Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome region 6pl5

Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome... Mammalian Genome 8, Brief Data Reports 299 2. Yerle M, Goureau A, Gellin J, Le Tissier P, .Moran C (1994) Mamm Species: Pig (Sus scrofa domestica) Genome 5, 34-37 Locus name: [3-Galactoside a2,6-sialyltransferase Locus symbol: SIAT-1 3. Grundmann U, Nerlich C, Rein T, Zettlmeissl G (1990) Nucleic Acids Map position: 13q4.1 Res 18, 667 Method of mapping: Somatic cell hybrids and fluorescence in situ 4. Wang X, Vertino A, Eddy RL, Byers MG, Jani-Sait SN, Shows TB, hybridization Lau JTY (1993) J Biol Chem 268, 4355-4361 Molecular reagents: PCR primers specific to exon 6 (P4: 5'AT- 5. Rogel-Gaillard C, Bourgeaux N, Save JC, Renard C, Coullin P, Pinton GATGACGCTGTGTGACCA3'; position 1428-1447; P5: P, Yerle M, Vaiman M, Chardon P (1996) Manuscript in preparation. 5'CAGTGAATGGTCCGGAAGCCAG3'; position 1635-1656) of 6. Harduin-Lepers A, Recchi MA, Delannoy P (1995) Glycobiology 5, human 13-galactoside a2,6-sialyltransferase gene [3,4] was used to 741-758 amplify the corresponding sequence in pig. 7. Livingston BD, Panlson JC (1993) J Biol Chem 268, 11504-11507 PCR primers deduced from the pig sequence (STPI: 5'GCT- 8. Hamamoto T, Kawasaki M, Kurosawa N, Nakaoka T, Lee YC, Tsuji GTGTGACCAGGTGGATGTTTAT3'; STP2: 5'GCAGCGTG- S (1993) Bioorg Med Chem 1, 141-145 GCTTTCCCAAGCAGG3') were used on a Mammalian Genome Springer Journals

Assignment of porcine CYBA gene encoding NADPH oxidase-light chain (p22-phox) to Chromosome region 6pl5

Loading next page...
Copyright © 1997 by Springer-Verlag
Life Sciences; Cell Biology; Anatomy; Zoology
Publisher site
See Article on Publisher Site


Mammalian Genome 8, Brief Data Reports 299 2. Yerle M, Goureau A, Gellin J, Le Tissier P, .Moran C (1994) Mamm Species: Pig (Sus scrofa domestica) Genome 5, 34-37 Locus name: [3-Galactoside a2,6-sialyltransferase Locus symbol: SIAT-1 3. Grundmann U, Nerlich C, Rein T, Zettlmeissl G (1990) Nucleic Acids Map position: 13q4.1 Res 18, 667 Method of mapping: Somatic cell hybrids and fluorescence in situ 4. Wang X, Vertino A, Eddy RL, Byers MG, Jani-Sait SN, Shows TB, hybridization Lau JTY (1993) J Biol Chem 268, 4355-4361 Molecular reagents: PCR primers specific to exon 6 (P4: 5'AT- 5. Rogel-Gaillard C, Bourgeaux N, Save JC, Renard C, Coullin P, Pinton GATGACGCTGTGTGACCA3'; position 1428-1447; P5: P, Yerle M, Vaiman M, Chardon P (1996) Manuscript in preparation. 5'CAGTGAATGGTCCGGAAGCCAG3'; position 1635-1656) of 6. Harduin-Lepers A, Recchi MA, Delannoy P (1995) Glycobiology 5, human 13-galactoside a2,6-sialyltransferase gene [3,4] was used to 741-758 amplify the corresponding sequence in pig. 7. Livingston BD, Panlson JC (1993) J Biol Chem 268, 11504-11507 PCR primers deduced from the pig sequence (STPI: 5'GCT- 8. Hamamoto T, Kawasaki M, Kurosawa N, Nakaoka T, Lee YC, Tsuji GTGTGACCAGGTGGATGTTTAT3'; STP2: 5'GCAGCGTG- S (1993) Bioorg Med Chem 1, 141-145 GCTTTCCCAAGCAGG3') were used on a


Mammalian GenomeSpringer Journals

Published: Mar 21, 2009


You’re reading a free preview. Subscribe to read the entire article.

DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro


Save searches from Google Scholar, PubMed
Create lists to organize your research
Export lists, citations
Access to DeepDyve database
Abstract access only
Unlimited access to over
18 million full-text articles
20 pages/month
PDF Discount
20% off