Effect of overexpression of LPAAT and GPD1 on lipid synthesis and composition in green microalga Chlamydomonas reinhardtii

Effect of overexpression of LPAAT and GPD1 on lipid synthesis and composition in green microalga... Biodiesel is an alternative energy source which has attracted increasing attention lately. Although algae-based biodiesel produc- tion has many benefits, it is still far from industrial application. Research suggests that improving lipid quality and production through genetic engineering of metabolic pathways will be the most promising way. To enhance lipid content, both lysophosphatidic acyltransferase gene (c-lpaat) and glycerol-3-phosphate dehydrogenase gene (c-gpd1), optimized according to the codon bias of Chlamydomonas reinhardtii, were inserted into the genomic DNA of model microalga C. reinhardtii by the glass bead method. Transgenic algae were screened by zeomycin resistance and RT-PCR. The transcription levels of inserted genes and the fatty acid content were significantly increased after intermittent heat shock. Most of all, the transcription levels of c- lpaat and c-gpd1 were increased 5.3 and 8.6 times after triple heat shocks, resulting in an increase of 44.5 and 67.5% lipid content, respectively. Furthermore, the content of long-chain saturated fatty acids and monounsaturated fatty acids, especially C18 and C18:1t, notably increased, while unsaturated fatty acids dramatically decreased. The results of this study offer a new strategy combining genetic manipulation and intermittent heat shock to enhance lipid production, especially the production of long-chain saturated fatty acids, using C. reinhardtii. . . . . Keywords Chlamydomonas reinhardtii Lipid content Triacylglycerol synthesis Transgenic algae Intermittent heat shock Introduction Biodiesel is an alternative and relatively clean energy source et al. 2010; Talebi et al. 2013). The same as most plants, which attracts increasing attention because the combustion of microalgae store lipid in the form of triacylglycerol (TAG), fossil fuels releases large amounts of CO and pollutants which is the main component of biodiesel (Mubarak et al. (Amaro et al. 2012; Mubarak et al. 2015). Microalgae are 2015). Found in microalgae, the lipid synthesis is mainly one of the most promising sources for the production of bio- through two pathways, fatty acid synthesis and TAG synthe- diesel as they possess short life cycle, perform photosynthesis, sis, which happen in the chloroplast and the endoplasmic re- occupy less land, and absorb a large amount of CO (Mata ticulum, respectively. Acetyl-coenzyme A (AcCoA) forms free fatty acids (FFAs) under the catalysis of Acetyl-CoA car- Electronic supplementary material The online version of this article boxylase (ACCase) and fatty acid synthase (FAS) (Liang and (https://doi.org/10.1007/s10811-017-1349-2) contains supplementary Jiang 2013;Kirchner etal. 2016). In addition, four enzymes material, which is available to authorized users. are involved in the synthesis of TAG, including glycerol-3- phosphate dehydrogenase (GPDH), lysophosphatidic acyl- * Zhangli Hu transferase (LPAAT), diacylglycerol acyltransferase (DGAT), huzl@szu.edu.cn and glycerol-3-phosphate acyltransferase (GPAT) (Griffiths Shenzhen Key Laboratory of Marine Bioresource and and Harrison 2009;Kirchner etal. 2016). Therefore, increas- Eco-environmental Science, Guangdong Engineering Research ing the expression of those genes may achieve the aim of Center for Marine Algal Biotechnology, College of Life Science, improving lipid content. Shenzhen University, Shenzhen 518060, People’s Republic of China 2 In the past few decades, researchers have screened algae School of Science and School of Interprofessional Health Studies, through strain screening and mutagenesis with the aim of im- Faculty of Health and Environmental Sciences, Auckland University of Technology, Auckland 1142, New Zealand proving lipid content (Banerjee et al. 2016; Kirchner et al. 2016). Though research shows that lipid content of microalgae Institute of Biomedical Technology, Auckland University of Technology, Auckland 1142, New Zealand increases under nitrogen or phosphate starvation, the growth 1712 J Appl Phycol (2018) 30:1711–1719 rate of algae is reduced (Hu et al. 2008; Griffiths and Harrison model to study exogenous gene expression and secondary 2009;Himanshu et al. 2016). Nowadays, genetic engineering metabolite synthesis. Here, LPAAT gene from Brassica napus enables us to modify genes related to fatty acid synthesis to and GPD1 gene from Saccharomyces cerevisiae were obtain strains with high lipid content in Chlamydomonas. resynthesized, according to the codon bias of C. reinhardtii, However, expressing ACCase and FAS genes from plants in and then inserted into its genomic DNA to obtain gene over- microalgae has not achieved the aim of significantly increas- expression. We also inserted Hsp70A-RBCS2 promoter and ing oil content (Dunahay et al. 1995; Dehesh et al. 2001). used intermittent heat shocks to find out whether lipid produc- Nevertheless, it is still hopeful to promote lipid content tion in C. reinhardtii can be enhanced and to assess the feasi- through enhancing key enzyme activity of TAG synthesis. In bility of adjusting key enzymes of the TAG synthesis pathway the meantime, transcriptome analysis of Chlamydomonas through genetic engineering to enhance lipid production. reinhardtii with high lipid accumulation reveals that GPDH and LPAAT are significantly upregulated, indicating a positive correlation between the transcription of those genes and cel- Materials and methods lular lipid accumulation (Lv et al. 2013; Fan et al. 2014). Introducing CrGPDH gene from C. reinhardtii into mutated Strains and growth conditions yeast reveals that it causes higher glycerol production (Casais- Molina et al. 2016). When introducing glycerol-3-phosphate Chlamydomonas reinhardtii strain CC-849 was purchased dehydrogenase gene (GPD1) from yeast to oil rapeseed, lipid from the Chlamydomonas Center in the USA and maintained content in the rapeseed is increased by 40% (Vigeolas et al. in Tris-acetate-phosphate (TAP) medium (Gorman and Levine 2007). Moreover, overexpression of LPAAT in Brassica napus 1965), under the temperature of 22 °C and continuous light at or GPAT in Arabidopsis thaliana enhances lipid content and −2 −1 20 μmol photons m s (normal condition). Escherichia coli TAG accumulation (Maisonneuve et al. 2010; Liang and Jiang TOP10 was taken from the bacterial stocks in our laboratory. 2013). The above results imply that changing fatty acid syn- Plasmid pH124 carrying the ble conferring zeomycin and thesis pathway or key enzyme transcription in chloroplast is phleomycin resistance in host cells was constructed and kept not a plausible way to enhance lipid production in algae. On clpaat cgpd1 in our laboratory (Wu et al. 2008). Tran and Tran the other hand, enhancing key enzyme activity of TAG syn- were transgenic algae with introduced c-lpaat and c-gpd1, thesis may promote TAG synthesis by accelerating the trans- respectively. port of FFAs from the chloroplast to the endoplasmic reticu- To apply heat shock (HS), 400 mL cells (wild-type (WT) lum. Currently, there are a limited number of reports using and transgenic algae) in the late logarithmic phase were incu- genetic engineering to modify TAG synthesis pathway to en- −2 −1 bated at 40 °C and light intensity of 20 μmol photons m s hance lipid production in microalgae. For example, it has been for 15 min. Then, the conditions were restored to normal. As reported that overexpression of DGAT in C. reinhardtii has not for multiple HSs, a 4-h recovery period was placed between significantly changed TAG composition or accumulation de- each HS. The sampling time points for a single heat shock spite detecting a high level of transcription (La Russa et al. (HS1) were as follows: before HS, 0 min after HS, and 30, 2012). Therefore, more studies are needed to investigate the 60, 90, and 120 min after recovery. The sampling time points feasibility of enhancing lipid production in algae through ge- for triple heat shocks (HS3) were as follows: before HS, 0 min netic engineering of key enzymes in the TAG pathway. after each HS, and 30, 120, and 240 min after each recovery. Firstly, a strong and inducible promoter is needed to over- The WT strain CC-849 without c-lpaat and c-gpd1 was used express lipid-producing genes in C. reinhardtii. The Hsp70A- as the control. After the treatment, algal cells (WT and trans- RBCS2 promoter has been previously studied and has shown genic algae) were subjected to DNA/RNA extraction and GC- that it could improve the transformation efficiency of a foreign MS analysis. gene and overexpress the foreign gene under 40 °C heat shock (Schroda et al. 2000, 2002). Hence, whether inserting this promoter in front of the lipid-producing gene combined with Construction of vector heat shock can improve gene expression and lipid production is worth investigating. LPAAT gene from Brassica napus (GenBank: AY616009) and In this study, we used C. reinhardtii as a model to investi- GPD1 gene from Saccharomyces cerevisiae (GenBank: gate the effect of GPDH and LPAAT on lipid production in Z24454) were resynthesized as c-lpaat and c-gpd1 according microalgae. Chlamydomonas reinhardtii is a single-cell green to the codon bias of C. reinhardtii and cloned in plasmid alga which has been widely used as a biological model for pUC57 (Sangon Biotech Co., Ltd., China). Fragments of c- photosynthesis and lipid metabolism (Ahmad et al. 2015). It lpaat and c-gpd1 were obtained after cleavage, using restriction has well-established genetic engineering systems in its nucle- endonucleases Nhe Iand PmaC I, and then were inserted into us, chloroplast, and mitochondria and has been used as a pH124 vector to obtain pH124-c-lpaat and pH 124-c-gpd1, J Appl Phycol (2018) 30:1711–1719 1713 respectively. The pH124 vector already contained Hsp70A- gene (as the internal control) was amplified with the primer RBCS2 promoter, RBCS2 terminator, and ble gene (Fig. 1a). sets Actin-F/Actin-R (Table 1). PCR program was set as fol- lows: initial denaturation at 95 °C for 2 min, followed by Nuclear transformation of C. reinhardtii 30 cycles of incubation at 95 °C for 30 s, at 60 °C for 15 s, at 72 °C for 15 s, and a final extension at 72 °C for 5 min. Genetic transformation of C. reinhardtii CC-849 was carried out using the Bglass bead method,^ according to the protocol Gene expression profiling: real-time RT-PCR described by Kindle (1990) and Wang et al. (2017). Total RNAs in WT and transgenic algae were extracted RNA extraction from cells in the late logarithmic phase. Real-time RT- PCR analysis was performed on an ABI PRISM 7900 se- Total RNAs were isolated using a RNA extraction kit quence detection system (Applied Biosystems, USA) fol- (FAST200) (Fastagen Biotechnology Co., Shanghai, China) lowing the protocol previously described using β-actin with DNase I treatment to eliminate possible DNA contami- gene as the internal control and SYBR Premix Ex Taq kit nation according to the manufacturer’s instructions. (Takara, Japan). To obtain cDNA, 1-μg extracted RNA was reversely transcribed into cDNA and then, an equal amount RT-PCR verification of transgenic algae of cDNA was selected as template to perform qRT-PCR. Primer sets for c-lpaat, c-gpd1,and β-actin genes are de- Total RNAs extracted from WT C. reinhardtii and transgenic scribedinTable 2. PCR conditions were as follows: one lines were used as the templates for RT-PCR reactions. The step of 95 °C incubation for 30, followed by 40 cycles of primer sets c-lpaat-F/c-lpaat-R and c-gpd1-F/c-gpd1-R were 95°C for5 and55°Cfor 30s. Datawithan R above 0.998 −ΔΔCt used to amplify the c-lpaat and c-gpd1 genes. The β-actin was analyzed using the 2 program (Lei et al. 2012). Fig. 1 Obtainment of transgenic algae with c-lpaat and c-gpd1. a RT-PCR verification of transgenic algae with c-lpaat and c-gpd1. Construction of transforming plasmids. c-lpaat and c-gpd1 were Specific fragments of 1176 bp were amplified from the total RNA of inserted into pH124 that contained the ampicillin- and zeomycin- transformants. M DL 2000, 1 positive control, PCR fragment of resistant genes and a strong heat-inducible promoter (Hsp70A 1176 bp, 2–4 transgenic algae with c-lpaat,5–7 transgenic algae with c- promoter). b Screening transformants through zeomycin resistance gpd1, 8 negative control, PCR fragment of β-actin from wild-type CC- −1 (10 μgmL ). Green clones were visible after 2–3 weeks, and 849. No c-lpaat and c-gpd1 products were detected in WT −1 transformants were kept in TAP containing 10 μgmL zeomycin. c 1714 J Appl Phycol (2018) 30:1711–1719 Table 1 List of primer sets used in RT-PCR compound with the National Institute of Standards and Technology mass spectral library. Automatic peak Primer name Primer sequences Product (bp) deconvolution was processed with Masslynx software (V4.1, c-lpaat-F 5′ CCAAGGTGGCTCGTGACTC 3′ 1176 Waters Corp.,USA) (Lei et al. 2012). The datasets of FAME c-lpaat-R 5′ ACTCGCCTCTGTGCCTGTT 3′ profiling for further analysis were obtained by normalization c-gpd1-F 5′ CGCCGACCGCCTGAACCT 3′ 1176 against the internal standard in the same chromatogram. c-gpd1-R 5′ CGCCGACCGCCTGAACCT 3′ Actin-F 5′ ACCCGTGCTGACTG 3′ 240 Actin-R 5′ ACGTTGAAGGTCTCGAACA 3′ Protein extraction and quantification When algal growth reached the exponential phase, algal cul- ture was collected and centrifuged at 5000×g and 22 °C for Three technical replicates and two biological replicates 5 min. The supernatant was discarded, and plant total protein were used. The transcription value of c-lpaat and c-gpd1 extraction kit (Sangon Biotech (Shanghai) Co., Ltd.) was used before HS was defined as 1, and then, we obtained the to extract total protein from the remaining algal cells. Bovine other transcription values and expressed them as relative serum albumin (BSA) standard curve was constructed to mea- ratios compared against the before-HS value. sure the protein content according to the above protein- measuring kit’s instruction. Fatty acid methyl ester transformation and FAME analysis Statistical analysis Total lipid extraction was performed as previously described (Lu et al. 2012) with slight modifications. Freeze-dried algal All experiments were repeated three times independently, and −1 powder of 15 mg was weighed. C (500 μgmL ,ANPEL data were recorded as the mean with standard deviation (SD). Laboratory Technologies (Shanghai) Inc.) was added into the For gene expression experiments, quantitative real-time PCR sample as the internal standard. Qualification and quantifica- analysis was performed using the BioRAD iQ5 software. For tion of fatty acid methyl esters (FAMEs) were performed on a each gene, the fold change was expressed as the mean ± SD Thermo Trace GC Ultra gas chromatograph coupled to (% control) and was calculated using the standard curve with Thermo Polaris Q mass spectrometry which was equipped approximation corrected for primer efficiency and normalized with a HP-5MS column (30 m × 0.32 mm id, film thickness to housekeeping gene β-actin expression values. Statistical 0.25 μm). The temperature of the injector was maintained at analyses were performed using the Student’s t test 250 °C. Helium was used as the carrier gas, ions were gener- (SPSS19.0). For all analyses, a p value < 0.05 was considered ated by a 70-Velectron beam, and the mass range scanned was statistically significant. −1 50 to 650 m/z at a rate of 2 scans s . The oven temperature for FAME analysis was initially maintained at 70 °C for 4 min, −1 followed by a temperature increment rate of 5 °C min to −1 195 °C; held for 5 min, followed by 3 °C min increase to Results −1 205 °C; held for 2 min, followed by 8 °C min increment to 230 °C; and then held for 1 min. GC-MS transmitting line Vector construction and transgenic alga obtainment temperature was maintained at 250 °C. Peak identification was performed by matching the mass spectra of each The LPAAT and GPD1 genes were resynthesized accord- ing to the codon bias of C. reinhardtii to obtain c-lpaat and c-gpd1 genes suitable for C. reinhardtii expression Table 2 List of primer sets used in real-time RT-PCR (Stevens et al. 1996) (see supplementary material 1). When treating with 42 °C HS, both c-lpaat and c-gpd1 Gene name Primer name Primer sequences genes under the control of Hsp70A promoter were overexpressed (Fig. 1a). Through zeomycin resistance c-lpaat Q-c-lpaat-F 5′ CCTGTGGCTGGAGCTGGTGT 3′ and RT-PCR screening, transgenic algal cells were obtain- Q-c-lpaat-R 5′ ATGTCCGAGCGGTGGTTGG 3′ ed. Transgenic algae inserted with c-lpaat and c-gpd1 c-gpd1 Q-c-gpd1-F 5′ GTGGTGGCCGAGAACTGCA 3′ clpaat cgpd1 were named as Tran and Tran , respectively Q-c-gpd1-R 5′ TGGTGGCGGGTGTTGATG 3′ (Fig. 1b, c). Transformation efficiency by the glass bead β-actin Actin-F 5′ ACCCGTGCTGCTGATG 3′ −7 −7 −1 method was 8.4 × 10 and 4 × 10 cells mL for c-lpaat Actin-R 5′ACGTTGAAGGTCTCGAACA 3′ and c-gpd1, respectively. J Appl Phycol (2018) 30:1711–1719 1715 Overexpressing c-lpaat and c-gpd1 in transgenic increased the TFA in transgenic algae. The TFA contents in −1 C. reinhardtii WT were 101.79 and 113.57 μgmg dry weight (DW) after one heat shock (HS × 1) and three heat shocks clpaat cgpd1 Both c-lpaat and c-gpd1 controlled by Hsp70A promoter were (HS × 3), respectively. TFA of Tran and Tran in- overexpressed under HS. The transcription levels of target creased 16.8 and 26.7%, respectively, after HS × 1, com- genes were unchanged during HS but increased quickly after pared with WT cells treated with HS × 1 (Fig. 4). algae cells were cooled down to the normal condition and Transgenic algae had significantly higher TFA than WT clpaat reached the highest level after 30 min, with c-lpaat increased cells after HS × 3, with an increase of 44.5% (Tran ) cgpd1 1.93 times and c-gpd1 increased 2.98 times (Fig. 2a, b). or 67.5% (Tran )(Fig. 4). These results were consistent Interestingly, the transcription levels of c-lpaat and c-gpd1 with the high level of gene transcriptions of c-lpaat and c- were further improved when treated with intermittent HS. For gpd1, indicating that overexpression of those genes could clpaat instance, the transcription levels of c-lpaat in Tran were enhance lipid accumulation in transformed C. reinhardtii increased 3.01, 4.46, and 5.3 times after three HSs, respectively cells. cgpd1 (Fig. 3a). The transcription levels of c-gpd1 in Tran were increased 3.6, 5.42, and 8.58 times, respectively (Fig. 3b). The Change in lipid composition of transgenic algae transcription levels of both genes reached the peak at 30 min after HS (Fig. 3a, b). Based on the data analysis, it was con- The fatty acid profile in algae was analyzed by using GC-MS. firmed that the transcription levels of target genes were dramat- WT and transformed algae have similar fatty acids as shown ically increased after HS. by GC-MS peaks (data not shown). The increase in TFA con- tent of transgenic algae was contributed by the increase of Heat shock enhances fatty acid content in transgenic nearly all types of fatty acids. For example, C18:1t in clpaat cgpd1 C. reinhardtii Tran and Tran cells had increases ranging from 177.3 to 270.9% after HS × 1, compared to the WT. The most clpaat As shown above, transcription levels of c-lpaat and c-gpd1 abundant component is still C18:3n3. In Tran , C16:0, in transgenic C. reinhardtii could be enhanced significant- C18:0, and C18:2t had increases ranging from 33 to 38%. cgpd1 ly after HS. Fatty acids (FAs) were extracted from WT and As to Tran , C16:0, C16:1, C18:0, and C18:2t had in- all transgenic algal cells under normal condition and after creases ranging from 43 to 73% (see Table 3 for more details). clpaat HS. Compared to the WT, under the normal culture condi- After HS × 3, in Tran cells, the content of C18:0 tion, the total fatty acid (TFA) contents of transgenic alga and C18:1t fatty acids increased by 355.3 and 220.1%, clpaat cgpd1 cgpd1 strains including Tran and Tran strains increased respectively, compared to the WT. In Tran cells, the by 17.4 and 23.6%, respectively. The HS treatment further content of C18:0 and C18:1 t fatty acids increased by Fig. 2 Single heat shock-enhanced transcription level of transformed genes in transgenic C. reinhardtii (HS heat shock, under 40 °C and 20 μmol −2 −1 photons m s light for 15 min, HS 0 min sampling immediately after heat stimulation. *P < 0.05 compared with before heat shock) 1716 J Appl Phycol (2018) 30:1711–1719 Fig. 4 Lipid content change of transgenic C. reinhardtii after heat shock (HS1 and HS3 stand for single heat shock and triple heat shocks, clpaat respectively.). After heat shock, total fatty acids of Tran and cgpd1 Tran significantly increased when compared with wild-type CC-849 Introducing c-lpaat and c-gpd1 to C. reinhardtii reduces protein synthesis The growth of WT and transgenic algae was similar, and the 6 −1 highest concentration was around 5.8 × 10 cells mL for all strains, indicating that the transformed genes had no effect on the growth of algal cells (see supplementary material 2). Chlamydomonas reinhardtii produces protein and lipid needed for cell function via photosynthesis. Therefore, the carbon amount is relatively fixed and kept in balance in the cellular system. There is a competitive relationship between protein and lipid syntheses in alga cells, and there are reports showing that inhibition of phosphoenolpyruvate carboxylase can enhance cellular fatty acid content in algae (Deng et al. clpaat 2014). After HS × 1, protein content of Tran and cgpd1 Tran cells decreased by 9.2 and 14.1%, respectively, com- clpaat Fig. 3 Triple heat shocks enhanced a c-lpaat and b c-gpd1 gene pared to WT. Furthermore, protein contents of Tran and cgpd1 transcriptions in transgenic C. reinhardtii.(*P < 0.05; **P <0.01 Tran cells decreased by 29 and 34%, respectively, after compared with before heat shock) HS × 3 (Fig. 5a, b). Interestingly, the protein content in WT showed increase after HS × 1 and HS × 3, suggesting that HS in this study had no negative effect on the growth of algae. All of the above demonstrate that introducing c-lpaat and 428.2 and 394.2%, respectively, compared to the WT (see c-gpd1 to C. reinhardtii changed carbon flow direction, which Table 4 for more details). Results showed that the in- increased lipid production but reduced protein synthesis. creased fatty acids were mainly C18 and the most abun- clpaat dant component is still C18:3n3. However, in Tran Introducing c-gpd1 rendered higher efficiency than introduc- cgpd1 cgpd1 ing c-lpaat, as Tran had 23% more lipid content but only and Tran cells, C18:3n3 percentage decreased from 34 to 27%, while C18:0 increased from 2 to 7%. The had 5.2% lower protein level. content of C16:0 and C16:1 fatty acids increased after clpaat cgpd1 HS × 3 in Tran and Tran . Hence, it is clear that introducing c-lpaat and c-gpd1 to C. reinhardtii can sig- Discussion nificantly increase cellular lipid accumulation, in particu- lar enhancing the production of monounsaturated fatty Recent reports show that lipid production in C. reinhardtii can acids and long-chain saturated fatty acids, which could be enhanced under nitrogen starvation (James et al. 2011). be beneficial for biodiesel production. Transcriptome analysis shows that the expression of more J Appl Phycol (2018) 30:1711–1719 1717 Table 3 Change of algal fatty clpaat cgpd1 Fatty acid Wild type Tran Increase (%) Tran Increase (%) acid content and composition −1 −1 −1 (μgmg DW) (μgmg DW) (μgmg DW) after one heat shock 16:0 15.05 ± 0.06 20.03 ± 0.09* 33.09 21.87 ± 0.08* 45.32 16:1 1.98 ± 0.16 1.99 ± 0.51 0.51 2.85 ± 0.19* 43.94 16:4 27.71 ± 0.38 29.03 ± 0.11 4.76 31.25 ± 0.40 12.78 18:0 1.55 ± 0.06 2.15 ± 0.06* 38.71 2.27 ± 0.07* 46.45 18:1t 1.10 ± 0.12 3.05 ± 0.09** 177.27 4.08 ± 0.13** 270.9 18:2t 7.47 ± 0.35 10.06 ± 0.13* 34.67 12.96 ± 0.27* 73.49 18:3 9.83 ± 0.09 10.68 ± 0.29 8.65 10.78 ± 0.16 9.66 18:3n3 37.10 ± 0.08 41.99 ± 0.18 13.18 43.01 ± 0.29 15.93 Average of all the observations of four repeated tests, in the form of mean ± standard error of representation; wild- type CC-849 represents a control. All data unit is in milligram per gram (dry weight). Statistical analysis software SPSS 19.0 than 2500 genes is upregulated, among which the transcrip- of introducing LPAAT and GPD1 into C. reinhardtii is capable tion of enzyme genes in TAG pathway is significantly in- of enhancing lipid production significantly under HS. This creased. One of them, GPDH, increases 5.8 times, and another approach has the potential to be used in high-oil-production gene, LPAAT, increases 3.6 times (Lv et al. 2013). GPDH algae, such as diatoms. Successful application of our strategy catalyzes the synthesis of glycerol-3-phosphate, and LPAAT may reduce the cost of biodiesel production. catalyzes the synthesis of phosphatidic acid, both supply sub- In our study, Hps70A promoter has been used to drive c- strates for TAG synthesis (Deng et al. 2011). Hence, in this gpd1 and c-lpaat expressions. This promoter can greatly en- study, those two genes were introduced into C. reinhardtii to hance gene expression under heat stimulation (Schroda et al. investigate their ability to enhance lipid production. High- 2002). Previous reports show that the transcription level of level transcription of LPAAT and GPD1 was detected, with target genes increases 3–26 times when employing Hsp70A increases of 5.3 and 8.6 times. We successfully used intermit- promoter to express them (Schroda et al. 2000, 2002;Wuet al. tent HS strategy to enhance lipid production for up to 67.5% 2008). We attempted intermittent multiple HS strategy to in- more than the WT. crease gene expression without affecting the growth of algal Currently known key TAG synthesis enzymes are GPDH, cells. Our intermittent triple-HS method has been proven to be GPAT, LPAAT, and DGAT (Lv et al. 2013). Inhibition of successful, where gene expression has been increased signif- LPAAT and DGAT at transcription levels results in lipid reduc- icantly compared with a single HS. Since mRNA is unlikely to tion (Zhang et al. 2005;Lvet al. 2013). On the other hand, accumulate after expression and HS and TATA-binding fac- introducing and overexpressing genes related to TAG synthe- tors can bind to the cis-elements of Hsp70A promoter such as sis cause lipid content to increase (Jain et al. 2000; Zhang et al. HSE sequence and TATA-box (Schroda et al. 2000, 2002), we 2005). Those results suggest that key enzymes of TAG syn- suggest that after the first HS, those regulatory proteins should thesis play important roles in lipid production. Our approach be retained in the cells, which bind to the promoter faster at the Table 4 Change of algal fatty clpaat cgpd1 Fatty acid Wild type Tran Increase (%) Tran Increase (%) acid content and composition −1 −1 −1 (μgmg DW) (μgmg DW) (μgmg DW) after triple heat shocks 16:0 18.05 ± 0.10 29.83 ± 0.06* 65.26 35.39 ± 0.04* 96.07 16:1 2.98 ± 0.06 4.55 ± 0.51* 52.68 6.93 ± 0.21* 132.55 16:4 29.71 ± 0.78 40.99 ± 0.11 37.97 39.65 ± 1.16 33.46 18:0 2.55 ± 0.22 11.61 ± 0.36** 355.29 13.47 ± 0.25** 428.24 18:1t 1.89 ± 0.06 6.05 ± 0.09** 220.11 9.34 ± 0.46** 394.18 18:2t 8.47 ± 0.13 13.06 ± 0.13* 54.19 18.72 ± 0.37* 121.02 18:3 10.83 ± 0.16 11.98 ± 0.50 10.62 15.36 ± 0.11* 41.83 18:3n3 39.09 ± 0.19 44.04 ± 0.07 12.66 51.37 ± 0.21 31.41 Average of all the observations of four repeated tests, in the form of mean ± standard error of representation; wild- type CC-849 represents a control. All data unit is in milligram per gram (dry weight). Statistical analysis software SPSS 19.0 1718 J Appl Phycol (2018) 30:1711–1719 increase proportionately. Polyunsaturated fatty acids, especial- ly α-linolenic acid, increase up to 12% in the transformed line. Interestingly, C18:1–3 slightly decreases in the DAGAT mu- tant strain in C. reinhardtii, while C16:0 slightly increases (La Russa et al. 2012). In yeast with introduced LPAAT, the pro- portion of C12:0 and C14:0 fatty acids increases, while in N. tabacum with introduced LPAAT, that proportion actually decreases (Yuan et al. 2015). Hence, the same gene expressed in different species may result in a different outcome. There is little information about the role of TAG synthesis enzymes in microalga lipid production. In this study, we have shown that with introduced LPAAT or GPD1, saturated and monounsatu- rated fatty acids (C16:0, C18:0, C18:1t, and C18:2 t) have increased significantly. This is consistent with a previous re- port (Mentewab and Stewart 2005). We also have observed that polyunsaturated fatty acids decreased significantly. Therefore, our genetic manipulation has increased long- chain saturated fatty acids, predominantly C16–C18, which make genetically modified C. reinhardtii an attractive source for biodiesel production with relatively low costs. In conclusion, we have established a C. reinhardtii genet- ically modified model that uses Hsp70A promoter to overex- press LPAAT gene from B. napus and GPD1 gene from S. cerevisiae. Applying intermittent multiple-HS strategy, this model can increase lipid production by up to 67.5% and the introduced c-lpaat and c-gpd1 gene expressions can be en- hanced by 5.3 and 8.6 times, respectively. We also have prov- en that overexpression of c-lpaat and c-gpd1 genes is the clpaat cause of high lipid production, which in the meantime reduces Fig. 5 Protein content change after heat shock in a Tran and b cgpd1 Tran cells. (HS heat shock, under 40 °C and 20 μmol protein content. Our results suggest that it is possible to create −2 −1 photons m s light for 15 min, HS 0 min sampling immediately after new strains of microalgae with high lipid production ability, heat stimulation. *P < 0.05 compared with the wild type) and this method can reduce the cost of biodiesel production, which has high technological and economic potentials. second and third HSs, which in turn results in fast enhance- ment of gene expression. The enhanced expression of c-gpd1 Acknowledgements We would like to thank the anonymous reviewers for their constructive suggestions. and c-lpaat increases the TAG synthesis. The 67.5% increase in lipid production resulting from the above is significantly Funding information This work was supported by the National Natural higher than previous reports in other microalgae (La Russa Science Foundation of China (Grant Nos. 31470389, 31470431), et al. 2012; Ibáñez-Salazar et al. 2014;Kang et al. 2015). Guangdong Natural Science Foundation (2014A030308017, 2016A030313052), Project of DEGP (2015KTSCX125), and Shenzhen In C. reinhardtii, the fatty acids are fairly evenly split be- Grant Plan for Science & Technology (JCYJ20160422171614147). tween 16-carbon chains (two thirds of which are C16:0) and 18-carbon chains (predominantly C18:3). Non-saturated fatty Open Access This article is distributed under the terms of the Creative acid content is higher than saturated fatty acid content, and the Commons Attribution 4.0 International License (http:// creativecommons.org/licenses/by/4.0/), which permits unrestricted use, main fatty acids include C16:0, C16:4, and C18:3n3 (James distribution, and reproduction in any medium, provided you give et al. 2011). Change of fatty acid synthesis enzymes may appropriate credit to the original author(s) and the source, provide a link change the composition of fatty acids as well. In particular, to the Creative Commons license, and indicate if changes were made. GPDH catalyzes dihydroxyacetone phosphatein to glycerol-3- phosphate, while LPAAT catalyzes the synthesis of phospha- References tidic acid (La Russa et al. 2012). When introducing diacyl- glycerol acyltransferase gene from B. napus to C. reinhardtii, Ahmad AI, Sharma AK, Daniell H, Kumar S (2015) Altered lipid com- there is no major change in the main fatty acid components. position and enhanced lipid production in green microalga by intro- However, the levels of saturated fatty acids in the transformed duction of Brassica diacylglycerol acyltransferase 2. Plant algae decrease to about 7% while unsaturated fatty acids Biotechnol J 13:540–550 J Appl Phycol (2018) 30:1711–1719 1719 Amaro HM, Ângela CM, Malcata FX (2012) Microalgae: an alternative Liang MH, Jiang JG (2013) Advancing oleaginous microorganisms to produce lipid via metabolic engineering technology. Prog Lipid Res as sustainable source of biofuels? Energy 44:158–166 Banerjee C, Singh PK, Shukla P (2016) Microalgal bioengineering for 52:395–408 sustainable energy development: recent transgenesis and metabolic Lu S, Wang J, Niu Y, Jie Y, Jian Z, Yuan Y (2012) Metabolic profiling engineering strategies. Biotechnol J 41:355–363 reveals growth related fame productivity and quality of Chlorella Dehesh K, Tai H, Edwards P, Byrne J, Jaworski JG (2001) sorokiniana, with different inoculum sizes. Biotechnol Bioeng 109: Overexpression of 3-ketoacyl-acyl-carrier protein synthase IIIs in 1651–1662 plants reduces the rate of lipid synthesis. Plant Physiol 125:1103– Lv H, Qu G, Qi X, Lu L, Tian C, Ma Y (2013) Transcriptome analysis of Chlamydomonas reinhardtii during the process of lipid accumula- Deng X, Cai J, Li Y, Fei X (2014) Expression and knockdown of the tion. Genomics 101:229–237 pepc1, gene affect carbon flux in the biosynthesis of triacylglycerols Maisonneuve S, Bessoule JJ, Lessire R, Delseny M, Roscoe TJ (2010) by the green alga Chlamydomonas reinhardtii. Biotechnol Lett 36: Expression of rapeseed microsomal lysophosphatidic acid acyltrans- 449–568 ferase isozymes enhances seed oil content in Arabidopsis. Plant Deng X, Li Y, Fei X (2011) The mRNA abundance of pepc2,gene is Physiol 152:670–684 negatively correlated with oil content in Chlamydomonas Mata TM, Martins AA, Caetano NS (2010) Microalgae for biodiesel reinhardtii. Biomass Bioenergy 35:1811–1817 production and other applications: a review. Renew Sust Energy Dunahay TG, Jarvis EE, Roessler PG (1995) Genetic transformation of the Rev 14:217–232 diatoms Cyclotella cryptica and Navicula saprophila. J Phycol 31: Casais-Molina ML, Peraza-Echeverria S, Echevarría-Machado I, 1004–1012 Herrera-Valencia VA (2016) Expression of Chlamydomonas Fan J, Cui Y, Wan M, Wang W, Li Y (2014) Lipid accumulation and reinhardtii CrGPDH2,and CrGPDH3, cDNAs in yeast reveals that biosynthesis genes response of the oleaginous Chlorella pyrenoidosa they encode functional glycerol-3-phosphate dehydrogenases in- under three nutrition stressors. Biotechnol Biofuels 7:1–14 volved in glycerol production and osmotic stress tolerance. J Appl Gorman DS, Levine RP (1965) Cytochrome f and plastocyanin: their Phycol 28:219–226 sequence in the photosynthetic electron transport chain of Mentewab A, Stewart CN (2005) Overexpression of an Arabidopsis Chlamydomonas reinhardi. ProcNatlAcadSci U S A 54:1665– thaliana ABC transporter confers kanamycin resistance to transgen- ic plants. Nat Biotechnol 23:1177–1180 Griffiths MJ, Harrison STL (2009) Lipid productivity as a key character- Mubarak M, Shaija A, Suchithra TV (2015) A review on the extraction of istic for choosing algal species for biodiesel production. J Appl lipid from microalgae for biodiesel production. Algal Res 7:117– Phycol 21:493–507 Himanshu S, Manish RS, Basuthkar JR, Kandala VRC (2016) Regulation Hu Q, Sommerfeld M, Jarvis E, Ghirardi M, Posewitz M, Seibert M, of starch, lipids and amino acids upon nitrogen sensing in Darzins A (2008) Microalgal triacylglycerols as feedstocks for bio- Chlamydomonas reinhardtii. Algal Res 18:33–44 fuel production: perspectives and advances. Plant J 54:621–639 Ibáñez-Salazar A, Rosales-Mendoza S, Rocha-Uribe A, Ramírez-Alonso Schroda M, Beck CF, Vallon O (2002) Sequence elements within an JI, Lara-Hernández I, Hernández-Torres A, Paz-Maldonado LMT, HSP70 promoter counteract transcriptional transgene silencing in Silva-Ramirez AS, Banuelos-Hernandez B, Martinez-Salgado JL, Chlamydomonas. Plant J 31:445–455 Soria-Guerra RE (2014) Over-expression of Dof-type transcription Schroda M, Blöcker D, Beck CF (2000) The HSP70A promoter as a tool factor increases lipid production in Chlamydomonas reinhardtii.J for the improved expression of transgenes in Chlamydomonas.Plant J Biotech 184:27–38 21:121–131 Jain RK, Coffey M, Lai K, Kumar A, Mackenzie SL (2000) Enhancement Stevens DR, Rochaix J-D, Purton S (1996) The bacterial phleomycin of seed oil content by expression of glycerol-3-phosphate acyltrans- resistance gene ble as a dominant selectable marker in ferase genes. Biochem Soc Trans 28:958–961 Chlamydomonas. Mol Gen Genet 251(1):23–30 James GO, Hocart CH, Hillier W, Chen H, Kordbacheh F, Price GD, Talebi AF, Mohtashami SK, Tabatabaei M, Tohidfar M, Bagheri A, Djordjevic MA (2011) Fatty acid profiling of Chlamydomonas Zeinalabedini M, Mirzaei HH, Mirzajanzadeh M, Shafaroudi SM, reinhardtii, under nitrogen deprivation. Bioresour Technol 102: Bakhtiari S (2013) Fatty acids profiling: a selective criterion for 3343–3351 screening microalgae strains for biodiesel production. Algal Res 2: Kang NK, Jeon S, Kwon S, Koh HG, Shin SE, Lee B, Choi GG, Yang 258–267 JW, Jeong BR, Chang YK (2015) Effects of overexpression of a Vigeolas H, Waldeck P, Zank T, Geigenberger P (2007) Increasing seed bHLH transcription factor on biomass and lipid production in oil content in oil-seed rape (Brassica napus L.) by over-expression Nannochloropsis salina. Biotechnol Biofuels 8:1–13 of a yeast glycerol-3-phosphate dehydrogenase under the control of Kindle KL (1990) High-frequency nuclear transformation of a seed-specific promoter. Plant Biotechnol J 5:431–441 Chlamydomonas reinhardtii.Proc NatlAcadSciU SA87:1228– Wang CG, Chen X, Li H, Wang JX, ZL H (2017) Artificial miRNA inhi- bition of phosphoenolpyruvate carboxylase increases fatty acid pro- Kirchner L, Wirshing A, Kurt L, Reinard T, Glick J, Cram EJ, Jacobsen duction in a green microalga Chlamydomonas reinhardtii. Biotechnol H-J, Lee-Parsons CWT (2016) Identification, characterization, and Biofuels 10:91 expression of diacylgylcerol acyltransferase type-1 from Chlorella Wu JX, ZL H, Wang CG, Li SF, Lei AP (2008) Efficient expression of vulgaris. Algal Res 13:167–181 green fluorescent protein (gfp) mediated by a chimeric promoter in La Russa M, Bogen C, Uhmeyer A, Doebbe A, Filippone E, Kruse O, Chlamydomonas reinhardtii. Chin J Oceanol Limnol 26:242–247 Mussgnug JH (2012) Functional analysis of three type-2 DGAT Yuan Y, Liang Y, Gao L, Sun R, Zheng Y, Li D (2015) Functional heter- homologue genes for triacylglycerol production in the green ologous expression of a lysophosphatidic acid acyltransferase from microalga Chlamydomonas reinhardtii. J Biotech 162:13–20 coconut (Cocos nucifera L.) endosperm in Saccharomyces Lei AP, Chen H, Shen GM, ZL H, Chen L, Wang JX (2012) Expression of cerevisiae and Nicotiana tabacum. Scientia Hort 192:224–230 fatty acid synthesis genes and fatty acid accumulation in Haematococcus pluvialis under different stressors. Biotechnol Zhang FY, Yang MF, YN X (2005) Silencing of DGAT1 in tobacco Biofuels 5:1–11 causes a reduction in seed oil content. Plant Sci 169:689–694 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Applied Phycology Springer Journals

Effect of overexpression of LPAAT and GPD1 on lipid synthesis and composition in green microalga Chlamydomonas reinhardtii

Free
9 pages

Loading next page...
 
/lp/springer_journal/effect-of-overexpression-of-lpaat-and-gpd1-on-lipid-synthesis-and-A40N4fDIGL
Publisher
Springer Journals
Copyright
Copyright © 2017 by The Author(s)
Subject
Life Sciences; Plant Sciences; Freshwater & Marine Ecology; Plant Physiology; Ecology
ISSN
0921-8971
eISSN
1573-5176
D.O.I.
10.1007/s10811-017-1349-2
Publisher site
See Article on Publisher Site

Abstract

Biodiesel is an alternative energy source which has attracted increasing attention lately. Although algae-based biodiesel produc- tion has many benefits, it is still far from industrial application. Research suggests that improving lipid quality and production through genetic engineering of metabolic pathways will be the most promising way. To enhance lipid content, both lysophosphatidic acyltransferase gene (c-lpaat) and glycerol-3-phosphate dehydrogenase gene (c-gpd1), optimized according to the codon bias of Chlamydomonas reinhardtii, were inserted into the genomic DNA of model microalga C. reinhardtii by the glass bead method. Transgenic algae were screened by zeomycin resistance and RT-PCR. The transcription levels of inserted genes and the fatty acid content were significantly increased after intermittent heat shock. Most of all, the transcription levels of c- lpaat and c-gpd1 were increased 5.3 and 8.6 times after triple heat shocks, resulting in an increase of 44.5 and 67.5% lipid content, respectively. Furthermore, the content of long-chain saturated fatty acids and monounsaturated fatty acids, especially C18 and C18:1t, notably increased, while unsaturated fatty acids dramatically decreased. The results of this study offer a new strategy combining genetic manipulation and intermittent heat shock to enhance lipid production, especially the production of long-chain saturated fatty acids, using C. reinhardtii. . . . . Keywords Chlamydomonas reinhardtii Lipid content Triacylglycerol synthesis Transgenic algae Intermittent heat shock Introduction Biodiesel is an alternative and relatively clean energy source et al. 2010; Talebi et al. 2013). The same as most plants, which attracts increasing attention because the combustion of microalgae store lipid in the form of triacylglycerol (TAG), fossil fuels releases large amounts of CO and pollutants which is the main component of biodiesel (Mubarak et al. (Amaro et al. 2012; Mubarak et al. 2015). Microalgae are 2015). Found in microalgae, the lipid synthesis is mainly one of the most promising sources for the production of bio- through two pathways, fatty acid synthesis and TAG synthe- diesel as they possess short life cycle, perform photosynthesis, sis, which happen in the chloroplast and the endoplasmic re- occupy less land, and absorb a large amount of CO (Mata ticulum, respectively. Acetyl-coenzyme A (AcCoA) forms free fatty acids (FFAs) under the catalysis of Acetyl-CoA car- Electronic supplementary material The online version of this article boxylase (ACCase) and fatty acid synthase (FAS) (Liang and (https://doi.org/10.1007/s10811-017-1349-2) contains supplementary Jiang 2013;Kirchner etal. 2016). In addition, four enzymes material, which is available to authorized users. are involved in the synthesis of TAG, including glycerol-3- phosphate dehydrogenase (GPDH), lysophosphatidic acyl- * Zhangli Hu transferase (LPAAT), diacylglycerol acyltransferase (DGAT), huzl@szu.edu.cn and glycerol-3-phosphate acyltransferase (GPAT) (Griffiths Shenzhen Key Laboratory of Marine Bioresource and and Harrison 2009;Kirchner etal. 2016). Therefore, increas- Eco-environmental Science, Guangdong Engineering Research ing the expression of those genes may achieve the aim of Center for Marine Algal Biotechnology, College of Life Science, improving lipid content. Shenzhen University, Shenzhen 518060, People’s Republic of China 2 In the past few decades, researchers have screened algae School of Science and School of Interprofessional Health Studies, through strain screening and mutagenesis with the aim of im- Faculty of Health and Environmental Sciences, Auckland University of Technology, Auckland 1142, New Zealand proving lipid content (Banerjee et al. 2016; Kirchner et al. 2016). Though research shows that lipid content of microalgae Institute of Biomedical Technology, Auckland University of Technology, Auckland 1142, New Zealand increases under nitrogen or phosphate starvation, the growth 1712 J Appl Phycol (2018) 30:1711–1719 rate of algae is reduced (Hu et al. 2008; Griffiths and Harrison model to study exogenous gene expression and secondary 2009;Himanshu et al. 2016). Nowadays, genetic engineering metabolite synthesis. Here, LPAAT gene from Brassica napus enables us to modify genes related to fatty acid synthesis to and GPD1 gene from Saccharomyces cerevisiae were obtain strains with high lipid content in Chlamydomonas. resynthesized, according to the codon bias of C. reinhardtii, However, expressing ACCase and FAS genes from plants in and then inserted into its genomic DNA to obtain gene over- microalgae has not achieved the aim of significantly increas- expression. We also inserted Hsp70A-RBCS2 promoter and ing oil content (Dunahay et al. 1995; Dehesh et al. 2001). used intermittent heat shocks to find out whether lipid produc- Nevertheless, it is still hopeful to promote lipid content tion in C. reinhardtii can be enhanced and to assess the feasi- through enhancing key enzyme activity of TAG synthesis. In bility of adjusting key enzymes of the TAG synthesis pathway the meantime, transcriptome analysis of Chlamydomonas through genetic engineering to enhance lipid production. reinhardtii with high lipid accumulation reveals that GPDH and LPAAT are significantly upregulated, indicating a positive correlation between the transcription of those genes and cel- Materials and methods lular lipid accumulation (Lv et al. 2013; Fan et al. 2014). Introducing CrGPDH gene from C. reinhardtii into mutated Strains and growth conditions yeast reveals that it causes higher glycerol production (Casais- Molina et al. 2016). When introducing glycerol-3-phosphate Chlamydomonas reinhardtii strain CC-849 was purchased dehydrogenase gene (GPD1) from yeast to oil rapeseed, lipid from the Chlamydomonas Center in the USA and maintained content in the rapeseed is increased by 40% (Vigeolas et al. in Tris-acetate-phosphate (TAP) medium (Gorman and Levine 2007). Moreover, overexpression of LPAAT in Brassica napus 1965), under the temperature of 22 °C and continuous light at or GPAT in Arabidopsis thaliana enhances lipid content and −2 −1 20 μmol photons m s (normal condition). Escherichia coli TAG accumulation (Maisonneuve et al. 2010; Liang and Jiang TOP10 was taken from the bacterial stocks in our laboratory. 2013). The above results imply that changing fatty acid syn- Plasmid pH124 carrying the ble conferring zeomycin and thesis pathway or key enzyme transcription in chloroplast is phleomycin resistance in host cells was constructed and kept not a plausible way to enhance lipid production in algae. On clpaat cgpd1 in our laboratory (Wu et al. 2008). Tran and Tran the other hand, enhancing key enzyme activity of TAG syn- were transgenic algae with introduced c-lpaat and c-gpd1, thesis may promote TAG synthesis by accelerating the trans- respectively. port of FFAs from the chloroplast to the endoplasmic reticu- To apply heat shock (HS), 400 mL cells (wild-type (WT) lum. Currently, there are a limited number of reports using and transgenic algae) in the late logarithmic phase were incu- genetic engineering to modify TAG synthesis pathway to en- −2 −1 bated at 40 °C and light intensity of 20 μmol photons m s hance lipid production in microalgae. For example, it has been for 15 min. Then, the conditions were restored to normal. As reported that overexpression of DGAT in C. reinhardtii has not for multiple HSs, a 4-h recovery period was placed between significantly changed TAG composition or accumulation de- each HS. The sampling time points for a single heat shock spite detecting a high level of transcription (La Russa et al. (HS1) were as follows: before HS, 0 min after HS, and 30, 2012). Therefore, more studies are needed to investigate the 60, 90, and 120 min after recovery. The sampling time points feasibility of enhancing lipid production in algae through ge- for triple heat shocks (HS3) were as follows: before HS, 0 min netic engineering of key enzymes in the TAG pathway. after each HS, and 30, 120, and 240 min after each recovery. Firstly, a strong and inducible promoter is needed to over- The WT strain CC-849 without c-lpaat and c-gpd1 was used express lipid-producing genes in C. reinhardtii. The Hsp70A- as the control. After the treatment, algal cells (WT and trans- RBCS2 promoter has been previously studied and has shown genic algae) were subjected to DNA/RNA extraction and GC- that it could improve the transformation efficiency of a foreign MS analysis. gene and overexpress the foreign gene under 40 °C heat shock (Schroda et al. 2000, 2002). Hence, whether inserting this promoter in front of the lipid-producing gene combined with Construction of vector heat shock can improve gene expression and lipid production is worth investigating. LPAAT gene from Brassica napus (GenBank: AY616009) and In this study, we used C. reinhardtii as a model to investi- GPD1 gene from Saccharomyces cerevisiae (GenBank: gate the effect of GPDH and LPAAT on lipid production in Z24454) were resynthesized as c-lpaat and c-gpd1 according microalgae. Chlamydomonas reinhardtii is a single-cell green to the codon bias of C. reinhardtii and cloned in plasmid alga which has been widely used as a biological model for pUC57 (Sangon Biotech Co., Ltd., China). Fragments of c- photosynthesis and lipid metabolism (Ahmad et al. 2015). It lpaat and c-gpd1 were obtained after cleavage, using restriction has well-established genetic engineering systems in its nucle- endonucleases Nhe Iand PmaC I, and then were inserted into us, chloroplast, and mitochondria and has been used as a pH124 vector to obtain pH124-c-lpaat and pH 124-c-gpd1, J Appl Phycol (2018) 30:1711–1719 1713 respectively. The pH124 vector already contained Hsp70A- gene (as the internal control) was amplified with the primer RBCS2 promoter, RBCS2 terminator, and ble gene (Fig. 1a). sets Actin-F/Actin-R (Table 1). PCR program was set as fol- lows: initial denaturation at 95 °C for 2 min, followed by Nuclear transformation of C. reinhardtii 30 cycles of incubation at 95 °C for 30 s, at 60 °C for 15 s, at 72 °C for 15 s, and a final extension at 72 °C for 5 min. Genetic transformation of C. reinhardtii CC-849 was carried out using the Bglass bead method,^ according to the protocol Gene expression profiling: real-time RT-PCR described by Kindle (1990) and Wang et al. (2017). Total RNAs in WT and transgenic algae were extracted RNA extraction from cells in the late logarithmic phase. Real-time RT- PCR analysis was performed on an ABI PRISM 7900 se- Total RNAs were isolated using a RNA extraction kit quence detection system (Applied Biosystems, USA) fol- (FAST200) (Fastagen Biotechnology Co., Shanghai, China) lowing the protocol previously described using β-actin with DNase I treatment to eliminate possible DNA contami- gene as the internal control and SYBR Premix Ex Taq kit nation according to the manufacturer’s instructions. (Takara, Japan). To obtain cDNA, 1-μg extracted RNA was reversely transcribed into cDNA and then, an equal amount RT-PCR verification of transgenic algae of cDNA was selected as template to perform qRT-PCR. Primer sets for c-lpaat, c-gpd1,and β-actin genes are de- Total RNAs extracted from WT C. reinhardtii and transgenic scribedinTable 2. PCR conditions were as follows: one lines were used as the templates for RT-PCR reactions. The step of 95 °C incubation for 30, followed by 40 cycles of primer sets c-lpaat-F/c-lpaat-R and c-gpd1-F/c-gpd1-R were 95°C for5 and55°Cfor 30s. Datawithan R above 0.998 −ΔΔCt used to amplify the c-lpaat and c-gpd1 genes. The β-actin was analyzed using the 2 program (Lei et al. 2012). Fig. 1 Obtainment of transgenic algae with c-lpaat and c-gpd1. a RT-PCR verification of transgenic algae with c-lpaat and c-gpd1. Construction of transforming plasmids. c-lpaat and c-gpd1 were Specific fragments of 1176 bp were amplified from the total RNA of inserted into pH124 that contained the ampicillin- and zeomycin- transformants. M DL 2000, 1 positive control, PCR fragment of resistant genes and a strong heat-inducible promoter (Hsp70A 1176 bp, 2–4 transgenic algae with c-lpaat,5–7 transgenic algae with c- promoter). b Screening transformants through zeomycin resistance gpd1, 8 negative control, PCR fragment of β-actin from wild-type CC- −1 (10 μgmL ). Green clones were visible after 2–3 weeks, and 849. No c-lpaat and c-gpd1 products were detected in WT −1 transformants were kept in TAP containing 10 μgmL zeomycin. c 1714 J Appl Phycol (2018) 30:1711–1719 Table 1 List of primer sets used in RT-PCR compound with the National Institute of Standards and Technology mass spectral library. Automatic peak Primer name Primer sequences Product (bp) deconvolution was processed with Masslynx software (V4.1, c-lpaat-F 5′ CCAAGGTGGCTCGTGACTC 3′ 1176 Waters Corp.,USA) (Lei et al. 2012). The datasets of FAME c-lpaat-R 5′ ACTCGCCTCTGTGCCTGTT 3′ profiling for further analysis were obtained by normalization c-gpd1-F 5′ CGCCGACCGCCTGAACCT 3′ 1176 against the internal standard in the same chromatogram. c-gpd1-R 5′ CGCCGACCGCCTGAACCT 3′ Actin-F 5′ ACCCGTGCTGACTG 3′ 240 Actin-R 5′ ACGTTGAAGGTCTCGAACA 3′ Protein extraction and quantification When algal growth reached the exponential phase, algal cul- ture was collected and centrifuged at 5000×g and 22 °C for Three technical replicates and two biological replicates 5 min. The supernatant was discarded, and plant total protein were used. The transcription value of c-lpaat and c-gpd1 extraction kit (Sangon Biotech (Shanghai) Co., Ltd.) was used before HS was defined as 1, and then, we obtained the to extract total protein from the remaining algal cells. Bovine other transcription values and expressed them as relative serum albumin (BSA) standard curve was constructed to mea- ratios compared against the before-HS value. sure the protein content according to the above protein- measuring kit’s instruction. Fatty acid methyl ester transformation and FAME analysis Statistical analysis Total lipid extraction was performed as previously described (Lu et al. 2012) with slight modifications. Freeze-dried algal All experiments were repeated three times independently, and −1 powder of 15 mg was weighed. C (500 μgmL ,ANPEL data were recorded as the mean with standard deviation (SD). Laboratory Technologies (Shanghai) Inc.) was added into the For gene expression experiments, quantitative real-time PCR sample as the internal standard. Qualification and quantifica- analysis was performed using the BioRAD iQ5 software. For tion of fatty acid methyl esters (FAMEs) were performed on a each gene, the fold change was expressed as the mean ± SD Thermo Trace GC Ultra gas chromatograph coupled to (% control) and was calculated using the standard curve with Thermo Polaris Q mass spectrometry which was equipped approximation corrected for primer efficiency and normalized with a HP-5MS column (30 m × 0.32 mm id, film thickness to housekeeping gene β-actin expression values. Statistical 0.25 μm). The temperature of the injector was maintained at analyses were performed using the Student’s t test 250 °C. Helium was used as the carrier gas, ions were gener- (SPSS19.0). For all analyses, a p value < 0.05 was considered ated by a 70-Velectron beam, and the mass range scanned was statistically significant. −1 50 to 650 m/z at a rate of 2 scans s . The oven temperature for FAME analysis was initially maintained at 70 °C for 4 min, −1 followed by a temperature increment rate of 5 °C min to −1 195 °C; held for 5 min, followed by 3 °C min increase to Results −1 205 °C; held for 2 min, followed by 8 °C min increment to 230 °C; and then held for 1 min. GC-MS transmitting line Vector construction and transgenic alga obtainment temperature was maintained at 250 °C. Peak identification was performed by matching the mass spectra of each The LPAAT and GPD1 genes were resynthesized accord- ing to the codon bias of C. reinhardtii to obtain c-lpaat and c-gpd1 genes suitable for C. reinhardtii expression Table 2 List of primer sets used in real-time RT-PCR (Stevens et al. 1996) (see supplementary material 1). When treating with 42 °C HS, both c-lpaat and c-gpd1 Gene name Primer name Primer sequences genes under the control of Hsp70A promoter were overexpressed (Fig. 1a). Through zeomycin resistance c-lpaat Q-c-lpaat-F 5′ CCTGTGGCTGGAGCTGGTGT 3′ and RT-PCR screening, transgenic algal cells were obtain- Q-c-lpaat-R 5′ ATGTCCGAGCGGTGGTTGG 3′ ed. Transgenic algae inserted with c-lpaat and c-gpd1 c-gpd1 Q-c-gpd1-F 5′ GTGGTGGCCGAGAACTGCA 3′ clpaat cgpd1 were named as Tran and Tran , respectively Q-c-gpd1-R 5′ TGGTGGCGGGTGTTGATG 3′ (Fig. 1b, c). Transformation efficiency by the glass bead β-actin Actin-F 5′ ACCCGTGCTGCTGATG 3′ −7 −7 −1 method was 8.4 × 10 and 4 × 10 cells mL for c-lpaat Actin-R 5′ACGTTGAAGGTCTCGAACA 3′ and c-gpd1, respectively. J Appl Phycol (2018) 30:1711–1719 1715 Overexpressing c-lpaat and c-gpd1 in transgenic increased the TFA in transgenic algae. The TFA contents in −1 C. reinhardtii WT were 101.79 and 113.57 μgmg dry weight (DW) after one heat shock (HS × 1) and three heat shocks clpaat cgpd1 Both c-lpaat and c-gpd1 controlled by Hsp70A promoter were (HS × 3), respectively. TFA of Tran and Tran in- overexpressed under HS. The transcription levels of target creased 16.8 and 26.7%, respectively, after HS × 1, com- genes were unchanged during HS but increased quickly after pared with WT cells treated with HS × 1 (Fig. 4). algae cells were cooled down to the normal condition and Transgenic algae had significantly higher TFA than WT clpaat reached the highest level after 30 min, with c-lpaat increased cells after HS × 3, with an increase of 44.5% (Tran ) cgpd1 1.93 times and c-gpd1 increased 2.98 times (Fig. 2a, b). or 67.5% (Tran )(Fig. 4). These results were consistent Interestingly, the transcription levels of c-lpaat and c-gpd1 with the high level of gene transcriptions of c-lpaat and c- were further improved when treated with intermittent HS. For gpd1, indicating that overexpression of those genes could clpaat instance, the transcription levels of c-lpaat in Tran were enhance lipid accumulation in transformed C. reinhardtii increased 3.01, 4.46, and 5.3 times after three HSs, respectively cells. cgpd1 (Fig. 3a). The transcription levels of c-gpd1 in Tran were increased 3.6, 5.42, and 8.58 times, respectively (Fig. 3b). The Change in lipid composition of transgenic algae transcription levels of both genes reached the peak at 30 min after HS (Fig. 3a, b). Based on the data analysis, it was con- The fatty acid profile in algae was analyzed by using GC-MS. firmed that the transcription levels of target genes were dramat- WT and transformed algae have similar fatty acids as shown ically increased after HS. by GC-MS peaks (data not shown). The increase in TFA con- tent of transgenic algae was contributed by the increase of Heat shock enhances fatty acid content in transgenic nearly all types of fatty acids. For example, C18:1t in clpaat cgpd1 C. reinhardtii Tran and Tran cells had increases ranging from 177.3 to 270.9% after HS × 1, compared to the WT. The most clpaat As shown above, transcription levels of c-lpaat and c-gpd1 abundant component is still C18:3n3. In Tran , C16:0, in transgenic C. reinhardtii could be enhanced significant- C18:0, and C18:2t had increases ranging from 33 to 38%. cgpd1 ly after HS. Fatty acids (FAs) were extracted from WT and As to Tran , C16:0, C16:1, C18:0, and C18:2t had in- all transgenic algal cells under normal condition and after creases ranging from 43 to 73% (see Table 3 for more details). clpaat HS. Compared to the WT, under the normal culture condi- After HS × 3, in Tran cells, the content of C18:0 tion, the total fatty acid (TFA) contents of transgenic alga and C18:1t fatty acids increased by 355.3 and 220.1%, clpaat cgpd1 cgpd1 strains including Tran and Tran strains increased respectively, compared to the WT. In Tran cells, the by 17.4 and 23.6%, respectively. The HS treatment further content of C18:0 and C18:1 t fatty acids increased by Fig. 2 Single heat shock-enhanced transcription level of transformed genes in transgenic C. reinhardtii (HS heat shock, under 40 °C and 20 μmol −2 −1 photons m s light for 15 min, HS 0 min sampling immediately after heat stimulation. *P < 0.05 compared with before heat shock) 1716 J Appl Phycol (2018) 30:1711–1719 Fig. 4 Lipid content change of transgenic C. reinhardtii after heat shock (HS1 and HS3 stand for single heat shock and triple heat shocks, clpaat respectively.). After heat shock, total fatty acids of Tran and cgpd1 Tran significantly increased when compared with wild-type CC-849 Introducing c-lpaat and c-gpd1 to C. reinhardtii reduces protein synthesis The growth of WT and transgenic algae was similar, and the 6 −1 highest concentration was around 5.8 × 10 cells mL for all strains, indicating that the transformed genes had no effect on the growth of algal cells (see supplementary material 2). Chlamydomonas reinhardtii produces protein and lipid needed for cell function via photosynthesis. Therefore, the carbon amount is relatively fixed and kept in balance in the cellular system. There is a competitive relationship between protein and lipid syntheses in alga cells, and there are reports showing that inhibition of phosphoenolpyruvate carboxylase can enhance cellular fatty acid content in algae (Deng et al. clpaat 2014). After HS × 1, protein content of Tran and cgpd1 Tran cells decreased by 9.2 and 14.1%, respectively, com- clpaat Fig. 3 Triple heat shocks enhanced a c-lpaat and b c-gpd1 gene pared to WT. Furthermore, protein contents of Tran and cgpd1 transcriptions in transgenic C. reinhardtii.(*P < 0.05; **P <0.01 Tran cells decreased by 29 and 34%, respectively, after compared with before heat shock) HS × 3 (Fig. 5a, b). Interestingly, the protein content in WT showed increase after HS × 1 and HS × 3, suggesting that HS in this study had no negative effect on the growth of algae. All of the above demonstrate that introducing c-lpaat and 428.2 and 394.2%, respectively, compared to the WT (see c-gpd1 to C. reinhardtii changed carbon flow direction, which Table 4 for more details). Results showed that the in- increased lipid production but reduced protein synthesis. creased fatty acids were mainly C18 and the most abun- clpaat dant component is still C18:3n3. However, in Tran Introducing c-gpd1 rendered higher efficiency than introduc- cgpd1 cgpd1 ing c-lpaat, as Tran had 23% more lipid content but only and Tran cells, C18:3n3 percentage decreased from 34 to 27%, while C18:0 increased from 2 to 7%. The had 5.2% lower protein level. content of C16:0 and C16:1 fatty acids increased after clpaat cgpd1 HS × 3 in Tran and Tran . Hence, it is clear that introducing c-lpaat and c-gpd1 to C. reinhardtii can sig- Discussion nificantly increase cellular lipid accumulation, in particu- lar enhancing the production of monounsaturated fatty Recent reports show that lipid production in C. reinhardtii can acids and long-chain saturated fatty acids, which could be enhanced under nitrogen starvation (James et al. 2011). be beneficial for biodiesel production. Transcriptome analysis shows that the expression of more J Appl Phycol (2018) 30:1711–1719 1717 Table 3 Change of algal fatty clpaat cgpd1 Fatty acid Wild type Tran Increase (%) Tran Increase (%) acid content and composition −1 −1 −1 (μgmg DW) (μgmg DW) (μgmg DW) after one heat shock 16:0 15.05 ± 0.06 20.03 ± 0.09* 33.09 21.87 ± 0.08* 45.32 16:1 1.98 ± 0.16 1.99 ± 0.51 0.51 2.85 ± 0.19* 43.94 16:4 27.71 ± 0.38 29.03 ± 0.11 4.76 31.25 ± 0.40 12.78 18:0 1.55 ± 0.06 2.15 ± 0.06* 38.71 2.27 ± 0.07* 46.45 18:1t 1.10 ± 0.12 3.05 ± 0.09** 177.27 4.08 ± 0.13** 270.9 18:2t 7.47 ± 0.35 10.06 ± 0.13* 34.67 12.96 ± 0.27* 73.49 18:3 9.83 ± 0.09 10.68 ± 0.29 8.65 10.78 ± 0.16 9.66 18:3n3 37.10 ± 0.08 41.99 ± 0.18 13.18 43.01 ± 0.29 15.93 Average of all the observations of four repeated tests, in the form of mean ± standard error of representation; wild- type CC-849 represents a control. All data unit is in milligram per gram (dry weight). Statistical analysis software SPSS 19.0 than 2500 genes is upregulated, among which the transcrip- of introducing LPAAT and GPD1 into C. reinhardtii is capable tion of enzyme genes in TAG pathway is significantly in- of enhancing lipid production significantly under HS. This creased. One of them, GPDH, increases 5.8 times, and another approach has the potential to be used in high-oil-production gene, LPAAT, increases 3.6 times (Lv et al. 2013). GPDH algae, such as diatoms. Successful application of our strategy catalyzes the synthesis of glycerol-3-phosphate, and LPAAT may reduce the cost of biodiesel production. catalyzes the synthesis of phosphatidic acid, both supply sub- In our study, Hps70A promoter has been used to drive c- strates for TAG synthesis (Deng et al. 2011). Hence, in this gpd1 and c-lpaat expressions. This promoter can greatly en- study, those two genes were introduced into C. reinhardtii to hance gene expression under heat stimulation (Schroda et al. investigate their ability to enhance lipid production. High- 2002). Previous reports show that the transcription level of level transcription of LPAAT and GPD1 was detected, with target genes increases 3–26 times when employing Hsp70A increases of 5.3 and 8.6 times. We successfully used intermit- promoter to express them (Schroda et al. 2000, 2002;Wuet al. tent HS strategy to enhance lipid production for up to 67.5% 2008). We attempted intermittent multiple HS strategy to in- more than the WT. crease gene expression without affecting the growth of algal Currently known key TAG synthesis enzymes are GPDH, cells. Our intermittent triple-HS method has been proven to be GPAT, LPAAT, and DGAT (Lv et al. 2013). Inhibition of successful, where gene expression has been increased signif- LPAAT and DGAT at transcription levels results in lipid reduc- icantly compared with a single HS. Since mRNA is unlikely to tion (Zhang et al. 2005;Lvet al. 2013). On the other hand, accumulate after expression and HS and TATA-binding fac- introducing and overexpressing genes related to TAG synthe- tors can bind to the cis-elements of Hsp70A promoter such as sis cause lipid content to increase (Jain et al. 2000; Zhang et al. HSE sequence and TATA-box (Schroda et al. 2000, 2002), we 2005). Those results suggest that key enzymes of TAG syn- suggest that after the first HS, those regulatory proteins should thesis play important roles in lipid production. Our approach be retained in the cells, which bind to the promoter faster at the Table 4 Change of algal fatty clpaat cgpd1 Fatty acid Wild type Tran Increase (%) Tran Increase (%) acid content and composition −1 −1 −1 (μgmg DW) (μgmg DW) (μgmg DW) after triple heat shocks 16:0 18.05 ± 0.10 29.83 ± 0.06* 65.26 35.39 ± 0.04* 96.07 16:1 2.98 ± 0.06 4.55 ± 0.51* 52.68 6.93 ± 0.21* 132.55 16:4 29.71 ± 0.78 40.99 ± 0.11 37.97 39.65 ± 1.16 33.46 18:0 2.55 ± 0.22 11.61 ± 0.36** 355.29 13.47 ± 0.25** 428.24 18:1t 1.89 ± 0.06 6.05 ± 0.09** 220.11 9.34 ± 0.46** 394.18 18:2t 8.47 ± 0.13 13.06 ± 0.13* 54.19 18.72 ± 0.37* 121.02 18:3 10.83 ± 0.16 11.98 ± 0.50 10.62 15.36 ± 0.11* 41.83 18:3n3 39.09 ± 0.19 44.04 ± 0.07 12.66 51.37 ± 0.21 31.41 Average of all the observations of four repeated tests, in the form of mean ± standard error of representation; wild- type CC-849 represents a control. All data unit is in milligram per gram (dry weight). Statistical analysis software SPSS 19.0 1718 J Appl Phycol (2018) 30:1711–1719 increase proportionately. Polyunsaturated fatty acids, especial- ly α-linolenic acid, increase up to 12% in the transformed line. Interestingly, C18:1–3 slightly decreases in the DAGAT mu- tant strain in C. reinhardtii, while C16:0 slightly increases (La Russa et al. 2012). In yeast with introduced LPAAT, the pro- portion of C12:0 and C14:0 fatty acids increases, while in N. tabacum with introduced LPAAT, that proportion actually decreases (Yuan et al. 2015). Hence, the same gene expressed in different species may result in a different outcome. There is little information about the role of TAG synthesis enzymes in microalga lipid production. In this study, we have shown that with introduced LPAAT or GPD1, saturated and monounsatu- rated fatty acids (C16:0, C18:0, C18:1t, and C18:2 t) have increased significantly. This is consistent with a previous re- port (Mentewab and Stewart 2005). We also have observed that polyunsaturated fatty acids decreased significantly. Therefore, our genetic manipulation has increased long- chain saturated fatty acids, predominantly C16–C18, which make genetically modified C. reinhardtii an attractive source for biodiesel production with relatively low costs. In conclusion, we have established a C. reinhardtii genet- ically modified model that uses Hsp70A promoter to overex- press LPAAT gene from B. napus and GPD1 gene from S. cerevisiae. Applying intermittent multiple-HS strategy, this model can increase lipid production by up to 67.5% and the introduced c-lpaat and c-gpd1 gene expressions can be en- hanced by 5.3 and 8.6 times, respectively. We also have prov- en that overexpression of c-lpaat and c-gpd1 genes is the clpaat cause of high lipid production, which in the meantime reduces Fig. 5 Protein content change after heat shock in a Tran and b cgpd1 Tran cells. (HS heat shock, under 40 °C and 20 μmol protein content. Our results suggest that it is possible to create −2 −1 photons m s light for 15 min, HS 0 min sampling immediately after new strains of microalgae with high lipid production ability, heat stimulation. *P < 0.05 compared with the wild type) and this method can reduce the cost of biodiesel production, which has high technological and economic potentials. second and third HSs, which in turn results in fast enhance- ment of gene expression. The enhanced expression of c-gpd1 Acknowledgements We would like to thank the anonymous reviewers for their constructive suggestions. and c-lpaat increases the TAG synthesis. The 67.5% increase in lipid production resulting from the above is significantly Funding information This work was supported by the National Natural higher than previous reports in other microalgae (La Russa Science Foundation of China (Grant Nos. 31470389, 31470431), et al. 2012; Ibáñez-Salazar et al. 2014;Kang et al. 2015). Guangdong Natural Science Foundation (2014A030308017, 2016A030313052), Project of DEGP (2015KTSCX125), and Shenzhen In C. reinhardtii, the fatty acids are fairly evenly split be- Grant Plan for Science & Technology (JCYJ20160422171614147). tween 16-carbon chains (two thirds of which are C16:0) and 18-carbon chains (predominantly C18:3). Non-saturated fatty Open Access This article is distributed under the terms of the Creative acid content is higher than saturated fatty acid content, and the Commons Attribution 4.0 International License (http:// creativecommons.org/licenses/by/4.0/), which permits unrestricted use, main fatty acids include C16:0, C16:4, and C18:3n3 (James distribution, and reproduction in any medium, provided you give et al. 2011). Change of fatty acid synthesis enzymes may appropriate credit to the original author(s) and the source, provide a link change the composition of fatty acids as well. In particular, to the Creative Commons license, and indicate if changes were made. GPDH catalyzes dihydroxyacetone phosphatein to glycerol-3- phosphate, while LPAAT catalyzes the synthesis of phospha- References tidic acid (La Russa et al. 2012). When introducing diacyl- glycerol acyltransferase gene from B. napus to C. reinhardtii, Ahmad AI, Sharma AK, Daniell H, Kumar S (2015) Altered lipid com- there is no major change in the main fatty acid components. position and enhanced lipid production in green microalga by intro- However, the levels of saturated fatty acids in the transformed duction of Brassica diacylglycerol acyltransferase 2. Plant algae decrease to about 7% while unsaturated fatty acids Biotechnol J 13:540–550 J Appl Phycol (2018) 30:1711–1719 1719 Amaro HM, Ângela CM, Malcata FX (2012) Microalgae: an alternative Liang MH, Jiang JG (2013) Advancing oleaginous microorganisms to produce lipid via metabolic engineering technology. Prog Lipid Res as sustainable source of biofuels? Energy 44:158–166 Banerjee C, Singh PK, Shukla P (2016) Microalgal bioengineering for 52:395–408 sustainable energy development: recent transgenesis and metabolic Lu S, Wang J, Niu Y, Jie Y, Jian Z, Yuan Y (2012) Metabolic profiling engineering strategies. Biotechnol J 41:355–363 reveals growth related fame productivity and quality of Chlorella Dehesh K, Tai H, Edwards P, Byrne J, Jaworski JG (2001) sorokiniana, with different inoculum sizes. Biotechnol Bioeng 109: Overexpression of 3-ketoacyl-acyl-carrier protein synthase IIIs in 1651–1662 plants reduces the rate of lipid synthesis. Plant Physiol 125:1103– Lv H, Qu G, Qi X, Lu L, Tian C, Ma Y (2013) Transcriptome analysis of Chlamydomonas reinhardtii during the process of lipid accumula- Deng X, Cai J, Li Y, Fei X (2014) Expression and knockdown of the tion. Genomics 101:229–237 pepc1, gene affect carbon flux in the biosynthesis of triacylglycerols Maisonneuve S, Bessoule JJ, Lessire R, Delseny M, Roscoe TJ (2010) by the green alga Chlamydomonas reinhardtii. Biotechnol Lett 36: Expression of rapeseed microsomal lysophosphatidic acid acyltrans- 449–568 ferase isozymes enhances seed oil content in Arabidopsis. Plant Deng X, Li Y, Fei X (2011) The mRNA abundance of pepc2,gene is Physiol 152:670–684 negatively correlated with oil content in Chlamydomonas Mata TM, Martins AA, Caetano NS (2010) Microalgae for biodiesel reinhardtii. Biomass Bioenergy 35:1811–1817 production and other applications: a review. Renew Sust Energy Dunahay TG, Jarvis EE, Roessler PG (1995) Genetic transformation of the Rev 14:217–232 diatoms Cyclotella cryptica and Navicula saprophila. J Phycol 31: Casais-Molina ML, Peraza-Echeverria S, Echevarría-Machado I, 1004–1012 Herrera-Valencia VA (2016) Expression of Chlamydomonas Fan J, Cui Y, Wan M, Wang W, Li Y (2014) Lipid accumulation and reinhardtii CrGPDH2,and CrGPDH3, cDNAs in yeast reveals that biosynthesis genes response of the oleaginous Chlorella pyrenoidosa they encode functional glycerol-3-phosphate dehydrogenases in- under three nutrition stressors. Biotechnol Biofuels 7:1–14 volved in glycerol production and osmotic stress tolerance. J Appl Gorman DS, Levine RP (1965) Cytochrome f and plastocyanin: their Phycol 28:219–226 sequence in the photosynthetic electron transport chain of Mentewab A, Stewart CN (2005) Overexpression of an Arabidopsis Chlamydomonas reinhardi. ProcNatlAcadSci U S A 54:1665– thaliana ABC transporter confers kanamycin resistance to transgen- ic plants. Nat Biotechnol 23:1177–1180 Griffiths MJ, Harrison STL (2009) Lipid productivity as a key character- Mubarak M, Shaija A, Suchithra TV (2015) A review on the extraction of istic for choosing algal species for biodiesel production. J Appl lipid from microalgae for biodiesel production. Algal Res 7:117– Phycol 21:493–507 Himanshu S, Manish RS, Basuthkar JR, Kandala VRC (2016) Regulation Hu Q, Sommerfeld M, Jarvis E, Ghirardi M, Posewitz M, Seibert M, of starch, lipids and amino acids upon nitrogen sensing in Darzins A (2008) Microalgal triacylglycerols as feedstocks for bio- Chlamydomonas reinhardtii. Algal Res 18:33–44 fuel production: perspectives and advances. Plant J 54:621–639 Ibáñez-Salazar A, Rosales-Mendoza S, Rocha-Uribe A, Ramírez-Alonso Schroda M, Beck CF, Vallon O (2002) Sequence elements within an JI, Lara-Hernández I, Hernández-Torres A, Paz-Maldonado LMT, HSP70 promoter counteract transcriptional transgene silencing in Silva-Ramirez AS, Banuelos-Hernandez B, Martinez-Salgado JL, Chlamydomonas. Plant J 31:445–455 Soria-Guerra RE (2014) Over-expression of Dof-type transcription Schroda M, Blöcker D, Beck CF (2000) The HSP70A promoter as a tool factor increases lipid production in Chlamydomonas reinhardtii.J for the improved expression of transgenes in Chlamydomonas.Plant J Biotech 184:27–38 21:121–131 Jain RK, Coffey M, Lai K, Kumar A, Mackenzie SL (2000) Enhancement Stevens DR, Rochaix J-D, Purton S (1996) The bacterial phleomycin of seed oil content by expression of glycerol-3-phosphate acyltrans- resistance gene ble as a dominant selectable marker in ferase genes. Biochem Soc Trans 28:958–961 Chlamydomonas. Mol Gen Genet 251(1):23–30 James GO, Hocart CH, Hillier W, Chen H, Kordbacheh F, Price GD, Talebi AF, Mohtashami SK, Tabatabaei M, Tohidfar M, Bagheri A, Djordjevic MA (2011) Fatty acid profiling of Chlamydomonas Zeinalabedini M, Mirzaei HH, Mirzajanzadeh M, Shafaroudi SM, reinhardtii, under nitrogen deprivation. Bioresour Technol 102: Bakhtiari S (2013) Fatty acids profiling: a selective criterion for 3343–3351 screening microalgae strains for biodiesel production. Algal Res 2: Kang NK, Jeon S, Kwon S, Koh HG, Shin SE, Lee B, Choi GG, Yang 258–267 JW, Jeong BR, Chang YK (2015) Effects of overexpression of a Vigeolas H, Waldeck P, Zank T, Geigenberger P (2007) Increasing seed bHLH transcription factor on biomass and lipid production in oil content in oil-seed rape (Brassica napus L.) by over-expression Nannochloropsis salina. Biotechnol Biofuels 8:1–13 of a yeast glycerol-3-phosphate dehydrogenase under the control of Kindle KL (1990) High-frequency nuclear transformation of a seed-specific promoter. Plant Biotechnol J 5:431–441 Chlamydomonas reinhardtii.Proc NatlAcadSciU SA87:1228– Wang CG, Chen X, Li H, Wang JX, ZL H (2017) Artificial miRNA inhi- bition of phosphoenolpyruvate carboxylase increases fatty acid pro- Kirchner L, Wirshing A, Kurt L, Reinard T, Glick J, Cram EJ, Jacobsen duction in a green microalga Chlamydomonas reinhardtii. Biotechnol H-J, Lee-Parsons CWT (2016) Identification, characterization, and Biofuels 10:91 expression of diacylgylcerol acyltransferase type-1 from Chlorella Wu JX, ZL H, Wang CG, Li SF, Lei AP (2008) Efficient expression of vulgaris. Algal Res 13:167–181 green fluorescent protein (gfp) mediated by a chimeric promoter in La Russa M, Bogen C, Uhmeyer A, Doebbe A, Filippone E, Kruse O, Chlamydomonas reinhardtii. Chin J Oceanol Limnol 26:242–247 Mussgnug JH (2012) Functional analysis of three type-2 DGAT Yuan Y, Liang Y, Gao L, Sun R, Zheng Y, Li D (2015) Functional heter- homologue genes for triacylglycerol production in the green ologous expression of a lysophosphatidic acid acyltransferase from microalga Chlamydomonas reinhardtii. J Biotech 162:13–20 coconut (Cocos nucifera L.) endosperm in Saccharomyces Lei AP, Chen H, Shen GM, ZL H, Chen L, Wang JX (2012) Expression of cerevisiae and Nicotiana tabacum. Scientia Hort 192:224–230 fatty acid synthesis genes and fatty acid accumulation in Haematococcus pluvialis under different stressors. Biotechnol Zhang FY, Yang MF, YN X (2005) Silencing of DGAT1 in tobacco Biofuels 5:1–11 causes a reduction in seed oil content. Plant Sci 169:689–694

Journal

Journal of Applied PhycologySpringer Journals

Published: Dec 19, 2017

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off