Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome region 6pl5

Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome... Mammalian Genome 8, Brief Data Reports 299 2. Yerle M, Goureau A, Gellin J, Le Tissier P, .Moran C (1994) Mamm Species: Pig (Sus scrofa domestica) Genome 5, 34-37 Locus name: [3-Galactoside a2,6-sialyltransferase Locus symbol: SIAT-1 3. Grundmann U, Nerlich C, Rein T, Zettlmeissl G (1990) Nucleic Acids Map position: 13q4.1 Res 18, 667 Method of mapping: Somatic cell hybrids and fluorescence in situ 4. Wang X, Vertino A, Eddy RL, Byers MG, Jani-Sait SN, Shows TB, hybridization Lau JTY (1993) J Biol Chem 268, 4355-4361 Molecular reagents: PCR primers specific to exon 6 (P4: 5'AT- 5. Rogel-Gaillard C, Bourgeaux N, Save JC, Renard C, Coullin P, Pinton GATGACGCTGTGTGACCA3'; position 1428-1447; P5: P, Yerle M, Vaiman M, Chardon P (1996) Manuscript in preparation. 5'CAGTGAATGGTCCGGAAGCCAG3'; position 1635-1656) of 6. Harduin-Lepers A, Recchi MA, Delannoy P (1995) Glycobiology 5, human 13-galactoside a2,6-sialyltransferase gene [3,4] was used to 741-758 amplify the corresponding sequence in pig. 7. Livingston BD, Panlson JC (1993) J Biol Chem 268, 11504-11507 PCR primers deduced from the pig sequence (STPI: 5'GCT- 8. Hamamoto T, Kawasaki M, Kurosawa N, Nakaoka T, Lee YC, Tsuji GTGTGACCAGGTGGATGTTTAT3'; STP2: 5'GCAGCGTG- S (1993) Bioorg Med Chem 1, 141-145 GCTTTCCCAAGCAGG3') were used on a http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome region 6pl5

Loading next page...
 
/lp/springer_journal/assignment-of-porcine-cyba-gene-encoding-nadph-oxidase-light-chain-p22-ZmkMsyoypF
Publisher
Springer-Verlag
Copyright
Copyright © 1997 by Springer-Verlag
Subject
Life Sciences; Cell Biology; Anatomy; Zoology
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900424
Publisher site
See Article on Publisher Site

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial