Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome region 6pl5

Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome... Mammalian Genome 8, Brief Data Reports 299 2. Yerle M, Goureau A, Gellin J, Le Tissier P, .Moran C (1994) Mamm Species: Pig (Sus scrofa domestica) Genome 5, 34-37 Locus name: [3-Galactoside a2,6-sialyltransferase Locus symbol: SIAT-1 3. Grundmann U, Nerlich C, Rein T, Zettlmeissl G (1990) Nucleic Acids Map position: 13q4.1 Res 18, 667 Method of mapping: Somatic cell hybrids and fluorescence in situ 4. Wang X, Vertino A, Eddy RL, Byers MG, Jani-Sait SN, Shows TB, hybridization Lau JTY (1993) J Biol Chem 268, 4355-4361 Molecular reagents: PCR primers specific to exon 6 (P4: 5'AT- 5. Rogel-Gaillard C, Bourgeaux N, Save JC, Renard C, Coullin P, Pinton GATGACGCTGTGTGACCA3'; position 1428-1447; P5: P, Yerle M, Vaiman M, Chardon P (1996) Manuscript in preparation. 5'CAGTGAATGGTCCGGAAGCCAG3'; position 1635-1656) of 6. Harduin-Lepers A, Recchi MA, Delannoy P (1995) Glycobiology 5, human 13-galactoside a2,6-sialyltransferase gene [3,4] was used to 741-758 amplify the corresponding sequence in pig. 7. Livingston BD, Panlson JC (1993) J Biol Chem 268, 11504-11507 PCR primers deduced from the pig sequence (STPI: 5'GCT- 8. Hamamoto T, Kawasaki M, Kurosawa N, Nakaoka T, Lee YC, Tsuji GTGTGACCAGGTGGATGTTTAT3'; STP2: 5'GCAGCGTG- S (1993) Bioorg Med Chem 1, 141-145 GCTTTCCCAAGCAGG3') were used on a http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome region 6pl5

Loading next page...
 
/lp/springer_journal/assignment-of-porcine-cyba-gene-encoding-nadph-oxidase-light-chain-p22-ZmkMsyoypF
Publisher
Springer Journals
Copyright
Copyright © 1997 by Springer-Verlag
Subject
Life Sciences; Cell Biology; Anatomy; Zoology
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900424
Publisher site
See Article on Publisher Site

Abstract

Mammalian Genome 8, Brief Data Reports 299 2. Yerle M, Goureau A, Gellin J, Le Tissier P, .Moran C (1994) Mamm Species: Pig (Sus scrofa domestica) Genome 5, 34-37 Locus name: [3-Galactoside a2,6-sialyltransferase Locus symbol: SIAT-1 3. Grundmann U, Nerlich C, Rein T, Zettlmeissl G (1990) Nucleic Acids Map position: 13q4.1 Res 18, 667 Method of mapping: Somatic cell hybrids and fluorescence in situ 4. Wang X, Vertino A, Eddy RL, Byers MG, Jani-Sait SN, Shows TB, hybridization Lau JTY (1993) J Biol Chem 268, 4355-4361 Molecular reagents: PCR primers specific to exon 6 (P4: 5'AT- 5. Rogel-Gaillard C, Bourgeaux N, Save JC, Renard C, Coullin P, Pinton GATGACGCTGTGTGACCA3'; position 1428-1447; P5: P, Yerle M, Vaiman M, Chardon P (1996) Manuscript in preparation. 5'CAGTGAATGGTCCGGAAGCCAG3'; position 1635-1656) of 6. Harduin-Lepers A, Recchi MA, Delannoy P (1995) Glycobiology 5, human 13-galactoside a2,6-sialyltransferase gene [3,4] was used to 741-758 amplify the corresponding sequence in pig. 7. Livingston BD, Panlson JC (1993) J Biol Chem 268, 11504-11507 PCR primers deduced from the pig sequence (STPI: 5'GCT- 8. Hamamoto T, Kawasaki M, Kurosawa N, Nakaoka T, Lee YC, Tsuji GTGTGACCAGGTGGATGTTTAT3'; STP2: 5'GCAGCGTG- S (1993) Bioorg Med Chem 1, 141-145 GCTTTCCCAAGCAGG3') were used on a

Journal

Mammalian GenomeSpringer Journals

Published: Mar 21, 2009

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off