Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer_journal/differential-modulation-of-host-immune-genes-in-the-kidney-and-cranium-cuKE3ew4Zq
- Publisher
- Springer Journals
- Copyright
- Copyright © 2018 by The Author(s).
- Subject
- Biomedicine; Parasitology; Entomology; Tropical Medicine; Infectious Diseases; Veterinary Medicine/Veterinary Science; Virology
- eISSN
- 1756-3305
- DOI
- 10.1186/s13071-018-2912-7
- Publisher site
- See Article on Publisher Site
Abstract
Background: Most of the studies on fish diseases focus on single infections, although in nature co-infections occur more often. The two freshwater myxozoan parasites of salmonids, having high economic and ecologic relevance are Tetracapsuloides bryosalmonae (Malacosporea), the etiological agent of proliferative kidney disease, and Myxobolus cerebralis (Myxosporea), the etiological agent of whirling disease. The present study aims to investigate immune modulation in rainbow trouts (Oncorhynchus mykiss) during single and co-infections by these parasites. Methods: Fish were initially infected with T. bryosalmonae (one group) and M. cerebralis (another group) separately. At 30 days post-exposure (dpe), both the single species infected groups were co-infected, respectively, with the other parasite. Posterior kidney and cartilage cranium samples were collected at 30, 60, 90 and 120 dpe and RT-qPCR was performed on them to assess the transcription of suppressors of cytokine signaling (SOCS) -1 and -3, Janus kinase-1 (JAK-1) and signal transducer and activator of transcription-3 (STAT-3) genes. Results: Kidney samples from the T. bryosalmonae-infected group showed upregulation of all immune genes tested between 60–120 dpe. Crania from the single M. cerebralis-infected group and the M. cerebralis and T. bryosalmonae co- infected group exhibited upregulation of SOCS-1 and JAK-1 between 60–120 dpe and SOCS-3 at 120 dpe. However, only in the single M. cerebralis-infected group, was a statistically significant expression of STAT-3 observed at 30 and 60 dpe. Conclusions: The results of this study indicate that both T. bryosalmonae and M. cerebralis induce overexpression of SOCS-1 and SOCS-3 genes and modulate the host immune response during the development of parasite to cause immunosuppression. Keywords: Co-infections, Salmonids, Proliferative kidney disease, Whirling disease, JAK/STAT signaling pathway, Immunosuppression * Correspondence: Mansour.El-Matbouli@vetmeduni.ac.at Clinical Division of Fish Medicine, University of Veterinary Medicine, Veterinärplatz 1, 1210 Vienna, Austria Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Kotob et al. Parasites & Vectors (2018) 11:326 Page 2 of 10 Background cytokine receptor complex. Thereafter, the binding of signal Proliferative kidney disease (PKD) is caused by the myx- transducer and activator of transcription (STAT) proteins ozoan parasite, Tetracapsuloides bryosalmonae that belongs to the site of the activated receptor and their phosphoryl- to the class Malacosprea and phylum Myxozoa [1, 2]. PKD ation occurs. Activated STAT proteins translocate to cell causes high economic losses of farmed and wild autoch- nucleus for signal transduction and initiate the gene tran- thonous salmonids and is distributed in the regions of Eur- scription [25–27]. The suppressors of cytokine signaling ope and North America [3–5]. The life-cycle of T. (SOCS) are a group of intracellular molecules that act as bryosalmonae alternates between an invertebrate freshwater strong negative regulators of the cytokine signaling through bryozoan host (Fredericella sultana) and a vertebrate sal- inhibition of the JAK-STAT pathway [28]. Even in Teleost monid host [4, 6]. PKD targets the kidney and induces fish, SOCS molecules are known to play an important role chronic immunopathology, granulomatous-like lesions and during the development of innate and acquired immunity lymphocytic hyperplasia of the interstitial kidney tissue, [29], with SOCS-1 and SOCS-3 being selectively induced along with hyperimmunoglobulinemia [7, 8]. Since this dis- during PKD [8, 30]. ease is temperature-dependent, climate change plays a cru- Even though co-infections occur frequently in the aquatic cial role in its pathogenesis [5]. The infective T. environment, the research on such a subject is still in the bryosalmonae malacospores spread either through infected infancy, with most of the studies often being conducted on tolerant hosts, such as brown trout (Salmo trutta)[9], or single infections [31–33]. During co-infections, the host im- infected bryozoan dispersal, via migrating zooids [10]and mune response induced by one pathogen can alter the infected statoblasts [11]. During PKD the mortality rate can pathogenesis of the secondary infections through the sup- range from less than 20%, to 95–100% in serious outbreaks pression or stimulation of the immune system [31–33]. The that are complicated by secondary infections and unfavor- interaction between different parasites could be either syn- able farming or environmental conditions [5, 12, 13]. ergistic or antagonistic in the infected host [32, 33]. Mixed Fish that recover from PKD acquire a strong im- infection of five myxozoan parasite species: T. bryosalmo- munity and become resistant to re-infections [14]. nae, Sphaerospora truttae, Chloromyxum schurovi, C. trut- This results from the massive activation of B cells, tae, and Myxobolus sp. has been examined in farmed which induces hyperimmunoglobulinemia in response brown trout (Salmo trutta)[34]. A big knowledge gap still to the parasite’s extra-sporogonic histozoic prolifera- exists in the understanding of immune response mechan- tion [8, 15, 16]. Rainbow trout (Oncorhynchus mykiss) ism in salmonids, during co-infections. Consequently, a show upregulation of tumor necrosis factor (TNF-α2), cy- substantial need for investigating the interactions between clooxygenase (COX-2) and, to some degree, of transform- heterogeneous micro-organisms during co-infections, is ing growth factor (TGF)-β, upon natural infection with T. there [35]. bryosalmonae [8, 17]. The quality of the immune reaction Recently, the impact of T. bryosalmonae and M. to T. bryosalmonae is temperature-dependent, resulting in cerebralis co-infection on pathology of the target or- either a predominant Th2-like immune response with gans of rainbow trout has been examined [36]. The abundant B cell response at 15 °C or predominant present study was designed to examine the expression Th1-like immune response with upregulation of the nat- of immune genes in rainbow trout when co-infected ural killer cell enhancement factor (NKEF) at 12 °C [18]. with two myxozoan parasites, by measuring the tran- Whirling disease (WD) is a highly debilitating disease scription levels of JAK/STAT signaling induced genes of salmonids that is caused by the myxozoan parasite and SOCS genes in the posterior kidney and cranial Myxobolus cerebralis [19, 20]. M. cerebralis alternates cartilages (the target tissues of PKD or WD pathogen- between two hosts, an invertebrate oligochaetae host esis), respectively. (Tubifex tubifex) and a vertebrate salmonid host, to complete a complex life-cycle [21, 22]. Mature myxos- Methods pores that are formed within the fish cartilage can infect Fish and the experiment design T. tubifex and once inside, T. tubifex triactinomyxons The experimental challenges, consisting of single (TAMs) are formed and released into the water, thus infection and co-infection with parasites, were infecting salmonids [23, 24]. WD is implicated in the performed as described previously in the first part of decline of wild trout populations in North America [22]. this study and the focus was on the pathological The severity of WD depends largely on the age and size assessment (Fig. 1)[36]. Briefly, pathogen-free rain- of the affected fish, with higher mortality rates in finger- bow trout (mean length 4.02 ± 0.26 cm, mean weight lings, up to 90% of the infected populations [22]. 0.6 ± 0.15 g) were divided into three groups of 96 The binding of a wide array of cytokines and growth fac- each: the first group was infected with T. bryosalmo- tors to their cell receptors activates the associated Janus nae spores, according to Kumar et al. [37], while the kinase (JAK) proteins and subsequently phosphorylates the second group was infected with M. cerebralis TAMs, Kotob et al. Parasites & Vectors (2018) 11:326 Page 3 of 10 Fig. 1 The experimental design. Three primary groups of rainbow trout: T. bryosalmonae-infected, M. cerebralis-infected, and uninfected control. Primary infected fish were exposed to M. cerebralis and T. bryosalmonae at 30 dpe, thereafter fish were sampled at the specified time points (adapted from Kotob et al. [36]) according to Hedrick et al. [38], and the third group was Reverse transcription quantitative PCR (RT-qPCR) kept as uninfected control. Thirty days later, half of the Parasite load determination (respectively for T. bryosalmo- fish from the first two infected groups were reciprocally nae and M. cerebralis) and quantification of the expres- co-infected with these parasites. At 30, 60, 90 and 120 sion of SOCS-1, SOCS-3, JAK-1 and STAT-3 genes, were days post-exposure (dpe), the fish were euthanized using performed using samples from posterior kidneys and the an overdose of tricaine methanesulfonate (500 mg/l, crania of infected fish, following the previously described MS-222, Sigma-Aldrich, Steinheim, Germany) and poster- methodology [8, 39–41]. Primers used for the gene tran- ior kidneys and crania were dissected out and preserved scription assessment are summarized in Table 1.The in RNAlater (Sigma-Aldrich). quantity of gene expression level was measured with CFX96 Touch Real-Time PCR detection system (Bio-Rad). RNA extraction and cDNA synthesis The PCR reaction of 20 μl final volume contained 4 μlof Total RNA was extracted from the posterior kidneys and 1:10-fold diluted cDNA, 1× SsoAdvanced Universal SYBR cranial samples of each group (n = 4) at each time point, Green Supermix (Bio-Rad), 0.4 μM of each primer, and starting from 30 dpe (time of co-infection), using DEPC-treated sterile distilled water (Bio-Rad). The PCR RNeasy Mini Kit (Qiagen, Hilden, Germany) following reaction consisted of an initial 5 min of cDNA denatur- the manufacturer’s instructions. An on-column DNase ation at 95 °C, followed by 35 cycles of 95 °C for 30 s, 57– digestion step was also included in order to remove 62 °C for 30 s and 72 °C for 30 s. A melting-point curve any residual DNA contamination. RNA concentration was measured, starting from 57 °C with an increase of was determined using a Nanodrop 2000c spectropho- 0.5 °C at every 10 s up to 95 °C, for detecting non-specific tometer (Thermo Fisher Scientific, Wilmington, USA) binding. Elongation factor 1 alpha [42] was used as a ref- and one microgram of total RNA was used to erence gene for normalizing the expression of targeted synthesize cDNA, with iScript cDNA Synthesis Kit genes and calculation of relative gene expression was (Bio-Rad, Hercules, USA). done using CFX manager software version 3.1 (Bio-Rad). Kotob et al. Parasites & Vectors (2018) 11:326 Page 4 of 10 Table 1 List of quantitative real-time PCR primers Primer name Primer sequence (5′-3′) Amplicon size (bp) GenBank ID Reference T. bryosalmonae RPL18 F GTAAACGGGGACAAAAAGA 251 FR852769 [8] T. bryosalmonae RPL18 R GGAGCAGCACCAAAATAC Myx18-909 F CTTTGACTGAATGTTATTCAGTTACAGCA 88 AF115253 [39] Myx18-996 R GCGGTCTGGGCAAATGC SOCS-1 F GATTAATACCGCTGGGATTCTGTG 136 AM748721 [8] SOCS-1 R CTCTCCCATCGCTACACAGTTCC SOCS-3 F CACAGAGAAACCGTTAAAAGGACTATCC 228 AM748723 [8] SOCS-3 R AAGGGGCTGCTGCTCATGAC JAK-1 F ACACTGATATTGGGCCGTTCTGGA 174 CA378782 [40] JAK-1 R CCTCGTCCTCTGCATCTTTACCAAC STAT-3 F GAATGAAGGGTATATTCTGG 152 U60333 [41] STAT-3 R TCCCACTGATGTCCTTTTCC EF-1α F AGACAGCAAAAACGACCCCC 167 HF563594 [42] EF-1α R AACGACGGTCGATCTTCTCC These primers were used in RT-qPCR to quantify the relative gene expression in posterior kidneys and cranial cartilages of infected rainbow trout during single and co-infections Statistical analysis immune genes. The statistical differences were considered The differences in the expression of genes that were significantata P-value < 0.05 and all the data were analyzed tested at different time points for each group were ana- in IBM SPSS software version 24. lyzed by a general linear model with repeated measure- ments and Sidak’s procedure was used for multiple Results comparison. One-way ANOVA with Tukey’s α-correction Tetracapsuloides bryosalmonae and Myxobolus cerebralis was used to examine the differences of expressions between parasite burden all groups at each time point. Pearson’s product-moment The relative expression of 60S ribosomal protein L18 of correlation coefficient (r) was measured to determine the T. bryosalmonae (RPL18) and 18S rRNA genes of M. correlation between relative expressions of all tested cerebralis in the posterior kidneys and the crania, Fig. 2 Parasite burden quantification in the posterior kidneys and cranial cartilages of infected rainbow trout. a T. bryosalmonae RPL18 expression in posterior kidneys of T. bryosalmonae-infected rainbow trout, b M. cerebralis 18S rRNA expression in cranial cartilages of M. cerebralis-infected rainbow trout. Bars indicate standard deviation (n =4) Kotob et al. Parasites & Vectors (2018) 11:326 Page 5 of 10 respectively, showed an increasing burden during the SOCS-1; F = 108.095, P < 0.001 for SOCS-3 and (2, 6) pathogenesis progression in single and co-infections F =8.116, P < 0.05 for JAK-1). No significant differ- (2, 6) (Fig. 2). Tb burden reached significantly higher levels in ence in the transcription of STAT-3 gene was observed be- the Mc-then-Tb co-infected group, in the posterior kid- tween all the groups at this stage (F = 2.471, P =0.165) (2,6) neys during 60 and 90 days post secondary exposure to (Figs. 3, 4). T. bryosalmonae (F = 5.969, P < 0.05; F = 8.750, At 60 dpe, SOCS-1 gene expression was upregulated (2, 6) (2, 6) P < 0.05) (Fig. 2a). Mc burden in the Tb-then-Mc in all Tb-infected groups which was significant in the sin- co-infected group was significantly lower than the single gle Tb-infected group compared to single Mc-infected and Mc-infected group at 30 dpe to Mc (F =8.240, uninfected control groups (F = 25.766, P = 0.001), and (1, 4) (2, 6) P = 0.045), then Mc burden increased at 60 dpe to other co-infected groups (F = 5.486, P = 0.044). When (2, 6) Mc in all Mc-infected groups and reached signifi- all the groups were compared, the upregulation of cantly higher levels in Mc-then-Tb co-infected group SOCS-3 was significant in the single Tb and Tb-then-Mc at 90 and 120 dpe to Mc (F = 64.105, P <0.01; co-infected groups (F = 27.941, P < 0.01) and upreg- (2, 6) (4, 10) F = 18.489, P = 0.013, respectively) (Fig. 2b). ulation of JAK-1 and STAT-3 gene expression was (1, 4) significant in all Tb-infected groups (F = 56.291, (4, 10) Immune gene expression in the posterior kidneys during P <0.01for JAK-1 and F = 58.690, P <0.01 for (4, 10) single and co-infections STAT-3) (Figs. 3, 4). Kidneys of the single Mc-infected group displayed no At 90 dpe, increased gene expression of SOCS-1, significant differences in the expression of SOCS-1, SOCS-3, JAK-1 and STAT-3 transcriptions was seen in JAK-1 and STAT-3 genes at all the time points, when all the Tb-infected groups, especially in the Mc-then-Tb compared to the uninfected control (F =2.670, co-infected group, compared to the uninfected control (1, 4) P > 0.05). However, only SOCS-3 gene expression in- and single Mc-infected groups (F = 21.612, P <0.001 (4, 10) creased from 90 dpe and showed a significant increase at for SOCS-1; F = 38.323, P < 0.001 for SOCS-3; F (4, 10) (4, 10) 120 dpe (F = 158.623, P = 0.001), indicating the stimu- = 22.507, P < 0.001 for JAK-1 and F = 20.744, P < (1, 4) (4, 10) lation of systemic immune response during the late stages 0.001 for STAT-3) (Figs. 3, 4). of WD (Figs. 3, 4). At 120 dpe, all the Tb-infected groups showed signifi- The expression of SOCS-1, SOCS-3 and JAK-1 genes cant upregulation of SOCS-1 and SOCS-3 gene expres- started to increase in the single Tb-infected group com- sion when compared with the uninfected control group pared to the single Mc-infected and uninfected con- (F = 24.981, P < 0.05 for SOCS-1 and F = (4, 10) (4, 10) trol groups at 30 dpe (F = 46.157, P <0.001 for 27.407, P < 0.01 for SOCS-3). Moreover, gene expression (2, 6) Fig. 3 Relative gene expression of SOCS-1 (a) and SOCS-3 (b) in posterior kidneys during single and co-infections. RT-qPCR data from different time points were normalized to EF-1α expression and relative gene expression data were statistically analyzed. Bars indicate standard deviation (n = 4). Time points were calculated from the primary exposures to T. bryosalmonae and M. cerebralis Kotob et al. Parasites & Vectors (2018) 11:326 Page 6 of 10 Fig. 4 Relative gene expression of JAK-1 (a) and STAT-3 (b) in posterior kidneys during single and co-infections. Details are the same as in Fig. 3 of JAK-1 and STAT-3 genes were upregulated in the single dpe in the single Mc and Mc-then-Tb co-infected groups Tb-infected and Tb-then-Mc co-infected groups (F = (F = 39.441, P < 0.01) (Fig. 5b), respectively. (4, 10) (3, 8) 15.852, P <0.01for JAK-1and F = 4.417 P <0.05for In the case of JAK-1 and STAT-3 gene expression, a (4, 10) STAT-3) compared to other groups (Figs. 3, 4). remarkable increase was observed in the single Mc-in- The correlation of tested immune genes was positively fected group at 30 dpe (F = 713.629, P < 0.001 for (1, 4) strong between SOCS-1 and JAK-1 in the single Tb-in- JAK-1 and F = 1489.910, P < 0.0001). The transcrip- (1, 4) fected group (r = 0.619, P = 0.032) (see Additional file 1: tion of JAK-1 gene was significantly increased between Table S1). The correlation between the expression of 60–120 dpe in the single Mc and Mc-then-Tb co-infected SOCS-1 and STAT-3 genes was also highly positive in groups compared to other groups (F = 36.765, P < (3, 8) the single Tb-infected group (r = 0.577 and P = 0.049). 0.001 at 60 dpe; F = 54.622, P < 0.001 at 90 dpe and (3, 8) Interestingly, a strong and highly significant positive cor- F =16.834, P < 0.01 at 120 dpe) (Fig. 6a). However, (3, 8) relation was detected in expression of SOCS-1 and statistically significant expression of STAT-3 was only ob- SOCS-3 genes in the single Tb-infected and Mc-then-Tb served in the single Mc-infected group which continued at co-infected groups (r = 0.959 and P = 0.0001; r = 0.895 60 dpe (F = 29.919, P <0.001) (Fig. 6b). (3, 8) and P = 0.001, respectively). SOCS-3 correlated posi- Since there was a low level of expression of all im- tively with JAK-1 and this correlation was highly sig- mune genes in the cranial cartilages, we did not observe nificant in the single Mc-infected group (r = 0.785 any correlation between the immune genes expression. and P = 0.002). A weak positive correlation was found between SOCS-3 and STAT-3 in all groups except in the Discussion single Mc-infected group, where the correlation was strong Myxozoan parasites can modulate the pro-inflammatory (r =0.722 and P = 0.008) and the expression of both genes cellular responses including phagocytosis, oxidative was found to be high at 90 and 120 dpe. Strong positive phagocytic activity and complement activity [43]. Add- correlation was also found between JAK-1 and STAT-3 in itionally, lysozyme, peroxidases, and acute-phase pro- single Tb and Mc-infected groups (r =0.779 and P = 0.003; teins, as the players of humoral immune mechanisms, r =0.775 and P = 0.003, respectively) (see Additional file 1). are also involved in the immune response against those parasites [8, 43]. In this study, we have investigated, for Immune gene expression in the crania during single and the first time, the immune response of rainbow trout co-infections during single and co-infections between T. bryosalmonae The transcription of SOCS-1 and SOCS-3 genes was and M. cerebralis, focusing on selective genes that are significantly higher between 60–120 dpe (F = 92.682, involved in the SOCS/JAK/STAT signaling pathway. We (3, 8) P < 0.001 at 60 dpe; F =9.596, P < 0.01at90dpe and also determined the correlations of gene expression be- (3, 8) F = 36.842, P < 0.001 at 120 dpe) (Fig. 5a) and at 120 tween these immune-related genes. The data obtained (3, 8) Kotob et al. Parasites & Vectors (2018) 11:326 Page 7 of 10 Fig. 5 Relative gene expression of SOCS-1 (a) and SOCS-3 (b) in cranial cartilages during single and co-infections. Details are the same as in Fig. 3 from this study demonstrate that the posterior kidneys kidneys of fish from this group showed increased expres- of all T. bryosalmonae-infected fish had elevated levels sions of tested immune genes at 90 dpe and their crania of tested immune genes and that the pathway was highly also showed the highest gene expression levels of induced during the pathogenesis of PKD, which was SOCS-1 and SOCS-3 at 120 dpe. present either as a single disease or in concomitance The transcription level of the T. bryosalmonae RPL18 with WD. However, the relative gene expressions of gene in cDNAs was measured to assess the relative bur- SOCS-1 and SOCS-3 were much higher than JAK-1 and den of the parasite T. bryosalmonae in posterior kidneys STAT-3. Additionally, the highest load of both parasites [8]. The single Tb-infected and Tb-then-Mc co-infected was detected in fish co-infected initially with M. cerebra- groups showed a decrease in the gene expression of T. lis and then with T. bryosalmonae at 90 dpe. The bryosalmonae RPL18 at 90 and 120 dpe, suggesting the Fig. 6 Relative gene expression of JAK-1 (a) and STAT-3 (b) in cranial cartilages during single and co-infections. Details are the same as in Fig. 3 Kotob et al. Parasites & Vectors (2018) 11:326 Page 8 of 10 activation of immune system and parasite clearance dur- parasitic burden and pathology progression [8, 30]. In ing this time. However, this was not in agreement with addition, one of the most striking findings was the pres- the immunohistochemistry (IHC) results obtained by ence of increased SOCS-1 and SOCS-3 gene transcrip- counting the number of parasites [36]. The disparity be- tion in the Mc-then-Tb co-infected group at 90 dpe that tween both the results could be because of the fact that correlated positively with the kidney swelling index and the IHC data reflected both dead and viable parasites pathological lesions of kidneys from this group [36]. This while the data obtained by T. bryosalmonae RPL18 gene could be attributed to the presence of synergistic inter- expression reflected only viable parasites in the samples. action during the period of co-infection [36]. It has been Nevertheless, the relative gene expression of T. bryosal- demonstrated earlier that SOCS-1 has a negative regula- monae RPL18 in Mc-then-Tb co-infected group per- tory effect on interferon (IFN) mediated JAK-STAT sig- sisted to increase, indicating active parasite proliferation naling in fish, and that there exists a direct negative and the suppression of immune response. Furthermore, interaction between SOCS-1 and STAT-1 and between the primary infection of rainbow trout with M. cerebralis SOCS-1 and Tyrosine kinase 2 (Tyk2) [28]. SOCS-1 and then with T. bryosalmonae fostered the pathogenesis blocks the differentiation of Th1 subset through inhib- of both infections and this co-infected group exhibited ition of IFN-γ-STAT-1 and IL-12-STAT-4 pathways and high parasitic burden of both parasites (Fig. 2a, b). These hence its deficiency can lead to constitutive expression data were in accordance with the counting of T. bryosa- of IFN-γ and STAT-1 inducing Th1 differentiation, pre- lomae stages in the kidney of infected fish [36]. The syn- venting Th17 differentiation [46]. SOCS-1 and SOCS-3 ergistic interaction that occurred in this case of have a negative regulatory role in IFN-γ signaling within co-infection might be due to the immunosuppressive ef- human keratinocytes and their overexpression inhibits fect of secondary exposure to T. bryosalmonae, which was IFN-γ-induced phosphorylation of IFN-γRα and activa- 30 days after primary M. cerebralis exposure [8, 17, 44]. tion of STAT-1 and STAT-3, leading to impaired PKD-mediated immunosuppression occurs due to the IFN-γ-dependent inflammatory responses [47]. The downregulation of some key regulatory genes and signifi- pathogenesis of PKD in rainbow trout is strongly inducing cant decrease in phagocytic and respiratory burst activity the transcription of Type II IFN-γ [8]. Despite the upregu- of kidney macrophages [44]. During the course of primary lation of all immune tested genes observed in this study, infection with M. cerebralis, the spores successfully we found that the relative gene expressions of SOCS-1 parasitize and multiply in the cranium and evade the im- and SOCS-3 in the posterior kidney were much higher mune system before the secondary exposure to T. bryosalo- than JAK-1 and STAT-3. Kumar et al. [42] found that the monae, because of which the infected fish exhibits gene expression of transforming protein RhoA, which reg- exacerbated form of clinical signs and lesions of both dis- ulates the signal transduction pathway of a wide range of eases along with the highest levels of transcription of the cellular processes, was upregulated in the kidney of brown specific genes of parasites load (T. byrosalmonae RPL18 trout infected with T. bryosalmonae and suggested that and M. cerebralis 18S rRNA) [36]. On the contrary, the sec- differential modulation of genes may support the parasite ondary infection with M. cerebralis counteracts the devel- development in fish hosts. In our experiment, we studied opment and the load of M. cerebralis in the cranium of the induced expressions of the tested JAK-STAT genes in Tb-infected rainbow trout, evident from the lower parasitic the trout kidneys, during T. bryosalmonae infection and load in this group (Fig. 2b). The decreased parasitic burden found that the gene expressions of SOCS-1 and SOCS-3 could be due to the cross-reactivity between the sporogonic were most prominent, which indicated their support for stages of both parasites that might induce cross-immunity parasite development in the fish host. and thereby interfering with the pathogenesis and parasitic It has been reported previously that innate immune re- burden of secondary M. cerebralis [45]. sponse genes namely, IFN-γ, interferon regulatory factor The pathogenesis of PKD is characterized by an 1 (IRF-1) and inducible nitric oxide synthase (iNOS) in anti-inflammatory reaction, T helper cell-like activity addition to Ubiquitin-like protein 1 were significantly and an intense B cell/antibody response with a marked upregulated both in susceptible as well as resistant rain- upregulation of interleukin (IL)-6, IL-10, IL-11 and anti- bow trout strains after exposure to M. cerebralis [41]. microbial peptides [8]. In our study, we found that the However, STAT-3 and metallothionein B were consist- expression of SOCS-1 and SOCS-3 genes was higher ently upregulated in the resistant Hofer strain and during the progression of PKD pathogenesis, further remained unchanged in the susceptible TL trout strain reaffirming the fact that the parasite causes an immuno- following M. cerebralis infection [41, 48]. In the present suppression reaction in host in order to evade its study, we found the expressions of the different immune immune system. This agrees with previous studies that genes to be significantly lower in the cranial cartilage have demonstrated specifically that the expression of than in the kidney, a main hematopoietic organ of fish. SOCS-1 and SOCS-3 genes strongly correlate with the Therefore, the kidney is characterized as an organ that Kotob et al. Parasites & Vectors (2018) 11:326 Page 9 of 10 elicits strong immune response against the invading Funding This study was funded in part by the University of Veterinary Medicine and pathogens. The transcription of SOCS-1 gene was found the Austrian Science Fund (FWF) project no. P29294-B25. to be upregulated in the cranial cartilages from 60 dpe to 120 dpe. The highest level of SOCS-1 and SOCS-3 Availability of data and materials All data supporting the findings of this study are presented in the main text gene expression in the cranium and the highest load of and its Additional file. M. cerebralis were detected in Mc-then-Tb co-infected group at 120 dpe, indicating an association between Authors’ contributions MEM and BG designed the research plan. MEM and GK supervised this study. expression of SOCS genes and disease progression and MHK performed the gene expression screening. MHK and GK analyzed the severity. This is in accordance with observations from data. MHK, GK and MS wrote the manuscript. MEM, BG and MA revised the the first part of this study wherein synergistic effects manuscript. All authors read and approved the final manuscript. were elicited during Mc-then-Tb co-infection along with Ethics approval and consent to participate exacerbated pathological lesions of PKD and WD [36]. This study was approved by the institutional ethics committee of the The elevated expression of JAK-1 gene in the cranium of University of Veterinary Medicine, Vienna and the national authority, and conducted according to §26 of the Austrian Law for Animal Experiments, single Mc-infected and Mc-then-Tb co-infected group at Tierversuchsgesetz 2012–TVG 2012 under permit no. GZ 68.205/0141-WF/V/ 60 dpe (Fig. 6), lowered with the course of time. This 3b/2015. expression reciprocally correlated with increased expres- Competing interests sion of SOCS genes in the Mc-then-Tb co-infected The authors declare that they have no competing interests. group with the course of time (Fig. 5). Therefore, we suggest that M. cerebralis modulates the immune gene Publisher’sNote expression to overcome the host cellular response. The Springer Nature remains neutral with regard to jurisdictional claims in results obtained from this study will help in understand- published maps and institutional affiliations. ing the host-pathogen interaction during single and Author details co-infections with PKD and WD. 1 Clinical Division of Fish Medicine, University of Veterinary Medicine, Veterinärplatz 1, 1210 Vienna, Austria. Department of Pathology, Faculty of Veterinary Medicine, Assiut University, Assiut 71526, Egypt. Department of Conclusions Biological Sciences, Wright State University, Dayton, OH 45435, USA. In this study, we highlight the SOCS/JAK/STAT signaling Received: 25 January 2018 Accepted: 22 May 2018 pathway and its role in co-infections with two myxozoan parasites. Rainbow trout infected with M. cerebralis and then subsequently with T. bryosalmonae showed the highest References 1. Canning EU, Curry A, Feist SW, Longshaw M, Okamura B. Tetracapsula loads of both parasites in the posterior kidneys and cranial bryosalmonae n. sp. for PKX organism, the cause of PKD in salmonid fish. cartilages, thereby indicating a synergistic interaction. This Bull Eur Ass Fish Pathol. 1999;19:203–6. study showed differential immunomodulation of SOCS 2. Canning EU, Curry A, Feist SW, Longshaw M, Okamura B. A new class and order of myxozoans to accommodate parasites of bryozoans with genes and post-receptor JAK/STAT induced genes during ultrastructural observations on Tetracapsula bryosalmonae (PKX organism). myxozoans co-infection when compared to single infection. J Eukaryot Microbiol. 2000;47:456–68. Our results suggest that T. bryosalmonae and M. cerebralis 3. El-Matbouli M, Hoffmann RW. Influence of water quality on the outbreak of proliferative kidney disease-field studies and exposure experiments. J Fish alter the JAK/STAT signaling pathway via astrong overex- Dis. 2002;25:459–67. pression of SOCS-1 and SOCS-3 genes. However, further 4. Grabner DS, El-Matbouli M. Transmission of Tetracapsuloides bryosalmonae studies are required to fully understand the early innate (Myxozoa: Malacosporea) to Fredericella sultana (Bryozoa: Phylactolaemata) by various fish species. Dis Aquat Organ. 2008;79:133–9. immune response of fish during myxozoans co-infections. 5. Okamura B, Hartikainen H, Schmidt-Posthaus H, Wahli T. Life cycle complexity, environmental change and the emerging status of salmonid Additional files proliferative kidney disease. Freshwater Biol. 2011;56:735–53. 6. Morris DJ, Adams A. Transmission of Tetracapsuloides bryosalmonae (Myxozoa: Malacosporea), the causative organism of salmonid proliferative Additional file 1: Table S1 The correlation of coefficient among kidney disease, to the freshwater bryozoan Fredericella sultana. Parasitology. different kidney immune genes expression in single and co-infected 2006;133:701–9. groups. (DOCX 14 kb) 7. Hedrick RP, MacConnell E, De Kinkelin P. Proliferative kidney disease of salmonid fish. Ann Rev Fish Dis. 1993;3:277–90. Abbreviations 8. Gorgoglione B, Wang T, Secombes CJ, Holland JW. Immune gene dpe: Days post-exposure; Mc: Myxobolus cerebralis; PKD: Proliferative kidney expression profiling of proliferative kidney disease in rainbow trout disease; RT-qPCR: Reverse transcription quantitative PCR; Oncorhynchus mykiss reveals a dominance of anti-inflammatory, antibody TAMs: Triactinomyxons; Tb: Tetracapsuloides bryosalmonae; WD: Whirling and T helper cell-like activities. Vet Res. 2013;44:55. disease 9. Soliman H, Kumar G, El-Matbouli M. Tetracapsuloides bryosalmonae persists in brown trout Salmo trutta for five years post exposure. Dis Aquat Organ. Acknowledgments 2018;127:151–6. We are thankful to the ministry of higher education in Egypt for offering a 10. Gorgoglione B, Kotob MH, El-Matbouli M. Migrating zooids allow the PhD scholarship to MHK. We are grateful to the whole team of the Clinical dispersal of Fredericella sultana (Bryozoa) to escape from unfavourable Division of Fish Medicine, University of Veterinary Medicine Vienna for their conditions and further spreading of Tetracapsuloides bryosalmonae. help during this study. J Invertebr Pathol. 2016;140:97–102. Kotob et al. Parasites & Vectors (2018) 11:326 Page 10 of 10 11. Abd-Elfattah A, El-Matbouli M, Kumar G. Structural integrity and viability 33. Kotob MH, Menanteau-Ledouble S, Kumar G, Abdelzaher M, El-Matbouli M. of Fredericella sultana statoblasts infected with Tetracapsuloides The impact of co-infections on fish: a review. Vet Res. 2016;47:98. bryosalmonae (Myxozoa) under diverse treatment conditions. Vet Res. 34. Holzer AS, Sommerville C, Wootten R. Molecular studies on the seasonal 2017;48:19. occurrence and development of five myxozoans in farmed Salmo trutta L. 12. Clifton-Hadley RS, Bucke D, Richards RH. Economic importance of Parasitology. 2006;132:193–205. proliferative kidney disease in salmonid fish in England and Wales. Vet Rec. 35. Johnson PT, Hoverman JT. Parasite diversity and coinfection determine 1986;119:305–6. pathogen infection success and host fitness. Proc Natl Acad Sci USA. 2012; 109:9006–11. 13. Gorgoglione B, Kotob MH, Unfer G, El-Matbouli M. First Proliferative Kidney 36. Kotob MH, Gorgoglione B, Kumar G, Abdelzaher M, Saleh M, El-Matbouli M. Disease outbreak in Austria, linking to the aetiology of Black Trout The impact of Tetracapsuloides bryosalmonae and Myxobolus cerebralis Syndrome threatening autochthonous trout populations. Dis Aquat Organ. co-infections on pathology in rainbow trout. Parasit Vectors. 2017;10:442. 2016;119:117–28. 37. Kumar G, Abd-Elfattah A, Saleh M, El-Matbouli M. Fate of Tetracapsuloides 14. Bailey C, Segner H, Wahli T. What goes around comes around: an bryosalmonae (Myxozoa) after infection of brown trout (Salmo trutta) and investigation of resistance to proliferative kidney disease in rainbow trout rainbow trout (Oncorhynchus mykiss). Dis Aquat Org. 2013;107:9–18. Oncorhynchus mykiss (Walbaum) following experimental re-exposure. J Fish 38. Hedrick RP, McDowell TS, Gay M, Marty GD, Georgiadis MP, MacConnell E. Dis. 2017;11:1599–612. Comparative susceptibility of rainbow trout Oncorhynchus mykiss and 15. Olesen NJ, Vestergard-Jørgensen PE. Quantification of serum brown trout Salmo trutta to Myxobolus cerebralis, the cause of salmonid immunoglobulin in rainbow trout Salmo gairdnieri under various whirling disease. Dis Aquat Org. 1999;37:173–83. environmental conditions. Dis Aquat Org. 1986;1:183–9. 39. Kelley GO, Zagmutt-Vergara FJ, Leutenegger CM, Adkison MA, Baxa DV, 16. Kumar G, Abd-Elfattah A, El-Matbouli M. Identification of differentially Hedrick RP. Identification of a serine protease gene expressed by Myxobolus expressed genes of brown trout (Salmo trutta) and rainbow trout cerebralis during development in rainbow trout Oncorhynchus mykiss. (Oncorhynchus mykiss) in response to Tetracapsuloides bryosalmonae Dis Aquat Organ. 2004;59:235–48. (Myxozoa). Parasitol Res. 2015;114:929–39. 40. Djordjevic B, Škugor S, Jørgensen SM, Øverland M, Mydland LT, Krasnov A. 17. Holland JW, Gould CRW, Jones CS, Noble LR, Secombes CJ. The expression Modulation of splenic immune responses to bacterial lipopolysaccharide in of immune-regulatory genes in rainbow trout, Oncorhynchus mykiss, during rainbow trout (Oncorhynchus mykiss) fed lentinan, a beta-glucan from a natural outbreak of proliferative kidney disease (PKD). Parasitology. mushroom Lentinula edodes. Fish Shellfish Immunol. 2009;26:201–9. 2003;126:95–102. 41. Baerwald MR. Temporal expression patterns of rainbow trout immune- 18. Bailey C, Segner H, Casanova-Nakayama A, Wahli T. Who needs the hotspot? related genes in response to Myxobolus cerebralis exposure. Fish Shellfish The effect of temperature on the fish host immune response to Immunol. 2013;35:965–71. Tetracapsuloides bryosalmonae the causative agent of proliferative kidney 42. Kumar G, Abd-Elfattah A, El-Matbouli M. Differential modulation of host disease. Fish Shellfish Immunol. 2017;63:424–37. genes in the kidney of brown trout Salmo trutta during sporogenesis of 19. Hofer B. Über die Drehkrankheit der Regenbogenforelle. Allg Fisch Ztg. Tetracapsuloides bryosalmonae (Myxozoa). Vet Res. 2014;45:101. 1903;28:7–8. 43. Alvarez-Pellitero P. Fish immunity and parasite infections: from innate 20. Hoffman GL. Myxobolus cerebralis, a worldwide cause of salmonid whirling immunity to immunoprophylactic prospects. Vet Immunol Immunopathol. disease. J Aquat Anim Health. 1990;2:30–7. 2008;126:171–98. 21. Wolf K, Markiw ME. Biology contravenes taxonomy in the Myxozoa: new 44. Chilmonczyk S, Monge D, De Kinkelin P. Proliferative kidney disease: cellular discoveries show alternation of invertebrate and vertebrate hosts. Science. aspects of the rainbow trout, Oncorhynchus mykiss (Walbaum), response to 1984;225:1449–52. parasitic infection. J Fish Dis. 2002;25:217–26. 22. Hedrick RP, El-Matbouli M, Adkinso MA, MacConnell E. Whirling disease: 45. Morris DJ, Molnar K, Longshaw M, Adams A. Immunostaining of spores and re-emergence among wild trout. Immunol Rev. 1998;166:365–76. plasmodia of disparate myxozoan genera with comments on the properties 23. El–Matbouli M, Hoffmann RW, Mandok C. Light and electron microscopic of the sporular mucus envelope. Parasitology. 2006;132:781–90. observations on the route of the triactinomyxon-sporoplasm of Myxobolus 46. Tanaka K, Ichiyama K, Hashimoto M, Yoshida H, Takimoto T, Takaesu G, et al. cerebralis from epidermis into rainbow trout cartilage. J Fish Biol. 1995;46: Loss of suppressor of cytokine signaling 1 in helper T cells leads to 919–35. defective Th17 differentiation by enhancing antagonistic effects of IFN-γ on 24. El-Matbouli M, Hoffmann RW. Light and electron microscopic studies on the STAT3 and Smads. J Immunol. 2008;180:3746–56. chronological development of Myxobolus cerebralis to the actinosporean 47. Federici M, Giustizieri ML, Scarponi C, Girolomoni G, Albanesi C. Impaired stage in Tubifex tubifex. Int J Parasitol. 1998;28:195–217. IFN-γ-dependent inflammatory responses in human keratinocytes 25. Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine signalling and overexpressing the suppressor of cytokine signaling 1. J Immunol. 2002;169: immune regulation. Nat Rev Immunol. 2007;7:454–65. 434–42. 26. O’Shea JJ, Gadina M, Schreiber RD. Cytokine signaling in 2002: new surprises 48. Baerwald MR, Welsh AB, Hedrick RP, May B. Discovery of genes implicated in the Jak/Stat pathway. Cell. 2002;109:S121–31. in whirling disease infection and resistance in rainbow trout using genome- 27. Ilangumaran S, Ramanathan S, Rottapel R. Regulation of the immune system wide expression profiling. BMC Genomics. 2008;9:37. by SOCS family adaptor proteins. Semin Immunol. 2004;16:351–65. 28. Skjesol A, Liebe T, Iliev DB, Thomassen EI, Tollersrud LG, Sobhkhez M, et al. Functional conservation of suppressors of cytokine signaling proteins between teleosts and mammals: Atlantic salmon SOCS1 binds to JAK/STAT family members and suppresses type I and II IFN signaling. Dev Comp Immunol. 2014;45:177–89. 29. Wang T, Secombes CJ. Rainbow trout suppressor of cytokine signalling (SOCS)-1, 2 and 3: Molecular identification, expression and modulation. Mol Immunol. 2008;45:1449–57. 30. Wang T, Gorgoglione B, Maehr T, Holland JW, Vecino JLG, Wadsworth S, et al. Fish suppressors of cytokine signaling (SOCS): gene discovery, modulation of expression and function. J Signal Transduct. 2011;2011: 31. Lello J, Boag B, Fenton A, Stevenson IR, Hudson PJ. Competition and mutualism among the gut helminths of a mammalian host. Nature. 2004;428:840–4. 32. Telfer S, Birtles R, Bennett M, Lambin X, Paterson S, Begon M. Parasite interactions in natural populations: insights from longitudinal data. Parasitology. 2008;135:767–81.
Journal
Parasites & Vectors – Springer Journals
Published: May 30, 2018