Characterization of CDC45L: a gene in the 22q11.2 deletion region expressed during murine and human development

Characterization of CDC45L: a gene in the 22q11.2 deletion region expressed during murine and... Mammalian Genome 10, 322–326 (1999). Incorporating Mouse Genome © Springer-Verlag New York Inc. 1999 Characterization of CDC45L: a gene in the 22q11.2 deletion region expressed during murine and human development 1 1 1 2 2 1,3 Tamim H. Shaikh, Shoshanna Gottlieb, Beatrice Sellinger, Feng Chen, Bruce A. Roe, Rebecca J. Oakey, 1,3 1,3 Beverly S. Emanuel, Marcia L. Budarf Division of Human Genetics and Molecular Biology, The Children’s Hospital of Philadelphia, 1002 Abramson Research Center, 34th Street and Civic Center Blvd., Philadelphia, Pennsylvania 19104, USA Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma 73019, USA Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, USA Received: 10 August 1998 / Accepted: 30 October 1998 Microdeletions of chromosomal region 22q11.2 have been associ- The predicted gene was shown to be expressed in humans by ated with many developmental disorders including DiGeorge syn- PCR amplification with gene-specific primers HpugNF (AG- drome (DGS), velocardiofacial syndrome (VCFS), and conotrun- GCTCTGGACAGCCTCTCCAG) and HpugNR (GGCAG- cal anomaly face syndrome (CTAFS). These syndromes have been CAGTTTGCAGCGCCGGT), with cDNA from human fetal brain referred to collectively as the 22q11 deletion syndrome (Budarf (Clontech) as template. The amplified product was sequenced di- and Mammalian Genome Springer Journals

Characterization of CDC45L: a gene in the 22q11.2 deletion region expressed during murine and human development

Loading next page...
Copyright © 1999 by Springer-Verlag New York Inc.
Life Sciences; Cell Biology; Animal Genetics and Genomics; Human Genetics
Publisher site
See Article on Publisher Site


Mammalian Genome 10, 322–326 (1999). Incorporating Mouse Genome © Springer-Verlag New York Inc. 1999 Characterization of CDC45L: a gene in the 22q11.2 deletion region expressed during murine and human development 1 1 1 2 2 1,3 Tamim H. Shaikh, Shoshanna Gottlieb, Beatrice Sellinger, Feng Chen, Bruce A. Roe, Rebecca J. Oakey, 1,3 1,3 Beverly S. Emanuel, Marcia L. Budarf Division of Human Genetics and Molecular Biology, The Children’s Hospital of Philadelphia, 1002 Abramson Research Center, 34th Street and Civic Center Blvd., Philadelphia, Pennsylvania 19104, USA Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma 73019, USA Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, USA Received: 10 August 1998 / Accepted: 30 October 1998 Microdeletions of chromosomal region 22q11.2 have been associ- The predicted gene was shown to be expressed in humans by ated with many developmental disorders including DiGeorge syn- PCR amplification with gene-specific primers HpugNF (AG- drome (DGS), velocardiofacial syndrome (VCFS), and conotrun- GCTCTGGACAGCCTCTCCAG) and HpugNR (GGCAG- cal anomaly face syndrome (CTAFS). These syndromes have been CAGTTTGCAGCGCCGGT), with cDNA from human fetal brain referred to collectively as the 22q11 deletion syndrome (Budarf (Clontech) as template. The amplified product was sequenced di- and


Mammalian GenomeSpringer Journals

Published: Mar 1, 1999

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.

DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro


Save searches from
Google Scholar,
Create lists to
organize your research
Export lists, citations
Read DeepDyve articles
Abstract access only
Unlimited access to over
18 million full-text articles
20 pages/month
PDF Discount
20% off