cDNA cloning and chromosomal mapping of mouse fast skeletal muscle troponin T

cDNA cloning and chromosomal mapping of mouse fast skeletal muscle troponin T Short Communications Mammalian Genome 8, 346-348 (1997). 9 Springer-Verlag New York Inc. 1997 cDNA cloning and chromosomal mapping of mouse fast skeletal muscle troponin T Anne Koch, 1 Todd S.-C. Juan, 1 Nancy A. Jenkins, 2 Debra J. GUbert, 2 Neal G. Copeland, 2 Ian K. McNiece, 1 Frederick A. Fletcher* ~Department of Developmental Hematology, Amgen, Incorporated, MIS99-1-A, 1840 De Havilland Drive Thousand Oaks, California 91320-1789, USA 2Mammalian Genetics Laboratory, ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 21702, USA Received: 7 December 1996 / Accepted 3 January 1997 Calcium-dependent contraction of vertebrate striated muscle is rat are so highly conserved, and since the 5' and 3' ends of cDNAs regulated in part through the interaction of the troponin protein from the two species coincided, we suggest that a full-length splice complex with tropomyosin and the actin-myosin myofibril. The variant of mouse fast troponin T was cloned. Northern analysis of troponin complex consists of three proteins, troponin I (TnI), tro- adult mouse poly(A) + mRNA revealed that the fast troponin T ponin C (TnC), and troponin T (TnT). TnI is an actin-binding protein that enables the troponin complex to physically inhibit the 1 gcctgc~gctggtcctgtccacaaggagcccccagcctttctcagac~caactacaga~a interaction of http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

cDNA cloning and chromosomal mapping of mouse fast skeletal muscle troponin T

Loading next page...
 
/lp/springer_journal/cdna-cloning-and-chromosomal-mapping-of-mouse-fast-skeletal-muscle-VyHG0t00pg
Publisher
Springer-Verlag
Copyright
Copyright © 1997 by Springer-Verlag
Subject
Life Sciences; Cell Biology; Anatomy; Zoology
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900437
Publisher site
See Article on Publisher Site

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial