Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells

Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite... Cell Mol Neurobiol (2018) 38:575 https://doi.org/10.1007/s10571-017-0493-1 ERRATUM Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells 1 1 2 1 3 • • • • • Hongjun Zou Ya Ding Weifeng Shi Xu Xu Aihua Gong 3 1,4 Zhijian Zhang Jinbo Liu Published online: 4 May 2017 Springer Science+Business Media New York 2017 Table 1 The primers for real-time PCR Erratum to: Cell Mol Neurobiol 0 0 DOI 10.1007/s10571-014-0126-x Primer Sequence (5 to 3 ) Base (bp) In the original publication of the article, there were errors MAPK3 Forward GAGGTCGATGICCGTGICA 19 in primer sequences under the section ‘‘Expression Plas- primer mids’’ and in Table 1. The corrected text and the table have MAPK3 Reverse ATGCGATCTGGGGTTGTC 18 primer been presented with this erratum. PDGFB Forward CTCCATCCGCTCCTTTGA 18 In the section titled, ‘‘Expression Plasmids’’ the primer primer sequence ‘‘Forward: ccggtgaccgatttctcctggtgttcctcgaggaa PDGFB Reverse TTCCGACTCGACTCCAGAAT 20 caccaggagaaatcggtcatttttg; Reverse: aattcaaaaatgacc- primer gatttctcctggtgttcctcgaggaacaccaggagaaatcggtca’’ should be VEGFA Forward GCTGCTGTAACGATGAAG 18 read as ‘‘Forward: ccggtagcaccatttgaaatcggttactcgagtaacc- primer gatttcaaatggtgctatttttg; Reverse: aattcaaaaatagcac VEGFA Reverse ATCTGCTGTGCTGTAGGA 18 catttgaaatcggttactcgagtaaccgatttcaaatggtgcta’’. primer In Table 1, primer sequences were omitted. The cor- PTEN Forward AAGGACGGACTGGTGTAA 18 rected table is given below: primer PTEN Reverse CCTGAGTTGGAGGAGTAGAT 20 primer http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Cellular and Molecular Neurobiology Springer Journals

Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells

Download PDF
1 page

Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells

Abstract

Cell Mol Neurobiol (2018) 38:575 https://doi.org/10.1007/s10571-017-0493-1 ERRATUM Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells 1 1 2 1 3 • • • • • Hongjun Zou Ya Ding Weifeng Shi Xu Xu Aihua Gong 3 1,4 Zhijian Zhang Jinbo Liu Published online: 4 May 2017 Springer Science+Business Media New York 2017 Table 1 The primers for real-time PCR Erratum to: Cell Mol Neurobiol 0 0 DOI...
Loading next page...
1
 
/lp/springer_journal/erratum-to-microrna-29c-pten-pathway-is-involved-in-mice-brain-9sHIQvmWrB

References (0)

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Springer Journals
Copyright
Copyright © 2017 by Springer Science+Business Media New York
Subject
Biomedicine; Neurosciences; Cell Biology; Neurobiology
ISSN
0272-4340
eISSN
1573-6830
DOI
10.1007/s10571-017-0493-1
Publisher site
See Article on Publisher Site

Abstract

Cell Mol Neurobiol (2018) 38:575 https://doi.org/10.1007/s10571-017-0493-1 ERRATUM Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells 1 1 2 1 3 • • • • • Hongjun Zou Ya Ding Weifeng Shi Xu Xu Aihua Gong 3 1,4 Zhijian Zhang Jinbo Liu Published online: 4 May 2017 Springer Science+Business Media New York 2017 Table 1 The primers for real-time PCR Erratum to: Cell Mol Neurobiol 0 0 DOI 10.1007/s10571-014-0126-x Primer Sequence (5 to 3 ) Base (bp) In the original publication of the article, there were errors MAPK3 Forward GAGGTCGATGICCGTGICA 19 in primer sequences under the section ‘‘Expression Plas- primer mids’’ and in Table 1. The corrected text and the table have MAPK3 Reverse ATGCGATCTGGGGTTGTC 18 primer been presented with this erratum. PDGFB Forward CTCCATCCGCTCCTTTGA 18 In the section titled, ‘‘Expression Plasmids’’ the primer primer sequence ‘‘Forward: ccggtgaccgatttctcctggtgttcctcgaggaa PDGFB Reverse TTCCGACTCGACTCCAGAAT 20 caccaggagaaatcggtcatttttg; Reverse: aattcaaaaatgacc- primer gatttctcctggtgttcctcgaggaacaccaggagaaatcggtca’’ should be VEGFA Forward GCTGCTGTAACGATGAAG 18 read as ‘‘Forward: ccggtagcaccatttgaaatcggttactcgagtaacc- primer gatttcaaatggtgctatttttg; Reverse: aattcaaaaatagcac VEGFA Reverse ATCTGCTGTGCTGTAGGA 18 catttgaaatcggttactcgagtaaccgatttcaaatggtgcta’’. primer In Table 1, primer sequences were omitted. The cor- PTEN Forward AAGGACGGACTGGTGTAA 18 rected table is given below: primer PTEN Reverse CCTGAGTTGGAGGAGTAGAT 20 primer

Journal

Cellular and Molecular Neurobiology – Springer Journals

Published: May 4, 2017

There are no references for this article.