Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells

Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite... Cell Mol Neurobiol (2018) 38:575 ERRATUM Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells 1 1 2 1 3 • • • • • Hongjun Zou Ya Ding Weifeng Shi Xu Xu Aihua Gong 3 1,4 Zhijian Zhang Jinbo Liu Published online: 4 May 2017 Springer Science+Business Media New York 2017 Table 1 The primers for real-time PCR Erratum to: Cell Mol Neurobiol 0 0 DOI 10.1007/s10571-014-0126-x Primer Sequence (5 to 3 ) Base (bp) In the original publication of the article, there were errors MAPK3 Forward GAGGTCGATGICCGTGICA 19 in primer sequences under the section ‘‘Expression Plas- primer mids’’ and in Table 1. The corrected text and the table have MAPK3 Reverse ATGCGATCTGGGGTTGTC 18 primer been presented with this erratum. PDGFB Forward CTCCATCCGCTCCTTTGA 18 In the section titled, ‘‘Expression Plasmids’’ the primer primer sequence ‘‘Forward: ccggtgaccgatttctcctggtgttcctcgaggaa PDGFB Reverse TTCCGACTCGACTCCAGAAT 20 caccaggagaaatcggtcatttttg; Reverse: aattcaaaaatgacc- primer gatttctcctggtgttcctcgaggaacaccaggagaaatcggtca’’ should be VEGFA Forward GCTGCTGTAACGATGAAG 18 read as ‘‘Forward: ccggtagcaccatttgaaatcggttactcgagtaacc- primer gatttcaaatggtgctatttttg; Reverse: aattcaaaaatagcac VEGFA Reverse ATCTGCTGTGCTGTAGGA 18 catttgaaatcggttactcgagtaaccgatttcaaatggtgcta’’. primer In Table 1, primer sequences were omitted. The cor- PTEN Forward AAGGACGGACTGGTGTAA 18 rected table is given below: primer PTEN Reverse CCTGAGTTGGAGGAGTAGAT 20 primer mus GAPDH GAAGGGTGGAGCCAAAAG 18 Forward primer The online version of the original article can be found under mus GAPDH ACCAGTGGATGCAGGGAT 18 doi:10.1007/s10571-014-0126-x. Reverse primer rno GAPDH GCAAGTTCAACGGCACAG 18 & Jinbo Liu Forward primer rno GAPDH ACGCCAGTAGACTCCACGAC 20 Department of Orthopedics, the Third Affiliated Hospital of Reverse primer Suzhou University, No. 185 Juqian street, Changzhou, mmu-miR-29c TAGCACCATTTGAAATCGGTTA 22 Jiangsu 213003, People’s Republic of China Forward Department of Clinical Laboratory, the Third Affiliated mmu-miR-29c GCGAGCACAGAATTAATACGAC 22 Hospital of Suzhou University, No. 185 Juqian Street, Reverse Changzhou, Jiangsu 213003, People’s Republic of China rno-miR-29c TAGCACCATTTGAAATCGGTTA 22 School of Medicine, Jiangsu University, Zhenjiang 212013, Forward People’s Republic of China rno-miR-29c GCGAGCACAGAATTAATACGAC 22 Reverse Department of Orthopaedics, The First People’s Hospital of Changzhou, School of Medicine, Third Affiliated Hospital of u6 Forward CTCGCTTCGGCAGCACA 17 Suzhou University, No. 185 of Juqian Street, u6 Reverse GCGAGCACAGAATTAATACGAC 22 Changzhou 213000, People’s Republic of China Cellular and Molecular Neurobiology Springer Journals

Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells

1 page
Loading next page...
1 Page
Springer US
Copyright © 2017 by Springer Science+Business Media New York
Biomedicine; Neurosciences; Cell Biology; Neurobiology
Publisher site
See Article on Publisher Site


Cell Mol Neurobiol (2018) 38:575 ERRATUM Erratum to: MicroRNA-29c/PTEN Pathway is Involved in Mice Brain Development and Modulates Neurite Outgrowth in PC12 Cells 1 1 2 1 3 • • • • • Hongjun Zou Ya Ding Weifeng Shi Xu Xu Aihua Gong 3 1,4 Zhijian Zhang Jinbo Liu Published online: 4 May 2017 Springer Science+Business Media New York 2017 Table 1 The primers for real-time PCR Erratum to: Cell Mol Neurobiol 0 0 DOI 10.1007/s10571-014-0126-x Primer Sequence (5 to 3 ) Base (bp) In the original publication of the article, there were errors MAPK3 Forward GAGGTCGATGICCGTGICA 19 in primer sequences under the section ‘‘Expression Plas- primer mids’’ and in Table 1. The corrected text and the table have MAPK3 Reverse ATGCGATCTGGGGTTGTC 18 primer been presented with this erratum. PDGFB Forward CTCCATCCGCTCCTTTGA 18 In the section titled, ‘‘Expression Plasmids’’ the primer primer sequence ‘‘Forward: ccggtgaccgatttctcctggtgttcctcgaggaa PDGFB Reverse TTCCGACTCGACTCCAGAAT 20 caccaggagaaatcggtcatttttg; Reverse: aattcaaaaatgacc- primer gatttctcctggtgttcctcgaggaacaccaggagaaatcggtca’’ should be VEGFA Forward GCTGCTGTAACGATGAAG 18 read as ‘‘Forward: ccggtagcaccatttgaaatcggttactcgagtaacc- primer gatttcaaatggtgctatttttg; Reverse: aattcaaaaatagcac VEGFA Reverse ATCTGCTGTGCTGTAGGA 18 catttgaaatcggttactcgagtaaccgatttcaaatggtgcta’’. primer In Table 1, primer sequences were omitted. The cor- PTEN Forward AAGGACGGACTGGTGTAA 18 rected table is given below: primer PTEN Reverse CCTGAGTTGGAGGAGTAGAT 20 primer mus GAPDH GAAGGGTGGAGCCAAAAG 18 Forward primer The online version of the original article can be found under mus GAPDH ACCAGTGGATGCAGGGAT 18 doi:10.1007/s10571-014-0126-x. Reverse primer rno GAPDH GCAAGTTCAACGGCACAG 18 & Jinbo Liu Forward primer rno GAPDH ACGCCAGTAGACTCCACGAC 20 Department of Orthopedics, the Third Affiliated Hospital of Reverse primer Suzhou University, No. 185 Juqian street, Changzhou, mmu-miR-29c TAGCACCATTTGAAATCGGTTA 22 Jiangsu 213003, People’s Republic of China Forward Department of Clinical Laboratory, the Third Affiliated mmu-miR-29c GCGAGCACAGAATTAATACGAC 22 Hospital of Suzhou University, No. 185 Juqian Street, Reverse Changzhou, Jiangsu 213003, People’s Republic of China rno-miR-29c TAGCACCATTTGAAATCGGTTA 22 School of Medicine, Jiangsu University, Zhenjiang 212013, Forward People’s Republic of China rno-miR-29c GCGAGCACAGAATTAATACGAC 22 Reverse Department of Orthopaedics, The First People’s Hospital of Changzhou, School of Medicine, Third Affiliated Hospital of u6 Forward CTCGCTTCGGCAGCACA 17 Suzhou University, No. 185 of Juqian Street, u6 Reverse GCGAGCACAGAATTAATACGAC 22 Changzhou 213000, People’s Republic of China


Cellular and Molecular NeurobiologySpringer Journals

Published: May 4, 2017

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.

DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library


Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly


Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.


Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area








Save searches from
Google Scholar,

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles


20 pages / month

PDF Discount

20% off