Development of pooled testing system for porcine epidemic diarrhoea using real-time fluorescent reverse-transcription loop-mediated isothermal amplification assay

Development of pooled testing system for porcine epidemic diarrhoea using real-time fluorescent... Background: Porcine epidemic diarrhoea (PED) is an emerging disease in pigs that causes massive economic losses in the swine industry, with high mortality in suckling piglets. Early identification of PED virus (PEDV)-infected herd through surveillance or monitoring strategies is necessary for mass control of PED. However, a common working diagnosis system involves identifying PEDV-infected animals individually, which is a costly and time-consuming approach. Given the above information, the thrusts of this study were to develop a real-time fluorescent reverse transcription loop-mediated isothermal amplification (RtF-RT-LAMP) assay and establish a pooled testing system using faecal sample to identify PEDV-infected herd. Results: In this study, we developed an accurate, rapid, cost-effective, and simple RtF- RT-LAMP assay for detecting the PEDV genome targeting M gene. The pooled testing system using the RtF-RT-LAMP assay was optimized such that a pool of at least 15 individual faecal samples could be analysed. Conclusions: The developed RtF-RT-LAMP assay in our study could support the design and implementation of large- scaled epidemiological surveys as well as active surveillance and monitoring programs for effective control of PED. Keywords: PEDV, RtF-RT-LAMP, One-step RT-PCR, Pooled stool samples Background epidemics were reported in important swine-producing Porcine epidemic diarrhoea (PED) is caused by PED countries such as USA, Canada, and Japan [6–8]. virus (PEDV), which is characterized by enteritis, vomit- Control PED programs require effective and rapid sur- ing, and watery diarrhoea. This leads to massive eco- veillance protocols, linked to prompt control procedures, nomic losses in the swine industry with high mortality to ensure that epidemics are brought under control in suckling pigs [1]. PED was first observed in England quickly. Currently, the identification of infected herd is in 1971 and identified in Belgium in 1978 [2, 3]. The dis- done by passive surveillance with required reporting of ease quickly spread to other European countries such as infected herds from veterinarians. However, veterinar- Belgium, England, Germany, France, and Switzerland in ians rely on herd demonstrating clinical signs of infec- the 1980s, and later to Asian countries including Korea, tion, which can lead to failure to accurately identify PED China, Thailand, and Vietnam [4, 5]. Recently, several status and transmission of PEDV to healthy animals. Moreover, surveillance or monitoring is applied to individ- uals, which is associated with important financial and time * Correspondence: sekiguchi@cc.miyazaki-u.ac.jp obstacles. Therefore, well-designed surveys as well as sen- Thi Ngan Mai and Van Diep Nguyen contributed equally to this work. sitive, specific, rapid, and simple detection methods are Animal Infectious Disease and Prevention, Department of Veterinary necessary for the identification of infected herd to control Sciences, Faculty of Agriculture, University of Miyazaki, Miyazaki, Japan Center for Animal Disease Control, University of Miyazaki, Miyazaki, Japan PED. Loop-mediated isothermal amplification (LAMP) Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Mai et al. BMC Veterinary Research (2018) 14:172 Page 2 of 8 combines rapidity, simplicity, and high specificity under diarrhoea virus CV777 strain (GenBank accession num- isothermal conditions [9, 10]. We developed an accurate, ber: KT323979) using the Primer Explorer 4 (https://pri- timely, and simple real-time fluorescent reverse transcrip- merexplorer.jp/lamp4.0.0/index.html) (Additional file 1). tion LAMP (RtF-RT-LAMP) assay (from M gene) using They were synthesized using sequence-grade purification pooled stool samples for PEDV detection. This assay can by Hokkaido System Science Co., Ltd. (Sapporo, Japan), be applied to strategies for the control, monitoring, and which included an outer pair (F3, B3), inner primers surveillance of PED. (FIP, FIP1, BIP), and a loop pair (loopF, loopB) (Table 1). Nucleotide sequences specific for PEDV were detected Methods by multiple alignments of 997 M gene sequences, avail- Viruses able from the DDBJ/EMBL/GenBank database. The PEDV NK94P6 and Fukuoka-1 Tr(−) strains which be- one-step RT-PCR used a previously published primer long to classical clade (G1) were propagated in pair on the S gene [11]. Vero-KY5 (Vero) cells. Trypsin was not used to culture PEDV in Vero cells. The NK94P6 and Fukuoka-1 strains RNA extraction were kindly provided by the National Institute of Animal The total RNAs were extracted from 250 μl cell culture Health, Japan, and the Fukuoka Chuo Livestock Hygiene supernatants of PEDV, TGEV, and PRRSV, JEV, GV Service Center, Fukuoka, Japan, respectively. The Vero using a RNA extraction kit (ReliaPrep™ RNA Cell Mini- cells were also provided by the National Institute of Ani- prep System, Promega, USA), according to the manufac- mal Health, Japan. Briefly, Vero cells were cultured in turer’s instructions. Eagle’s minimal essential medium (EMEM) (Sigma-Al- drich, Tokyo, Japan) supplemented with 10% (v/v) foetal One-step RT-PCR bovine serum (FBS) (Funakoshi, Tokyo, Japan), 0.3% One-step RT-PCR was performed using AccessQuick™ (w/v) tryptose phosphate broth (TPB) (Sigma-Aldrich), RT-PCR System kits (Promega Corporation, WI, USA) and 100 U/ml penicillin-streptomycin (Wako, Tokyo, as previously reported [12]. RT-PCR parameters in- Japan) at 37 °C in a humidified atmosphere contain- cluded a reverse transcription step of 45 °C for 45 min ing 5% CO . Viruses were propagated in Vero cells and an incubation step of 94 °C for 2 min, 35 cycles at cultured in EMEM with 2% FBS and 0.3% TPB at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 1 min, 37 °C. The titter of the PEDV NK94P6 and followed by the final extension at 72 °C for 10 min. The Fukuoka-1 Tr(−) strains were 2.8 × 10 TCID /ml RT-PCR products were visualized by electrophoresis on and 2 × 10 TCID /ml, respectively. a 1.5% agarose gel with ethidium bromide. Transmissible gastroenteritis coronavirus - TGEV (vaccine strain h-5; Nisseiken, Tokyo, Japan) was propa- RtF-RT-LAMP gated in Vero cells; porcine reproductive and respiratory The RtF-RT-LAMP reaction was conducted in a final re- syndrome virus - PRRSV (live PRRS vaccine - Ingelvac action volume of 25 μl consisting of 2 μl RNA template, PRRS® MLV- Boehringer Ingelheim company); Japanese FIP and BIP primers (1.6 μM each), Loop F and Loop B Encephalitis virus – JEV and Getal virus - GV (live vac- primers (0.8 μM each), F3 and B3 primers (0.2 μM cine – Kyoto Biken company, Kyoto, Japan). each), Isothermal Mastermixes (OptiGene, UK), 0.15 u of AMV reverse transcriptase (15 u/μl; Invitrogen, USA). Primers Amplification reactions were performed at 63 °C for All primers for RtF-RT-LAMP were designed from the 40 min (with fluorescence detection followed by melt highly conserved M gene sequence of porcine epidemic curve analysis from 90 to 70 °C at 0.05 °C/s), and then Table 1 Primers used for RtF-RT-LAMP in this study Primer ID Sequence (5′ to 3′) Gene location F3 PED_F3_ID1 TCCTTATGGCTTGCATCAC 25,846–25,864 B3 PED_B3_ID1 CCGTAGACAATTGTTGTAGTGG 26,143–26,122 FIP PED_FIP_ID1, PED_FIP_ID1modified GTMGGCCCATCACAGAAGTAGTTTT 25,983–25,963 (TTTT) GGTTGTGGCGCAGGACA 25,903–25,919 BIP PED_BIP_ID1 CCAACTGGTGTAACGCTAACACTTTTT 26,010–26,032 (TTTT) TACCTGTACGCCAGTAGC 26,087–26,070 LF PED_LF_ID37 TTTCAGGATTGAAAGACCACCAAG 25,947–25,924 LB PED_LB_ID6 GGTACATTGCTTGTAGAGGGCTATAA 26,040–26,065 M: A or C Mai et al. BMC Veterinary Research (2018) 14:172 Page 3 of 8 heated at a start temperature of 98 °C and end Detection of PEDV in clinical samples temperature of 80 °C for 10 min with a ramp rate of A total of 99 faecal pig samples were collected from pig 0.05 °C/sec to terminate the reactions using Genie® III farms in Japan including 50 PED positive samples (from (OptiGene, UK). The fluorescence of the reaction was Kagoshima, Miyazaki, Aomori, Aichi prefectures) that measured in real time, verifying the start of the were collected from December 2013 to August 2017 and amplification. 49 negative samples from a PED negative farm (Sumiyoshi farm, Miyazaki prefecture). These positive Specificity of RtF-RT-LAMP samples are classical, emerging Non-S INDEL, S INDEL, PEDV (adapted strain NK94P6), PRRSV (vaccine strain and S1 NTD-del PEDV variants and some positive sam- MLV), TEGV (vaccine strain h5), JEV (vaccine strain ples are mixed infection of emerging non-S INDEL and HmLu-SC) and GV (vaccine strain HAL-KB) were used S1 NTD-del PEDV variants. Faecal samples were pre- as templates for RtF-RT-LAMP to analyse the specificity pared as a 10% (w/v) suspension in PBS (pH 7.2) and of RtF-RT-LAMP. Sterile ddH O was used as the nega- centrifuged at 2300 x g at 4 °C for 10 min. A 250-μl ali- tive control. quot of supernatant was used for RNA extraction (Relia- Prep™ RNA Cell Miniprep System, Promega, USA). RNA Sensitivity analysis of the RtF-RT-LAMP was used as a template for detection of PEDV by To evaluate the sensitivity of the RtF-RT-LAMP, one-step RT-PCR and RtF-RT-LAMP. PEDV-infected Vero cell cultures of two strains (NK94P6 and Fukuoka-1 Tr(−)) with defined median tis- Pooled samples sue culture infective dose (TCID ) was tenfold serial di- The RtF-RT-LAMP assay was used to determine effi- luted with the supernatant of negative faecal samples. ciency in pooled stool samples for future application in RNA was then extracted from 250 μl media of each dilu- large-scaled epidemiological surveys. We determined the tion and used as a template for RtF-RT-LAMP and sensitivity of the RT-LAMP assay in pooled faecal sam- one-step RT-PCR as mentioned above. ples to calculate the possible sample sizes that can be applied to the pooled technique. Each PEDV positive Real-time RT-PCR sample was pooled with PEDV negative samples in dif- The quantitative One-Step PrimeScript RT-PCR kit ferent pooling ratios including 1:4, 1:9, 1:14, 1:19, 1:24, (Takara Bio, Japan) was used for the real-time RT-PCR 1:29, 1:34, 1:39, 1:44, and 1:49. A 50-μl aliquot from in- to quantitate two PEDV field strains (PEDV S INDEL dividual positive or negative samples was transferred to and Non-S INDEL field strains). A 198 bp DNA frag- a new tube and carefully votexed. Then, 250 μl in each ment of the N gene was amplified with the primer sets pooling ratio was used for RNA extraction (ReliaPrep™ of forward primer (qN306-F) 5’-CGCAAAGACTGAAC RNA Cell Miniprep System, Promega, USA). RNA was CCACTAAC-3′ and reverse primer (56R) 5’-TTGC used as a template for RtF-RT-LAMP. CTCTGTTGTTACTTGGAGAT-3′. A TaqMan probe (ProbeN466–469) with the sequence of 5’-GCAG Results GAGTCGTGGTAATGGCAACA-3′ was labeled with Specificity of the RtF-RT-LAMP assay the 5′-reporter dye 6-carboxyfluorescein (FAM) and the The PEDV NK94P6 strain and other related porcine vi- 3′-quencher BHQ3. Real-time RT-PCR was carried out ruses (PRRSV, TGEV, JEV, GV) were tested using the in a 20 μl reaction containing 2 μl of RNA template, RtF-RT-LAMP assay to evaluate the specificity. Only 10 μl of 2X One Step RT-PCR Buffer III, 0.4 μlof PEDV was positive, and no LAMP products were de- TaKaRa Ex Taq HS, 0.4 μl of both forward and reverse tected in the reactions from other relevant porcine vi- primer, 0.8 μl of Probe, 0.4 μl of ROX Reference Dye ruses or negative control used in this study (Fig. 1). The and 5.6 μl of RNase free water. The reactions were per- results indicated that the RtF-RT-LAMP assay was spe- formed using a StepOnePlus™ Real-Time PCR System cific for PEDV and can be applied for distinguishing (Amplified Biosystems, USA) under the following condi- PEDV from other porcine viruses. tions: initial reverse transcription at 42 °C for 5 min, followed by initial denaturation at 95 °C for 10 s, 40 cy- Sensitivity of the RtF-RT-LAMP assay cles of denaturation at 95 °C for 5 s, and annealing and To evaluate the sensitivity of the RtF-RT-LAMP assay, extension at 60 °C for 30 s. The results of amplification the detection limit was compared to the conventional were analyzed by StepOne Software v2.3 (Amplified Bio- one-step RT-PCR by amplifying ten-fold serial dilutions systems). Tenfold serial dilutions of the transcripts were from the cell culture of two PEDV strains (NK94P6 and 7 2 prepared at concentrations of 8.97 × 10 to 8.97 × 10 Fukuoka-1 Tr(−)). The detection limit of the one-step copies of PEDV per 1 μl volume that were used for RT-PCR of the NK94P6 strain and Fukuoka-1 Tr(−) 3 2 obtaining the standard curves. strain were 2.8 × 10 TCID /ml and 2 × 10 TCID /ml, 50 50 Mai et al. BMC Veterinary Research (2018) 14:172 Page 4 of 8 Amplification Negative control PEDV PRRSV TGEV -20000 05:00 15:00 25:00 35:00 45:00 55:00 Time (mm:ss) Amplification PEDV JEV GV Negative control -20000 05:00 10:00 15:00 20:00 25:00 30:00 35:00 40:00 Time (mm:ss) Fig. 1 Specificity of the RtF-RT-LAMP assay for detecting the PEDV M gene. RNA of PEDV, PRRSV and TGEV (a); PEDV, JEV and GV (b) were used as templates for the RtF-RT-LAMP assay performed at 63 °C for 60 min while, the detection limit of the RtF-RT-LAMP assay Detection of PEDV in clinical samples 1 0 was 2.8 × 10 TCID /ml and 2 × 10 TCID /ml, re- To evaluate the sensitivity and specificity of the 50 50 spectively (Tables 2 and 3). In addition, we used other RtF-RT-LAMP assay to detect PEDV from clinical sam- two field strains that were PEDV S INDEL and Non-S ples, one-step RT-PCR was used as the gold standard. A INDEL strains to confirm the sensitivity of total of 99 clinical samples were tested by one-step RtF-RT-LAMP (Additional files 2 and 3). This was much RT-PCR that included 50 PED positive samples and 49 higher than that of the one-step RT-PCR. The sensitivity PED negative samples. All samples were tested by of the RtF-RT-LAMP assay was 100 times higher than RtF-RT-LAMP assay. As shown in Tables 4, 49 PED that of one-step RT-PCR. Moreover, the real-time DNA negative samples were detected as negative and 50 PED fluorescence intensity from the reactions at all concen- positive samples were detected as positive by the trations evaluated was high when the reactions were per- RtF-RT-LAMP assay. No false negative or positive re- formed within 40 min. Therefore, the optimal reaction sults were observed. Therefore, using one-step RT-PCR condition of the current RtF-RT-LAMP assay for PEDV as the gold standard, the sensitivity and specificity of the was optimized for 40 min. RtF-RT-LAMP assay were 100%. Table 2 Detection limits of one-step RT-PCR and RtF-RT-LAMP for the NK94P6 strain 5 4 3 2 1 0 − 1 TCID50 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 One-step ++ + –– – RT-PCR RtF-RT-LAMP + + + + + –– (amplification time mm:ss) (9:30) (11:45) (12:30) (15:45) (34:45) + Positive in duplicate - Negative in duplicate 5 − 1 6 From 2.8 × 10 to 2.8 × 10 : tenfold serial dilution of 2.8 × 10 TCID50 PEDV NK94P6 strain Fluorescence Fluorescence Mai et al. BMC Veterinary Research (2018) 14:172 Page 5 of 8 Table 3 Detection limits of one-step RT-PCR and RtF-RT-LAMP for the Fukuoka-1 Tr(−) strain 3 2 1 0 − 1 − 2 − 3 TCID50 2 × 10 2× 10 2× 10 2× 10 2×10 2× 10 2× 10 One-step RT-PCR + + – – ––– RtF-RT-LAMP + + + + ± –– (amplification time mm:ss) 16:00 18:15 23:45 35:45 + Positive in duplicate - Negative in duplicate ± One positive and one negative in duplicate 3 − 3 4 From 2 × 10 to 2 × 10 : tenfold serial dilution of 2 × 10 TCID50 PEDV Fukuoka-1 Tr(−) strain Pooled sample developed for the N gene [15, 16]. The use of LAMP for To estimate sample sizes for pooled faecal samples using detecting PEDV has been reported [15–17]. However, the RtF-RT-LAMP assay, four positive samples were the previously described RT-LAMP assays for detecting chosen from 50 positive samples based on amplification PEDV were not monitored by real-time florescent de- time in RT-LAMP and intensity of the electrophoresis vices. Furthermore, they only used four primers for the band of RT-PCR products at different levels from the LAMP assay, and only the N gene was used for design- weakest positive to the strongest positive (Fig. 2). Sample ing primers. Moreover, some mismatches were found be- 331 had the weakest electrophoresis band in RT-PCR. It tween primers and template in the 3′-end of some was positive at the 25:45 min mark for amplification primers that were used in the Gou et al. study [17]. Mis- time, for which RT-LAMP can be positive until a pool- matches, especially within the 3′-end primer region, ing size of 15 samples. However, three other positive affect both the stability of the primer-template duplex samples can be positive until a pooling size of 45 pooling and the efficiency with which the polymerase extends or 50 samples (Table 5). the primer, potentially leading to biased results or even failure [18, 19]. In this study, all primers, including loop Discussion primers, were designed from the highly conserved M In this study, we successfully developed an RtF-RT-LAMP gene of PEDV. To achieve maximum sensitivity of detec- assay for detection of PEDV in pooled faecal samples as tion for PEDV, the primer set used in this study included an economical protocol for detection of infected herd in both FIP primers (PED_FIP_ID1 and PED_FIP_ID1mo- surveillance or monitoring strategies of PED. A sensitive, dified). PED_FIP_ID1 and PED_FIP_ID1modified shared specific, rapid, and simple RtF-RT-LAMP assay including nucleotide identity with approximately 95 and 5% avail- loop primers from the M gene for PEDV detection was able PEDV sequences in the GenBank, respectively. Im- developed. The reaction condition of the RtF-RT-LAMP portantly, the entire procedure of current RT-LAMP was optimized by selecting a primer set and simple incu- could be completed in a simple process within 50 min. bation at 63 °C for 40 min. The sensitivity of the Using RT-PCR as the gold standard, the sensitivity and RtF-RT-LAMP assay for PEDV detection was at least 100 specificity of the RtF-RT-LAMP assay reached 100%. times higher than that of one-step RT-PCR. Particularly, Interestingly, the sensitivity and specificity of the by semi-quantitative analysis, the RtF-RT-LAMP assay RT-LAMP assay were not highlighted in the previously was applied to identifying the size for pooled stool sam- described RT-LAMP methods for PEDV detection [15– ples. Using the RtF-RT-LAMP assay, at least a pool of 15 17]. Our results also indicate that the sensitivity of the individual faecal samples could be applied instead of test- RtF-RT-LAMP assay was much higher than that of the ing individual samples for cost saving in PED surveillance one-step RT-PCR. LAMP is a simple, rapid, specific and or monitoring programmes. cost-effective nucleic acid amplification method because The PEDV M protein is a highly conserved it provides high amplification efficiency with DNA being 9 10 trans-membrane protein that is the most abundant enve- amplified 10 –10 times in 15–60 min and use of 4 to 6 lope component [13, 14]. Two reports have shown that different primers to recognize 6 to 8 distinct regions on the developed RT-LAMP method for the PEDV M gene the target gene [9, 10]. In addition, LAMP is also applic- has a higher sensitivity than the RT-LAMP method able to RNA upon use of reverse transcriptase (RTase) Table 4 Sensitivity and specificity of the RtF-RT-LAMP assay One-step RT-PCR Number of positive samples Number of negative samples Total RtF-RT-LAMP Number of positive samples 50 0 50 Number of negative samples 0 49 49 Total 50 49 99 Mai et al. BMC Veterinary Research (2018) 14:172 Page 6 of 8 Amplification Sample 324 Sample 329 Sample M1 Sample 331 20000 Negative control -20000 05:00 15:00 25:00 35:00 45:00 55:00 Time (mm:ss) Fig. 2 Positive faecal samples were used for estimating the pooled size. Four faecal samples were chosen from strongest positive to weakest positive that based on amplification time in the RtF-RT-LAMP assay and the intensity of electrophoresis bands of RT-PCR products together with DNA polymerase [20]. One study demon- sensitivity of the RtF-RT-LAMP assay. The strated that for PEDV detection, the sensitivity of qPCR RtF-RT-LAMP assay was much more sensitive than was higher than that of RT-PCR [21]. RT-PCR and one-step RT-PCR even with different strains in TCID50 real-time RT-PCR techniques also demonstrate high spe- or copies. The optimal size for pooled stool samples was cificity and sensitivity. However, these techniques require evaluated using a semi-quantitative method based on the sophisticated and high-precision instruments (such as amplification time in the RtF-RT-LAMP assay and inten- PCR and quantitative fluorescence PCR machines). Fur- sity of the electrophoresis band for RT-PCR products. thermore, the RT-PCR procedure is a time-consuming Even with the weakest positive electrophoresis band in and complicated process. The RtF-RT-LAMP method one-step RT-PCR, in total 50 positive faecal samples was showed distinct advantages with regards to detection time, still positive in the RtF-RT-LAMP assay at a pooling size as well as a simple process for rapid detection of PEDV. of 15, which was pooled from 14 individual negative faecal Early identification of the infected herd through sur- samples and one weak positive faecal sample. Further- veillance and monitoring strategies to enhance biosecur- more, of the 50 PED positive samples, only two samples ity measures is necessary to control PED. However, showed weak positive electrophoresis bands. Our pooled passive surveillance and individual testing could lead to results indicate that a pool of at least 15 individual faecal important problems such being less effective as well as samples can be applied using the RtF-RT-LAMP assay. In resulting in high cost and time commitments. Recently, addition, the cost of one RT-PCR test was estimated based a pooled sample technique has been developed and ap- on the reagent cost, which was about 5 times more expen- plied as a cost-efficient approach to surveillance or mon- sive than the RtF-RT-LAMP assay. In our study, testing itoring programs for pathogens such as Salmonella spp. pooled stool samples by RtF-RT-LAMP assay holds prom- in pigs and bovine viral diarrhoea virus in cattle [22, 23]. ise for surveillance and monitoring strategies. To our In this study, two pathogenically different PEDV strains knowledge, this is the first study to provide evidence of and other two field strains were used to evaluate the the estimation of sample sizes for pooled stool samples for detecting PEDV using an accurate, simple, and timely RtF-RT-LAMP method. Our results will support the de- Table 5 Detection PEDV in pooled faecal samples by RtF-RT- LAMP sign and implementation of large-scaled epidemiological surveys as well as active surveillance or monitoring sys- Pooled size 5 10 15 20 25 30 35 40 45 50 tems for effective control of PED. Further research will be 331 + + + – –––– –– required on a larger scale to confirm the effectiveness of M1 + +++ ++++ + – the pooled sample protocol. 329 + +++ ++++ ++ 324 + +++ ++++ ++ Conclusions Pooled size: Each PEDV positive sample was pooled with PEDV negative In this study, the highly sensitive, specific, rapid, and samples in different pooling ratios including 1:4, 1:9, 1:14, 1:19, 1:24, 1:29, 1:34, simple RtF-RT-LAMP assay based on the M gene, using 1:39, 1:44, and 1:49 331, M1, 329, 324: Four positive samples were selected for pooling with a a mobile device for detection of PEDV in pooled stool of different number of negative samples at least 15 samples was shown to be an economical diag- +: Positive by RtF-RT-LAMP -: Negative by RtF-RT-LAMP nosis test for PEDV detection. Use of these methods will Fluorescence Mai et al. BMC Veterinary Research (2018) 14:172 Page 7 of 8 not only be feasible, but also serve as effective surveil- Competing interests The authors declare that they have no competing interests. lance and monitoring strategies to control PED. Publisher’sNote Additional files Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Additional file 1: RT-LAMP primers design for PEDV nucleotide Author details detection. Nucleotide sequence alignments of M gene of seven PEDV Animal Infectious Disease and Prevention, Department of Veterinary strains. Representative M gene sequences in each strain are aligned with Sciences, Faculty of Agriculture, University of Miyazaki, Miyazaki, Japan. clustalW. Sequence data of designing primers for RT-LAMP in this study Faculty of Veterinary Medicine, Vietnam National University of Agriculture, (KT323979.1), the sequence used for RT-PCR (JX435310.1 and JN089738.1), Hanoi, Vietnam. Center for Animal Disease Control, University of Miyazaki, the sequence of G1b S INDEL strain (KY619833.1), the sequence of G2b/ Miyazaki, Japan. Non S INDEL/North America strain (KY619838.1), the sequence of G2a/ Non S INDEL/Asian strain (KJ960178.1), the sequence of NK96P4C6 G1a Received: 12 January 2018 Accepted: 22 May 2018 classical strain (KY619828). Primer recognition sites are indicated with primer names. (DOCX 28 kb) Additional file 2: Detection limits of one-step RT-PCR and RtF-RT-LAMP 5 0 References for PEDV S INDEL field strain. From 5.0 × 10 to 5.0 × 10 : tenfold serial di- 6 1. Sun RQ, Cai RJ, Chen YQ, Liang PS, Chen DK, Song CX. Outbreak of porcine lution of 5.0 × 10 copies PEDV S INDEL field strain. (DOCX 14 kb) epidemic diarrhea in suckling piglets, China. Emerging Infect Dis. 2012;18: Additional file 3: Detection limits of one-step RT-PCR and RtF-RT-LAMP 161–3. 6 0 for the PEDV Non-S INDEL field strain. From 1.5 × 10 to 1.5 × 10 : tenfold 2. Pensaert M, De Bouck P. A new coronavirus-like particle associated with serial dilution of 1.5 × 10 copies PEDV Non-S INDEL field strain. diarrhea in swine. Arch Virol. 1978;58:243–7. (DOCX 14 kb) 3. Woode GN, Bridger J, Hall GA, Jones JM, Jackson G. The isolation of reovirus-like agents (rotaviruses) from acute gastroenteritis of piglets (plates XVI). J Med Microbiol. 1976;9:203–9. Abbreviations 4. Song D, Park B. Porcine epidemic diarrhoea virus: a comprehensive review EMEM: Eagle’s minimal essential medium; FBS: Foetal bovine serum; of molecular epidemiology, diagnosis, and vaccines. Virus Genes. 2012;44: GV: Getal virus; JEV: Japanese Encephalitis virus; PED: Porcine epidemic 167–75. diarrhoea; PEDV: Porcine epidemic diarrhoea virus; PRRSV: Porcine 5. Duy DT, Toan NT, Puranaveja S, Thanawongnuwech R. Genetic reproductive and respiratory syndrome virus; RtF-RT-LAMP: Real-time characterization of porcine epidemic diarrhea virus (PEDV) isolates from fluorescent reverse transcription loop-mediated isothermal amplification; RT- southern Vietnam during 2009–2010 outbreaks. Thai J Vet Med. PCR: Reverse transcription polymerase chain reaction; TCID: Tissue culture 2011;41:55–64. infective dose; TGEV: Transmissible gastroenteritis coronavirus; TPB: Tryptose 6. Alvarez J, Goede D, Morrison R, Perez A. Spatial and temporal epidemiology phosphate broth of porcine epidemic diarrhea (PED) in the Midwest and southeast regions of the United States. Prev Vet Med. 2016;123:155–60. Acknowledgments 7. Vlasova AN, Marthaler D, Wang Q, Culhane MR, Rossow K, Rovira A, James We would like to thank the National Institute of Animal Health, Japan and Collins JK. Distinct characteristics and complex evolution of PEDV strains, Fukuoka Chuo Livestock Hygiene Service Center, Fukuoka, Japan for North America, may 2013–February 2014. Emerging Infect Dis. 2014;20(10): providing PEDV strains and Vero cells. 1620–8. 8. Sasaki Y, Alvarez J, Sekiguchi S, Sueyoshi M, Otake S, Perez A. Epidemiological factors associated to spread of porcine epidemic diarrhea Funding in Japan. Prev Vet Med. 2016;123:161–7. This work was supported by JSPS KAKENHI (Grant Number 15 K18786) and 9. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, the Ito Foundation. The funders had no role in study design, or the Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. collection, analysis, and interpretation of data. In addition, they were not 2000;28:e63. involved in the writing of the report or the decision to submit the article for 10. Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated publication. isothermal amplification using loop primers. Mol Cell Probes. 2002;16:223–9. 11. Kim SY, Song DS, Park BK. Differential detection of transmissible Availability of data and materials gastroenteritis virus and porcine epidemic diarrhea virus by duplex RT-PCR. The datasets supporting the conclusions of this article are included within J Vet Diagn Investig. 2001;13:516–20. the article. All datasets are available from the corresponding author on 12. Van Diep N, Norimine J, Sueyoshi M, Lan NT, Hirai T, Yamaguchi R. US-like reasonable request. isolates of porcine epidemic diarrhea virus from Japanese outbreaks between 2013 and 2014. Springerplus. 2015;4:756. Authors’ contributions 13. Utiger A, Tobler K, Bridgen A, Suter M, Singh M, Ackermann M. Identification TNM collected samples and performed the RtF-RT-LAMP, analyzed the data and of proteins specified by porcine epidemic diarrhoea virus. Adv Exp Med drafted the manuscript. VDN collected samples and performed the one-step Biol. 1995;380:287–90. RT-PCR. WY assembled the sequence data, designed primers and contributed 14. Zhang Z, Chen J, Shi H, Chen X, Shi D, Feng L, Yang B. Identification of a to experimental design. TO, RY and JN contributed to the study design. SM, KN conserved linear B-cell epitope in the M protein of porcine epidemic and YS helped in laboratory analysis. SS conceptualized and supervised the diarrhea virus. Virol J. 2012;9:225. study. SS also analyzed and revised the manuscript. All authors read, 15. Ren X, Li P. Development of reverse transcription loop-mediated isothermal commented on and approved the final version of the manuscript. amplification for rapid detection of porcine epidemic diarrhea virus. Virus Genes. 2011;42:229–35. Ethics approval 16. Yu X, Shi L, Lv X, Yao W, Cao M, Yu H, Wang X, Zheng S. Development of a All samples were obtained from healthy or naturally infected animals in the real-time reverse transcription loop-mediated isothermal amplification field by qualified veterinarians as a part of normal veterinary care and method for the rapid detection of porcine epidemic diarrhea virus. Virol J. diagnostic testing procedures. Therefore, no aggressive operation was 2015;12:76. conducted against pigs for sampling purpose and no pigs or other animals 17. Gou H, Deng J, Wang J, Pei J, Liu W, Zhao M, Chen J. Rapid and sensitive were sacrificed for the purposes of this study. The University of Miyazaki detection of porcine epidemic diarrhea virus by reverse transcription loop- DNA recombinant Committee approved the protocol for our cloning mediated isothermal amplification combined with a vertical flow experiments of PEDV (protocol number 2017–541). visualization strip. Mol Cell Probes. 2015;29:48–53. Mai et al. BMC Veterinary Research (2018) 14:172 Page 8 of 8 18. Lefever S, Pattyn F, Hellemans J, Vandesompele J. Single-nucleotide polymorphisms and other mismatches reduce performance of quantitative PCR assays. Clin Chem. 2013;59:1470–80. 19. Stadhouders R, Pas SD, Anber J, Voermans J, Mes TH, Schutten M. The effect of primer-template mismatches on the detection and quantification of nucleic acids using the 5′ nuclease assay. J Mol Diagn. 2010;12:109–17. 20. Whiting SH, Champoux JJ. Properties of strand displacement synthesis by Moloney murine leukemia virus reverse transcriptase: mechanistic implications. J Mol Biol. 1998;278:559–77. 21. Masuda T, Tsuchiaka S, Ashiba T, Yamasato H, Fukunari K, Omatsu T, Furuya T, Shirai J, Mizutani T, Nagai M. Development of one-step real-time reverse transcriptase-PCR-based assays for the rapid and simultaneous detection of four viruses causing porcine diarrhea. Jpn J Vet Res. 2016;64:5–14. 22. Arnold ME, Cook AJ. Estimation of sample sizes for pooled faecal sampling for detection of Salmonella in pigs. Epidemiol Infect. 2009;137:1734–41. 23. Munoz-Zanzi CA, Johnson WO, Thurmond MC, Hietala SK. Pooled-sample testing as a herd-screening tool for detection of bovine viral diarrhea virus persistently infected cattle. J Vet Diagn Investig. 2000;12:195–203. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Veterinary Research Springer Journals

Development of pooled testing system for porcine epidemic diarrhoea using real-time fluorescent reverse-transcription loop-mediated isothermal amplification assay

Free
8 pages

Loading next page...
 
/lp/springer_journal/development-of-pooled-testing-system-for-porcine-epidemic-diarrhoea-ltX00S2nkw
Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Medicine & Public Health; Veterinary Medicine/Veterinary Science; Zoology; Transgenics
eISSN
1746-6148
D.O.I.
10.1186/s12917-018-1498-9
Publisher site
See Article on Publisher Site

Abstract

Background: Porcine epidemic diarrhoea (PED) is an emerging disease in pigs that causes massive economic losses in the swine industry, with high mortality in suckling piglets. Early identification of PED virus (PEDV)-infected herd through surveillance or monitoring strategies is necessary for mass control of PED. However, a common working diagnosis system involves identifying PEDV-infected animals individually, which is a costly and time-consuming approach. Given the above information, the thrusts of this study were to develop a real-time fluorescent reverse transcription loop-mediated isothermal amplification (RtF-RT-LAMP) assay and establish a pooled testing system using faecal sample to identify PEDV-infected herd. Results: In this study, we developed an accurate, rapid, cost-effective, and simple RtF- RT-LAMP assay for detecting the PEDV genome targeting M gene. The pooled testing system using the RtF-RT-LAMP assay was optimized such that a pool of at least 15 individual faecal samples could be analysed. Conclusions: The developed RtF-RT-LAMP assay in our study could support the design and implementation of large- scaled epidemiological surveys as well as active surveillance and monitoring programs for effective control of PED. Keywords: PEDV, RtF-RT-LAMP, One-step RT-PCR, Pooled stool samples Background epidemics were reported in important swine-producing Porcine epidemic diarrhoea (PED) is caused by PED countries such as USA, Canada, and Japan [6–8]. virus (PEDV), which is characterized by enteritis, vomit- Control PED programs require effective and rapid sur- ing, and watery diarrhoea. This leads to massive eco- veillance protocols, linked to prompt control procedures, nomic losses in the swine industry with high mortality to ensure that epidemics are brought under control in suckling pigs [1]. PED was first observed in England quickly. Currently, the identification of infected herd is in 1971 and identified in Belgium in 1978 [2, 3]. The dis- done by passive surveillance with required reporting of ease quickly spread to other European countries such as infected herds from veterinarians. However, veterinar- Belgium, England, Germany, France, and Switzerland in ians rely on herd demonstrating clinical signs of infec- the 1980s, and later to Asian countries including Korea, tion, which can lead to failure to accurately identify PED China, Thailand, and Vietnam [4, 5]. Recently, several status and transmission of PEDV to healthy animals. Moreover, surveillance or monitoring is applied to individ- uals, which is associated with important financial and time * Correspondence: sekiguchi@cc.miyazaki-u.ac.jp obstacles. Therefore, well-designed surveys as well as sen- Thi Ngan Mai and Van Diep Nguyen contributed equally to this work. sitive, specific, rapid, and simple detection methods are Animal Infectious Disease and Prevention, Department of Veterinary necessary for the identification of infected herd to control Sciences, Faculty of Agriculture, University of Miyazaki, Miyazaki, Japan Center for Animal Disease Control, University of Miyazaki, Miyazaki, Japan PED. Loop-mediated isothermal amplification (LAMP) Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Mai et al. BMC Veterinary Research (2018) 14:172 Page 2 of 8 combines rapidity, simplicity, and high specificity under diarrhoea virus CV777 strain (GenBank accession num- isothermal conditions [9, 10]. We developed an accurate, ber: KT323979) using the Primer Explorer 4 (https://pri- timely, and simple real-time fluorescent reverse transcrip- merexplorer.jp/lamp4.0.0/index.html) (Additional file 1). tion LAMP (RtF-RT-LAMP) assay (from M gene) using They were synthesized using sequence-grade purification pooled stool samples for PEDV detection. This assay can by Hokkaido System Science Co., Ltd. (Sapporo, Japan), be applied to strategies for the control, monitoring, and which included an outer pair (F3, B3), inner primers surveillance of PED. (FIP, FIP1, BIP), and a loop pair (loopF, loopB) (Table 1). Nucleotide sequences specific for PEDV were detected Methods by multiple alignments of 997 M gene sequences, avail- Viruses able from the DDBJ/EMBL/GenBank database. The PEDV NK94P6 and Fukuoka-1 Tr(−) strains which be- one-step RT-PCR used a previously published primer long to classical clade (G1) were propagated in pair on the S gene [11]. Vero-KY5 (Vero) cells. Trypsin was not used to culture PEDV in Vero cells. The NK94P6 and Fukuoka-1 strains RNA extraction were kindly provided by the National Institute of Animal The total RNAs were extracted from 250 μl cell culture Health, Japan, and the Fukuoka Chuo Livestock Hygiene supernatants of PEDV, TGEV, and PRRSV, JEV, GV Service Center, Fukuoka, Japan, respectively. The Vero using a RNA extraction kit (ReliaPrep™ RNA Cell Mini- cells were also provided by the National Institute of Ani- prep System, Promega, USA), according to the manufac- mal Health, Japan. Briefly, Vero cells were cultured in turer’s instructions. Eagle’s minimal essential medium (EMEM) (Sigma-Al- drich, Tokyo, Japan) supplemented with 10% (v/v) foetal One-step RT-PCR bovine serum (FBS) (Funakoshi, Tokyo, Japan), 0.3% One-step RT-PCR was performed using AccessQuick™ (w/v) tryptose phosphate broth (TPB) (Sigma-Aldrich), RT-PCR System kits (Promega Corporation, WI, USA) and 100 U/ml penicillin-streptomycin (Wako, Tokyo, as previously reported [12]. RT-PCR parameters in- Japan) at 37 °C in a humidified atmosphere contain- cluded a reverse transcription step of 45 °C for 45 min ing 5% CO . Viruses were propagated in Vero cells and an incubation step of 94 °C for 2 min, 35 cycles at cultured in EMEM with 2% FBS and 0.3% TPB at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 1 min, 37 °C. The titter of the PEDV NK94P6 and followed by the final extension at 72 °C for 10 min. The Fukuoka-1 Tr(−) strains were 2.8 × 10 TCID /ml RT-PCR products were visualized by electrophoresis on and 2 × 10 TCID /ml, respectively. a 1.5% agarose gel with ethidium bromide. Transmissible gastroenteritis coronavirus - TGEV (vaccine strain h-5; Nisseiken, Tokyo, Japan) was propa- RtF-RT-LAMP gated in Vero cells; porcine reproductive and respiratory The RtF-RT-LAMP reaction was conducted in a final re- syndrome virus - PRRSV (live PRRS vaccine - Ingelvac action volume of 25 μl consisting of 2 μl RNA template, PRRS® MLV- Boehringer Ingelheim company); Japanese FIP and BIP primers (1.6 μM each), Loop F and Loop B Encephalitis virus – JEV and Getal virus - GV (live vac- primers (0.8 μM each), F3 and B3 primers (0.2 μM cine – Kyoto Biken company, Kyoto, Japan). each), Isothermal Mastermixes (OptiGene, UK), 0.15 u of AMV reverse transcriptase (15 u/μl; Invitrogen, USA). Primers Amplification reactions were performed at 63 °C for All primers for RtF-RT-LAMP were designed from the 40 min (with fluorescence detection followed by melt highly conserved M gene sequence of porcine epidemic curve analysis from 90 to 70 °C at 0.05 °C/s), and then Table 1 Primers used for RtF-RT-LAMP in this study Primer ID Sequence (5′ to 3′) Gene location F3 PED_F3_ID1 TCCTTATGGCTTGCATCAC 25,846–25,864 B3 PED_B3_ID1 CCGTAGACAATTGTTGTAGTGG 26,143–26,122 FIP PED_FIP_ID1, PED_FIP_ID1modified GTMGGCCCATCACAGAAGTAGTTTT 25,983–25,963 (TTTT) GGTTGTGGCGCAGGACA 25,903–25,919 BIP PED_BIP_ID1 CCAACTGGTGTAACGCTAACACTTTTT 26,010–26,032 (TTTT) TACCTGTACGCCAGTAGC 26,087–26,070 LF PED_LF_ID37 TTTCAGGATTGAAAGACCACCAAG 25,947–25,924 LB PED_LB_ID6 GGTACATTGCTTGTAGAGGGCTATAA 26,040–26,065 M: A or C Mai et al. BMC Veterinary Research (2018) 14:172 Page 3 of 8 heated at a start temperature of 98 °C and end Detection of PEDV in clinical samples temperature of 80 °C for 10 min with a ramp rate of A total of 99 faecal pig samples were collected from pig 0.05 °C/sec to terminate the reactions using Genie® III farms in Japan including 50 PED positive samples (from (OptiGene, UK). The fluorescence of the reaction was Kagoshima, Miyazaki, Aomori, Aichi prefectures) that measured in real time, verifying the start of the were collected from December 2013 to August 2017 and amplification. 49 negative samples from a PED negative farm (Sumiyoshi farm, Miyazaki prefecture). These positive Specificity of RtF-RT-LAMP samples are classical, emerging Non-S INDEL, S INDEL, PEDV (adapted strain NK94P6), PRRSV (vaccine strain and S1 NTD-del PEDV variants and some positive sam- MLV), TEGV (vaccine strain h5), JEV (vaccine strain ples are mixed infection of emerging non-S INDEL and HmLu-SC) and GV (vaccine strain HAL-KB) were used S1 NTD-del PEDV variants. Faecal samples were pre- as templates for RtF-RT-LAMP to analyse the specificity pared as a 10% (w/v) suspension in PBS (pH 7.2) and of RtF-RT-LAMP. Sterile ddH O was used as the nega- centrifuged at 2300 x g at 4 °C for 10 min. A 250-μl ali- tive control. quot of supernatant was used for RNA extraction (Relia- Prep™ RNA Cell Miniprep System, Promega, USA). RNA Sensitivity analysis of the RtF-RT-LAMP was used as a template for detection of PEDV by To evaluate the sensitivity of the RtF-RT-LAMP, one-step RT-PCR and RtF-RT-LAMP. PEDV-infected Vero cell cultures of two strains (NK94P6 and Fukuoka-1 Tr(−)) with defined median tis- Pooled samples sue culture infective dose (TCID ) was tenfold serial di- The RtF-RT-LAMP assay was used to determine effi- luted with the supernatant of negative faecal samples. ciency in pooled stool samples for future application in RNA was then extracted from 250 μl media of each dilu- large-scaled epidemiological surveys. We determined the tion and used as a template for RtF-RT-LAMP and sensitivity of the RT-LAMP assay in pooled faecal sam- one-step RT-PCR as mentioned above. ples to calculate the possible sample sizes that can be applied to the pooled technique. Each PEDV positive Real-time RT-PCR sample was pooled with PEDV negative samples in dif- The quantitative One-Step PrimeScript RT-PCR kit ferent pooling ratios including 1:4, 1:9, 1:14, 1:19, 1:24, (Takara Bio, Japan) was used for the real-time RT-PCR 1:29, 1:34, 1:39, 1:44, and 1:49. A 50-μl aliquot from in- to quantitate two PEDV field strains (PEDV S INDEL dividual positive or negative samples was transferred to and Non-S INDEL field strains). A 198 bp DNA frag- a new tube and carefully votexed. Then, 250 μl in each ment of the N gene was amplified with the primer sets pooling ratio was used for RNA extraction (ReliaPrep™ of forward primer (qN306-F) 5’-CGCAAAGACTGAAC RNA Cell Miniprep System, Promega, USA). RNA was CCACTAAC-3′ and reverse primer (56R) 5’-TTGC used as a template for RtF-RT-LAMP. CTCTGTTGTTACTTGGAGAT-3′. A TaqMan probe (ProbeN466–469) with the sequence of 5’-GCAG Results GAGTCGTGGTAATGGCAACA-3′ was labeled with Specificity of the RtF-RT-LAMP assay the 5′-reporter dye 6-carboxyfluorescein (FAM) and the The PEDV NK94P6 strain and other related porcine vi- 3′-quencher BHQ3. Real-time RT-PCR was carried out ruses (PRRSV, TGEV, JEV, GV) were tested using the in a 20 μl reaction containing 2 μl of RNA template, RtF-RT-LAMP assay to evaluate the specificity. Only 10 μl of 2X One Step RT-PCR Buffer III, 0.4 μlof PEDV was positive, and no LAMP products were de- TaKaRa Ex Taq HS, 0.4 μl of both forward and reverse tected in the reactions from other relevant porcine vi- primer, 0.8 μl of Probe, 0.4 μl of ROX Reference Dye ruses or negative control used in this study (Fig. 1). The and 5.6 μl of RNase free water. The reactions were per- results indicated that the RtF-RT-LAMP assay was spe- formed using a StepOnePlus™ Real-Time PCR System cific for PEDV and can be applied for distinguishing (Amplified Biosystems, USA) under the following condi- PEDV from other porcine viruses. tions: initial reverse transcription at 42 °C for 5 min, followed by initial denaturation at 95 °C for 10 s, 40 cy- Sensitivity of the RtF-RT-LAMP assay cles of denaturation at 95 °C for 5 s, and annealing and To evaluate the sensitivity of the RtF-RT-LAMP assay, extension at 60 °C for 30 s. The results of amplification the detection limit was compared to the conventional were analyzed by StepOne Software v2.3 (Amplified Bio- one-step RT-PCR by amplifying ten-fold serial dilutions systems). Tenfold serial dilutions of the transcripts were from the cell culture of two PEDV strains (NK94P6 and 7 2 prepared at concentrations of 8.97 × 10 to 8.97 × 10 Fukuoka-1 Tr(−)). The detection limit of the one-step copies of PEDV per 1 μl volume that were used for RT-PCR of the NK94P6 strain and Fukuoka-1 Tr(−) 3 2 obtaining the standard curves. strain were 2.8 × 10 TCID /ml and 2 × 10 TCID /ml, 50 50 Mai et al. BMC Veterinary Research (2018) 14:172 Page 4 of 8 Amplification Negative control PEDV PRRSV TGEV -20000 05:00 15:00 25:00 35:00 45:00 55:00 Time (mm:ss) Amplification PEDV JEV GV Negative control -20000 05:00 10:00 15:00 20:00 25:00 30:00 35:00 40:00 Time (mm:ss) Fig. 1 Specificity of the RtF-RT-LAMP assay for detecting the PEDV M gene. RNA of PEDV, PRRSV and TGEV (a); PEDV, JEV and GV (b) were used as templates for the RtF-RT-LAMP assay performed at 63 °C for 60 min while, the detection limit of the RtF-RT-LAMP assay Detection of PEDV in clinical samples 1 0 was 2.8 × 10 TCID /ml and 2 × 10 TCID /ml, re- To evaluate the sensitivity and specificity of the 50 50 spectively (Tables 2 and 3). In addition, we used other RtF-RT-LAMP assay to detect PEDV from clinical sam- two field strains that were PEDV S INDEL and Non-S ples, one-step RT-PCR was used as the gold standard. A INDEL strains to confirm the sensitivity of total of 99 clinical samples were tested by one-step RtF-RT-LAMP (Additional files 2 and 3). This was much RT-PCR that included 50 PED positive samples and 49 higher than that of the one-step RT-PCR. The sensitivity PED negative samples. All samples were tested by of the RtF-RT-LAMP assay was 100 times higher than RtF-RT-LAMP assay. As shown in Tables 4, 49 PED that of one-step RT-PCR. Moreover, the real-time DNA negative samples were detected as negative and 50 PED fluorescence intensity from the reactions at all concen- positive samples were detected as positive by the trations evaluated was high when the reactions were per- RtF-RT-LAMP assay. No false negative or positive re- formed within 40 min. Therefore, the optimal reaction sults were observed. Therefore, using one-step RT-PCR condition of the current RtF-RT-LAMP assay for PEDV as the gold standard, the sensitivity and specificity of the was optimized for 40 min. RtF-RT-LAMP assay were 100%. Table 2 Detection limits of one-step RT-PCR and RtF-RT-LAMP for the NK94P6 strain 5 4 3 2 1 0 − 1 TCID50 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 2.8 × 10 One-step ++ + –– – RT-PCR RtF-RT-LAMP + + + + + –– (amplification time mm:ss) (9:30) (11:45) (12:30) (15:45) (34:45) + Positive in duplicate - Negative in duplicate 5 − 1 6 From 2.8 × 10 to 2.8 × 10 : tenfold serial dilution of 2.8 × 10 TCID50 PEDV NK94P6 strain Fluorescence Fluorescence Mai et al. BMC Veterinary Research (2018) 14:172 Page 5 of 8 Table 3 Detection limits of one-step RT-PCR and RtF-RT-LAMP for the Fukuoka-1 Tr(−) strain 3 2 1 0 − 1 − 2 − 3 TCID50 2 × 10 2× 10 2× 10 2× 10 2×10 2× 10 2× 10 One-step RT-PCR + + – – ––– RtF-RT-LAMP + + + + ± –– (amplification time mm:ss) 16:00 18:15 23:45 35:45 + Positive in duplicate - Negative in duplicate ± One positive and one negative in duplicate 3 − 3 4 From 2 × 10 to 2 × 10 : tenfold serial dilution of 2 × 10 TCID50 PEDV Fukuoka-1 Tr(−) strain Pooled sample developed for the N gene [15, 16]. The use of LAMP for To estimate sample sizes for pooled faecal samples using detecting PEDV has been reported [15–17]. However, the RtF-RT-LAMP assay, four positive samples were the previously described RT-LAMP assays for detecting chosen from 50 positive samples based on amplification PEDV were not monitored by real-time florescent de- time in RT-LAMP and intensity of the electrophoresis vices. Furthermore, they only used four primers for the band of RT-PCR products at different levels from the LAMP assay, and only the N gene was used for design- weakest positive to the strongest positive (Fig. 2). Sample ing primers. Moreover, some mismatches were found be- 331 had the weakest electrophoresis band in RT-PCR. It tween primers and template in the 3′-end of some was positive at the 25:45 min mark for amplification primers that were used in the Gou et al. study [17]. Mis- time, for which RT-LAMP can be positive until a pool- matches, especially within the 3′-end primer region, ing size of 15 samples. However, three other positive affect both the stability of the primer-template duplex samples can be positive until a pooling size of 45 pooling and the efficiency with which the polymerase extends or 50 samples (Table 5). the primer, potentially leading to biased results or even failure [18, 19]. In this study, all primers, including loop Discussion primers, were designed from the highly conserved M In this study, we successfully developed an RtF-RT-LAMP gene of PEDV. To achieve maximum sensitivity of detec- assay for detection of PEDV in pooled faecal samples as tion for PEDV, the primer set used in this study included an economical protocol for detection of infected herd in both FIP primers (PED_FIP_ID1 and PED_FIP_ID1mo- surveillance or monitoring strategies of PED. A sensitive, dified). PED_FIP_ID1 and PED_FIP_ID1modified shared specific, rapid, and simple RtF-RT-LAMP assay including nucleotide identity with approximately 95 and 5% avail- loop primers from the M gene for PEDV detection was able PEDV sequences in the GenBank, respectively. Im- developed. The reaction condition of the RtF-RT-LAMP portantly, the entire procedure of current RT-LAMP was optimized by selecting a primer set and simple incu- could be completed in a simple process within 50 min. bation at 63 °C for 40 min. The sensitivity of the Using RT-PCR as the gold standard, the sensitivity and RtF-RT-LAMP assay for PEDV detection was at least 100 specificity of the RtF-RT-LAMP assay reached 100%. times higher than that of one-step RT-PCR. Particularly, Interestingly, the sensitivity and specificity of the by semi-quantitative analysis, the RtF-RT-LAMP assay RT-LAMP assay were not highlighted in the previously was applied to identifying the size for pooled stool sam- described RT-LAMP methods for PEDV detection [15– ples. Using the RtF-RT-LAMP assay, at least a pool of 15 17]. Our results also indicate that the sensitivity of the individual faecal samples could be applied instead of test- RtF-RT-LAMP assay was much higher than that of the ing individual samples for cost saving in PED surveillance one-step RT-PCR. LAMP is a simple, rapid, specific and or monitoring programmes. cost-effective nucleic acid amplification method because The PEDV M protein is a highly conserved it provides high amplification efficiency with DNA being 9 10 trans-membrane protein that is the most abundant enve- amplified 10 –10 times in 15–60 min and use of 4 to 6 lope component [13, 14]. Two reports have shown that different primers to recognize 6 to 8 distinct regions on the developed RT-LAMP method for the PEDV M gene the target gene [9, 10]. In addition, LAMP is also applic- has a higher sensitivity than the RT-LAMP method able to RNA upon use of reverse transcriptase (RTase) Table 4 Sensitivity and specificity of the RtF-RT-LAMP assay One-step RT-PCR Number of positive samples Number of negative samples Total RtF-RT-LAMP Number of positive samples 50 0 50 Number of negative samples 0 49 49 Total 50 49 99 Mai et al. BMC Veterinary Research (2018) 14:172 Page 6 of 8 Amplification Sample 324 Sample 329 Sample M1 Sample 331 20000 Negative control -20000 05:00 15:00 25:00 35:00 45:00 55:00 Time (mm:ss) Fig. 2 Positive faecal samples were used for estimating the pooled size. Four faecal samples were chosen from strongest positive to weakest positive that based on amplification time in the RtF-RT-LAMP assay and the intensity of electrophoresis bands of RT-PCR products together with DNA polymerase [20]. One study demon- sensitivity of the RtF-RT-LAMP assay. The strated that for PEDV detection, the sensitivity of qPCR RtF-RT-LAMP assay was much more sensitive than was higher than that of RT-PCR [21]. RT-PCR and one-step RT-PCR even with different strains in TCID50 real-time RT-PCR techniques also demonstrate high spe- or copies. The optimal size for pooled stool samples was cificity and sensitivity. However, these techniques require evaluated using a semi-quantitative method based on the sophisticated and high-precision instruments (such as amplification time in the RtF-RT-LAMP assay and inten- PCR and quantitative fluorescence PCR machines). Fur- sity of the electrophoresis band for RT-PCR products. thermore, the RT-PCR procedure is a time-consuming Even with the weakest positive electrophoresis band in and complicated process. The RtF-RT-LAMP method one-step RT-PCR, in total 50 positive faecal samples was showed distinct advantages with regards to detection time, still positive in the RtF-RT-LAMP assay at a pooling size as well as a simple process for rapid detection of PEDV. of 15, which was pooled from 14 individual negative faecal Early identification of the infected herd through sur- samples and one weak positive faecal sample. Further- veillance and monitoring strategies to enhance biosecur- more, of the 50 PED positive samples, only two samples ity measures is necessary to control PED. However, showed weak positive electrophoresis bands. Our pooled passive surveillance and individual testing could lead to results indicate that a pool of at least 15 individual faecal important problems such being less effective as well as samples can be applied using the RtF-RT-LAMP assay. In resulting in high cost and time commitments. Recently, addition, the cost of one RT-PCR test was estimated based a pooled sample technique has been developed and ap- on the reagent cost, which was about 5 times more expen- plied as a cost-efficient approach to surveillance or mon- sive than the RtF-RT-LAMP assay. In our study, testing itoring programs for pathogens such as Salmonella spp. pooled stool samples by RtF-RT-LAMP assay holds prom- in pigs and bovine viral diarrhoea virus in cattle [22, 23]. ise for surveillance and monitoring strategies. To our In this study, two pathogenically different PEDV strains knowledge, this is the first study to provide evidence of and other two field strains were used to evaluate the the estimation of sample sizes for pooled stool samples for detecting PEDV using an accurate, simple, and timely RtF-RT-LAMP method. Our results will support the de- Table 5 Detection PEDV in pooled faecal samples by RtF-RT- LAMP sign and implementation of large-scaled epidemiological surveys as well as active surveillance or monitoring sys- Pooled size 5 10 15 20 25 30 35 40 45 50 tems for effective control of PED. Further research will be 331 + + + – –––– –– required on a larger scale to confirm the effectiveness of M1 + +++ ++++ + – the pooled sample protocol. 329 + +++ ++++ ++ 324 + +++ ++++ ++ Conclusions Pooled size: Each PEDV positive sample was pooled with PEDV negative In this study, the highly sensitive, specific, rapid, and samples in different pooling ratios including 1:4, 1:9, 1:14, 1:19, 1:24, 1:29, 1:34, simple RtF-RT-LAMP assay based on the M gene, using 1:39, 1:44, and 1:49 331, M1, 329, 324: Four positive samples were selected for pooling with a a mobile device for detection of PEDV in pooled stool of different number of negative samples at least 15 samples was shown to be an economical diag- +: Positive by RtF-RT-LAMP -: Negative by RtF-RT-LAMP nosis test for PEDV detection. Use of these methods will Fluorescence Mai et al. BMC Veterinary Research (2018) 14:172 Page 7 of 8 not only be feasible, but also serve as effective surveil- Competing interests The authors declare that they have no competing interests. lance and monitoring strategies to control PED. Publisher’sNote Additional files Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Additional file 1: RT-LAMP primers design for PEDV nucleotide Author details detection. Nucleotide sequence alignments of M gene of seven PEDV Animal Infectious Disease and Prevention, Department of Veterinary strains. Representative M gene sequences in each strain are aligned with Sciences, Faculty of Agriculture, University of Miyazaki, Miyazaki, Japan. clustalW. Sequence data of designing primers for RT-LAMP in this study Faculty of Veterinary Medicine, Vietnam National University of Agriculture, (KT323979.1), the sequence used for RT-PCR (JX435310.1 and JN089738.1), Hanoi, Vietnam. Center for Animal Disease Control, University of Miyazaki, the sequence of G1b S INDEL strain (KY619833.1), the sequence of G2b/ Miyazaki, Japan. Non S INDEL/North America strain (KY619838.1), the sequence of G2a/ Non S INDEL/Asian strain (KJ960178.1), the sequence of NK96P4C6 G1a Received: 12 January 2018 Accepted: 22 May 2018 classical strain (KY619828). Primer recognition sites are indicated with primer names. (DOCX 28 kb) Additional file 2: Detection limits of one-step RT-PCR and RtF-RT-LAMP 5 0 References for PEDV S INDEL field strain. From 5.0 × 10 to 5.0 × 10 : tenfold serial di- 6 1. Sun RQ, Cai RJ, Chen YQ, Liang PS, Chen DK, Song CX. Outbreak of porcine lution of 5.0 × 10 copies PEDV S INDEL field strain. (DOCX 14 kb) epidemic diarrhea in suckling piglets, China. Emerging Infect Dis. 2012;18: Additional file 3: Detection limits of one-step RT-PCR and RtF-RT-LAMP 161–3. 6 0 for the PEDV Non-S INDEL field strain. From 1.5 × 10 to 1.5 × 10 : tenfold 2. Pensaert M, De Bouck P. A new coronavirus-like particle associated with serial dilution of 1.5 × 10 copies PEDV Non-S INDEL field strain. diarrhea in swine. Arch Virol. 1978;58:243–7. (DOCX 14 kb) 3. Woode GN, Bridger J, Hall GA, Jones JM, Jackson G. The isolation of reovirus-like agents (rotaviruses) from acute gastroenteritis of piglets (plates XVI). J Med Microbiol. 1976;9:203–9. Abbreviations 4. Song D, Park B. Porcine epidemic diarrhoea virus: a comprehensive review EMEM: Eagle’s minimal essential medium; FBS: Foetal bovine serum; of molecular epidemiology, diagnosis, and vaccines. Virus Genes. 2012;44: GV: Getal virus; JEV: Japanese Encephalitis virus; PED: Porcine epidemic 167–75. diarrhoea; PEDV: Porcine epidemic diarrhoea virus; PRRSV: Porcine 5. Duy DT, Toan NT, Puranaveja S, Thanawongnuwech R. Genetic reproductive and respiratory syndrome virus; RtF-RT-LAMP: Real-time characterization of porcine epidemic diarrhea virus (PEDV) isolates from fluorescent reverse transcription loop-mediated isothermal amplification; RT- southern Vietnam during 2009–2010 outbreaks. Thai J Vet Med. PCR: Reverse transcription polymerase chain reaction; TCID: Tissue culture 2011;41:55–64. infective dose; TGEV: Transmissible gastroenteritis coronavirus; TPB: Tryptose 6. Alvarez J, Goede D, Morrison R, Perez A. Spatial and temporal epidemiology phosphate broth of porcine epidemic diarrhea (PED) in the Midwest and southeast regions of the United States. Prev Vet Med. 2016;123:155–60. Acknowledgments 7. Vlasova AN, Marthaler D, Wang Q, Culhane MR, Rossow K, Rovira A, James We would like to thank the National Institute of Animal Health, Japan and Collins JK. Distinct characteristics and complex evolution of PEDV strains, Fukuoka Chuo Livestock Hygiene Service Center, Fukuoka, Japan for North America, may 2013–February 2014. Emerging Infect Dis. 2014;20(10): providing PEDV strains and Vero cells. 1620–8. 8. Sasaki Y, Alvarez J, Sekiguchi S, Sueyoshi M, Otake S, Perez A. Epidemiological factors associated to spread of porcine epidemic diarrhea Funding in Japan. Prev Vet Med. 2016;123:161–7. This work was supported by JSPS KAKENHI (Grant Number 15 K18786) and 9. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, the Ito Foundation. The funders had no role in study design, or the Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. collection, analysis, and interpretation of data. In addition, they were not 2000;28:e63. involved in the writing of the report or the decision to submit the article for 10. Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated publication. isothermal amplification using loop primers. Mol Cell Probes. 2002;16:223–9. 11. Kim SY, Song DS, Park BK. Differential detection of transmissible Availability of data and materials gastroenteritis virus and porcine epidemic diarrhea virus by duplex RT-PCR. The datasets supporting the conclusions of this article are included within J Vet Diagn Investig. 2001;13:516–20. the article. All datasets are available from the corresponding author on 12. Van Diep N, Norimine J, Sueyoshi M, Lan NT, Hirai T, Yamaguchi R. US-like reasonable request. isolates of porcine epidemic diarrhea virus from Japanese outbreaks between 2013 and 2014. Springerplus. 2015;4:756. Authors’ contributions 13. Utiger A, Tobler K, Bridgen A, Suter M, Singh M, Ackermann M. Identification TNM collected samples and performed the RtF-RT-LAMP, analyzed the data and of proteins specified by porcine epidemic diarrhoea virus. Adv Exp Med drafted the manuscript. VDN collected samples and performed the one-step Biol. 1995;380:287–90. RT-PCR. WY assembled the sequence data, designed primers and contributed 14. Zhang Z, Chen J, Shi H, Chen X, Shi D, Feng L, Yang B. Identification of a to experimental design. TO, RY and JN contributed to the study design. SM, KN conserved linear B-cell epitope in the M protein of porcine epidemic and YS helped in laboratory analysis. SS conceptualized and supervised the diarrhea virus. Virol J. 2012;9:225. study. SS also analyzed and revised the manuscript. All authors read, 15. Ren X, Li P. Development of reverse transcription loop-mediated isothermal commented on and approved the final version of the manuscript. amplification for rapid detection of porcine epidemic diarrhea virus. Virus Genes. 2011;42:229–35. Ethics approval 16. Yu X, Shi L, Lv X, Yao W, Cao M, Yu H, Wang X, Zheng S. Development of a All samples were obtained from healthy or naturally infected animals in the real-time reverse transcription loop-mediated isothermal amplification field by qualified veterinarians as a part of normal veterinary care and method for the rapid detection of porcine epidemic diarrhea virus. Virol J. diagnostic testing procedures. Therefore, no aggressive operation was 2015;12:76. conducted against pigs for sampling purpose and no pigs or other animals 17. Gou H, Deng J, Wang J, Pei J, Liu W, Zhao M, Chen J. Rapid and sensitive were sacrificed for the purposes of this study. The University of Miyazaki detection of porcine epidemic diarrhea virus by reverse transcription loop- DNA recombinant Committee approved the protocol for our cloning mediated isothermal amplification combined with a vertical flow experiments of PEDV (protocol number 2017–541). visualization strip. Mol Cell Probes. 2015;29:48–53. Mai et al. BMC Veterinary Research (2018) 14:172 Page 8 of 8 18. Lefever S, Pattyn F, Hellemans J, Vandesompele J. Single-nucleotide polymorphisms and other mismatches reduce performance of quantitative PCR assays. Clin Chem. 2013;59:1470–80. 19. Stadhouders R, Pas SD, Anber J, Voermans J, Mes TH, Schutten M. The effect of primer-template mismatches on the detection and quantification of nucleic acids using the 5′ nuclease assay. J Mol Diagn. 2010;12:109–17. 20. Whiting SH, Champoux JJ. Properties of strand displacement synthesis by Moloney murine leukemia virus reverse transcriptase: mechanistic implications. J Mol Biol. 1998;278:559–77. 21. Masuda T, Tsuchiaka S, Ashiba T, Yamasato H, Fukunari K, Omatsu T, Furuya T, Shirai J, Mizutani T, Nagai M. Development of one-step real-time reverse transcriptase-PCR-based assays for the rapid and simultaneous detection of four viruses causing porcine diarrhea. Jpn J Vet Res. 2016;64:5–14. 22. Arnold ME, Cook AJ. Estimation of sample sizes for pooled faecal sampling for detection of Salmonella in pigs. Epidemiol Infect. 2009;137:1734–41. 23. Munoz-Zanzi CA, Johnson WO, Thurmond MC, Hietala SK. Pooled-sample testing as a herd-screening tool for detection of bovine viral diarrhea virus persistently infected cattle. J Vet Diagn Investig. 2000;12:195–203.

Journal

BMC Veterinary ResearchSpringer Journals

Published: May 29, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off