ERRβ in ER + ve and for 24 h prior to transfection with pEYFP C1-ERRβ ER-ve breast cancer patients in tissue microarray construct and were allowed to grow for 48 h. Cells slides (TMA). The breast cancer TMA slide consist were further harvested and were treated with 70% of 24 samples with both ER + ve and ER-ve breast ethanol for fixation, washed with ice cold 1X PBS carcinoma and adjacent normal breast tissues. IHC thrice and were stained with DNA stain propidium showed 2 (8.33%) samples that were negatively stained iodide (PI) at 37 °C. Sorting was performed and were while 22 (91.67%) samples were positively stained for analyzed using BD LSRFortessa (BD Biosciences) as ERRβ expression. Interestingly, we found that com- described previously [45]. posite score for ERRβ IHC staining was significantly high in ER + ve breast cancer patients (n =6) than in Statistical analysis patients with ER-ve receptor status (n =6) suggesting The statistical significance was analyzed using unpaired that ERRβ expression might be controlled by ERα t-test for 2-group comparison. Each data represents the (Fig. 2a, b). To further confirm this observation we mean ± SEM from three independent experiments. performed western blot and reverse transcription PCR P-value < 0.05 was considered as statistically significant. (RT-PCR) for ERRβ in ER + ve (MCF7 and T47D) and One-way ANOVA test was performed to analyze the ER-ve (MDA-MB231) breast cancer cell lines and the statistical significance of multiple group comparison. expression of ERRβ was found to be ERα dependent P-value < 0.05 was considered as statistically significant (Fig. 2c, d). We further confirmed these findings through and were represented in respected figures accordingly. short hairpin ribonucleic acid (shRNA) knockdown of ERα in MCF7 cells. We found that depletion of ERα by Results knockdown showed a significant decrease of ERRβ Decreased expression of ERRβ in breast carcinoma expression in MCF7 cells (Fig. 3a (i & ii), b (i & ii) The role of ERRβ in breast carcinoma has not been and c (i & ii)). These results suggest for the first time much elucidated with few reports published recently [37, that expression of the orphan receptor ERRβ is ERα 46]. To determine the role of ERRβ expression in breast status dependent and may have clinical significance in carcinogenesis, we performed immunohistochemistry breast cancer pathogenesis. (IHC) using commercially available tissue microarray slides (TMA) purchased from US Biomax (https:// Estrogen dependent expression of ERRβ in ER + ve breast www.biomax.us/) which consist of 24 samples consisting cancer cells of both breast carcinoma and adjacent normal breast As we have shown the correlation between ERα and tissue samples. Among the 24 samples, 4 (16.66%) were ERRβ in ER + ve patient samples and breast cancer cells, negative and 19 (79.11%) were positive for ERRβ staining we therefore analyzed the effect of estrogen on ERRβ ex- and 1 sample was stromal tissue. Our IHC staining pression. MCF7 cells were treated with estrogen (10 & (composite score) showed a significant decreased expres- 100 nM) for different time intervals (0, 6, 12, 24 & 48 h) sion of ERRβ in breast carcinoma tissues compared to and western blot was performed. A significant increase adjacent normal breast tissues (Fig. 1a and b). We next in the expression of ERRβ (> 2 fold) was observed with performed western blot (WB) analyses of whole cell ly- estrogen treatment (100 nM) (Fig. 4a (iii & iv)) and ef- sates isolated from breast cancer cells and immortalized fect of estrogen was observed at time point as low as 6 h normal breast cells. WB analyses indicated significantly with highest expression (~ 5 fold) at 48 h. It is to be low levels of ERRβ expression in breast cancer cell lines noted that the treatment with lower concentration of es- compared to immortalized breast cell line, MCF10A trogen (10 nM) also showed significant change in MCF7 (Fig. 1c). The publicly available dataset, GEO accession: cells after 12 to 24 h (Fig. 4a (i & ii)). However the estro- GSE9893 was screened and analyzed for ERRβ expression gen mediated ERRβ up-regulation was inhibited with Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 6 of 15 Fig. 1 Expression of ERRβ in normal vs breast cancer tumor samples, cell lines and its pathological significance. a Immunohistochemical staining of tissue microarray slides using ERRβ antibody in both normal (n = 4) and breast carcinoma tissues (n = 19). Increased expression of ERRβ in normal tissues compared with breast carcinoma. b Graphical representation of IHC composite score of each tissue microarray sample. Composite score was calculated for each sample using both intensity score and percentage of cells positive for ERRβ staining (composite score < 3 low categorized; 3–5 moderately categorized; ≥ 6 highly categorized). Graph was plotted using composite score and p-values were calculated using 2-group t-test (p <0.05 considered as significant). c Western blots revealing high expression of ERRβ in normal breast cell line (MCF10A), than breast cancer cell lines (MCF7, T47D, and MDA-MB-231). Densitometry analyses of ERRβ expression in normal and breast cancer cell lines, One-way ANOVA test was performed to acquire statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). d Kaplan-Meier survival curve of Chanrion et al. (Dataset: GSE9893) correlated higher expression of ERRβ with favorable survival (p = 0.027382) tamoxifen treatment (Fig. 4b). These results suggest that of unlabelled estrogen response element (ERE) consen- ERRβ expression in ER + ve breast cancer cells is estro- sus sequence. The unlabelled ERE consensus com- gen dependent. pletely abolish the DNA/protein complex suggesting the binding of ERα (Fig. 5b). Further chromatin immu- ERα regulates ERRβ by binding to ERE sites present in the noprecipitation assay (ChIP) was carried out to confirm 5′ flanking region of ERRβ the binding of ERα on ERRβ promoter in-vivo. MCF7 To understand the role of estrogen receptor α in the and T47D cells were treated with estrogen for 48 h and regulation of ERRβ,the 5′ flanking sequence of ERRβ were subjected to ChIP procedure using ERα monoclo- was screened for the presence of ERE sites manually. nal antibody. The isolated immunoprecipitated DNA Two putative half estrogen responsive elements (ERE fragments were then subjected to PCR amplification. sites) were found and designated as ERE site1 (− 877 to TheChIPPCR suggests theenrichedbinding of ERα − 872) and ERE site 2 (− 810 to − 805) (Fig. 5a). To con- on both the half ERE sites present on the 5′ flanking firm the binding of ERα to the putative half ERE sites region of ERRβ during estrogen stimulation compared present in the 5′ flanking sequence of ERRβ,electro- with the untreated samples and binding of ERα on ERE phoretic mobility shift assay (EMSA) was performed. site 1 is stronger than ERE site 2 (Fig. 6a (i) and (ii)). The oligonucleotides designated as ERRβ EMSA site1 However we did not observe any binding of ERα in the − 32 and ERRβ EMSA site2 were radio labeled with [γ P] same sites in MDA-MB231 cell line as expected and ATP and incubated with nuclear extracts isolated from used as a negative control during the ERα ChIP proced- MCF7 cells. EMSA clearly shows that ERα can bind to ure. (Fig. 6c). Apart from ERα recruitment to ERE both the putative sites (ERE site 1 and ERE site 2). The elements, ERRβ may also be co-recruited on its own specificity of the protein bound to the sites was further promoter through ERα. Previous reports have already confirmed by competing with 50–500 fold molar excess proved that estrogen treatment lead to formation of Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 7 of 15 Fig. 2 Correlation of ERRβ expression with ERα in breast tumors and cell lines. a Immunohistochemical staining with ERRβ antibody in ER + ve and ER-ve breast cancer patients. Elevated expression of ERRβ was found in ER + ve (n =6) compared to ER-ve (n = 6) breast cancer patient samples. b Graphical representation of IHC composite scores of each tissue microarray sample showing significant elevated expression of ERRβ in ER +vethaninER-ve breast cancer patient samples. Graph was plotted using composite score and p-values were calculated using 2-group t-test (p < 0.05 considered as significant). c, d Western blots, Reverse transcription polymerase chain reaction (RT PCR) and densitometry analysis results representing elevated levels of ERRβ in ER + ve breast cancer cells (*p < 0.05, **p <0.01, ***p < 0.001, ****p < 0.0001). Statistical significance for relative gene expression (RT PCR) and normalized percentage of expression (WB) was analyzed using One-way ANOVA and unpaired t-test respectively (p-value < 0.05 was considered as significant) heterodimer between ERα and ERRβ proteins [48]. Our construct was co-transfected with ERα and ERRβ previous results also suggest the increased nuclear expression vector plasmid. After 48 h of co-transfec- localization of ERα in thepresenceofestrogen. There- tion with ERα,a significantincreaseinluciferaseac- fore we hypothesize that the binding of ERRβ on its tivity of ERRβ promoter was found (Fig. 7b). The own promoter may be through ERα in the form of luciferase activity was further elevated in the presence heterodimer. To test this hypothesis we initially per- of ERα and ERRβ followed by estrogen treatment com- formed in-vivo ChIP assay using ERRβ specific antibody pared to only ERα and ERRβ co-transfection. However, and found that ERRβ binds to the half ERE sites present no significant change was observed in the luciferase on its 5′ flanking region in the presence of estrogen activity in the presence of ERRβ transfection alone (Fig. 6b (i) and (ii)). We then performed Re-ChIP in (Fig. 7c). These findings suggest that ERα binds to half whichboththe ERα and ERRβ antibodies were used. ERE sites in the promoter of ERRβ to increase its tran- Re-ChIP PCR clearly showed that ERα along with ERRβ scription. Apart from that our results also show that binds to the half ERE sites present in the 5′ flanking re- ERRβ along with ERα bind to the half ERE sites gion of ERRβ in the presence of estrogen (Fig. 6d). This present on promoter of ERRβ gene. data clearly shows that ERα and ERRβ could bind dir- ectly and as ERα/ERRβ heterodimer in the presence of estrogen to regulate ERRβ transcriptionally. ERRβ regulates cell cycle in breast cancer cells In our present study we demonstrate that ERα can regu- ERα up-regulates the promoter activity of ERRβ late ERRβ expression. It has been proven that ERRs cip To further confirm the effect of ERα on ERRβ promoter share target genes with ERs and p21 is a target gene of activity, we cloned the ERRβ promoter in pGL3 basic ERα and it has significant role in cell cycle regulation luciferase vector using Kpn1 and Xho1 restriction sites. [20, 21, 49]. Hence we hypothesize that ERRβ may also cip The ERRβ promoter construct was sequenced and regulate p21 and has a significant role in cell cycle cloning was confirmed (Fig. 7a). pGL3-ERRβ promoter regulation. To understand the role of ERRβ in cell cycle, Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 8 of 15 Fig. 3 Expression of ERRβ is ERα dependent. Efficient knockdown of ERα showing significant decrease in the expression of ERRβ in MCF7 cells. a, b Quantitative Real-time PCR (qRT-PCR) and Reverse transcription polymerase chain reaction (RT-PCR) results showing decreased expression of -ΔΔCt ERRβ in ERα depleted MCF7 cells. Housekeeping gene GAPDH treated as control and ΔCt, ΔΔCt, 2 values were calculated and graph was -ΔΔCt plotted using 2 values. Fold change ≥ 2 was considered as significant. p-values were calculated using 2-group t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). c Western blot revealing the depleted expression of ERRβ in ERα Knockdown MCF7 (ERα KD) cells we overexpressed ERRβ in ER + ve breast cancer cells Discussion (MCF7 and T47D). Forty-eight hours of post transfec- ERα plays an important role in breast cancer progres- tion, the whole cell lysates were extracted from the sion, metastasis and treatment [50, 51]. DNA binding ERRβ expression vector and control vector transfected domain of ERα is highly conserved with ERRs hence can cells and western blot was performed. Western blot ana- share target genes [21, 22]. ERRs involve in cell prolifer- cip lyses showed that cell cycle proteins p18 and p21 were ation and energy metabolism [21, 29]. Expression of up-regulated whereas cyclin D1 was down-regulated ERRβ was found to be constant throughout the men- cip (Fig. 8a). Similar results were also observed in the p21 strual cycle [52]. ERRβ can regulate Nanog expression mRNA levels in both MCF7 and T47D cells (Fig. 8b, c). through interacting with Oct4 [53] and acts as tumor These results suggest the probable role of ERRβ in suppressor in prostate cancer cells [36]. A limited litera- cip the regulation of cell cycle by regulating p18, p21 ture has addressed the role of ERRβ in breast cancer. and cyclin D1 in breast cancer cells. Furthermore, We therefore studied the possible role of ERRβ in breast fluorescence-activated cell sorting analysis for cell cancer. We found the relative expression of ERRβ is high cycle showed increase in G0/G1 phase cell population in immortalized normal breast cells (MCF10A), in con- in ERRβ ectopically expressed cells as expected trast to breast cancer cell lines (MCF7, T47D, (Fig. 8d). These results proved the cell cycle regulatory MDA-MB231) and these findings were in agreement and tumor suppressive role of ERRβ in breast cancer cells. with the previous studies [37]. Immunohistochemical The schematic representation provides an overall idea of staining with ERRβ showed a significant increased ex- the regulation of ERRβ and its role in cell cycle regulation pression of ERRβ in normal breast tissues compared to in breast cancer cell lines (Fig. 9). breast carcinoma tissues. Breast cancer patients having Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 9 of 15 Fig. 4 Estrogen regulates the expression of ERRβ. a Western blots and densitometry analyses showing up-regulation of ERRβ upon estrogen treatment at different concentrations [10 nM (i) & 100 nM (ii)] for different time points (0, 6, 12, 24, 48 h) in MCF7 cells. MCF7 cells showed > 2 fold high expression of ERRβ upon the treatment of 100 nM E2 treatment. b Combinatorial treatment of MCF7 cells with estrogenand tamoxifendecreaseERRβ expression. The association between normalized percentage expression in different groups were analyzed using One-way ANOVA test (ns- no significance, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001) high expression of ERRβ showed better survival [47]. detected two half ERE sites in the upstream region of Both Immunohistochemical and western blot studies re- ERRβ andproved the bindingofERα on those ERE vealed high expression of ERRβ in ER + ve breast sites both in-vitro and in-vivo. ERα interacts with cancers and it is dependent on Estrogen receptor status. various proteins such as Sp1 and Ap1 which can fa- Furthermore, reduced ERRβ expression was observed in cilitate the binding of ERα on half ERE sites [57]. Sp1 ERα depleted MCF7 cells. These results indicate the pos- stabilizes ERα dimer and co-operate the binding of sible role of ERα in the regulation of ERRβ in breast can- ERα on half EREs present on its target gene promoter cer. Estrogen is required for the development of breast [58, 59]. Whereas, HMG1 interacts with ERα and sta- and ovaries in mammals [54], acts as a ligand for ERs bilizes ERα-ERE binding through which it enhances [55], promotes cell proliferation and migration [56]. In the transcription activity [60]. Since previous studies our study we attributed the role of estrogen in the regu- have suggested that ERα is an interacting partner of lation of ERRβ in breast cancer cells. We confirmed that ERRβ [48], therefore we hypothesize that ERRβ might the expression of ERRβ is highly elevated in the presence be playing an important role in the regulation of its of estrogen in ER + ve breast cancer cells (MCF7). How- own promoter by acting as facilitator of ERα to bind ever, in competition studies ERRβ expression was re- to the half ERE sites. ChIP assay and Re-ChIP pro- duced with tamoxifen treatment along with estrogen. vided enough evidenceses to confirm the self regula- Since ERs and ERRs show sequence similarity, there tion of ERRβ through ERα in thepresenceof is a possibility of sharing of target genes and estrogen. Furthermore, luciferase assay confirmed the cross-talk between these receptors. In this study we regulation of ERRβ by ERα. Surprisingly, ERRβ alone Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 10 of 15 Fig. 5 ERα interacts to ERRβ promoter in-vitro. a Schematic representation of two functional half ERE sites present in ERRβ promoter. Half ERE sites were situated from − 877 to − 872 and − 810 to − 805 respectively in the upstream region of ERRβ promoter. b Electrophoretic mobility shift assay (EMSA) − 32 representing the binding of ERα on both the half ERE sites in ERRβ promoter region. Oligonucleotides including half EREsitewerelabeled with [γ P] ATP and were incubated for 20 min with nuclear lysate extracted from MCF7 cells. An unlabeled ERE consensus oligonucleotide sequences were used as cold probe for competition at 50, 100 and 500 folds molar excess. Oligonucleotides were separated in 6% polyacrylamide gel using 0.5X TBE (Tris/Borate/ Ethylenediaminetetraacetic acid) for 1 h at 180 V. The gel was dried and was autoradiographed has no effect on promoter activity. These findings analysis (FACS) provided enough evidence of cell cycle cip demonstrate that ERα can regulate the transcriptional regulatory role of ERRβ in MCF7 cells. p21 protein activity of ERRβ. levels were directly correlated with the expression of In normal cells the cell division is tightly regulated ERRβ in prostate cancer cells and it has been proved cip and a fine balance amongst the cell cycle modulators that p21 is a direct target for ERRβ [36]. Interestingly cip does exist [61]. The impairment of this fine balance is p21 was demonstrated as a direct target for both cip one of the major causes of cancer. p21 is an inhibitor ERRα and ERRγ and their protein levels were negatively of cyclin dependent kinase belongs to cip and kip family correlated with each other [67, 68]. Thus, not only for cip [62], primarily inhibits CDK2 by which it can inhibit cell ERRβ, p21 is a direct target for all ERRs. Prostate and cip cycle progression [63, 64]. p21 arrests G1-G2 transi- breast cancer cells showed inhibition of ERRα using tion in cell cycle through binding to PCNA in P53 defi- XCT790 (inverse agonist) leads to reduction in cell pro- cient cells [65]. p18 belongs to INK4 family and can liferation [67]. However, ERRβ and ERRγ were served as inhibit cyclin dependent kinases potentially. Reduced tumor suppressors in prostate cancer cells [36, 68]. Re- levels of p18 were detected in hepatocellular carcinoma cent studies also demonstrated the tumor suppressor [66]. In this study, we have established the correlation role of ERRβ through BCAS2 in breast cancer cells [37]. between the expression of ERRβ and various cell cycle Our results were in agreement with the previous studies cip markers such as p21 , p18 and cyclin D1 in breast can- and this cell cycle regulatory and tumor suppressor roles cip cer cells. The elevated levels of p21 , p18 and de- of ERRβ in breast cancer cells suggest that ERRβ can be creased expression of cyclin D1 in ectopically expressed considered as a potential therapeutic target for the treat- ERRβ breast cancer cell lines were observed. Cell cycle ment of breast cancer. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 11 of 15 Fig. 6 Estrogen facilitates binding of ERRβ on half EREs through ERα. a ChIP assay showing ERα binding to half EREs on ERRβ promoter in-vivo in the presence of estrogen in (i) MCF7 and (ii) T47D cells. b ERRβ binding in the upstream region of ERRβ promoter upon estrogen treatment in (i) MCF7 and (ii) T47D cells. c ER-ve breast cancer cells (MDA-MB 231) showing no binding of ERα on ERRβ promoter and used as a negative control. d Re-ChIP shows binding of ERα and ERRβ heterodimer complex on half ERE sites present on ERRβ promoter Fig. 7 Effect of ERα and ERRβ on ERRβ promoter. a Schematic representation of ERRβ promoter showing two half ERE sites. b ERα regulates ERRβ classically in the presence of estrogen. c MCF7 cells were transfected with ERα, ERRβ along with ERRβ promoter and luciferase readings were obtained in the presence and absence of estrogen stimulation. Renilla readings were taken as a control and all the experiments were conducted in triplicates; statistical significance was analyzed using One-way ANOVA test and p < 0.05 considered as significant (ns- no significance, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001) Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 12 of 15 Fig. 8 ERRβ is a regulator of cell cycle and inhibition of ERRβ leads to cell proliferation. a Western blots and densitometry analysis showing changes in the cip expression of cell cycle markers, such as p21 , p18 and cyclin D1 upon the over expression of ERRβ in MCF7 cells. b, c ERRβ was ectopically expressed in cip cip ER + ve breast cancer cells, after 48 h the mRNA levels of p21 were examined by RT-PCR and RT-qPCR, p21 was significantly up-regulated. All the results were obtained from three independent experiments and each done in triplicates, 2-group unpaired t-test was used to obtain p-values and p <0.05 considered as significant (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).d Fluorescence- activated cell sorting assay (FACS) showing increase of cell fractions in G0/G1 phase upon ectopic expression of ERRβ in MCF7 cells One might surprise with the tumor suppressive role and ERRβ decrease the intranuclear mobility through of an estrogen induced gene. It is well established which it can inhibit the transcriptional activity of ERα that estrogen promotes cell proliferation in ER + ve [48]. This phenomenon might be playing an import- breast cancer cells but also induces the expression of ant role in the inhibition of estrogen responsive target p53 and BRCA1. Interestingly, not only p53 but also genes. Hormonal activation of tumor suppressive BRCA1 gene is associated with inhibition of cell genes such as p53, BRCA1, RERG and ERRβ do play growth, DNA repair and apoptosis [69–73]. P53 and a vital role in the regulatory pathways that inhibit the BRCA1 both physically interact with ERα and inhibit estrogen induced cell growth and differentiation. ERα-mediated transactivation [74, 75]. Recent studies also showed that estrogen up-regulate the expression Conclusions of RERG a novel tumor suppressive gene which is In our present study we have categorically demonstrated highly expressed in ER + ve breast cancers [76]. In that ERRβ expression was down-regulated in the breast our study we showed that ERRβ is an estrogen re- cancer patient samples in comparison with normal sam- sponsive gene and it exhibits tumor suppressor role ples. High expression of ERRβ showed a significant fa- in breast cancer cells. Recent studies showed that vorable survival outcome in breast cancer. We showed ERRβ interacts with ERα in the presence of estrogen for the first time that the expression of ERRβ is ERα Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 13 of 15 cip Fig. 9 Schematic representation of ERα classically regulating ERRβ and role of ERRβ in cell cycle regulation through p18 and p21 .Inthe presence of estrogen ERα gets activated and forms a heterodimer by interacting with ERRβ.ERα alone or along with ERRβ in the form of heterodimer binds to the promoter region of ERRβ and up-regulates its promoter activity. ERRβ up-regulates cell cycle markers expression cip cip such as p21 and p18. p21 , p18 are cyclin dependent kinase inhibitors and halt cell cycle. Thus, our study suggests that the cell cycle cip regulating role of ERRβ by up-regulating p21 and p18 dependent and stimulated by steroid hormone estrogen Scientific and Industrial Research, Government of India for research fellowship. We thank Dr. S. Senapati for extending his help regarding TMA as observed in patient data and breast cancer cell lines. related work. We thank Dr. Philippa Saunders, Director, MRC Centre for In vitro and In vivo studies proved that ERRβ is a direct Reproductive Health, The Queen’s Medical Research Institute, Edinburgh, for cip target of ERα. Cyclin D1, p21 and p18 plays an providing ERRβ-YFP and ERα-CFP constructs. We would like to thank Mr. Ravi Chandra Tagirasa and Mr. Sashi bhusana sahoo for extending their help in important role in cell cycle and we also have estab- performing FACS and technical support respectively. lished the correlation between the expression of ERRβ and the expression of these cell cycle modulators. Funding Therefore our study proposes that ERRβ could be a This work was supported by institutional core grant of Institute of Life Sciences, Department of Biotechnology, Government of India. possible tumor suppressor and can be used as thera- peutic target in breast cancer. Availability of data and materials All those named as authors confirmed the availability of data and materials. Abbreviations The supporting data are available from the corresponding author and will be BC: Breast cancer; ChIP: Chromatin immunoprecipitation; DMEM: Dulbecco’s provided upon reasonable request. modified Eagle’s medium; E2: Estrogen; EMSA: Electrophoretic mobility shift assay; ER: Estrogen receptor; ERR: Estrogen related receptor; FBS: Fetal bovine Authors’ contributions serum; GAPDH: Glyceraldehyde-3- phosphate dehydrogenase; qRT- BMK, SC and SKM conceived and designed the study. BMK, SC, DRM, SKN PCR: Quantitative real-time polymerase chain reaction; RPMI 1640: Roswell performed the experiments, manuscript was written by BMK, SKM, SC and Park Memorial Institute 1640; RT-PCR: Reverse transcription polymerase chain DRM. BMK and SS performed IHC and scoring was performed by AKA for reaction; shRNA: Short hairpin RNA; TMA: Tissue microarray TMA slides. SKM analyzed the data and all the authors have read and approved the final version of manuscript before publication. Acknowledgements BMK, SC and SS thank the Department of Biotechnology, Government of India for research fellowships. DRM thank Indian Council of Medical Research, Ethics approval and consent to participate Government of India for research fellowship. SKN thank the Council of Materials and cell lines used in this study don’t require an ethical approval. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 14 of 15 Competing interests 17. Sun P, Wei L, Denkert C, Lichtenegger W, Sehouli J. The orphan nuclear The authors declare that they have no competing interests. receptors, estrogen receptor-related receptors: their role as new biomarkers in gynecological cancer. Anticancer Res. 2006;26(2C):1699–706. 18. Giguere V. Orphan nuclear receptors: from gene to function. Endocr Rev. Publisher’sNote 1999;20(5):689–725. Springer Nature remains neutral with regard to jurisdictional claims in 19. Enmark E, Gustafsson JA. Orphan nuclear receptors–the first eight years. Mol published maps and institutional affiliations. Endocrinol. 1996;10(11):1293–307. 20. Zhang Z, Chen K, Shih JC, Teng CT. Estrogen-related receptors-stimulated Author details monoamine oxidase B promoter activity is down-regulated by estrogen Cancer Biology Lab, Institute of Life Sciences, Nalco Square, receptors. Mol Endocrinol. 2006;20(7):1547–61. Chandrasekharpur, Bhubaneswar, Odisha 751023, India. Present address: 21. Lu D, Kiriyama Y, Lee KY, Giguere V. Transcriptional regulation of the Department of Biochemistry and Molecular Biology, University of Nebraska estrogen-inducible pS2 breast cancer marker gene by the ERR family of Medical Center (UNMC), Omaha, NE, USA. Department of Gene Function & orphan nuclear receptors. Cancer Res. 2001;61(18):6755–61. Regulation, Institute of Life Sciences, Nalco square, Chandrasekharpur, 22. Giguere V, Yang N, Segui P, Evans RM. Identification of a new class of Bhubaneswar, Odisha 751023, India. Tumor Microenvironment and Animal steroid hormone receptors. Nature. 1988;331(6151):91–4. Models Lab, Department of Translational Research and Technology 23. Eudy JD, Yao S, Weston MD, Ma-Edmonds M, Talmadge CB, Cheng JJ, Development, Institute of Life Sciences, Nalco square, Chandrasekharpur, Kimberling WJ, Sumegi J. Isolation of a gene encoding a novel member of Bhubaneswar, Odisha 751023, India. Department of Pathology, Kalinga the nuclear receptor superfamily from the critical region of usher syndrome Institute of Medical Sciences, Chandaka Industrial Estate, KIIT Rd, Patia, type IIa at 1q41. Genomics. 1998;50(3):382–4. Bhubaneswar, Odisha, India. 24. Hong H, Yang L, Stallcup MR. Hormone-independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Received: 1 November 2017 Accepted: 18 May 2018 Biol Chem. 1999;274(32):22618–26. 25. Chen F, Zhang Q, McDonald T, Davidoff MJ, Bailey W, Bai C, Liu Q, Caskey CT. Identification of two hERR2-related novel nuclear receptors utilizing References bioinformatics and inverse PCR. Gene. 1999;228(1–2):101–9. 1. National Breast Cancer Foundation, INC. Breast Cancer Facts. http://www. 26. Johnston SD, Liu X, Zuo F, Eisenbraun TL, Wiley SR, Kraus RJ, Mertz JE. nationalbreastcancer.org/breast-cancer-facts Estrogen-related receptor alpha 1 functionally binds as a monomer to 2. American Cancer Society: breast cancer facts and figures 2016–2017. https:// extended half-site sequences including ones contained within estrogen- www.cancer.org/cancer/breast-cancer/about/how-common-is-breast-cancer. response elements. Mol Endocrinol. 1997;11(3):342–52. html 27. Vanacker JM, Pettersson K, Gustafsson JA, Laudet V. Transcriptional targets 3. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, shared by estrogen receptor- related receptors (ERRs) and estrogen receptor Ross DT, Johnsen H, Akslen LA, et al. Molecular portraits of human breast (ER) alpha, but not by ERbeta. EMBO J. 1999;18(15):4270–9. tumours. Nature. 2000;406(6797):747–52. 28. Bonnelye E, Vanacker JM, Dittmar T, Begue A, Desbiens X, Denhardt DT, 4. Lewis-Wambi JS, Jordan VC. Treatment of postmenopausal breast cancer with Aubin JE, Laudet V, Fournier B. The ERR-1 orphan receptor is a Selective Estrogen Receptor Modulators (SERMs). Breast Dis. 2005;24:93–105. transcriptional activator expressed during bone development. Mol 5. Hawkins MB, Thornton JW, Crews D, Skipper JK, Dotte A, Thomas P. Endocrinol. 1997;11(7):905–16. Identification of a third distinct estrogen receptor and reclassification of 29. Sladek R, Bader JA, Giguere V. The orphan nuclear receptor estrogen-related estrogen receptors in teleosts. Proc Natl Acad Sci U S A. 2000;97(20):10751–6. receptor alpha is a transcriptional regulator of the human medium-chain 6. Gronemeyer H. Transcription activation by estrogen and progesterone acyl coenzyme a dehydrogenase gene. Mol Cell Biol. 1997;17(9):5400–9. receptors. Annu Rev Genet. 1991;25:89–123. 30. Giguere V. Transcriptional control of energy homeostasis by the estrogen- 7. Pettersson K, Grandien K, Kuiper GG, Gustafsson JA. Mouse estrogen related receptors. Endocr Rev. 2008;29(6):677–96. receptor beta forms estrogen response element-binding heterodimers with 31. Bookout AL, Jeong Y, Downes M, Yu RT, Evans RM, Mangelsdorf DJ. estrogen receptor alpha. Mol Endocrinol. 1997;11(10):1486–96. Anatomical profiling of nuclear receptor expression reveals a hierarchical 8. Cowley SM, Hoare S, Mosselman S, Parker MG. Estrogen receptors alpha and transcriptional network. Cell. 2006;126(4):789–99. beta form heterodimers on DNA. J Biol Chem. 1997;272(32):19858–62. 32. Vega RB, Kelly DP. A role for estrogen-related receptor alpha in the control 9. Tremblay GB, Tremblay A, Labrie F, Giguere V. Dominant activity of of mitochondrial fatty acid beta-oxidation during brown adipocyte activation function 1 (AF-1) and differential stoichiometric requirements for differentiation. J Biol Chem. 1997;272(50):31693–9. AF-1 and -2 in the estrogen receptor alpha-beta heterodimeric complex. 33. Huss JM, Imahashi K, Dufour CR, Weinheimer CJ, Courtois M, Kovacs A, Mol Cell Biol. 1999;19(3):1919–27. Giguere V, Murphy E, Kelly DP. The nuclear receptor ERRalpha is required for 10. Wu WF, Tan XJ, Dai YB, Krishnan V, Warner M, Gustafsson JA. Targeting the bioenergetic and functional adaptation to cardiac pressure overload. estrogen receptor beta in microglia and T cells to treat experimental Cell Metab. 2007;6(1):25–37. autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 2013;110(9):3543–8. 34. Pettersson K, Svensson K, Mattsson R, Carlsson B, Ohlsson R, Berkenstam A. 11. Thomas C, Gustafsson JA. The different roles of ER subtypes in cancer Expression of a novel member of estrogen response element-binding biology and therapy. Nat Rev Cancer. 2011;11(8):597–608. nuclear receptors is restricted to the early stages of chorion formation 12. Cooper JA, Rohan TE, Cant EL, Horsfall DJ, Tilley WD. Risk factors for breast during mouse embryogenesis. Mech Dev. 1996;54(2):211–23. cancer by oestrogen receptor status: a population-based case-control study. 35. Collin RW, Kalay E, Tariq M, Peters T, van der Zwaag B, Venselaar H, Oostrik Br J Cancer. 1989;59(1):119–25. J, Lee K, Ahmed ZM, Caylan R, et al. Mutations of ESRRB encoding estrogen- 13. Lazennec G, Bresson D, Lucas A, Chauveau C, Vignon F. ER beta inhibits related receptor beta cause autosomal-recessive nonsyndromic hearing proliferation and invasion of breast cancer cells. Endocrinology. 2001; impairment DFNB35. Am J Hum Genet. 2008;82(1):125–38. 142(9):4120–30. 36. Yu S, Wong YC, Wang XH, Ling MT, Ng CF, Chen S, Chan FL. Orphan 14. Paruthiyil S, Parmar H, Kerekatte V, Cunha GR, Firestone GL, Leitman nuclear receptor estrogen-related receptor-beta suppresses in vitro and in DC. Estrogen receptor beta inhibits human breast cancer cell vivo growth of prostate cancer cells via p21(WAF1/CIP1) induction and as a proliferation and tumor formation by causing a G2 cell cycle arrest. potential therapeutic target in prostate cancer. Oncogene. 2008;27(23): Cancer Res. 2004;64(1):423–8. 3313–28. 15. Strom A, Hartman J, Foster JS, Kietz S, Wimalasena J, Gustafsson JA. Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation 37. Sengupta D, Bhargava DK, Dixit A, Sahoo BS, Biswas S, Biswas G, Mishra SK. of the breast cancer cell line T47D. Proc Natl Acad Sci U S A. 2004; ERRbeta signalling through FST and BCAS2 inhibits cellular proliferation in 101(6):1566–71. breast cancer cells. Br J Cancer. 2014;110(8):2144–58. 16. Vegeto E, Belcredito S, Etteri S, Ghisletti S, Brusadelli A, Meda C, Krust A, 38. Kleiner HE, Krishnan P, Tubbs J, Smith M, Meschonat C, Shi R, Lowery- Dupont S, Ciana P, Chambon P, et al. Estrogen receptor-alpha mediates the Nordberg M, Adegboyega P, Unger M, Cardelli J, et al. Tissue microarray brain antiinflammatory activity of estradiol. Proc Natl Acad Sci U S A. 2003; analysis of eIF4E and its downstream effector proteins in human breast 100(16):9614–9. cancer. J Exp Clin Cancer Res. 2009;28:5. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 15 of 15 39. Kenny PA, Lee GY, Myers CA, Neve RM, Semeiks JR, Spellman PT, Lorenz K, 60. Zhang CC, Krieg S, Shapiro DJ. HMG-1 stimulates estrogen response Lee EH, Barcellos-Hoff MH, Petersen OW, et al. The morphologies of breast element binding by estrogen receptor from stably transfected HeLa cells. cancer cell lines in three-dimensional assays correlate with their profiles of Mol Endocrinol. 1999;13(4):632–43. gene expression. Mol Oncol. 2007;1(1):84–96. 61. Barnum KJ, O'Connell MJ. Cell cycle regulation by checkpoints. Methods 40. Debnath J, Muthuswamy SK, Brugge JS. Morphogenesis and oncogenesis of Mol Biol. 2014;1170:29–40. MCF-10A mammary epithelial acini grown in three-dimensional basement 62. Mandal M, Bandyopadhyay D, Goepfert TM, Kumar R. Interferon-induces membrane cultures. Methods. 2003;30(3):256–68. expression of cyclin-dependent kinase-inhibitors p21WAF1 and p27Kip1 that prevent activation of cyclin-dependent kinase by CDK-activating kinase 41. Chaudhary S, Madhukrishna B, Adhya AK, Keshari S, Mishra SK. (CAK). Oncogene. 1998;16(2):217–25. Overexpression of caspase 7 is ERalpha dependent to affect proliferation 63. Smits VA, Klompmaker R, Vallenius T, Rijksen G, Makela TP, Medema RH. p21 and cell growth in breast cancer cells by targeting p21(Cip). Oncogenesis. inhibits Thr161 phosphorylation of Cdc2 to enforce the G2 DNA damage 2016;5:e219. checkpoint. J Biol Chem. 2000;275(39):30638–43. 42. Strauss WM. Preparation of genomic DNA from mammalian tissue. Current 64. Abbas T, Jha S, Sherman NE, Dutta A. Autocatalytic phosphorylation of protocols in immunology. 2001;Chapter 10:Unit 10 12. CDK2 at the activating Thr160. Cell Cycle. 2007;6(7):843–52. 43. Listerman I, Sapra AK, Neugebauer KM. Cotranscriptional coupling of 65. Cayrol C, Knibiehler M, Ducommun B. p21 binding to PCNA causes G1 and splicing factor recruitment and precursor messenger RNA splicing in G2 cell cycle arrest in p53-deficient cells. Oncogene. 1998;16(3):311–20. mammalian cells. Nat Struct Mol Biol. 2006;13(9):815–22. 66. Morishita A, Masaki T, Yoshiji H, Nakai S, Ogi T, Miyauchi Y, Yoshida S, Funaki T, 44. Truax AD, Greer SF. ChIP and re-ChIP assays: investigating interactions Uchida N, Kita Y, et al. Reduced expression of cell cycle regulator p18(INK4C) in between regulatory proteins, histone modifications, and the DNA human hepatocellular carcinoma. Hepatology. 2004;40(3):677–86. sequences to which they bind. Methods Mol Biol. 2012;809:175–88. 67. Bianco S, Lanvin O, Tribollet V, Macari C, North S, Vanacker JM. Modulating 45. Tourigny A, Charbonneau F, Xing P, Boukrab R, Rousseau G, St-Arnaud R, estrogen receptor-related receptor-alpha activity inhibits cell proliferation. J Brezniceanu ML. CYP24A1 exacerbated activity during diabetes contributes Biol Chem. 2009;284(35):23286–92. to kidney tubular apoptosis via caspase-3 increased expression and 68. Yu S, Wang X, Ng CF, Chen S, Chan FL. ERRgamma suppresses cell activation. PLoS One. 2012;7(10):e48652. proliferation and tumor growth of androgen-sensitive and androgen- 46. Heckler MM, Zeleke TZ, Divekar SD, Fernandez AI, Tiek DM, Woodrick J, insensitive prostate cancer cells and its implication as a therapeutic target Farzanegan A, Roy R, Uren A, Mueller SC, et al. Antimitotic activity of DY131 for prostate cancer. Cancer Res. 2007;67(10):4904–14. and the estrogen-related receptor beta 2 (ERRbeta2) splice variant in breast 69. Hurd C, Khattree N, Alban P, Nag K, Jhanwar SC, Dinda S, Moudgil VK. cancer. Oncotarget. 2016;7(30):47201–20. Hormonal regulation of the p53 tumor suppressor protein in T47D human 47. Chanrion M, Negre V, Fontaine H, Salvetat N, Bibeau F, Mac Grogan G, breast carcinoma cell line. J Biol Chem. 1995;270(48):28507–10. Mauriac L, Katsaros D, Molina F, Theillet C, et al. A gene expression 70. Hurd C, Dinda S, Khattree N, Moudgil VK. Estrogen-dependent and signature that can predict the recurrence of tamoxifen-treated primary independent activation of the P1 promoter of the p53 gene in transiently breast cancer. Clin Cancer Res. 2008;14(6):1744–52. transfected breast cancer cells. Oncogene. 1999;18(4):1067–72. 48. Tanida T, Matsuda KI, Yamada S, Hashimoto T, Kawata M. Estrogen-related 71. Hurd C, Khattree N, Dinda S, Alban P, Moudgil VK. Regulation of tumor receptor beta reduces the subnuclear mobility of estrogen receptor alpha suppressor proteins, p53 and retinoblastoma, by estrogen and antiestrogens and suppresses estrogen-dependent cellular function. J Biol Chem. 2015; in breast cancer cells. Oncogene. 1997;15(8):991–5. 290(19):12332–45. 72. Spillman MA, Bowcock AM. BRCA1 and BRCA2 mRNA levels are coordinately 49. Mandal S, Davie JR. Estrogen regulated expression of the p21 Waf1/Cip1 elevated in human breast cancer cells in response to estrogen. Oncogene. gene in estrogen receptor positive human breast cancer cells. J Cell Physiol. 1996;13(8):1639–45. 2010;224(1):28–32. 73. Gudas JM, Nguyen H, Li T, Cowan KH. Hormone-dependent regulation of 50. Duffy MJ. Estrogen receptors: role in breast cancer. Crit Rev Clin Lab Sci. BRCA1 in human breast cancer cells. Cancer Res. 1995;55(20):4561–5. 2006;43(4):325–47. 74. Fan S, Wang J, Yuan R, Ma Y, Meng Q, Erdos MR, Pestell RG, Yuan F, Auborn 51. Felzen V, Hiebel C, Koziollek-Drechsler I, Reissig S, Wolfrum U, Kogel D, KJ, Goldberg ID, et al. BRCA1 inhibition of estrogen receptor signaling in Brandts C, Behl C, Morawe T. Estrogen receptor alpha regulates non- transfected cells. Science. 1999;284(5418):1354–6. canonical autophagy that provides stress resistance to neuroblastoma and 75. Liu G, Schwartz JA, Brooks SC. Estrogen receptor protects p53 from breast cancer cells and involves BAG3 function. Cell Death Dis. 2015;6:e1812. deactivation by human double minute-2. Cancer Res. 2000;60(7):1810–4. 52. Bombail V, MacPherson S, Critchley HO, Saunders PT. Estrogen receptor 76. Finlin BS, Gau CL, Murphy GA, Shao H, Kimel T, Seitz RS, Chiu YF, Botstein D, related beta is expressed in human endometrium throughout the normal Brown PO, Der CJ, et al. RERG is a novel ras-related, estrogen-regulated and menstrual cycle. Hum Reprod. 2008;23(12):2782–90. growth-inhibitory gene in breast cancer. J Biol Chem. 2001;276(45):42259–67. 53. van den Berg DL, Zhang W, Yates A, Engelen E, Takacs K, Bezstarosti K, Demmers J, Chambers I, Poot RA. Estrogen-related receptor beta interacts with Oct4 to positively regulate Nanog gene expression. Mol Cell Biol. 2008; 28(19):5986–95. 54. Russo IH, Russo J. Role of hormones in mammary cancer initiation and progression. J Mammary Gland Biol Neoplasia. 1998;3(1):49–61. 55. Tamrazi A, Carlson KE, Daniels JR, Hurth KM, Katzenellenbogen JA. Estrogen receptor dimerization: ligand binding regulates dimer affinity and dimer dissociation rate. Mol Endocrinol. 2002;16(12):2706–19. 56. Laidlaw IJ, Clarke RB, Howell A, Owen AW, Potten CS, Anderson E. The proliferation of normal human breast tissue implanted into athymic nude mice is stimulated by estrogen but not progesterone. Endocrinology. 1995;136(1):164–71. 57. Klinge CM. Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res. 2001;29(14):2905–19. 58. Petz LN, Nardulli AM. Sp1 binding sites and an estrogen response element half-site are involved in regulation of the human progesterone receptor a promoter. Mol Endocrinol. 2000;14(7):972–85. 59. Dahlman-Wright K, Qiao Y, Jonsson P, Gustafsson JA, Williams C, Zhao C. Interplay between AP-1 and estrogen receptor alpha in regulating gene expression and proliferation networks in breast cancer cells. Carcinogenesis. 2012;33(9):1684–91. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Cancer Springer Journals

Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer

Free
15 pages
Loading next page...
 
/lp/springer_journal/estrogen-receptor-dependent-regulation-of-estrogen-related-receptor-zcd1A15Jj0
Publisher
BioMed Central
Copyright
Copyright © 2018 by The Author(s).
Subject
Biomedicine; Cancer Research; Oncology; Surgical Oncology; Health Promotion and Disease Prevention; Biomedicine, general; Medicine/Public Health, general
eISSN
1471-2407
D.O.I.
10.1186/s12885-018-4528-x
Publisher site
See Article on Publisher Site

Abstract

Background: Breast cancer (BC) is highly heterogeneous with ~ 60–70% of estrogen receptor positive BC patient’s response to anti-hormone therapy. Estrogen receptors (ERs) play an important role in breast cancer progression and treatment. Estrogen related receptors (ERRs) are a group of nuclear receptors which belong to orphan nuclear receptors, which have sequence homology with ERs and share target genes. Here, we investigated the possible role and clinicopathological importance of ERRβ in breast cancer. Methods: Estrogen related receptor β (ERRβ) expression was examined using tissue microarray slides (TMA) of Breast Carcinoma patients with adjacent normal by immunohistochemistry and in breast cancer cell lines. In order to investigate whether ERRβ is a direct target of ERα, we investigated the expression of ERRβ in short hairpin ribonucleic acid knockdown of ERα breast cancer cells by western blot, qRT-PCR and RT-PCR. We further confirmed the binding of ERα by electrophoretic mobility shift assay (EMSA), chromatin immunoprecipitation (ChIP), Re-ChIP and luciferase assays. Fluorescence-activated cell sorting analysis (FACS) was performed to elucidate the role of ERRβ in cell cycle regulation. A Kaplan-Meier Survival analysis of GEO dataset was performed to correlate the expression of ERRβ with survival in breast cancer patients. Results: Tissue microarray (TMA) analysis showed that ERRβ is significantly down-regulated in breast carcinoma tissue samples compared to adjacent normal. ER + ve breast tumors and cell lines showed a significant expression of ERRβ compared to ER-ve tumors and cell lines. Estrogen treatment significantly induced the expression of ERRβ and it was ERα dependent. Mechanistic analyses indicate that ERα directly targets ERRβ through estrogen response element and ERRβ cip also mediates cell cycle regulation through p18, p21 and cyclin D1 in breast cancer cells. Our results also showed the up-regulation of ERRβ promoter activity in ectopically co-expressed ERα and ERRβ breast cancer cell lines. Fluorescence- activated cell sorting analysis (FACS) showed increased G0/G1 phase cell population in ERRβ overexpressed MCF7 cells. Furthermore, ERRβ expression was inversely correlated with overall survival in breast cancer. Collectively our results suggest cell cycle and tumor suppressor role of ERRβ in breast cancer cells which provide a potential avenue to target ERRβ signaling pathway in breast cancer. Conclusion: Our results indicate that ERRβ is a negative regulator of cell cycle and a possible tumor suppressor in breast cancer. ERRβ could be therapeutic target for the treatment of breast cancer. Keywords: Breast cancer, Estrogen receptor α (ERα), Estrogen related receptor β (ERRβ), Estrogen/17beta-estradiol (E2), Promoter, Tissue microarray (TMA), ChIP, Re-ChIP, Fluorescence-activated cell sorting analysis (FACS) * Correspondence: sandipkmishra@hotmail.com Cancer Biology Lab, Institute of Life Sciences, Nalco Square, Chandrasekharpur, Bhubaneswar, Odisha 751023, India Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 2 of 15 Background through estrogen in breast cancer. We demonstrated Breast cancer (BC) is the second leading cause of deaths the elevated levels of ERRβ in normal breast tissues and in women worldwide. The occurrence rate of male BC is ER + ve breast tumors compared to breast carcinoma rare; it is the most predominant cancer in women in and ER-ve breast tumors respectively. We also demon- United States (US) [1]. It has been estimated that 2,52,710 strated that ectopic expression of ERRβ causes signifi- cip new cases and 40,610 deaths are expected in women cant up-regulation of p18 and p21 in breast cancer during the year 2017 in U.S alone [2]. BC has been cells and also arrest cell cycle in G0/G1 phase. Thus recently classified based on molecular patterns of gene our data, suggest the tumor suppressor role of ERRβ expression into different subtypes [3]. Luminal subtype which provide therapeutic potential to ERRβ signaling which is characterized by the presence of estrogen recep- pathway. tor (ER) comprises ~ 60–70% of BC and responds better to endocrine therapy i.e.; tamoxifen [4]. However, due to Methods lack of therapy ER negative BC demands to identify mo- Tissue microarray lecular targets that might have therapeutic importance. Breast cancer tissue microarray slides (Cat No. BR ERs are a group of nuclear receptors regulated by ster- 243v, BR 246a) were purchased from US Biomax oid hormone estrogen (E2). ERs are of three types; ERα, (Rockville, MD, USA). The slides were stained by ERβ and ERγ [5]. In the presence of E2, ERs either as a anti-ERRβ antibody at 1:50 dilution (sc-68879, Santa homodimer or heterodimer bind to estrogen response Cruz, Dallas, TX, USA) and were further processed elements (ERE) present in the target gene promoter to using ABC system (Vector Laboratories, Bulingame, regulate its transcriptional activity [6–9]. ERα and ERβ CA, USA) as described previously [38]. The images expresses widely in different tissues including brain [10]. were captured under Leica microscope (Wetzlar, Although ERα causes cell migration, division, tumor Germany) using LAS EZ software version 2.1.0. The growth in response to E2 [11, 12], ERβ inhibits migration, slides were examined and scoring was done by an proliferation and invasion of breast cancer cells [13–15]. experienced pathologist. The intensity score was calcu- Besides being a key molecule in breast cancer pathogen- lated based on staining for ERRβ and was assigned from 0 esis, ERα plays an anti-inflammatory role in brain [16]. to 3 (0 indicating no staining; 1+ weakly stained; 2+ Estrogen related receptors (ERRs) are a group of moderately stained and 3+ strongly stained positively). nuclear receptors family having sequence homology The percentage of positively stained cells were scored with ERsand actastranscriptional regulators [17]. Un- as follows, 0- no positive staining; 1+, 1–25% positively like ERs, ERRs are lesser known affected by steroid hor- stained cells; 2+, 26–50% positively stained cells; 3+, mone estrogen. Since a decade after discovery, no 51–70% positively stained cells; 4+, > 70% positively natural ligand has been found for these receptors, stained cells. The composite score was calculated using hence called as orphan nuclear receptors [18, 19]. Es- both intensity score and the percentage of positive trogen related receptors (ERRs) share target genes with cells as it is a product of both scores. The composite ERs [20, 21]. Estrogen related receptors (ERRs) are also score range was given from 0 to 12. The samples of 3 types; ERRα,ERRβ and ERRγ [22–25]. ERRs scored < 3 were considered as low categorized; 3–5 recognize a short sequence referred as ERR- responsive moderately categorized; ≥ 6 highly categorized. The element (ERRE) on target gene promoter and regulate graph was plotted using composite scores using their transcriptional activity [26–29]. The distribution GraphPad Prism version 6.01. of ERRs varies, although ERRα expresses in various tis- sues such as kidney, skeletal muscle, intestinal tract etc, Cell culture and treatment but ERRγ restrict themselves mainly in heart and kid- Human estrogen receptor positive breast cancer cell ney [30, 31]. ERRα mediates cell proliferation through lines (MCF7 and T47D) and estrogen receptor negative pS2 [21] and plays an important role in regulation of breast cancer cell line (MDA-MB231) were purchased mitochondrial metabolism in breast cancer cells [29, from cell repository of National Center for Cell Sciences 32]. Knockdown of ERRα leads to cardiac arrest in mice (NCCS, Pune, India) and were cultured and maintained [33]. ERRβ expresses in early stages of mouse embry- as described previously [39]. MCF10A was a kind gift onic development [34]. Mutation in ERRβ leads to from Dr. Annapoorni Rangarajan (IISc, Bangalore, India) autosomal recessive non syndromic hearing impairment was maintained as previously described [40]. For estro- in mice [35]. ERRβ acts as tumor suppressor in prostate gen treatments, MCF7 and T47D cell lines were grown cip cancer by up-regulating p21 [36]. Recent studies have in phenol red free medium for 48 h prior to demonstrated the abrogated expression of ERRβ in 17beta-estradiol (E2) (Sigma-Aldrich, St. Louis, MO, breast cancer cells [37]. In this studywehavedemon- USA) treatment. MCF7 cells were treated with10 and strated that ERα regulates the expression of ERRβ 100 nM E2 concentrations for different time points 0, 6, Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 3 of 15 12, 24, 48 h. For inhibition studies, MCF7 cells were Scientific, Waltham, MA, USA) restriction enzymes for treated with 1 μM of tamoxifen (Sigma-Aldrich) [41], 4 h at 37 °C and purified. The restriction digested PCR 10 nM E2 individually and in combination with both for product and PGL3 vectors were ligated using T4 DNA 24 h prior to harvesting of cells. MCF7 cells were ligase (New England BioLabs, Inc., Ipswich, MA, USA) transfected with ERα shRNA (SHCLND-NM_000125, and clone was confirmed by sequencing and designated Sigma-Aldrich) and were culture and maintained for as pGL3-ERRβ. 48 h prior to further experiments. Total RNA isolation and real-time PCR Cloning of 5′ flanking region of ERRβ gene Total RNA was isolated from MCF7, T47D, MDA Genomic DNA was isolated from MCF7 cells as per the MB-231 and ERα KD cells using Tri reagent (Sig- standard protocol [42]. A 1014 bp genomic fragment of ma-Aldrich). A total of 500 ng was digested with the ERRβ gene, from − 988 to + 26 bp relative to the DNase-I enzyme (Sigma-Aldrich) and was subjected to start sequence of exon1 (designated as + 1) was ampli- cDNA synthesis using superscript II first strand fied by PCR using 50–100 nanograms of genomic DNA synthesis kit (Thermo Scientific). Reverse transcrip- as a template. The genomic fragment was amplified with tion PCR and Quantitative reverse transcription PCR KpnI and XhoI restriction sites using primer sequences was performed using primers provided in Table 1. provided in Table 1. The parameters of PCR reaction GAPDH was taken as an internal control and ΔΔCT were as follows: initial denaturation 95 °C for 5 min, values were calculated for Quantitative reverse tran- 35 cycles of 95 °C for 30 s, 56 °C for 30 s, 72 °C for scription PCR. The Quantitative reverse transcription 1 min and a final extension of 72 °C for 10 min. The PCR results were plotted using GraphPad Prism amplified samples were resolved in 0.8% (w/v) agarose version 6.01. gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. Preparation of cell extracts and western blotting Both the purified PCR product and PGL3 basic lucifer- The whole cell lysates from breast cancer cell lines ase vector were digested using KpnI and XhoI (Thermo (MCF10A, MCF7, T47D, MDA MB-231) were pre- pared using RIPA buffer (500 mM NaCl, 5 mM MgCl , 1% Na deoxycholate, 20 mM Tris-HCl (pH 8.0), 10% Table 1 List of primers glycerol, 1 mM EDTA, 100 mM EGTA, 0.1% NP40, 1% S.No Oligos Sequence (5′-3′) Triton X-100, 0.1 M Na VO , 1X Protease inhibitor). 3 4 1 ERRβ Promoter F ACAGGTACCTTGTACTCCAGTCTGGGCGA Approximately 20–40 microgram of protein was separated using 10–12% SDS-polyacrylamide gel and 2 ERRβ Promoter R ACACTCGAGATGTCCCTGACCACACCTCT transferred onto PVDF membrane (GE Healthcare Life 3 RT-ERα F AGCTCCTCCTCATCCTCTCC Sciences, Chalfont, UK). Blots were incubated with 5% 4 RT-ERα R TCTCCAGCAGCAGGTCATAG nonfat milk for blocking and were further incubated 5 RT-ERRβ F CTATGACGACAAGCTGGTGT with 1 μg each of subsequent antibodies ERα (8644, 6 RT-ERRβ R CCTCGATGTACATGGAATCG Cell signaling technology, Danvers, MA, USA), ERRβ cip 7 RT-p21 F GAGGCCGGGATGAGTTGGGAGGAG (Sc-68879, Santa Cruz) [37], α-tubulin (Sigma-Al- cip drich), cyclin D1 (2978, Cell Signaling Technology), 8 RT-p21 R CAGCCGGCGTTTGGAGTGGTAGAA cip p21 (2947, Cell Signaling Technology), p18 (2896, 9 RT-GAPDH F AAGATCATCAGCAATGCCTC Cell Signaling Technology) followed by corresponding 10 RT-GAPDH R CTCTTCCTCTTGTGCTCTTG HRP labeled secondary antibody. The blot was incu- 11 ERRβ EMSA Site 1F GGACAAAAATAAGGTCAAGTTTCTTTGTTA bated with ECL (Santa Cruz) for 5 min and visualized 12 ERRβ EMSA Site 1R TAACAAAGAAACTTGACCTTATTTTTGTCC in Chemidoc XRS+ molecular 228 imager (Bio-Rad, 13 ERRβ EMSA Site 2F ATTTAATGAGACAGGTCATTCATTCAGTCA Hercules, CA, USA). α-tubulin wasconsideredasa loading control. The western blot images were quanti- 14 ERRβ EMSA Site 2R TGACTGAATGAATGAATGACCTGTCTCAT TAAAT fied using Image J software (NIH, Bethesda, MD, USA). 15 ERRβ chip ERE Site CCAGTCTGGGCGACAAGAGTGAAACTC 1F 16 ERRβ chip ERE Site CCATTACAGTGGATTGTGGAG Electrophoretic mobility shift assay 1R The nuclear fractions were isolated as described 17 ERRβ chip ERE Site CTCCACAATCCACTGTAATGG previously [41] using CelLytic NuCLEAR Extraction Kit 2F (Sigma-Aldrich) and were stored at -80 °C for further 18 ERRβ chip ERE Site CCAACTACCAGGAGAATAGGAGCAC use. In-vitro DNA-protein interaction was carried out 1R using Electrophoretic mobility shift assay (EMSA). The Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 4 of 15 oligonucleotide sequences having ERE site present in the washing buffers i.e. Low salt buffer [0.1% (v/v) SDS, ERRβ promoter region were synthesized and were desig- 2 mM EDTA, 1% (v/v) Triton X-100, 20 mM Tris-HCl nated as ERRβ EMSA site 1 (− 888 to − 859) and ERRβ (pH 8.1) and 150 mM NaCl], High salt buffer [0.1% (v/ EMSA site 2 (− 822 to − 793). The forward strands of v) SDS, 1% (v/v) Triton X-100, 2 mM EDTA, 20 mM both EMSA site 1 and EMSA site 2 were labeled at 5′ Tris-HCl (pH 8.1) and 500 mM NaCl], LiCl salt buffer − 32 end with [γ P] ATP (BRIT, Hyderabad, India) using [0.25 M LiCl, 1% (v/v) NP-40, 1% (w/v) deoxycholic T4 polynucleotide kinase (Promega, Madison, USA). acid (sodium salt), 1 mM EDTA and 10 mM Tris-HCl The 5′ labeled oligonucleotides were annealed with un- (pH 8.1)], 1X TE [10 mM Tris-HCl (pH 8.1) and labeled reverse complementary strands incubating in an- 1 mM EDTA] and were eluted using elution buffer nealing buffer (1 M Tris-HCl (pH 7.5), 4 M NaCl, 0.5 M (1% (v/v)SDS,0.1 MNaHCO ). The eluted samples MgCl ). The annealed oligonucleotides were incubated and input were reverse crosslinked with 5 M NaCl for with nuclear extract for 20 min at RT in binding buffer 6 h at 65 °C followed by incubation with 0.5 M EDTA, [1 M Tris-HCl (pH 7.5), 50% (v/v) glycerol, 0.5 M 1 M Tris-HCl (pH 6.5) and proteinase K at 45 °C for EDTA, 1 M DTT, 50 mg/ml BSA, 4 M NaCl]. 1 h. ChIP elutes were purified using phenol/chloro- Poly(dI-dC) was used as a nonspecific competitor. For form and ethanol precipitated. DNA samples were fur- specific competition 100–150 fold excess unlabeled ERα ther used to perform PCR analyses to confirm the consensus oligonucleotides were added to the reaction binding of ERα and ERRβ on ERRβ promoter. The pri- 10 min prior to adding 0.2 pmoles radiolabeled oligonu- mer sequences used for ChIP PCR were provided in cleotides. The DNA-protein complexes were separated Table 1. in 6% polyacrylamide gel at 180 V for 1 h in 0.5X Tris-HCl/Borate/EDTA running buffer [40 mM Tris-Cl Re-ChIP (pH 8.3), 45 mM boric acid and 1 mM EDTA] and was Re-ChIP was performed as described previously with dried and autoradiographed. brief modifications [44]. The sonicated samples were incubated with 1 μg of anti-IgG (kch-504-250; Diage- Chromatin immunoprecipitation assay (ChIP) node) and anti-ERα (8644 s; Cell Signaling Technology) Chromatin immunoprecipitation was performed as antibodies. The antibody and protein complex was ex- prescribed previously with minor modifications [43]. tracted using protein A/G agarose beads (GE Healthcare MCF7 and T47D cells were grown in phenol red free Life Sciences), washed with Re-ChIP wash buffer (2 mM DMEM, RPMI-1640 (PAN Biotech GmbH, Aidenbach, EDTA, 500 mM NaCl, 0.1% (v/v) SDS, 1% (v/v) NP40) Germany) medium respectively, supplemented with and eluted with Re-ChIP elution buffer (1X TE, 2% SDS, 10% (v/v) charcoal treated FBS (PAN Biotech GmbH) 15 mM DTT). The eluted samples were further sub- for 48 h prior to E2 treatment. Cells were treated with jected to secondary immunoprecipitation with 1 μgof 100 nM E2 for 48 h, fixed with 1% (v/v) formaldehyde anti-ERRβ (Sc-68879, Santa Cruz) primary antibody. The 3− andwerewashedtwice with 1X PBS(10 mM PO , complex was extracted using protein A/G agarose beads 137 mM NaCl and 2.7 mM KCl). Cells were lysed in (GE Healthcare Life Sciences), washed with different SDS lysis buffer (1% (w/v)SDS,10mMEDTA, 50 mM buffers (Low salt buffer, High salt buffer, LiCl salt buffer, Tris-HCl (pH 8.1)) with protease inhibitor cocktail 1X TE) and eluted. The eluted samples were further sub- (Sigma-Aldrich) and were sonicated using Bioruptor jected to reverse crosslinking followed by phenol/chloro- ultrasonicator device (Diagenode S.A., Seraing, form/isoamyl alcohol DNA isolation. The DNA samples Belgium) at M2 amplitude strength. The sonicated were further used to perform PCR to confirm the bind- samples were subjected to pre-clearing with protein ing of ERα and ERRβ complex on the ERRβ promoter. A/G agarose beads (GE Healthcare Life Sciences). These pre-cleared samples were diluted with ChIP Transfection and luciferase assay dilution buffer (0.01% (w/v)SDS,1.1%(v/v) Triton MCF7 cells were grown in 24 well plates in phenol red X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl (pH 8.1), free DMEM supplemented with 10% (v/v) charcoal 167 mM NaCl) and divided into two equal parts IgG treated fetal bovine serum 48 h prior to estrogen (E2) and IP, 50 μl was taken as input and was stored at treatment. Cells were transfected with pGL3-ERRβ, -80 °C. The IgG and IP were incubated with 1 μgof pEGFP-ERα [41], pEYFP C1-ERRβ [37], pRL-Renilla anti-IgG (Diagenode), anti-ERα (8644 s; Cell Signaling luciferase construct (Promega) in different combina- Technology) and anti-ERRβ (sc-68879, Santa Cruz) tions using jetPRIME-polyplus-transfection reagent antibodies respectively. The protein-antibody complex (Polyplus transfection, New York, NY, USA) according was extracted by incubating the samples with protein to manufacture protocol. Post 24 h transfection cells A/G agarose beads. The protein-antibody-bead com- were treated with 100 nM E2 and vehicle and were plex was extracted, washed with series of different allowed to grow for 24 h. Luciferase assay was Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 5 of 15 performed using Dual luciferase assay detection kit and survival of breast cancer patients. As Kaplan-Meier (Promega) according to manufacture protocol. Lucif- survival analyses showed a significant overall survival in erase readings were obtained and were normalized patients with high ERRβ expression (p = 0.027382) sug- with Renilla luciferase activity. The graph was plotted gesting the anti-tumorigenic role in breast cancer (Fig. 1d) with normalized readings using GraphPad Prism soft- [47]. Thus our results indicate that ERRβ expression is ware version 6.01. decreased in breast carcinoma patients, breast cancer cell lines and also has pathological implications in Fluorescence-activated cell sorting analyses (FACS) for breast cancer. cell cycle MCF7 Cells (3 × 10 )weregrown in6well plates in ERRβ expression is ERα dependent Dulbecco’s Modified Eagle Medium supplemented To define the role of ERRβ in breast carcinogenesis, with 10% charcoal treated fetal bovine serum at 37 °C we elucidated the expression of ERRβ in ER + ve and for 24 h prior to transfection with pEYFP C1-ERRβ ER-ve breast cancer patients in tissue microarray construct and were allowed to grow for 48 h. Cells slides (TMA). The breast cancer TMA slide consist were further harvested and were treated with 70% of 24 samples with both ER + ve and ER-ve breast ethanol for fixation, washed with ice cold 1X PBS carcinoma and adjacent normal breast tissues. IHC thrice and were stained with DNA stain propidium showed 2 (8.33%) samples that were negatively stained iodide (PI) at 37 °C. Sorting was performed and were while 22 (91.67%) samples were positively stained for analyzed using BD LSRFortessa (BD Biosciences) as ERRβ expression. Interestingly, we found that com- described previously [45]. posite score for ERRβ IHC staining was significantly high in ER + ve breast cancer patients (n =6) than in Statistical analysis patients with ER-ve receptor status (n =6) suggesting The statistical significance was analyzed using unpaired that ERRβ expression might be controlled by ERα t-test for 2-group comparison. Each data represents the (Fig. 2a, b). To further confirm this observation we mean ± SEM from three independent experiments. performed western blot and reverse transcription PCR P-value < 0.05 was considered as statistically significant. (RT-PCR) for ERRβ in ER + ve (MCF7 and T47D) and One-way ANOVA test was performed to analyze the ER-ve (MDA-MB231) breast cancer cell lines and the statistical significance of multiple group comparison. expression of ERRβ was found to be ERα dependent P-value < 0.05 was considered as statistically significant (Fig. 2c, d). We further confirmed these findings through and were represented in respected figures accordingly. short hairpin ribonucleic acid (shRNA) knockdown of ERα in MCF7 cells. We found that depletion of ERα by Results knockdown showed a significant decrease of ERRβ Decreased expression of ERRβ in breast carcinoma expression in MCF7 cells (Fig. 3a (i & ii), b (i & ii) The role of ERRβ in breast carcinoma has not been and c (i & ii)). These results suggest for the first time much elucidated with few reports published recently [37, that expression of the orphan receptor ERRβ is ERα 46]. To determine the role of ERRβ expression in breast status dependent and may have clinical significance in carcinogenesis, we performed immunohistochemistry breast cancer pathogenesis. (IHC) using commercially available tissue microarray slides (TMA) purchased from US Biomax (https:// Estrogen dependent expression of ERRβ in ER + ve breast www.biomax.us/) which consist of 24 samples consisting cancer cells of both breast carcinoma and adjacent normal breast As we have shown the correlation between ERα and tissue samples. Among the 24 samples, 4 (16.66%) were ERRβ in ER + ve patient samples and breast cancer cells, negative and 19 (79.11%) were positive for ERRβ staining we therefore analyzed the effect of estrogen on ERRβ ex- and 1 sample was stromal tissue. Our IHC staining pression. MCF7 cells were treated with estrogen (10 & (composite score) showed a significant decreased expres- 100 nM) for different time intervals (0, 6, 12, 24 & 48 h) sion of ERRβ in breast carcinoma tissues compared to and western blot was performed. A significant increase adjacent normal breast tissues (Fig. 1a and b). We next in the expression of ERRβ (> 2 fold) was observed with performed western blot (WB) analyses of whole cell ly- estrogen treatment (100 nM) (Fig. 4a (iii & iv)) and ef- sates isolated from breast cancer cells and immortalized fect of estrogen was observed at time point as low as 6 h normal breast cells. WB analyses indicated significantly with highest expression (~ 5 fold) at 48 h. It is to be low levels of ERRβ expression in breast cancer cell lines noted that the treatment with lower concentration of es- compared to immortalized breast cell line, MCF10A trogen (10 nM) also showed significant change in MCF7 (Fig. 1c). The publicly available dataset, GEO accession: cells after 12 to 24 h (Fig. 4a (i & ii)). However the estro- GSE9893 was screened and analyzed for ERRβ expression gen mediated ERRβ up-regulation was inhibited with Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 6 of 15 Fig. 1 Expression of ERRβ in normal vs breast cancer tumor samples, cell lines and its pathological significance. a Immunohistochemical staining of tissue microarray slides using ERRβ antibody in both normal (n = 4) and breast carcinoma tissues (n = 19). Increased expression of ERRβ in normal tissues compared with breast carcinoma. b Graphical representation of IHC composite score of each tissue microarray sample. Composite score was calculated for each sample using both intensity score and percentage of cells positive for ERRβ staining (composite score < 3 low categorized; 3–5 moderately categorized; ≥ 6 highly categorized). Graph was plotted using composite score and p-values were calculated using 2-group t-test (p <0.05 considered as significant). c Western blots revealing high expression of ERRβ in normal breast cell line (MCF10A), than breast cancer cell lines (MCF7, T47D, and MDA-MB-231). Densitometry analyses of ERRβ expression in normal and breast cancer cell lines, One-way ANOVA test was performed to acquire statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). d Kaplan-Meier survival curve of Chanrion et al. (Dataset: GSE9893) correlated higher expression of ERRβ with favorable survival (p = 0.027382) tamoxifen treatment (Fig. 4b). These results suggest that of unlabelled estrogen response element (ERE) consen- ERRβ expression in ER + ve breast cancer cells is estro- sus sequence. The unlabelled ERE consensus com- gen dependent. pletely abolish the DNA/protein complex suggesting the binding of ERα (Fig. 5b). Further chromatin immu- ERα regulates ERRβ by binding to ERE sites present in the noprecipitation assay (ChIP) was carried out to confirm 5′ flanking region of ERRβ the binding of ERα on ERRβ promoter in-vivo. MCF7 To understand the role of estrogen receptor α in the and T47D cells were treated with estrogen for 48 h and regulation of ERRβ,the 5′ flanking sequence of ERRβ were subjected to ChIP procedure using ERα monoclo- was screened for the presence of ERE sites manually. nal antibody. The isolated immunoprecipitated DNA Two putative half estrogen responsive elements (ERE fragments were then subjected to PCR amplification. sites) were found and designated as ERE site1 (− 877 to TheChIPPCR suggests theenrichedbinding of ERα − 872) and ERE site 2 (− 810 to − 805) (Fig. 5a). To con- on both the half ERE sites present on the 5′ flanking firm the binding of ERα to the putative half ERE sites region of ERRβ during estrogen stimulation compared present in the 5′ flanking sequence of ERRβ,electro- with the untreated samples and binding of ERα on ERE phoretic mobility shift assay (EMSA) was performed. site 1 is stronger than ERE site 2 (Fig. 6a (i) and (ii)). The oligonucleotides designated as ERRβ EMSA site1 However we did not observe any binding of ERα in the − 32 and ERRβ EMSA site2 were radio labeled with [γ P] same sites in MDA-MB231 cell line as expected and ATP and incubated with nuclear extracts isolated from used as a negative control during the ERα ChIP proced- MCF7 cells. EMSA clearly shows that ERα can bind to ure. (Fig. 6c). Apart from ERα recruitment to ERE both the putative sites (ERE site 1 and ERE site 2). The elements, ERRβ may also be co-recruited on its own specificity of the protein bound to the sites was further promoter through ERα. Previous reports have already confirmed by competing with 50–500 fold molar excess proved that estrogen treatment lead to formation of Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 7 of 15 Fig. 2 Correlation of ERRβ expression with ERα in breast tumors and cell lines. a Immunohistochemical staining with ERRβ antibody in ER + ve and ER-ve breast cancer patients. Elevated expression of ERRβ was found in ER + ve (n =6) compared to ER-ve (n = 6) breast cancer patient samples. b Graphical representation of IHC composite scores of each tissue microarray sample showing significant elevated expression of ERRβ in ER +vethaninER-ve breast cancer patient samples. Graph was plotted using composite score and p-values were calculated using 2-group t-test (p < 0.05 considered as significant). c, d Western blots, Reverse transcription polymerase chain reaction (RT PCR) and densitometry analysis results representing elevated levels of ERRβ in ER + ve breast cancer cells (*p < 0.05, **p <0.01, ***p < 0.001, ****p < 0.0001). Statistical significance for relative gene expression (RT PCR) and normalized percentage of expression (WB) was analyzed using One-way ANOVA and unpaired t-test respectively (p-value < 0.05 was considered as significant) heterodimer between ERα and ERRβ proteins [48]. Our construct was co-transfected with ERα and ERRβ previous results also suggest the increased nuclear expression vector plasmid. After 48 h of co-transfec- localization of ERα in thepresenceofestrogen. There- tion with ERα,a significantincreaseinluciferaseac- fore we hypothesize that the binding of ERRβ on its tivity of ERRβ promoter was found (Fig. 7b). The own promoter may be through ERα in the form of luciferase activity was further elevated in the presence heterodimer. To test this hypothesis we initially per- of ERα and ERRβ followed by estrogen treatment com- formed in-vivo ChIP assay using ERRβ specific antibody pared to only ERα and ERRβ co-transfection. However, and found that ERRβ binds to the half ERE sites present no significant change was observed in the luciferase on its 5′ flanking region in the presence of estrogen activity in the presence of ERRβ transfection alone (Fig. 6b (i) and (ii)). We then performed Re-ChIP in (Fig. 7c). These findings suggest that ERα binds to half whichboththe ERα and ERRβ antibodies were used. ERE sites in the promoter of ERRβ to increase its tran- Re-ChIP PCR clearly showed that ERα along with ERRβ scription. Apart from that our results also show that binds to the half ERE sites present in the 5′ flanking re- ERRβ along with ERα bind to the half ERE sites gion of ERRβ in the presence of estrogen (Fig. 6d). This present on promoter of ERRβ gene. data clearly shows that ERα and ERRβ could bind dir- ectly and as ERα/ERRβ heterodimer in the presence of estrogen to regulate ERRβ transcriptionally. ERRβ regulates cell cycle in breast cancer cells In our present study we demonstrate that ERα can regu- ERα up-regulates the promoter activity of ERRβ late ERRβ expression. It has been proven that ERRs cip To further confirm the effect of ERα on ERRβ promoter share target genes with ERs and p21 is a target gene of activity, we cloned the ERRβ promoter in pGL3 basic ERα and it has significant role in cell cycle regulation luciferase vector using Kpn1 and Xho1 restriction sites. [20, 21, 49]. Hence we hypothesize that ERRβ may also cip The ERRβ promoter construct was sequenced and regulate p21 and has a significant role in cell cycle cloning was confirmed (Fig. 7a). pGL3-ERRβ promoter regulation. To understand the role of ERRβ in cell cycle, Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 8 of 15 Fig. 3 Expression of ERRβ is ERα dependent. Efficient knockdown of ERα showing significant decrease in the expression of ERRβ in MCF7 cells. a, b Quantitative Real-time PCR (qRT-PCR) and Reverse transcription polymerase chain reaction (RT-PCR) results showing decreased expression of -ΔΔCt ERRβ in ERα depleted MCF7 cells. Housekeeping gene GAPDH treated as control and ΔCt, ΔΔCt, 2 values were calculated and graph was -ΔΔCt plotted using 2 values. Fold change ≥ 2 was considered as significant. p-values were calculated using 2-group t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). c Western blot revealing the depleted expression of ERRβ in ERα Knockdown MCF7 (ERα KD) cells we overexpressed ERRβ in ER + ve breast cancer cells Discussion (MCF7 and T47D). Forty-eight hours of post transfec- ERα plays an important role in breast cancer progres- tion, the whole cell lysates were extracted from the sion, metastasis and treatment [50, 51]. DNA binding ERRβ expression vector and control vector transfected domain of ERα is highly conserved with ERRs hence can cells and western blot was performed. Western blot ana- share target genes [21, 22]. ERRs involve in cell prolifer- cip lyses showed that cell cycle proteins p18 and p21 were ation and energy metabolism [21, 29]. Expression of up-regulated whereas cyclin D1 was down-regulated ERRβ was found to be constant throughout the men- cip (Fig. 8a). Similar results were also observed in the p21 strual cycle [52]. ERRβ can regulate Nanog expression mRNA levels in both MCF7 and T47D cells (Fig. 8b, c). through interacting with Oct4 [53] and acts as tumor These results suggest the probable role of ERRβ in suppressor in prostate cancer cells [36]. A limited litera- cip the regulation of cell cycle by regulating p18, p21 ture has addressed the role of ERRβ in breast cancer. and cyclin D1 in breast cancer cells. Furthermore, We therefore studied the possible role of ERRβ in breast fluorescence-activated cell sorting analysis for cell cancer. We found the relative expression of ERRβ is high cycle showed increase in G0/G1 phase cell population in immortalized normal breast cells (MCF10A), in con- in ERRβ ectopically expressed cells as expected trast to breast cancer cell lines (MCF7, T47D, (Fig. 8d). These results proved the cell cycle regulatory MDA-MB231) and these findings were in agreement and tumor suppressive role of ERRβ in breast cancer cells. with the previous studies [37]. Immunohistochemical The schematic representation provides an overall idea of staining with ERRβ showed a significant increased ex- the regulation of ERRβ and its role in cell cycle regulation pression of ERRβ in normal breast tissues compared to in breast cancer cell lines (Fig. 9). breast carcinoma tissues. Breast cancer patients having Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 9 of 15 Fig. 4 Estrogen regulates the expression of ERRβ. a Western blots and densitometry analyses showing up-regulation of ERRβ upon estrogen treatment at different concentrations [10 nM (i) & 100 nM (ii)] for different time points (0, 6, 12, 24, 48 h) in MCF7 cells. MCF7 cells showed > 2 fold high expression of ERRβ upon the treatment of 100 nM E2 treatment. b Combinatorial treatment of MCF7 cells with estrogenand tamoxifendecreaseERRβ expression. The association between normalized percentage expression in different groups were analyzed using One-way ANOVA test (ns- no significance, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001) high expression of ERRβ showed better survival [47]. detected two half ERE sites in the upstream region of Both Immunohistochemical and western blot studies re- ERRβ andproved the bindingofERα on those ERE vealed high expression of ERRβ in ER + ve breast sites both in-vitro and in-vivo. ERα interacts with cancers and it is dependent on Estrogen receptor status. various proteins such as Sp1 and Ap1 which can fa- Furthermore, reduced ERRβ expression was observed in cilitate the binding of ERα on half ERE sites [57]. Sp1 ERα depleted MCF7 cells. These results indicate the pos- stabilizes ERα dimer and co-operate the binding of sible role of ERα in the regulation of ERRβ in breast can- ERα on half EREs present on its target gene promoter cer. Estrogen is required for the development of breast [58, 59]. Whereas, HMG1 interacts with ERα and sta- and ovaries in mammals [54], acts as a ligand for ERs bilizes ERα-ERE binding through which it enhances [55], promotes cell proliferation and migration [56]. In the transcription activity [60]. Since previous studies our study we attributed the role of estrogen in the regu- have suggested that ERα is an interacting partner of lation of ERRβ in breast cancer cells. We confirmed that ERRβ [48], therefore we hypothesize that ERRβ might the expression of ERRβ is highly elevated in the presence be playing an important role in the regulation of its of estrogen in ER + ve breast cancer cells (MCF7). How- own promoter by acting as facilitator of ERα to bind ever, in competition studies ERRβ expression was re- to the half ERE sites. ChIP assay and Re-ChIP pro- duced with tamoxifen treatment along with estrogen. vided enough evidenceses to confirm the self regula- Since ERs and ERRs show sequence similarity, there tion of ERRβ through ERα in thepresenceof is a possibility of sharing of target genes and estrogen. Furthermore, luciferase assay confirmed the cross-talk between these receptors. In this study we regulation of ERRβ by ERα. Surprisingly, ERRβ alone Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 10 of 15 Fig. 5 ERα interacts to ERRβ promoter in-vitro. a Schematic representation of two functional half ERE sites present in ERRβ promoter. Half ERE sites were situated from − 877 to − 872 and − 810 to − 805 respectively in the upstream region of ERRβ promoter. b Electrophoretic mobility shift assay (EMSA) − 32 representing the binding of ERα on both the half ERE sites in ERRβ promoter region. Oligonucleotides including half EREsitewerelabeled with [γ P] ATP and were incubated for 20 min with nuclear lysate extracted from MCF7 cells. An unlabeled ERE consensus oligonucleotide sequences were used as cold probe for competition at 50, 100 and 500 folds molar excess. Oligonucleotides were separated in 6% polyacrylamide gel using 0.5X TBE (Tris/Borate/ Ethylenediaminetetraacetic acid) for 1 h at 180 V. The gel was dried and was autoradiographed has no effect on promoter activity. These findings analysis (FACS) provided enough evidence of cell cycle cip demonstrate that ERα can regulate the transcriptional regulatory role of ERRβ in MCF7 cells. p21 protein activity of ERRβ. levels were directly correlated with the expression of In normal cells the cell division is tightly regulated ERRβ in prostate cancer cells and it has been proved cip and a fine balance amongst the cell cycle modulators that p21 is a direct target for ERRβ [36]. Interestingly cip does exist [61]. The impairment of this fine balance is p21 was demonstrated as a direct target for both cip one of the major causes of cancer. p21 is an inhibitor ERRα and ERRγ and their protein levels were negatively of cyclin dependent kinase belongs to cip and kip family correlated with each other [67, 68]. Thus, not only for cip [62], primarily inhibits CDK2 by which it can inhibit cell ERRβ, p21 is a direct target for all ERRs. Prostate and cip cycle progression [63, 64]. p21 arrests G1-G2 transi- breast cancer cells showed inhibition of ERRα using tion in cell cycle through binding to PCNA in P53 defi- XCT790 (inverse agonist) leads to reduction in cell pro- cient cells [65]. p18 belongs to INK4 family and can liferation [67]. However, ERRβ and ERRγ were served as inhibit cyclin dependent kinases potentially. Reduced tumor suppressors in prostate cancer cells [36, 68]. Re- levels of p18 were detected in hepatocellular carcinoma cent studies also demonstrated the tumor suppressor [66]. In this study, we have established the correlation role of ERRβ through BCAS2 in breast cancer cells [37]. between the expression of ERRβ and various cell cycle Our results were in agreement with the previous studies cip markers such as p21 , p18 and cyclin D1 in breast can- and this cell cycle regulatory and tumor suppressor roles cip cer cells. The elevated levels of p21 , p18 and de- of ERRβ in breast cancer cells suggest that ERRβ can be creased expression of cyclin D1 in ectopically expressed considered as a potential therapeutic target for the treat- ERRβ breast cancer cell lines were observed. Cell cycle ment of breast cancer. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 11 of 15 Fig. 6 Estrogen facilitates binding of ERRβ on half EREs through ERα. a ChIP assay showing ERα binding to half EREs on ERRβ promoter in-vivo in the presence of estrogen in (i) MCF7 and (ii) T47D cells. b ERRβ binding in the upstream region of ERRβ promoter upon estrogen treatment in (i) MCF7 and (ii) T47D cells. c ER-ve breast cancer cells (MDA-MB 231) showing no binding of ERα on ERRβ promoter and used as a negative control. d Re-ChIP shows binding of ERα and ERRβ heterodimer complex on half ERE sites present on ERRβ promoter Fig. 7 Effect of ERα and ERRβ on ERRβ promoter. a Schematic representation of ERRβ promoter showing two half ERE sites. b ERα regulates ERRβ classically in the presence of estrogen. c MCF7 cells were transfected with ERα, ERRβ along with ERRβ promoter and luciferase readings were obtained in the presence and absence of estrogen stimulation. Renilla readings were taken as a control and all the experiments were conducted in triplicates; statistical significance was analyzed using One-way ANOVA test and p < 0.05 considered as significant (ns- no significance, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001) Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 12 of 15 Fig. 8 ERRβ is a regulator of cell cycle and inhibition of ERRβ leads to cell proliferation. a Western blots and densitometry analysis showing changes in the cip expression of cell cycle markers, such as p21 , p18 and cyclin D1 upon the over expression of ERRβ in MCF7 cells. b, c ERRβ was ectopically expressed in cip cip ER + ve breast cancer cells, after 48 h the mRNA levels of p21 were examined by RT-PCR and RT-qPCR, p21 was significantly up-regulated. All the results were obtained from three independent experiments and each done in triplicates, 2-group unpaired t-test was used to obtain p-values and p <0.05 considered as significant (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).d Fluorescence- activated cell sorting assay (FACS) showing increase of cell fractions in G0/G1 phase upon ectopic expression of ERRβ in MCF7 cells One might surprise with the tumor suppressive role and ERRβ decrease the intranuclear mobility through of an estrogen induced gene. It is well established which it can inhibit the transcriptional activity of ERα that estrogen promotes cell proliferation in ER + ve [48]. This phenomenon might be playing an import- breast cancer cells but also induces the expression of ant role in the inhibition of estrogen responsive target p53 and BRCA1. Interestingly, not only p53 but also genes. Hormonal activation of tumor suppressive BRCA1 gene is associated with inhibition of cell genes such as p53, BRCA1, RERG and ERRβ do play growth, DNA repair and apoptosis [69–73]. P53 and a vital role in the regulatory pathways that inhibit the BRCA1 both physically interact with ERα and inhibit estrogen induced cell growth and differentiation. ERα-mediated transactivation [74, 75]. Recent studies also showed that estrogen up-regulate the expression Conclusions of RERG a novel tumor suppressive gene which is In our present study we have categorically demonstrated highly expressed in ER + ve breast cancers [76]. In that ERRβ expression was down-regulated in the breast our study we showed that ERRβ is an estrogen re- cancer patient samples in comparison with normal sam- sponsive gene and it exhibits tumor suppressor role ples. High expression of ERRβ showed a significant fa- in breast cancer cells. Recent studies showed that vorable survival outcome in breast cancer. We showed ERRβ interacts with ERα in the presence of estrogen for the first time that the expression of ERRβ is ERα Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 13 of 15 cip Fig. 9 Schematic representation of ERα classically regulating ERRβ and role of ERRβ in cell cycle regulation through p18 and p21 .Inthe presence of estrogen ERα gets activated and forms a heterodimer by interacting with ERRβ.ERα alone or along with ERRβ in the form of heterodimer binds to the promoter region of ERRβ and up-regulates its promoter activity. ERRβ up-regulates cell cycle markers expression cip cip such as p21 and p18. p21 , p18 are cyclin dependent kinase inhibitors and halt cell cycle. Thus, our study suggests that the cell cycle cip regulating role of ERRβ by up-regulating p21 and p18 dependent and stimulated by steroid hormone estrogen Scientific and Industrial Research, Government of India for research fellowship. We thank Dr. S. Senapati for extending his help regarding TMA as observed in patient data and breast cancer cell lines. related work. We thank Dr. Philippa Saunders, Director, MRC Centre for In vitro and In vivo studies proved that ERRβ is a direct Reproductive Health, The Queen’s Medical Research Institute, Edinburgh, for cip target of ERα. Cyclin D1, p21 and p18 plays an providing ERRβ-YFP and ERα-CFP constructs. We would like to thank Mr. Ravi Chandra Tagirasa and Mr. Sashi bhusana sahoo for extending their help in important role in cell cycle and we also have estab- performing FACS and technical support respectively. lished the correlation between the expression of ERRβ and the expression of these cell cycle modulators. Funding Therefore our study proposes that ERRβ could be a This work was supported by institutional core grant of Institute of Life Sciences, Department of Biotechnology, Government of India. possible tumor suppressor and can be used as thera- peutic target in breast cancer. Availability of data and materials All those named as authors confirmed the availability of data and materials. Abbreviations The supporting data are available from the corresponding author and will be BC: Breast cancer; ChIP: Chromatin immunoprecipitation; DMEM: Dulbecco’s provided upon reasonable request. modified Eagle’s medium; E2: Estrogen; EMSA: Electrophoretic mobility shift assay; ER: Estrogen receptor; ERR: Estrogen related receptor; FBS: Fetal bovine Authors’ contributions serum; GAPDH: Glyceraldehyde-3- phosphate dehydrogenase; qRT- BMK, SC and SKM conceived and designed the study. BMK, SC, DRM, SKN PCR: Quantitative real-time polymerase chain reaction; RPMI 1640: Roswell performed the experiments, manuscript was written by BMK, SKM, SC and Park Memorial Institute 1640; RT-PCR: Reverse transcription polymerase chain DRM. BMK and SS performed IHC and scoring was performed by AKA for reaction; shRNA: Short hairpin RNA; TMA: Tissue microarray TMA slides. SKM analyzed the data and all the authors have read and approved the final version of manuscript before publication. Acknowledgements BMK, SC and SS thank the Department of Biotechnology, Government of India for research fellowships. DRM thank Indian Council of Medical Research, Ethics approval and consent to participate Government of India for research fellowship. SKN thank the Council of Materials and cell lines used in this study don’t require an ethical approval. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 14 of 15 Competing interests 17. Sun P, Wei L, Denkert C, Lichtenegger W, Sehouli J. The orphan nuclear The authors declare that they have no competing interests. receptors, estrogen receptor-related receptors: their role as new biomarkers in gynecological cancer. Anticancer Res. 2006;26(2C):1699–706. 18. Giguere V. Orphan nuclear receptors: from gene to function. Endocr Rev. Publisher’sNote 1999;20(5):689–725. Springer Nature remains neutral with regard to jurisdictional claims in 19. Enmark E, Gustafsson JA. Orphan nuclear receptors–the first eight years. Mol published maps and institutional affiliations. Endocrinol. 1996;10(11):1293–307. 20. Zhang Z, Chen K, Shih JC, Teng CT. Estrogen-related receptors-stimulated Author details monoamine oxidase B promoter activity is down-regulated by estrogen Cancer Biology Lab, Institute of Life Sciences, Nalco Square, receptors. Mol Endocrinol. 2006;20(7):1547–61. Chandrasekharpur, Bhubaneswar, Odisha 751023, India. Present address: 21. Lu D, Kiriyama Y, Lee KY, Giguere V. Transcriptional regulation of the Department of Biochemistry and Molecular Biology, University of Nebraska estrogen-inducible pS2 breast cancer marker gene by the ERR family of Medical Center (UNMC), Omaha, NE, USA. Department of Gene Function & orphan nuclear receptors. Cancer Res. 2001;61(18):6755–61. Regulation, Institute of Life Sciences, Nalco square, Chandrasekharpur, 22. Giguere V, Yang N, Segui P, Evans RM. Identification of a new class of Bhubaneswar, Odisha 751023, India. Tumor Microenvironment and Animal steroid hormone receptors. Nature. 1988;331(6151):91–4. Models Lab, Department of Translational Research and Technology 23. Eudy JD, Yao S, Weston MD, Ma-Edmonds M, Talmadge CB, Cheng JJ, Development, Institute of Life Sciences, Nalco square, Chandrasekharpur, Kimberling WJ, Sumegi J. Isolation of a gene encoding a novel member of Bhubaneswar, Odisha 751023, India. Department of Pathology, Kalinga the nuclear receptor superfamily from the critical region of usher syndrome Institute of Medical Sciences, Chandaka Industrial Estate, KIIT Rd, Patia, type IIa at 1q41. Genomics. 1998;50(3):382–4. Bhubaneswar, Odisha, India. 24. Hong H, Yang L, Stallcup MR. Hormone-independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Received: 1 November 2017 Accepted: 18 May 2018 Biol Chem. 1999;274(32):22618–26. 25. Chen F, Zhang Q, McDonald T, Davidoff MJ, Bailey W, Bai C, Liu Q, Caskey CT. Identification of two hERR2-related novel nuclear receptors utilizing References bioinformatics and inverse PCR. Gene. 1999;228(1–2):101–9. 1. National Breast Cancer Foundation, INC. Breast Cancer Facts. http://www. 26. Johnston SD, Liu X, Zuo F, Eisenbraun TL, Wiley SR, Kraus RJ, Mertz JE. nationalbreastcancer.org/breast-cancer-facts Estrogen-related receptor alpha 1 functionally binds as a monomer to 2. American Cancer Society: breast cancer facts and figures 2016–2017. https:// extended half-site sequences including ones contained within estrogen- www.cancer.org/cancer/breast-cancer/about/how-common-is-breast-cancer. response elements. Mol Endocrinol. 1997;11(3):342–52. html 27. Vanacker JM, Pettersson K, Gustafsson JA, Laudet V. Transcriptional targets 3. Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, shared by estrogen receptor- related receptors (ERRs) and estrogen receptor Ross DT, Johnsen H, Akslen LA, et al. Molecular portraits of human breast (ER) alpha, but not by ERbeta. EMBO J. 1999;18(15):4270–9. tumours. Nature. 2000;406(6797):747–52. 28. Bonnelye E, Vanacker JM, Dittmar T, Begue A, Desbiens X, Denhardt DT, 4. Lewis-Wambi JS, Jordan VC. Treatment of postmenopausal breast cancer with Aubin JE, Laudet V, Fournier B. The ERR-1 orphan receptor is a Selective Estrogen Receptor Modulators (SERMs). Breast Dis. 2005;24:93–105. transcriptional activator expressed during bone development. Mol 5. Hawkins MB, Thornton JW, Crews D, Skipper JK, Dotte A, Thomas P. Endocrinol. 1997;11(7):905–16. Identification of a third distinct estrogen receptor and reclassification of 29. Sladek R, Bader JA, Giguere V. The orphan nuclear receptor estrogen-related estrogen receptors in teleosts. Proc Natl Acad Sci U S A. 2000;97(20):10751–6. receptor alpha is a transcriptional regulator of the human medium-chain 6. Gronemeyer H. Transcription activation by estrogen and progesterone acyl coenzyme a dehydrogenase gene. Mol Cell Biol. 1997;17(9):5400–9. receptors. Annu Rev Genet. 1991;25:89–123. 30. Giguere V. Transcriptional control of energy homeostasis by the estrogen- 7. Pettersson K, Grandien K, Kuiper GG, Gustafsson JA. Mouse estrogen related receptors. Endocr Rev. 2008;29(6):677–96. receptor beta forms estrogen response element-binding heterodimers with 31. Bookout AL, Jeong Y, Downes M, Yu RT, Evans RM, Mangelsdorf DJ. estrogen receptor alpha. Mol Endocrinol. 1997;11(10):1486–96. Anatomical profiling of nuclear receptor expression reveals a hierarchical 8. Cowley SM, Hoare S, Mosselman S, Parker MG. Estrogen receptors alpha and transcriptional network. Cell. 2006;126(4):789–99. beta form heterodimers on DNA. J Biol Chem. 1997;272(32):19858–62. 32. Vega RB, Kelly DP. A role for estrogen-related receptor alpha in the control 9. Tremblay GB, Tremblay A, Labrie F, Giguere V. Dominant activity of of mitochondrial fatty acid beta-oxidation during brown adipocyte activation function 1 (AF-1) and differential stoichiometric requirements for differentiation. J Biol Chem. 1997;272(50):31693–9. AF-1 and -2 in the estrogen receptor alpha-beta heterodimeric complex. 33. Huss JM, Imahashi K, Dufour CR, Weinheimer CJ, Courtois M, Kovacs A, Mol Cell Biol. 1999;19(3):1919–27. Giguere V, Murphy E, Kelly DP. The nuclear receptor ERRalpha is required for 10. Wu WF, Tan XJ, Dai YB, Krishnan V, Warner M, Gustafsson JA. Targeting the bioenergetic and functional adaptation to cardiac pressure overload. estrogen receptor beta in microglia and T cells to treat experimental Cell Metab. 2007;6(1):25–37. autoimmune encephalomyelitis. Proc Natl Acad Sci U S A. 2013;110(9):3543–8. 34. Pettersson K, Svensson K, Mattsson R, Carlsson B, Ohlsson R, Berkenstam A. 11. Thomas C, Gustafsson JA. The different roles of ER subtypes in cancer Expression of a novel member of estrogen response element-binding biology and therapy. Nat Rev Cancer. 2011;11(8):597–608. nuclear receptors is restricted to the early stages of chorion formation 12. Cooper JA, Rohan TE, Cant EL, Horsfall DJ, Tilley WD. Risk factors for breast during mouse embryogenesis. Mech Dev. 1996;54(2):211–23. cancer by oestrogen receptor status: a population-based case-control study. 35. Collin RW, Kalay E, Tariq M, Peters T, van der Zwaag B, Venselaar H, Oostrik Br J Cancer. 1989;59(1):119–25. J, Lee K, Ahmed ZM, Caylan R, et al. Mutations of ESRRB encoding estrogen- 13. Lazennec G, Bresson D, Lucas A, Chauveau C, Vignon F. ER beta inhibits related receptor beta cause autosomal-recessive nonsyndromic hearing proliferation and invasion of breast cancer cells. Endocrinology. 2001; impairment DFNB35. Am J Hum Genet. 2008;82(1):125–38. 142(9):4120–30. 36. Yu S, Wong YC, Wang XH, Ling MT, Ng CF, Chen S, Chan FL. Orphan 14. Paruthiyil S, Parmar H, Kerekatte V, Cunha GR, Firestone GL, Leitman nuclear receptor estrogen-related receptor-beta suppresses in vitro and in DC. Estrogen receptor beta inhibits human breast cancer cell vivo growth of prostate cancer cells via p21(WAF1/CIP1) induction and as a proliferation and tumor formation by causing a G2 cell cycle arrest. potential therapeutic target in prostate cancer. Oncogene. 2008;27(23): Cancer Res. 2004;64(1):423–8. 3313–28. 15. Strom A, Hartman J, Foster JS, Kietz S, Wimalasena J, Gustafsson JA. Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation 37. Sengupta D, Bhargava DK, Dixit A, Sahoo BS, Biswas S, Biswas G, Mishra SK. of the breast cancer cell line T47D. Proc Natl Acad Sci U S A. 2004; ERRbeta signalling through FST and BCAS2 inhibits cellular proliferation in 101(6):1566–71. breast cancer cells. Br J Cancer. 2014;110(8):2144–58. 16. Vegeto E, Belcredito S, Etteri S, Ghisletti S, Brusadelli A, Meda C, Krust A, 38. Kleiner HE, Krishnan P, Tubbs J, Smith M, Meschonat C, Shi R, Lowery- Dupont S, Ciana P, Chambon P, et al. Estrogen receptor-alpha mediates the Nordberg M, Adegboyega P, Unger M, Cardelli J, et al. Tissue microarray brain antiinflammatory activity of estradiol. Proc Natl Acad Sci U S A. 2003; analysis of eIF4E and its downstream effector proteins in human breast 100(16):9614–9. cancer. J Exp Clin Cancer Res. 2009;28:5. Madhu Krishna et al. BMC Cancer (2018) 18:607 Page 15 of 15 39. Kenny PA, Lee GY, Myers CA, Neve RM, Semeiks JR, Spellman PT, Lorenz K, 60. Zhang CC, Krieg S, Shapiro DJ. HMG-1 stimulates estrogen response Lee EH, Barcellos-Hoff MH, Petersen OW, et al. The morphologies of breast element binding by estrogen receptor from stably transfected HeLa cells. cancer cell lines in three-dimensional assays correlate with their profiles of Mol Endocrinol. 1999;13(4):632–43. gene expression. Mol Oncol. 2007;1(1):84–96. 61. Barnum KJ, O'Connell MJ. Cell cycle regulation by checkpoints. Methods 40. Debnath J, Muthuswamy SK, Brugge JS. Morphogenesis and oncogenesis of Mol Biol. 2014;1170:29–40. MCF-10A mammary epithelial acini grown in three-dimensional basement 62. Mandal M, Bandyopadhyay D, Goepfert TM, Kumar R. Interferon-induces membrane cultures. Methods. 2003;30(3):256–68. expression of cyclin-dependent kinase-inhibitors p21WAF1 and p27Kip1 that prevent activation of cyclin-dependent kinase by CDK-activating kinase 41. Chaudhary S, Madhukrishna B, Adhya AK, Keshari S, Mishra SK. (CAK). Oncogene. 1998;16(2):217–25. Overexpression of caspase 7 is ERalpha dependent to affect proliferation 63. Smits VA, Klompmaker R, Vallenius T, Rijksen G, Makela TP, Medema RH. p21 and cell growth in breast cancer cells by targeting p21(Cip). Oncogenesis. inhibits Thr161 phosphorylation of Cdc2 to enforce the G2 DNA damage 2016;5:e219. checkpoint. J Biol Chem. 2000;275(39):30638–43. 42. Strauss WM. Preparation of genomic DNA from mammalian tissue. Current 64. Abbas T, Jha S, Sherman NE, Dutta A. Autocatalytic phosphorylation of protocols in immunology. 2001;Chapter 10:Unit 10 12. CDK2 at the activating Thr160. Cell Cycle. 2007;6(7):843–52. 43. Listerman I, Sapra AK, Neugebauer KM. Cotranscriptional coupling of 65. Cayrol C, Knibiehler M, Ducommun B. p21 binding to PCNA causes G1 and splicing factor recruitment and precursor messenger RNA splicing in G2 cell cycle arrest in p53-deficient cells. Oncogene. 1998;16(3):311–20. mammalian cells. Nat Struct Mol Biol. 2006;13(9):815–22. 66. Morishita A, Masaki T, Yoshiji H, Nakai S, Ogi T, Miyauchi Y, Yoshida S, Funaki T, 44. Truax AD, Greer SF. ChIP and re-ChIP assays: investigating interactions Uchida N, Kita Y, et al. Reduced expression of cell cycle regulator p18(INK4C) in between regulatory proteins, histone modifications, and the DNA human hepatocellular carcinoma. Hepatology. 2004;40(3):677–86. sequences to which they bind. Methods Mol Biol. 2012;809:175–88. 67. Bianco S, Lanvin O, Tribollet V, Macari C, North S, Vanacker JM. Modulating 45. Tourigny A, Charbonneau F, Xing P, Boukrab R, Rousseau G, St-Arnaud R, estrogen receptor-related receptor-alpha activity inhibits cell proliferation. J Brezniceanu ML. CYP24A1 exacerbated activity during diabetes contributes Biol Chem. 2009;284(35):23286–92. to kidney tubular apoptosis via caspase-3 increased expression and 68. Yu S, Wang X, Ng CF, Chen S, Chan FL. ERRgamma suppresses cell activation. PLoS One. 2012;7(10):e48652. proliferation and tumor growth of androgen-sensitive and androgen- 46. Heckler MM, Zeleke TZ, Divekar SD, Fernandez AI, Tiek DM, Woodrick J, insensitive prostate cancer cells and its implication as a therapeutic target Farzanegan A, Roy R, Uren A, Mueller SC, et al. Antimitotic activity of DY131 for prostate cancer. Cancer Res. 2007;67(10):4904–14. and the estrogen-related receptor beta 2 (ERRbeta2) splice variant in breast 69. Hurd C, Khattree N, Alban P, Nag K, Jhanwar SC, Dinda S, Moudgil VK. cancer. Oncotarget. 2016;7(30):47201–20. Hormonal regulation of the p53 tumor suppressor protein in T47D human 47. Chanrion M, Negre V, Fontaine H, Salvetat N, Bibeau F, Mac Grogan G, breast carcinoma cell line. J Biol Chem. 1995;270(48):28507–10. Mauriac L, Katsaros D, Molina F, Theillet C, et al. A gene expression 70. Hurd C, Dinda S, Khattree N, Moudgil VK. Estrogen-dependent and signature that can predict the recurrence of tamoxifen-treated primary independent activation of the P1 promoter of the p53 gene in transiently breast cancer. Clin Cancer Res. 2008;14(6):1744–52. transfected breast cancer cells. Oncogene. 1999;18(4):1067–72. 48. Tanida T, Matsuda KI, Yamada S, Hashimoto T, Kawata M. Estrogen-related 71. Hurd C, Khattree N, Dinda S, Alban P, Moudgil VK. Regulation of tumor receptor beta reduces the subnuclear mobility of estrogen receptor alpha suppressor proteins, p53 and retinoblastoma, by estrogen and antiestrogens and suppresses estrogen-dependent cellular function. J Biol Chem. 2015; in breast cancer cells. Oncogene. 1997;15(8):991–5. 290(19):12332–45. 72. Spillman MA, Bowcock AM. BRCA1 and BRCA2 mRNA levels are coordinately 49. Mandal S, Davie JR. Estrogen regulated expression of the p21 Waf1/Cip1 elevated in human breast cancer cells in response to estrogen. Oncogene. gene in estrogen receptor positive human breast cancer cells. J Cell Physiol. 1996;13(8):1639–45. 2010;224(1):28–32. 73. Gudas JM, Nguyen H, Li T, Cowan KH. Hormone-dependent regulation of 50. Duffy MJ. Estrogen receptors: role in breast cancer. Crit Rev Clin Lab Sci. BRCA1 in human breast cancer cells. Cancer Res. 1995;55(20):4561–5. 2006;43(4):325–47. 74. Fan S, Wang J, Yuan R, Ma Y, Meng Q, Erdos MR, Pestell RG, Yuan F, Auborn 51. Felzen V, Hiebel C, Koziollek-Drechsler I, Reissig S, Wolfrum U, Kogel D, KJ, Goldberg ID, et al. BRCA1 inhibition of estrogen receptor signaling in Brandts C, Behl C, Morawe T. Estrogen receptor alpha regulates non- transfected cells. Science. 1999;284(5418):1354–6. canonical autophagy that provides stress resistance to neuroblastoma and 75. Liu G, Schwartz JA, Brooks SC. Estrogen receptor protects p53 from breast cancer cells and involves BAG3 function. Cell Death Dis. 2015;6:e1812. deactivation by human double minute-2. Cancer Res. 2000;60(7):1810–4. 52. Bombail V, MacPherson S, Critchley HO, Saunders PT. Estrogen receptor 76. Finlin BS, Gau CL, Murphy GA, Shao H, Kimel T, Seitz RS, Chiu YF, Botstein D, related beta is expressed in human endometrium throughout the normal Brown PO, Der CJ, et al. RERG is a novel ras-related, estrogen-regulated and menstrual cycle. Hum Reprod. 2008;23(12):2782–90. growth-inhibitory gene in breast cancer. J Biol Chem. 2001;276(45):42259–67. 53. van den Berg DL, Zhang W, Yates A, Engelen E, Takacs K, Bezstarosti K, Demmers J, Chambers I, Poot RA. Estrogen-related receptor beta interacts with Oct4 to positively regulate Nanog gene expression. Mol Cell Biol. 2008; 28(19):5986–95. 54. Russo IH, Russo J. Role of hormones in mammary cancer initiation and progression. J Mammary Gland Biol Neoplasia. 1998;3(1):49–61. 55. Tamrazi A, Carlson KE, Daniels JR, Hurth KM, Katzenellenbogen JA. Estrogen receptor dimerization: ligand binding regulates dimer affinity and dimer dissociation rate. Mol Endocrinol. 2002;16(12):2706–19. 56. Laidlaw IJ, Clarke RB, Howell A, Owen AW, Potten CS, Anderson E. The proliferation of normal human breast tissue implanted into athymic nude mice is stimulated by estrogen but not progesterone. Endocrinology. 1995;136(1):164–71. 57. Klinge CM. Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res. 2001;29(14):2905–19. 58. Petz LN, Nardulli AM. Sp1 binding sites and an estrogen response element half-site are involved in regulation of the human progesterone receptor a promoter. Mol Endocrinol. 2000;14(7):972–85. 59. Dahlman-Wright K, Qiao Y, Jonsson P, Gustafsson JA, Williams C, Zhao C. Interplay between AP-1 and estrogen receptor alpha in regulating gene expression and proliferation networks in breast cancer cells. Carcinogenesis. 2012;33(9):1684–91.

Journal

BMC CancerSpringer Journals

Published: May 30, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off