Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer_journal/babesia-vesperuginis-in-insectivorous-bats-from-china-Ne3y2zRpuG
- Publisher
- Springer Journals
- Copyright
- Copyright © 2018 by The Author(s).
- Subject
- Biomedicine; Parasitology; Entomology; Tropical Medicine; Infectious Diseases; Veterinary Medicine/Veterinary Science; Virology
- eISSN
- 1756-3305
- DOI
- 10.1186/s13071-018-2902-9
- Publisher site
- See Article on Publisher Site
Abstract
Background: To increase understanding of human bacterial and parasitic pathogens in bats, we investigated the prevalence of Babesia spp., Rickettsia spp., Anaplasma spp. and Coxiella burnetii in bats from China. Methods: Bats were captured from Mengyin County, Shandong Province of China using nets. DNA was extracted from the blood and spleen of bats for molecular detection of Babesia spp., Rickettsia spp., Anaplasma spp. and Coxiella burnetii with specific primers for each species. Results: A total of 146 spleen samples and 107 blood samples of insectivorous bats, which belonged to 6 species within two families, were collected from Mengyin County, Shandong Province of China. We found that two Eptesicus serotinus (2/15, 13.3%) were positive for Babesia vesperuginis. We were unable to detect genomic sequences for Rickettsia spp., Anaplasma spp. and Coxiella burnetii. Conclusions: To our knowledge, our study showed for the first time the presence of Babesia vesperuginis in Eptesicus serotinus collected from China, suggesting that Babesia vesperuginis has a broad host species and geographical distribution. Keywords: Bat, China, Babesia vesperuginis Background been almost exclusively Babesia vesperuginis [5–9], with Bats have been studied in recent years due to their asso- the exception of a study reporting Babesia canis, the ciation with several serious emerging viruses, such as causative agent of canine babesiosis, in the feces of bats SARS-Coronavirus, Hendra virus, Nipha virus, Ebola from Hungary [10]. In addition, a recent study reported virus and Marburg virus [1]. Most studies have focused the detection of B. vesperuginis, Babesia crassa and B. on emerging viruses; however, bacterial and parasitic canis in ixodid ticks on bats [11], which indicated that agents in bats have been largely neglected. We previ- bats could harbor a greater diversity of Babesia species ously showed that bats from northern China carried sev- and hard ticks could also play a role in Babesia trans- eral novel Bartonella spp. [2] as well as a diversity of mission among bats. The role of bats in the ecology of Ba- pathogenic Leptospira spp. [3]. To have a better under- besia spp. as well as the vectors involved in transmission of standing of bacterial and parasitic pathogens in bats, we Babesia spp. among bats deserves further investigation. expanded our study to several tick-borne bacterial and Rickettsia spp. are intracellular bacteria that are respon- parasitic pathogens, including Babesia spp., Rickettsia sible for life-threatening spotted and typhus fevers in spp., Anaplasma spp. and Coxiella burnetii. humans [12]. So far, Rickettsia spp. infections in bats were Babesia spp. are tick-transmitted protozoan hemopar- limited to several serological and molecular surveys in asites associated with a wide range of vertebrate hosts America, Africa and Europe. Antibodies against several worldwide [4]. So far, Babesia spp. detected in bats have spotted fever group (SFG) Rickettsia spp. were reported in bats from Brazil and USA [13, 14]. DNA of Rickettsia spp. was also detected in the blood samples of bats from * Correspondence: yuxuejie@whu.edu.cn Swaziland, South Africa and Saint Kitts Island [15, 16]. A Hui-Ju Han and Jian-Wei Liu contributed equally to this work. recent study conducted in Europe showed that Rickettsia Wuhan University School of Health Sciences, Wuhan, Hubei, China Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Han et al. Parasites & Vectors (2018) 11:317 Page 2 of 5 spp. DNA was detected in bat feces [17]. Moreover, bat Briefly, bats were anesthetized for collecting blood sam- ectoparasites, including soft ticks (Argasidae), hard ticks ples, and were then killed with overdosed anesthetic to (Ixodidae) and flies (Nycteribiidae), were found to carry a collect organs. diversity of Rickettsia spp. that were identical to those found in bats, indicating the vector-borne transmission of Rickettsia spp. [18–23]. So far, there is a lack of knowledge Molecular detection for Babesia spp., Rickettsia spp., on Rickettsia spp. in bats in Asia. Anaplasma spp. and C. burnetii Anaplasma spp. belong to the order Rickettsiales, caus- Bat blood DNA extraction was performed with the ing tick-borne anaplasmosis in animals and humans [24]. Qiagen DNA Kit (Qiagen, Hilden, Germany) and the So far, there is no report of Anaplasma spp. in bats. spleen was extracted with the AllPrep DNA/RNA Coxiella burnetii is an obligate intracellular gram-negative Mini Kit (Qiagen), according to the manufacturer’s bacterium, and is the agent of Q fever [25]. So far, there are instructions. Blood DNA samples were screened for no reports of C. burnetii in bats. However, its existence in Babesia spp., Rickettsia spp. and Anaplasma spp. ticks from bats has been reported in Algeria [26]. Spleen DNA samples were screened for C. burnetii. Therefore, the aim of the study was to investigate the Primers used in this study are shown in Table 1. prevalence of Babesia spp., Rickettsia spp., Anaplasma For Babeisa spp., an initial screening PCR targeting spp. and C. burnetii in bats from China. 18S rDNA was conducted in a 50 μl mixture contain- ing 25 μl DreamTaq Green PCR Master Mix (2×) (Thermo Fisher Scientific, Waltham, MA, USA), 0.8 μl Methods 25 μmol/l of each forward and reverse primer (Sangon Bat sampling Biotech, Shanghai, China), 16.4 μl nuclease-free water, and Bats were captured with nets from Mengyin County, 7 μl blood DNA of each sample. Nuclease-free water was Shandong Province of China (117°45' to 118°15'N,35°27' used as negative controls. PCR was performed under the to 36°02'S) as part of an ongoing program of detecting following conditions: 1 denaturing cycle at 95 °C for 5 min novel microorganisms (viruses, bacteria and parasites) followed by 35 cycles at 95 °C for 30 s, 55°C for 30 s, and in bats. Identification of bat species was performed by 72 °C for 1 min and an additional final cycle at 72 °C for DNA sequencing the PCR amplified cytochrome b 10 min. (cytb) gene as described previously [27]. Details on the For 18S rDNA positive samples, an additional nested collection of bat specimens are as described previously [2]. PCR targeting cox1was performed. The first round PCR Table 1 PCR primers used for Babesia spp., Rickettsia spp. and Anaplasma spp. and C. burnetii screening Target agent PCR method Primer Primer sequences (5'→3') Target gene Amplicon size (bp) Tissue tested Reference Babesia spp. PCR BJ1 GTCTTGTAATTGGAATGATGG 18S rDNA ~500 Blood [10] BN2 TAGTTTATGGTTAGGACTACG Nested PCR Bab_For1 ATWGGATTYTATATGAGTAT cox1 924 [7] Bab_Rev1 ATAATCWGGWATYCTCCTTGG Bab_For2 TCTCTWCATGGWTTAATTATGATAT Bab_Rev2 TAGCTCCAATTGAHARWACAAAGTG Rickettsia spp. qPCR gltA-F GTGAATGAAAGATTACACTATTTAT gltA – Blood [30] gltA-R GTATCTTAGCAATCATTCTAATAGC qPCR 338-F GAMAAATGAATTATATACGCCGCAAA RC0338 gene – 338-R ATTATTKCCAAATATTCGTCCTGTAC Anaplasma spp. Nested PCR AE1-F AAGCTTAACACATGCAAGTCGAA 16S rRNA 926 Blood [31] AE1-R AGTCACTGACCCAACCTTAAATG EE3 GTCGAACGGATTATTCTTTATAGCTTGC EE4 CCCTTCCGTTAAGAAGGATCTAATCTCC Coxiella burnetii Nested PCR omp1 AGTAGAAGCATCCCAAGCATTG com1 438 Spleen [32] omp2 TGCCTGCTAGCTGTAACGATTG omp3 GAAGCGCAACAAGAAGAACA omp4 TGGAAGTTATCACGCAGTTG Han et al. Parasites & Vectors (2018) 11:317 Page 3 of 5 was conducted in a 25 μl mixture containing 0.125 μl After alignment by ClustalW with MEGA 7.0 [28], 5U/μl TakaRa Ex Taq (TaKaRa, Shiga, Japan), 2.5 μl phylogenetic trees were constructed using the Maximum 2+ 10×ExTaqbuffer (Mg free), 2 μl25mM MgCl ,2 μl Likelihood method with the Tamura-Nei model by using dNTP mixture (2.5 mM for each), 0.4 μl25 μmol/l of MEGA7.0, and bootstrap values were calculated with 1000 each forward and reverse primer, 12.6μl nuclease-free replicates. water and 5 μl blood DNA of each sample. The sec- ond round PCR was the same as described above for 18S rDNA except that 3 μl of first round PCR prod- Results uct was used as a template. The PCR condition was A total of 146 bats belonging to 6 species within two the same as described for 18S rDNA, but the anneal- families were sampled. Bats of the family Rhinolophidae ing temperature for the first and second rounds of included 4 Rhinolophus ferrumequinum and 14 Rhinolo- PCR were 45 °C and 49 °C, respectively. phus pusillus captured from a karst cave; bats of the For Anaplasma spp. and C. burnetii, a nested PCR family of Vespertilionidae included 26 Eptesicus seroti- was conducted as described for cox1of Babesia spp. nus from two farmers’ houses, 34 Myotis fimbriatus and Blood DNA and spleen DNA were used for the detec- 10 Myotis ricketti from a city sewer and 58 Myotis pequi- tion of Anaplasma spp. and C. burnetii, respectively. nius from a cave (Table 2). Finally, 146 spleen DNA The PCR conditions were the same as described for 18S samples were screened for C. burnetii, and 107 blood rDNA of Babesia spp. DNA samples were screened for Babesia spp., Rickettsia PCR products were analyzed by 1.2% agarose gel elec- spp. and Anaplasma spp. trophoresis and detected using ethidium bromide under In this study, we found that 2 out of 15 blood samples UV light. PCR products with expected sizes were excised of E. serotinus (2/15, 13.3%) were positive for Babesia from gels and extracted using a Gel Extraction Kit spp., while blood samples of the other 5 bat species (Rh. (Promega, Madison, WI, USA), which were then cloned ferrumequinum, Rh. pusillus, My. fimbriatus, My. ricketti into the pMD19-T vector (TaKaRa) for sequencing. and My. pequiniu) were all negative. BLAST analysis of Quantitative real-time PCR (qPCR) was used for the de- the 517 bp 18S rDNA sequences showed that the two tection of Rickettsia spp. The reaction was conducted in a Babesia spp. detected in E. serotinus in this study (desig- 50 μl mixture containing 25 μl FastStart Universal SYBR nated as bat Babesia vesperuginis SD030 and bat Babesia Green Master (ROX), 0.8 μl25 μmol/l of each forward vesperuginis SD043), which differed by 4 nucleotides, and reverse primer, 16.4 μl nuclease-free water, and 7 μl shared 99.4% similarity with B. vesperuginis (GenBank: blood DNA of each sample. The tests were performed AJ871610). BLAST analysis of the 924 bp cox1 sequences using a Light Cycler 480 II (Roche, Mannheim, Germany) showed that the bat Babesia vesperuginis SD030 and bat with the following conditions: an initial denaturation at 95 Babesia vesperuginis SD043 differed by 3 nucleotides, °C for 10 min, followed by 40 cycles at 95 °C for 10 s and and shared 98.2% and 98.1% similarity with B. vesperugi- at 58 °C for 30 s. Nuclease-free water was used as negative nis (GenBank: MF996533), respectively. Phylogenetic controls in each run. Results were considered positive if analysis of 18S rDNA and cox1genes also showed that the cycle threshold (Ct) value was lower than 36. Babeisa spp. detected in bats in this study clustered together with B. vesperuginis (Figs. 1 and 2). The 18S Phylogenetic analysis rDNA and cox1sequences of B.vesperuginis of this study Chromatograms were checked with Chromas 2.5.1 were deposited in the GenBank with accession numbers: (Technelysium, Tewantin, QLD, Australia) to exclude MG832414-MG832415 and MH234577-MH234578. double peaks, and sequences were analyzed with the We were unable to detect genomic sequences for Rick- BLAST programme (http://blast.ncbi.nlm.nih.gov/Blast.cgi). ettsia spp., Anaplasma spp. and C. burnetii. Table 2 Information of bats sampled from Mengyin County, Shandong Province of China Family Sampling site Species Common name Spleen samples Blood samples Rhinolophidae Karst Cave Rhinolophus ferrumequinum Greater horseshoe bat 4 3 Rhinolo phuspusillus Least horseshoe bat 14 10 Vespertilionidae Farmers’ houses Eptesicus serotinus Common serotine 26 15 City sewer Myotis fimbriatus Fringed long-footed myotis 34 16 Myotis ricketti Rickett’s big-footed myotis 10 5 Cave Myotis pequinius Peking myotis 58 58 Total 146 107 Han et al. Parasites & Vectors (2018) 11:317 Page 4 of 5 Discussion Babesia vesperuginis in bats was first described in bats from Italy, and later also found in bats from other parts of Europe (UK, Austria, Czech Republic, Romania) and South America (Colombia) [5, 7–9]. So far, B. vesperuginis has been detected in Nyctalus noctula and Pipistrellus sp. from Italy; My. mystacinus and Pipistrellus sp. from the UK; Mormoops megalophylla from Colombia; My. alcathoe, My. bechsteinii, My. myotis and Vespertilio murinus from Romania; Ny. noctula, Pi. nathusii and Pi. pipistrellus from the Czech Republic; Pi. pipistrellus and Ve. murinus from Austria; and Pi. pipistrellus from China [5–9]. The preva- lence of B. vesperuginis in Pipistrellus spp. in Europe has been reported as 8.45% (6/71), 9.22% (19/206), 16.7% (6/36) and 10% (5/48) [6, 7, 9, 29]. The prevalence of B. vesperugi- nis in Mo. megalophylla in South America and in N. noc- tula in Europe was reported to be 1.19% (2/168) and 1.63% Fig. 1 Phylogenetic tree based on the 517 bp 18S rDNA sequences (4/246), respectively [5, 7]. However, the prevalence of B. of Babesia spp. identified in this study and relevant sequences from GenBank. The tree was constructed with MEGA 7.0 by using the vesperuginis in other bat species might be biased due to the Maximum Likelihood method with the Tamura-Nei model. Only limited sample size [7, 8]. In this study, the prevalence of B. bootstrap values no lower than 75% were shown. Babesia vesperuginis in E. serotinus from China was 13.3% (2/15), vesperuginis detected in bats in this study are shown in bold, and which might also be biased by the limited sample size. To are designated as bat Babesia vesperuginis SD030 and bat Babesia our knowledge, this is the first report of B. vesperuginis in vesperuginis SD043. Theileria mutans was used as the outgroup E. serotinus,suggestingthat B. vesperuginis has a broad host species and geographical distribution. Natural and experimental infection showed that B.ves- peruginis was pathogenic to bats, which could result in symptoms such as lowered blood haemoglobin, raised white blood cell counts and enlarged spleen in bats [8]. Soft ticks (Argas vespertilionis) were suspected to play a role in the transmission of B. vesperuginis among bats [8]. Although no ticks were found on bats in this study, a recent study reported that soft ticks (Argas vespertilionis) collected from B. vesperuginis-positive bats (Pi. pipistrel- lus)werealsopositivefor B. vesperuginis in northwestern China [6], indicating that soft ticks might be the vector for B. vesperuginis transmission among bats. Conclusions We detected B. vesperuginis in E. serotinus collected from China, suggesting that B. vesperuginis has a broad host species and geographical distribution. Since B. ves- peruginis is pathogenic to bats, the finding of this species in China has some implications for the conservation of bats in China. Fig. 2 Phylogenetic tree based on the 924 bp cox1 sequences of Babesia spp. identified in this study and relevant sequences from the Acknowledgments We are grateful to Mengyin County Center for Disease Control and GenBank. The tree was constructed with MEGA 7.0 by using the Prevention for their assistance in bat collection. Maximum Likelihood method with the Tamura-Nei model. Only bootstrap values no lower than 75% were shown. Babesia vesperuginis detected in bats in this study are shown in bold, and Funding are designated as bat Babesia vesperuginis SD030 and bat Babesia This study was supported by a grant from National Natural Science Funds of vesperuginis SD043. Theileria parva was used as the outgroup China (No. 31570167). Han et al. Parasites & Vectors (2018) 11:317 Page 5 of 5 Availability of data and materials 16. Reeves WK, Beck J, Orlova MV, Daly JL, Pippin K, Revan F, et al. Ecology of The B. vesperuginis sequences of this study are available in the GenBank bats, their ectoparasites, and associated pathogens on Saint Kitts Island. J under the accession numbers MG832414-MG832415 and MH234577- Med Entomol. 2016. MH234578. 17. Hornok S, Szőke K, Estók P, Krawczyk A, Haarsma AJ, Kováts D, et al. Assessing bat droppings and predatory bird pellets for vector-borne bacteria: molecular evidence of bat-associated Neorickettsia sp. in Europe. Authors’ contributions Antonie Van Leeuwenhoek. 2018. https://doi.org/10.1007/s10482-018-1043-7. HJH designed the study. HJH, JWL, HLW, XRQ, MZ, LJW, CMZ and YLZ 18. Piksa K, Stańczak J, Biernat B, Górz A, Nowak-Chmura M, Siuda K. Detection participated in bat sampling and performed the experiments. HJH and RQ of Borrelia burgdorferi sensu lato and spotted fever group Rickettsiae in hard helped in data analysis. HJH, XJY and HY wrote the manuscript. All authors ticks (Acari, Ixodidae) parasitizing bats in Poland. Parasitol Res. 2016;115: read and approved the final manuscript. 1727–31. 19. Sánchez-Montes S, Guzmán-Cornejo C, Martínez-Nájera Y, Becker I, Venzal Ethical approval JM, Labruna MB. Rickettsia lusitaniae associated with Ornithodoros The collection of bats for microbiological studies was approved by the Ethics yumatensis (Acari: Argasidae) from two caves in Yucatan, Mexico. Ticks Tick Committee of Prevention Medicine of Shandong University (No.20150501). Borne Dis. 2016;7:1097–101. 20. Tahir D, Socolovschi C, Marié JL, Ganay G, Berenger JM, Bompar JM, et al. Competing interests New Rickettsia species in soft ticks Ornithodoros hasei collected from bats in The authors declare that they have no competing interests. French Guiana. Ticks Tick Borne Dis. 2016;7:1089–96. 21. Socolovschi C, Kernif T, Raoult D, Parola P. Borrelia, Rickettsia, and Ehrlichia species in bat ticks, France, 2010. Emerg Infect Dis. 2012;18:1966–75. Publisher’sNote 22. Loftis AD, Gill JS, Schriefer ME, Levin ML, Eremeeva ME, Gilchrist MJ, et al. Springer Nature remains neutral with regard to jurisdictional claims in Detection of Rickettsia, Borrelia, and Bartonella in Carios kelleyi (Acari: published maps and institutional affiliations. Argasidae). J Med Entomol. 2005;42:473–80. 23. Wilkinson DA, Duron O, Cordonin C, Gomard Y, Ramasindrazana B, Mavingui Author details P, et al. The bacteriome of bat flies (Nycteribiidae) from the Malagasy Wuhan University School of Health Sciences, Wuhan, Hubei, China. Region: a community shaped by host ecology, bacterial transmission mode, Shandong University School of Public Health, Jinan, Shandong, China. and host-vector specificity. Appl Environv Microb. 2016;82:1778–88. Fudan University School of Medicine, Shanghai, China. 24. Ben Said M, Belkahia H, Messadi L. Anaplasma spp. in North Africa: a review on molecular epidemiology, associated risk factors and genetic Received: 4 March 2018 Accepted: 15 May 2018 characteristics. Ticks Tick Borne Dis. 2018;9:543–55. 25. Colville JL, Berryhill DL. Q fever. Handbook of zoonoses. Saint Louis: Mosby; 2007. p. 139–41. References 26. Leulmi H, Aouadi A, Bitam I, Bessas A, Benakhla A, Raoult D, et al. Detection 1. Han HJ, Wen HL, Zhou CM, Chen FF, Luo LM, Liu JW, et al. Bats as reservoirs of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and of severe emerging infectious diseases. Virus Res. 2015;205:1–6. tissues from wild and domestic animals in northeastern Algeria. Parasit 2. Han HJ, Wen HL, Zhao L, Liu JW, Luo LM, Zhou CM, et al. Novel Bartonella Vectors. 2016;9:27. species in insectivorous bats, northern China. PLoS One. 2017;12:e0167915. 27. Linacre A, Lee JC. Species determination: the role and use of the 3. Han H-J, Wen H-L, Liu J-W, Qin X-R, Zhao M, Wang L-J, et al. Pathogenic cytochrome b gene. Meth Mole Biol. 2016;1420:287–96. Leptospira species in insectivorous bats, China, 2015. Emerg Infect Dis. 2018; 28. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics 24. In press. Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33:1870–4. 4. Schnittger L, Rodriguez AE, Florin-Christensen M, Morrison DA. Babesia:a 29. Gardner RA, Molyneux DH, Stebbings RE. Studies on the prevalence of world emerging. Infect Genet Evol. 2012;12:1788–809. hematozoa of British bats. Mammal Rev. 1987;17:75–80. 5. Marinkelle CJ. Babesia sp. in Colombian bats (Microchiroptera). J Wildlife Dis. 30. Socolovschi C, Mediannikov O, Sokhna C, Tall A, Diatta G, Bassene H, et al. 1996;32:534–5. Rickettsia felis-associated uneruptive fever, Senegal. Emerg Infect Dis. 2010; 6. Liu X, Yan B, Wang Q, Jiang M, Tu C, Chen C, et al. Babesia vesperuginis in 16:1140–2. common pipistrelle (Pipistrellus pipistrellus) and the bat soft tick Argas 31. Kang JG, Ko S, Kim YJ, Yang HJ, Lee H, Shin NS, et al. New genetic variants vespertilionis in Republic of China. J Wildlife Dis. 2018;54:419–21. of Anaplasma phagocytophilum and Anaplasma bovis from Korean water 7. Corduneanu A, Hrazdilová K, Sándor AD, Matei IA, Ionică AM, Barti L, et al. deer (Hydropotes inermis argyropus). Vector Borne Zoonotic Dis. 2011;11: Babesia vesperuginis, a neglected piroplasmid: new host and geographical 929–38. records, and phylogenetic relations. Parasit Vectors. 2017;10:598. 32. Liu L, Baoliang X, Yingqun F, Ming L, Yu Y, Yong H, et al. Coxiella burnetii in 8. Gardner RA, Molyneux DH. Babesia vesperuginis: natural and experimental rodents on Heixiazi Island at the Sino-Russian border. Am J Trop Med Hyg. infections in British bats (Microchiroptera). Parasitology. 1987;95:461–9. 2013;88:770–3. 9. Concannon R, Wynn-Owen K, Simpson VR, Birtles RJ. Molecular characterization of haemoparasites infecting bats (Microchiroptera) in Cornwall, UK. Parasitology. 2005;131:489–96. 10. Hornok S, Estók P, Kováts D, Flaisz B, Takács N, Szőke K, et al. Screening of bat faeces for arthropod-borne apicomplexan protozoa: Babesia canis and Besnoitia besnoiti-like sequences from Chiroptera. Parasit Vectors. 2015;8:441. 11. Hornok S, Szőke K, Kováts D, Estók P, Görföl T, Boldogh SA, et al. DNA of Piroplasms of ruminants and dogs in ixodid bat ticks. PLoS One. 2016;11:e0167735. 12. Walker DH, Ismail N. Emerging and re-emerging rickettsioses: endothelial cell infection and early disease events. Nat Rev Microbiol. 2008;6:375–86. 13. D’Auria SR, Camargo MC, Pacheco RC, Savani ES, Dias MA, da Rosa AR, et al. Serologic survey for rickettsiosis in bats from São Paulo city, Brazil. Vector Borne Zoonotic Dis. 2010;10:459–63. 14. Reeves WK, Streicker DG, Loftis AD, Dasch GA. Serologic survey of Eptesicus fuscus from Georgia, U.S.A. for Rickettsia and Borrelia and laboratory transmission of a Rickettsia by bat ticks. J Vector Ecol. 2006;31:386–9. 15. Dietrich M, Tjale MA, Weyer J, Kearney T, Seamark EC, Nel LH, et al. Diversity of Bartonella and Rickettsia spp. in bats and their blood-feeding ectoparasites from South Africa and Swaziland. PLoS One. 2016;11:e0152077.
Journal
Parasites & Vectors – Springer Journals
Published: May 29, 2018