Access the full text.
Sign up today, get DeepDyve free for 14 days.
Loading next page...
/lp/springer_journal/an-innovative-diagnostic-technology-for-the-codon-mutation-c580y-in-YHY8uUfDzh
- Publisher
- Springer Journals
- Copyright
- Copyright © 2018 by The Author(s)
- Subject
- Biomedicine; Parasitology; Tropical Medicine; Infectious Diseases; Entomology; Microbiology; Public Health
- eISSN
- 1475-2875
- DOI
- 10.1186/s12936-018-2362-x
- Publisher site
- See Article on Publisher Site
Abstract
Background: The recent spread of artemisinin (ART )-resistant Plasmodium falciparum represents an emerging global threat to public health. In Southeast Asia, the C580Y mutation of kelch13 (k13) is the dominant mutation of ART-resist- ant P. falciparum. Therefore, a simple method for the detection of C580Y mutation is urgently needed to enable wide- spread routine surveillance in the field. The aim of this study is to develop a new diagnostic procedure for the C580Y mutation using loop-mediated isothermal amplification (LAMP) combined with the MinION nanopore sequencer. Results: A LAMP assay for the k13 gene of P. falciparum to detect the C580Y mutation was successfully developed. The detection limit of this procedure was 10 copies of the reference plasmid harboring the k13 gene within 60 min. Thereafter, amplicon sequencing of the LAMP products using the MinION nanopore sequencer was performed to clarify the nucleotide sequences of the gene. The C580Y mutation was identified based on the sequence data col - lected from MinION reads 30 min after the start of sequencing. Further, clinical evaluation of the LAMP assay in 34 human blood samples collected from patients with P. falciparum malaria in Indonesia revealed a positive detection rate of 100%. All LAMP amplicons of up to 12 specimens were simultaneously sequenced using MinION. The results of sequencing were consistent with those of the conventional PCR and Sanger sequencing protocol. All procedures from DNA extraction to variant calling were completed within 3 h. The C580Y mutation was not found among these 34 P. falciparum isolates in Indonesia. Conclusions: An innovative method combining LAMP and MinION will enable simple, rapid, and high-sensitivity detection of the C580Y mutation of P. falciparum, even in resource-limited situations in developing countries. Keywords: Malaria, Plasmodium falciparum, Artemisinin resistance, LAMP, Nanopore sequencer, MinION , kelch 13 *Correspondence: t_maeda@saitama-med.ac.jp Department of Microbiology, Saitama Medical University, 38 Morohongo, Moroyama-machi, Iruma-gun, Saitama 350-0495, Japan Full list of author information is available at the end of the article © The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/ publi cdoma in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Imai et al. Malar J (2018) 17:217 Page 2 of 11 has some operational advantages over conventional Background PCR procedures because it is fast, easy to use, and cost- Malaria is a mosquito-borne infectious disease and one effective [10]. Amplification is mediated by a loop struc - of the most severe and prevalent public health problems ture and relies on an auto-cycling procedure performed in tropical and subtropical areas worldwide. In recent with strand-displacement of Bst DNA polymerase under years, the spread of artemisinin (ART)-resistant Plas- isothermal conditions. Furthermore, the amplification modium falciparum malaria, which is defined as delayed products in LAMP reactions can be directly judged by parasite clearance from the blood following appropriate turbidity or changes in fluorescence with the naked eye. treatment with ART monotherapy or ART-based com- Given these properties, the LAMP method is expected to bination therapy (ACT) [1], has gained global attention, become an important and widely-used clinical diagnostic particularly in Southeast Asia and southern China [2–4]. technique in point-of-care testing for infectious diseases The World Health Organization (WHO) currently rec - and will require only limited equipment and labor. The ommends ACT instead of artesunate monotherapy as the advantages of LAMP are particularly relevant in areas first-line treatment for suspected P. falciparum malaria with limited resources [11, 12]. Recently, Loopamp infections, and has urgently proposed a global plan for MALARIA Pan/Pf Detection Kit (Eiken Chemical Co., the monitoring and surveillance of ART-resistant P. fal- Ltd., Tokyo, Japan) has become commercially available ciparum to assess the threat of emerging resistant strains for the detection of Plasmodium parasites. [5]. The MinION nanopore sequencer is a pocket-sized and A molecular marker of ART resistance in P. falciparum USB-connected portable real-time sequencer developed has not been completely identified or validated; however, by Oxford Nanopore Technologies (ONT; Oxford, UK). mutations in the kelch13 (k13)-propeller gene are thought The advantages of MinION include the simple and rapid to be associated with ART resistance based on in vitro preparation of samples, portability, real-time sequencing, and in vivo investigations [1]. Although amino acids relatively low cost, and the need for minimal equipment substitutions N458Y, Y493H, R539T, I543T, R561H, and and personnel. Recently, MinION has been shown to C580Y could all be associated with ART-resistance and be an alternative method for whole genome sequencing reduce the cure rate following ACT treatment, C580Y that can be used for genomic surveillance and infection is thought to be the dominant mutation and a potential control in hospitals by enabling the rapid identification drug resistance marker, especially in Southeast Asia [6– of pathogens, including Ebola virus, in areas with lim- 9]. Recently, ART-resistant strains of P. falciparum with ited resources [13, 14]. In addition, an innovative diag- C580Y mutation have spread across Cambodia, north- nostic technology using the LAMP assay combined with eastern Thailand, and southern Laos. Simultaneously, MinION, which is rapid, simple, highly sensitive, and the mutation could have developed resistance to pipe- cost-effective, has been introduced for the serotyping of raquine—one of the ACT partner drugs—because this dengue virus and genotyping of Plasmodium parasites drug is related to high rates of failure in the treatment of [15, 16]. malaria [8]. Thus, there is an urgent need to strengthen In this study, a single nucleotide polymorphism geno- the surveillance and elimination of ART-resistant P. falci- typing method for C580Y in k13 of P. falciparum with parum C580Y mutation in Southeast Asia. clinical specimens using the LAMP assay combined with Point mutations and their prevalence can be con- MinION nanopore sequencing was developed. This is a firmed by polymerase chain reaction (PCR) amplification quick, sensitive, and simple method that requires mini- and Sanger sequencing, which are widely used and well mal equipment and personnel. established. However, these techniques are unsuitable in malaria-endemic areas due to their high cost and need Methods for sophisticated laboratories, and they cannot keep up Design of LAMP primers with the current demand for field-based assays. Clinical The oligonucleotide LAMP primers for the detection of samples need to be stored by appropriate protocols and the codon mutation of C580Y were designed based on transferred to laboratories from remote locations, which the sequences of k13 to encompass C580Y within the creates several disadvantages, including the cost of trans- F1–B1 primer pairs via online LAMP primer design soft- portation, transfer time, and potential loss of clinical ware (PrimerExplorer 5, http://prime rexpl orer.jp/index samples. Therefore, a simple and easy-to-perform molec - .html; Eiken Chemical). Based on in silico analysis of the ular genotyping method is urgently required to accurately k13 sequence in six human Plasmodium parasites (P. fal- assess the distribution of ART-resistant P. falciparum in ciparum, Plasmodium vivax, Plasmodium ovale curtisi, malaria-endemic areas. Plasmodium ovale wallikeri, Plasmodium knowlesi, and Loop-mediated isothermal amplification (LAMP) is Plasmodium malariae), these primers were located on an isothermal nucleic acid amplification technique that Imai et al. Malar J (2018) 17:217 Page 3 of 11 diverse sequences for species-specific LAMP amplifica - 63, 64, and 65 °C in duplicate to find the optimum tem - tion (Additional file 1: Fig. S1). The sequences of each perature for the LAMP amplification. selected primer are given in Table 1 and their positions are shown in Fig. 1. The detection limit and specificity of the LAMP assay Ten-fold serial dilutions of each plasmid DNA rang- 1 5 ing from 1.0 × 10 to 1.0 × 10 copies/μL were produced Plasmid construction to determine the detection limit of the LAMP primers, The templates used for the analytical LAMP reac - and stored at − 20 °C in duplicate until use. Addition- tions were the pEX-A2J1 plasmids harbouring par- ally, to evaluate the specificity of the test, seven different tial sequences within the k13 of P. falciparum, which protozoa (Toxoplasma gondii, Cryptosporidium parvum, were constructed by Eurofines Genomics Co., Ltd. Giardia intestinalis, Entamoeba histolytica, Leishmania (Tokyo, Japan) based on the reference sequences (Gen- donovani, Trypanosoma brucei rhodesiense, and Trypa- Bank accession numbers: P. falciparum, KT956001.1 nosoma cruzi) isolated by the National BioResource Pro- and KR537460.1). The sequences of the constructed ject (http://www.nbrp.jp/) were also examined. plasmids are summarized in Fig. 1. The plasmids were serially diluted tenfold and adjusted from 1.0 × 10 to Clinical samples and ethics 1.0 × 10 copies/μL to determine the detection threshold Clinical samples were obtained from Sam Ratulangi Uni- and specificity of the LAMP reactions. The sequences of versity in Manado and Bitung, North Sulawesi, Indonesia the constructed plasmids were confirmed by the Sanger from August to December 2010. All patients were diag- method using F3 and B3 primers (Table 1). nosed based on symptoms, blood smears stained with Giemsa stain, and nested PCR according to previously reported protocols [17–19]. Peripheral blood was col- LAMP reactions lected by FTA Elute cards (GE Healthcare Life Sciences, The reactions were performed using a Loopamp DNA Little Chalfont, UK) from each patient and stored at Amplification Reagent Kit (Eiken Chemical). Detection room temperature. of the LAMP amplicons was performed by real-time Both the design and protocol of this study conformed measurements of turbidity using a Loopamp real-time to the Helsinki Declaration and were approved by the turbidimeter LA-200 (Eiken Chemical) and visual obser- Institutional Ethics Committee. All samples were col- vations of the colour changes with the naked eye under lected after written informed consent has been obtained. natural light. The final reaction volume was 25 μL, com - The methods of collection and analysis of the human prising 40 pmol of the FIP primer and 40 pmol of the BIP samples were approved and cleared by the Institutional primer, 20 pmol of each loop primer, 5 pmol of F3 and Ethical Review Board of Sam Ratulangi University and B3 primers, 1 μL of the Bst DNA polymerase, reaction the University of Tokyo. buffer (20 mM Tris–HCl, 10 mM KCl, 8 mM MgSO , 10 mM (NH ) SO , 0.1% Tween 20, 0.8 M betaine, and 4 2 4 DNA extraction from clinical samples 1.4 mM each dNTP), and 1 μL of plasmid DNA or 8 μL of Genomic DNA was extracted following the manufac- genomic DNA samples. Reactions were carried out at 62, turer’s instructions for FTA Elute cards. Briefly, each disk with a diameter of 3.0 mm was cut from the blood spot areas and washed three times with 200 μL of distilled Table 1 Nucleotide sequences of the LAMP primers water. DNA was eluted in 30 μL of TE buffer (10 mM constructed for kelch13 of Plasmodium falciparum Tris–HCl, 0.1 mM EDTA, pH 8.0) with a heat block at Primer Sequence (5′–3′) Length 95 °C for 30 min. Finally, 8.0 μL of supernatant was used as template DNA for both LAMP assays. LAMP primers F3TGG GGG ATA TGA TGG CTC 18 Sequencing of LAMP products by MinION B3ATT ATC AAT ACC TCC AAC AACAT 23 To confirm the presence of codon mutation C580Y in FIPAGC TGA TGA TCT AGG GGT ATT CAA -TTC 49 k13, amplicon sequencing of LAMP reactions by Min- TAT TAT ACC GAA TGT AGA AGC A ION sequencer was performed. LAMP amplicons BIPAAT GGG AAC AAT TTC CAT ATG CCT -GAT 48 TAA GGT AAT TAA AAG CTG CTC derived from plasmid DNA harboring partial sequences LFCCC ATG CTT TCA TAC GAT GAT CAT A 25 of k13 with or without C580Y mutation and clinical sam- ples were purified with Agencourt AMPure XP beads F3 and B3, outer primers; FIP and BIP, inner primers; LF, loop primer (Beckman Coulter Inc., Brea, CA). For the multiplex The FIP primer consisted of F2 and the complementary strand (F1c) The BIP primer consisted of B2 and the complementary strand (B1c) and real-time MinION sequencing, a Rapid Barcoding Imai et al. Malar J (2018) 17:217 Page 4 of 11 Amino acids R RNNC GVTSNGRIYC KR537460(C580Y) TAGAAGAAATAATTGT GGTGTTACGTCAAATGGTAGAATTTATTGT KT956991(WT) TAGAAGAAATAATTGT GGTGTTACGTCAAATGGTAGAATTTATTGT Amino acids R RNNC GVTSNGRIYC 543 553 F3 F2 Amino acids I--G--G--Y--D--G--S--S--I--I--P--N--V--E--A--Y--D--H--R--M- KR537460(C580Y) ATTGGGGGATATGATGGCTCTTCTATTATA CCGAATGTAGAAGCATATGATCATCGTATG KT956001(WT) ATTGGGGGATATGATGGCTCTTCTATTATA CCGAATGTAGAAGCATATGATCATCGTATG Amino acids I--G--G--Y--D--G--S--S--I--I--P--N--V--E--A--Y--D--H--R--M- 563 573 LF F1 *** Amino acids K--A--W--V--E--V--A--P--L--N--T--P--R--S--S--A--M--Y--V--A- KR537460(C580Y) AAAGCATGGGTAGAGGTGGCACCTTTGAAT ACCCCTAGATCATCAGCTATGTATGTTGCT KT956001(WT) AAAGCATGGGTAGAGGTGGCACCTTTGAAT ACCCCTAGATCATCAGCTATGTGTGTTGCT Amino acids K--A--W--V--E--V--A--P--L--N--T--P--R--S--S--A--M--C--V--A- 583 593 Amino acids F--D--N--K--I--Y--V--I--G--G--T--N--G--E--R--L--N--S--I--E- KR537460(C580Y) TTTGATAATAAAATTTATGTCATTGGTGGA ACTAATGGTGAGAGATTAAATTCTATTGAA KT956001(WT) TTTGATAATAAAATTTATGTCATTGGTGGA ACTAATGGTGAGAGATTAAATTCTATTGAA Amino acids F--D--N--K--I--Y--V--I--G--G--T--N--G--E--R--L--N--S--I E 603 613 B1 Amino acids - V--Y--E--E--K--M--N--K--W--E--Q--F--P--Y--A--L--L--E--A--R- KR537460(C580Y) GTATATGAAGAAAAAATGAATAAATGGGAA CAATTTCCATATGCCTTATTAGAAGCTAGA KT956001(WT) GTATATGAAGAAAAAATGAATAAATGGGAA CAATTTCCATATGCCTTATTAGAAGCTAGA Amino acids - V--Y--E--E--K--M--N--K--W--E--Q--F--P--Y--A--L--L--E--A--R- 623 633 B2 B3 Amino acids - S--S--G--A--A--F--N--Y--L--N--Q--I--Y--V--V--G--G--I--D--N- KR537460(C580Y) AGTTCAGGAGCAGCTTTTAATTACCTTAAT CAAATATATGTTGTTGGAGGTATTGATAAT KT956001(WT) AGTTCAGGAGCAGCTTTTAATTACCTTAAT CAAATATATGTTGTTGGAGGTATTGATAAT Amino acids -S--S--G--A--A--F--N--Y--L--N--Q--I--Y--V--V--G--G--I--D N Amino acids EH N KR537460(C580Y) GAACATAACA- KT956001(WT) GAACATAACA Amino acids EH N Fig. 1 Alignment of the partial sequences of the kelch13 of Plasmodium falciparum, which was constructed within the pEX-A2J1 plasmid. The constructed sets of LAMP primers are shown as lines and boxes. Asterisks show the specific sequences located at the codon position of C580Y in artemisinin-resistant P. falciparum Sequencing Kit (SQK-RBK001, ONT) was used to MinION Flow Cell (FLO-MIN107 R9.5 Version) and the sequence up to 12 samples on a single flow cell. LAMP “NC_48Hr_sequencing_FLO-MIN107_SQK-RBK001_ amplicons (200 ng each) were measured by Qubit 3.0 plus_basecaller” protocol was initiated using MinKNOW Fluorometer (Thermo Fisher Scientific) and simultane - software (ONT, v1.4.2). ously processed for the barcoding and library preparation using the Rapid Barcoding Sequencing Kit, according Analysis of MinION data to the manufacturer’s instructions. After the MinION Figure 2 shows the workflow of the data analysis in Platform QC run, the DNA library was loaded into this study. Local basecalling was performed using Imai et al. Malar J (2018) 17:217 Page 5 of 11 [Turbidity] [Copies / reaction] 1 10 1 10 0.75 1 10 1 10 0.5 1 10 1 10 0.25 NC [Min] Fig. 3 The detection limit of LAMP for kelch13 of Plasmodium falciparum with tenfold serial dilutions of plasmid DNA 5′-GGG AAT CTG GTG GTA ACA GC-3′; second round forward primers, 5′-GCC AAG CTG CCA TTC ATT TG-3′ and reverse primers, 5′-GCC TTG TTG AAA GAA GCA GA-3′. Thermal cycling was carried out under Fig. 2 Schematic of the data analysis workflow in this study the following conditions: 94 °C for 2 min, followed by 40 cycles at 98 °C for 10 s, 55 °C for 30 s, 68 °C for 1 min, with a final extension at 68 °C for 7 min in both the first- and second-round amplifications. The 1000-fold dilution MinKNOW in real time and automatically. FAST5 products of the first round of PCR were used as templates reads were collected at 30 min and 48 h after the start of for the second round. All second-round PCR products sequencing. FASTQ files were extracted from each col - were analyzed using 1.2% (w/v) agarose gel, stained with lected FAST5 read via Poretools (v 0.6.0). Demultiplex- ethidium bromide, and purified by Agencourt AMPure ing and adapter trimming was performed using Porechop XP beads (Beckman Coulter). Sanger sequencing of these (v 0.2.2), and each FASTQ per ONT-barcode data was purified PCR amplicons was performed by Eurofines mapped by BWA-MEM (v 0.7.15) using the sequence of Genomics Co., Ltd. (Tokyo, Japan). k13 without the C580Y codon mutation between a pair of LAMP primers, F1c (5′-TTG AAT ACC CCT AGA TCA TCA GC-3′) and B1c (5′-AAT GGG AAC AAT Results TTC CAT ATG CCT-3′). The mapped data with a “Map - Sensitivity and specificity of LAMP Quality” < 60 were discarded via Samtools (v 1.5.0). The A tenfold serial dilution of each plasmid DNA was ampli- single nucleotide variant calling from mapped data was fied to determine the lower detection limit of the con - obtained via Samtools and BCFtools (v 1.5.0), and cutoff structed LAMP assay and the optimal temperature was values of 50 for single nucleotide variant quality and read observed at 62 °C. Figure 3 shows the results of detection depth were determined. Mapped data were visualized by based on real-time turbidity; amplification of the tar - IGV software (v 2.3.8). FAST5 reads and mapped data get DNA is indicated by the rising curve. The minimum were analysed via Poretools and Samtools, respectively. amounts of plasmid DNA on real-time turbidities with LA-200 were 1.0 × 10 /reaction within 60 min (Fig. 2). These results were similar to those obtained by observ - k13 amplification and Sanger sequencing ing visual changes within 60 min. Additionally, 1.0 ng The Sanger method was used to perform PCR amplicon of genomic DNA derived from seven other protozoa sequencing to confirm and validate the sequence results (Toxoplasma gondii, Cryptosporidium parvum, Giardia of LAMP amplicons via the MinION sequencer for the intestinalis, Entamoeba histolytica, Leishmania dono- clinical specimens. For the specific amplification of k13, vani, Trypanosoma brucei rhodesiense, and Trypanosoma nested PCR according to previously reported protocols cruzi) were not amplified by the LAMP procedure. were used [7]. Briefly, the first- and second-round PCR amplicons were generated by PrimeSTAR GXL DNA Polymerase (Takara Bio Inc., Kusatsu, Japan) with the Clinical evaluation of LAMP assays following primers: first round forward primers, 5′-CGG Parasitemia was confirmed in 40 blood samples AGT GAC CAA ATC TGG GA-3′ and reverse primers, by nested-PCR (33 P. falciparum, 6 P. vivax, and 1 Imai et al. Malar J (2018) 17:217 Page 6 of 11 Table 2 Summary of the results of nested PCR and LAMP amplifications, and the identification of kelch13 mutations of P. falciparum LAMP reaction Identification of mutation PCR and Sanger LAMP and MinION Positive Negative C580Y Wild type C580Y Wild type Nested PCR P. f 33 33 0 0 33 0 33 P. f/P. v 1 1 0 0 1 0 1 P. v 6 0 6 – – – – P. f, P. falciparum; P. v, P. vivax; P.f/P.v, P. falciparum and P. vivax co-infection co-infection with P. falciparum and P. vivax). All 33 P. file 2: Table S1). In addition, the same analysis of reads collected 48 h after the start of MinION sequencing were falciparum and the 1 co-infection cases were positive also performed (Additional file 4: Fig. S3 and Additional (n = 34; 100%). None of the 6 P. vivax blood samples were file 2: Table S3). The results of variant calling were con amplified with the LAMP primers (Table 2). - sistent with the results at 30 min. Sequencing of LAMP products by MinION Figure 4 and Additional file 2: Table S1 show the results Discussion of FAST5 reads analysis generated 30 min after the Although several sophisticated LAMP methods have start of MinION sequencing. The mean collected read been developed for the detection of Plasmodium para- numbers and read bases per run were 10,052 and 2215, sites from clinical specimens [11, 12, 20–33], none have respectively. Of the total collected reads, 1.57–7.75% been designed to detect single nucleotide polymorphisms were classified into ONT-barcodes after barcode demul - (SNPs) associated with ART resistance in P. falciparum. tiplexing; however, reads from 35.8 to 70.6% were unclas- The LAMP method combined with MinION sequenc - sified. Based on the analysis of the mapped data, a depth ing method was capable of simultaneously detecting of coverage above 50× was achieved at each base on the both P. falciparum parasitaemia and the codon muta- reference sequence. Because LAMP amplicons contain tion in k13 in up to 12 samples at a high level of sensi- random repeating structures, a read was mapped as a ref- tivity without expensive or large experimental devices. erence sequence more than once by BWA-MEM. The practical advantage of this method is that it enables Table 3 showed the results of mapped data obtained real-time monitoring of ART resistance in patients diag- from the analysis workflow using LAMP amplicons with nosed with P. falciparum malaria, even in areas with lim- plasmids harbouring the partial sequences of k13 with or ited resources, because the samples can be prepared and without the C580Y mutation. Variant callings from col - sequenced without storage or transfer to a fully-equipped lected reads were consistent with the plasmid sequences. laboratory. Another advantage of this protocol is that The average accuracy of the mapped reads of LAMP sequence data can be stored in the cloud and shared at anytime, anywhere in the world. amplicons generated from plasmids with the codon The gold standard diagnostic method for malaria to mutation C580Y was 89.0%, and at the base of the muta- date is the microscopic examination of Giemsa-stained tion C580Y (position 6/from “G” to “A”), 86.4% reads thin or thick blood smears. Several rapid diagnostic were correctly matched with “A”, but 13.6% reads were tests (RDT), such as the rapid immunochromatographic mismatched (Additional file 3: Fig. S2, Additional file 2: test, are already manufactured and used throughout Table S2). None of the 34 LAMP amplicons from clinical speci the world. However, misdiagnosis is common in micro - - mens showed the C580Y mutation based on variant call- scopic examinations or rapid immunochromatographic ing from collected reads at 30 min. These results were tests of mixed infections when a patient has low-density consistent with the results of PCR amplicon sequencing parasitemia or is asymptomatic [34–36]. Consequently, by conventional Sanger methods (Table 2 and Additional low-density parasitaemia or asymptomatic carriers of P. (See figure on next page.) Fig. 4 The results of FAST5 reads analysis collected 30 min from the start of MinION sequencing. a Histogram of FAST5 read sizes from each MinION sequencing run. b Collector’s curve reflecting the total base pairs of sequencing yield over time for each MinION sequencing run. c Depth of coverage for each ONT-barcode number and MinION sequencing run Imai et al. Malar J (2018) 17:217 Page 7 of 11 c Imai et al. Malar J (2018) 17:217 Page 8 of 11 Table 3 Summary of the MinION sequencing of LAMP amplicons from plasmids Reference plasmid Total reads Mapped reads Coverage % bases Accuracy (%) Sequencing result > MQ60 depth > 50 C580Y 389 793 748.10 100 89.54 C580Y Wild type 476 822 761.83 100 89.9 Wild type falciparum could be reservoirs for malaria infections [37, copies/reaction vs 1.0 × 10 copies/reaction), and the 38]. Therefore, highly sensitive diagnostic tools that can “Barcode-LAMP FIP primers” can detect only 85.7% of P. detect even low-density parasitaemia are essential for the falciparum parasitaemia cases (Additional file 5: Fig. S4, elimination and accurate epidemiological surveillance Additional file 2: Tables S4, S5). In the study by Yamagi- of ART-resistant P. falciparum. Molecular diagnostic shi et al., the sensitivity of real-time LAMP in the clinical tests such as PCR or LAMP methods are highly sensi- cases was only 80%, and the LAMP reaction took 90 min. tive and can detect plasmodium infections even at very The sensitivity of the above-mentioned LAMP assay was low levels of parasitaemia [20, 39–42]. In particular, the inferior to previously reported LAMP assays for dengue detection limit of standard nested-PCR [18], real-time virus (sensitivity ~ 100%) [49–51]. In addition, the proto- PCR [43], and commercial LAMP assay for malaria (Loo- col took over 2 h to prepare the library using the Ligation pamp MALARIA Pan/Pf Detection Kit, Eiken Chemi- Sequencing Kit (SQK-LSK002). In this study, all proce- cal, Japan) are respectively 6.0, 0.7, and 25.0 parasites/ dures from DNA extraction to variant calling were com- mL, and exceed the detection limit of both microscopy pleted within 3 h. (50–500 parasites/mL) [44, 45] and RDT for P. falcipa- It is well documented that MinION reads have a much rum-specific histidine-rich protein II, Plasmodium lac- higher error rate, especially via 1D-chemistry, than tate dehydrogenase, or aldolase (100 parasites/mL) [44]. conventional Sanger sequencing or other next genera- In this study, the detection limit of the LAMP method for tion sequencing platforms, including 454, Illumina, and k13 gene was 1.0 × 10 copies/reaction (corresponding to Iontorrent technology [52–55]. The rate of accuracy of 12.5 parasite/mL), and the levels of sensitivity and speci- 1D-read chemistry with R9.4 flow cell is about 90% (https ficity were 100% in the clinical samples. The sensitivity ://nanop orete ch.com/). To generate accurate sequences, of the LAMP assay is equivalent to previously described genomic regions must be read multiple times, with errors L AMP assays (sensitivity ~ 100% and specificity ~ 100%) eliminated through consensus averaging. Because of the [11, 12, 20–33]. high error rate of MinION, a 50-fold read coverage of Using the high specificity of the LAMP method, the genome positions was sufficient to accurately deter - techniques for genotyping gene polymorphisms with- mine the genotypes. LAMP amplicons are constructed out sequence analysis have been developed, including of complicated repeating structures; therefore, a single LAMP with FIP and/or BIP primers, which are designed read generated from MinION contains several multiple to contain a single-nucleotide polymorphism at each base sequences of the target region. This LAMP method 5′ end (SNPs-LAMP) (http://loopa mp.eiken .co.jp/) or combined with MinION sequencing could collect suf- insert artificial mutations using FIP and/or BIP prim - ficient sequence data within 30 min of starting MinION ers (ARMS-LAMP) [46, 47]. However, the design of sequencing. The results of variant calling by this method LAMP primers for the above-mentioned protocol is not were completely consistent with the results of Sanger only quite difficult and limited, but also less sensitive sequencing. Therefore, this procedure is a highly accurate than conventional LAMP assays [48]. In contrast, the method of variant calling. However, it did not achieve LAMP method combined with MinION sequencing can sufficient accuracy for deep sequencing to detect low- achieve unlimited LAMP primer designs for genotyping frequency mutations within a sample because the average polymorphisms. rate of accuracy was 89.4%. A diagnostic method for dengue virus via the real-time Therefore, if the proportion of the C580Y mutant strain LAMP method combined with MinION sequencer has is smaller than that of the wild type strain in the same been previously developed [16]. However, the multiplex clinical specimen, the C580Y mutation may not be accu- sequence methods for that protocol use barcoded-LAMP rately detected. It is thought that this disparity occurred FIP primers, which insert a unique 24-base ONT-barcode for the following reasons: the high error rate of MinION tag within the F1c sites. In this study, the detection limit reads, the fidelity of the LAMP enzyme, and the mapping of “Barcode-LAMP FIP primers” was one-hundredth algorithm of BWA-MEM. ONT has introduced 1D2-read that of the “Non-barcoded LAMP FIP primers” (1.0 × 10 chemistry with higher precision than 1D-read chemistry Imai et al. Malar J (2018) 17:217 Page 9 of 11 (https ://nanop orete ch.com/), which will improve the pre- C580Y as the reference sequence (kelch13 of wild type; KT956001.1) visual- cision of the combined LAMP and MinION sequencer ized by igvtools. The lower image is a Sanger sequencing trace of the C580Y allele using the same sample. b: The upper image shows mapped method in the future. reads from plasmid DNA with the wild type as the reference sequence. This study was limited due to the small number of The lower image is the Sanger sequencing trace of the wild type allele. malaria samples; hence, the performance of the sensi- Asterisks show the specific sequences located at the codon position of C580Y in kelch13. tivity and specificity in clinical samples have not been demonstrated. The specificity in clinical samples that Additional file 4: Fig. S3. The results of FAST5 reads analysis collected 48 h from the start of MinION sequencing. a: Histogram of FAST5 read contained only P. vivax were evaluated. In addition, there sizes from each MinION sequencing run. b: Collector’s curve reflecting were no C580Y mutations in k13 found among 34 P. fal- the total base pairs of the sequencing yield over time for each MinION ciparum isolates collected in 2010 in Indonesia. An accu- sequencing run. c: Depth of coverage for each ONT-barcode number and MinION sequencing run. rate evaluation of the sensitivity and specificity of this Additional file 5: Fig. S4. The detection limit of Barcode-LAMP assay for method requires further investigation in a clinical setting. kelch13 of Plasmodium falciparum with tenfold serial dilutions of plasmid The LAMP method combined with MinION sequenc - DNA. ing detected SNPs only in the 95 bp region incorporat- ing the C580Y codon mutation in k13 amplified by the Authors’ contributions LAMP primers. The other codon mutations in k13 are JT, YS, JY, and TMa conceived and designed the study; KI, NT, LRR, JS, and TMa reportedly associated with ART resistance. This proce - gathered and analysed the data, and drafted and edited the manuscript; KH, dure will be used to detect other mutations for the sur- YE, RM, HO, TMu, SM, YS, and JY supervised the study and revised the manu- script; YS, JY, and TMa performed project administration. All authors read and veillance of ART resistance in the next study. Due to the approved the final manuscript. flexibility afforded in the design of LAMP primers, this procedure can easily be used to detect other SNPs associ- Author details Department of Infectious Disease and Infection Control, Saitama Medical ated with drug-resistance genes not only in P. falciparum, University, 38 Morohongo, Moroyama-machi, Iruma-gun, Saitama 350-0495, but also in bacteria or fungi. Japan. Center for Clinical Infectious Diseases and Research, Saitama Medical University, 38 Morohongo, Moroyama-machi, Iruma-gun, Saitama 350-0495, Japan. Department of Computational Biology and Medical Science, Gradu- Conclusions ate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, In this study, an innovative diagnostic technology to Kashiwa, Chiba 277-8562, Japan. Research Center for Zoonosis Control, detect the codon mutation C580Y in k13 of P. falciparum Hokkaido University, North 20, West 10 Kita-ku, Sapporo, Hokkaido 001-0020, Japan. Faculty of Medicine, Oita University, 1-1 Hasama-machi, Yufu, Oita was demonstrated. The method, which uses the LAMP 879-5593, Japan. Department of Medical Entomology, Faculty of Tropi- assay combined with MinION sequencer, is rapid, sim- cal Medicine, Mahidol University, 420/6 Ratchawithi Road, Thung Phaya, ple, and highly sensitive. This procedure could contrib - Ratchathewi, Bangkok 10400, Thailand. Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871, Japan. ute to the epidemiological surveillance of ART-resistant Division of Biomedical Sciences, Department of Basic Veterinary Medicine, P. falciparum and be applied to the analyses of sequence Obihiro University of Agriculture and Veterinary Medicine, 2-11 Inada-cho, polymorphisms or genotyping. The next step for refining Obihiro, Hokkaido 080-8555, Japan. Department of Parasitology, Faculty of Medicine, Sam Ratulangi University, Kampus Unsrat, Bahu Manado 95115, this procedure will be to conduct a clinical evaluation to Indonesia. Department of Infectious Diseases and Infection Control, Saitama verify that the sensitivity and specificity are sufficient and Medical Center, Saitama Medical University, 1981 Kamoda, Kawagoe, Saitama consistent in resource-limited endemic regions. 350-8550, Japan. Department of Microbiology, Saitama Medical University, 38 Morohongo, Moroyama-machi, Iruma-gun, Saitama 350-0495, Japan. Additional files Global Station for Zoonosis Control, GI-CoRE, Hokkaido University, North 20, West 10 Kita-ku, Sapporo, Hokkaido 001-0020, Japan. Additional file 1: Fig. S1. Sequence alignment of the kelch-propeller Acknowledgements domain of human Plasmodium parasites and the primer locations for This work was supported in part by the National BioResource Project in Japan. LAMP. Pf, P. falciparum; Pv, P. vivax; Poc, P. ovale curtisi; Pow, P. ovale wallikeri; (http://www.nbrp.jp/). Pm, P. malariae; Pk, P. knowlesi. Competing interests Additional file 2: Table S1. The analysis of FAST5 reads collected 30 The authors declare that they have no competing interests. min after the start of MinION sequencing. Table S2. The results of the visualization analysis and the valiant calling using the reads collected Availability of data and materials 30 min and 48 h after the start of MinION sequencing. Table S3. The The datasets supporting the conclusions of this article are included within the analysis of FAST5 reads collected 48 h after the start of MinION sequenc- article. ing. Table S4. Nucleotide sequences of the Barcoded-LAMP primers constructed for kelch 13 of Plasmodium falciparum. Table S5. Summary Consent for publication of the results of nested PCR and Barcoded-LAMP amplifications in clinical Not applicable. samples. Additional file 3: Fig. S2. A comparison of visualizations of mapped Min- Ethics approval and consent to participate ION reads with Sanger sequencing trace data. a: The upper image shows Ethical clearances were obtained from Institutional Ethical Review Board mapped reads from LAMP amplicons generated from plasmid DNA with of Sam Ratulangi University and The University of Tokyo (Approval Number Imai et al. Malar J (2018) 17:217 Page 10 of 11 10-49). The purpose of the study was explained in detail and written, informed 17. Iwasaki M, Toshihiro Y, Otsuka K, Suzuki W, Nagamine K, Hase T, et al. Vali- consent was obtained from all participants. Confidentiality was maintained by dation of the loop-mediated isothermal amplification method for single avoiding the use of names and other identifiers. nucleotide polymorphism genotyping with whole blood. Genome Lett. 2003;2:119–26. Funding 18. Singh B, Bobogare A, Cox-Singh J, Snounou G, Abdullah MS, Rahman This research did not receive any specific grant from funding agencies in the HA. A genus- and species-specific nested polymerase chain reaction public, commercial, or not-for-profit sectors. malaria detection assay for epidemiologic studies. Am J Trop Med Hyg. 1999;60:687–92. 19. Singh B, Kim Sung L, Matusop A, Radhakrishnan A, Shamsul SS, Cox-Singh Publisher’s Note J, et al. A large focus of naturally acquired Plasmodium knowlesi infections Springer Nature remains neutral with regard to jurisdictional claims in pub- in human beings. Lancet. 2004;363:1017–24. lished maps and institutional affiliations. 20. Cook J, Aydin-Schmidt B, Gonzalez IJ, Bell D, Edlund E, Nassor MH, et al. Loop-mediated isothermal amplification (LAMP) for point-of-care detec- Received: 7 October 2017 Accepted: 22 May 2018 tion of asymptomatic low-density malaria parasite carriers in Zanzibar. Malar J. 2015;14:43. 21. Cuadros J, Perez-Tanoira R, Prieto-Perez L, Martin-Martin I, Berzosa P, Gon- zalez V, et al. Field evaluation of malaria microscopy, rapid malaria tests and loop-mediated isothermal amplification in a rural hospital in South References Western Ethiopia. PLoS One. 2015;10:e0142842. 1. WHO. Global Malaria Programme Artemisinin and artemisinin-based 22. Hayashida K, Simukoko H, Simmunza M, Ndebe J, Chota A, Namangala combination therapy resistance. Status report. Geneva: World Health B, et al. Direct detection of falciparum and non-falciparum malaria DNA Organization; 2016. from a drop of blood with high sensitivity by the dried-LAMP system. 2. Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, et al. Arte- Parasit Vectors. 2017;10:26. misinin resistance in Plasmodium falciparum malaria. N Engl J Med. 23. Hopkins H, Gonzalez IJ, Polley SD, Angutoko P, Ategeka J, Asiimwe C, et al. 2009;361:455–67. Highly sensitive detection of malaria parasitemia in a malaria-endemic 3. Hawkes M, Conroy AL, Kain KC. Spread of artemisinin resistance in setting: performance of a new loop-mediated isothermal amplification malaria. N Engl J Med. 2014;371:1944–5. kit in a remote clinic in Uganda. J Infect Dis. 2013;208:645–52. 4. Noedl H, Se Y, Schaecher K, Smith BL, Socheat D, Fukuda MM. Evidence 24. Lau YL, Fong MY, Mahmud R, Chang PY, Palaeya V, Cheong FW, et al. of artemisinin-resistant malaria in western Cambodia. N Engl J Med. Specific, sensitive and rapid detection of human Plasmodium knowlesi 2008;359:2619–20. infection by loop-mediated isothermal amplification (LAMP) in blood 5. WHO. Guidelines for the treatment of malaria. 3rd ed. Geneva: World samples. Malar J. 2011;10:197. Health Organization; 2015. 25. Lau YL, Lai MY, Fong MY, Jelip J, Mahmud R. Loop-mediated isothermal 6. Miotto O, Amato R, Ashley EA, MacInnis B, Almagro-Garcia J, Amaratunga amplification assay for identification of five human plasmodium species C, et al. Genetic architecture of artemisinin-resistant Plasmodium falcipa- in Malaysia. Am J Trop Med Hyg. 2016;94:336–9. rum. Nat Genet. 2015;47:226–34. 26. Lee PW, Ji DD, Liu CT, Rampao HS, do Rosario VE, Lin IF, et al. Application 7. Ariey F, Witkowski B, Amaratunga C, Beghain J, Langlois AC, Khim N, of loop-mediated isothermal amplification for malaria diagnosis during a et al. A molecular marker of artemisinin-resistant Plasmodium falciparum follow-up study in Sao Tome. Malar J. 2012;11:408. malaria. Nature. 2014;505:50–5. 27. Lucchi NW, Demas A, Narayanan J, Sumari D, Kabanywanyi A, Kachur SP, 8. Imwong M, Suwannasin K, Kunasol C, Sutawong K, Mayxay M, Rekol H, et al. Real-time fluorescence loop mediated isothermal amplification for et al. The spread of artemisinin-resistant Plasmodium falciparum in the the diagnosis of malaria. PLoS One. 2010;5:e13733. Greater Mekong subregion: a molecular epidemiology observational 28. Lucchi NW, Ljolje D, Silva-Flannery L, Udhayakumar V. Use of malachite study. Lancet Infect Dis. 2017;17:491–7. green-loop mediated isothermal amplification for detection of Plasmo - 9. Imwong M, Jindakhad T, Kunasol C, Sutawong K, Vejakama P, Dondorp dium spp. parasites. PLoS One. 2016;11:e0151437. AM. An outbreak of artemisinin resistant falciparum malaria in Eastern 29. Modak SS, Barber CA, Geva E, Abrams WR, Malamud D, Ongagna YS. Thailand. Sci Rep. 2015;5:17412. Rapid point-of-care isothermal amplification assay for the detection of 10. Mori Y, Notomi T. Loop-mediated isothermal amplification (LAMP): a malaria without nucleic acid purification. Infect Dis (Auckl). 2016;9:1–9. rapid, accurate, and cost-effective diagnostic method for infectious 30. Mohon AN, Elahi R, Khan WA, Haque R, Sullivan DJ Jr, Alam MS. A new diseases. J Infect Chemother. 2009;15:62–9. visually improved and sensitive loop mediated isothermal amplifica- 11. Morris U, Khamis M, Aydin-Schmidt B, Abass AK, Msellem MI, Nassor MH, tion (LAMP) for diagnosis of symptomatic falciparum malaria. Acta Trop. et al. Field deployment of loop-mediated isothermal amplification for 2014;134:52–7. centralized mass-screening of asymptomatic malaria in Zanzibar: a pre- 31. Oriero EC, Okebe J, Jacobs J, Van Geertruyden JP, Nwakanma D, elimination setting. Malar J. 2015;14:205. D’Alessandro U. Diagnostic performance of a novel loop-mediated 12. Aydin-Schmidt B, Xu W, Gonzalez IJ, Polley SD, Bell D, Shakely D, et al. isothermal amplification (LAMP) assay targeting the apicoplast genome Loop mediated isothermal amplification (LAMP) accurately detects for malaria diagnosis in a field setting in sub-Saharan Africa. Malar J. malaria DNA from filter paper blood samples of low density parasitae - 2015;14:396. mias. PLoS One. 2014;9:e103905. 32. Patel JC, Lucchi NW, Srivastava P, Lin JT, Sug-Aram R, Aruncharus S, et al. 13. Quick J, Ashton P, Calus S, Chatt C, Gossain S, Hawker J, et al. Rapid draft Field evaluation of a real-time fluorescence loop-mediated isothermal sequencing and real-time nanopore sequencing in a hospital outbreak of amplification assay, RealAmp, for the diagnosis of malaria in Thailand and Salmonella. Genome Biol. 2015;16:114. India. J Infect Dis. 2014;210:1180–7. 14. Kugelman JR, Wiley MR, Mate S, Ladner JT, Beitzel B, Fakoli L, et al. 33. Sirichaisinthop J, Buates S, Watanabe R, Han ET, Suktawonjaroenpon W, Monitoring of Ebola Virus Makona evolution through establish- Krasaesub S, et al. Evaluation of loop-mediated isothermal amplifica- ment of advanced genomic capability in Liberia. Emerg Infect Dis. tion (LAMP) for malaria diagnosis in a field setting. Am J Trop Med Hyg. 2015;21:1135–43. 2011;85:594–6. 15. Elia MIY, Isra W, Mochammad H. The evaluation on molecular techniques 34. Cheng Q, Cunningham J, Gatton ML. Systematic review of sub-micro- of reverse transcription loop-mediated isothermal amplification (RT- scopic P. vivax infections: prevalence and determining factors. PLoS Negl LAMP), reverse transcription polymerase chain reaction (RT-PCR), and Trop Dis. 2015;9:e3413. their diagnostic results on MinION Nanopore sequencer for the detec- 35. Okell LC, Ghani AC, Lyons E, Drakeley CJ. Submicroscopic infection in tion of dengue virus serotypes. Am J Microbiol Res. 2015;3:118–24. Plasmodium falciparum-endemic populations: a systematic review and 16. Yamagishi J, Runtuwene LR, Hayashida K, Mongan AE, Thi LAN, Thuy LN, meta-analysis. J Infect Dis. 2009;200:1509–17. et al. Serotyping dengue virus with isothermal amplification and a port - 36. Falade CO, Ajayi IO, Nsungwa-Sabiiti J, Siribie M, Diarra A, Serme L, et al. able sequencer. Sci Rep. 2017;7:3510. Malaria rapid diagnostic tests and malaria microscopy for guiding malaria Imai et al. Malar J (2018) 17:217 Page 11 of 11 treatment of uncomplicated fevers in Nigeria and prereferral cases in 3 46. Tamura S, Maeda T, Misawa K, Osa M, Hamamoto T, Yuki A, et al. Devel- African countries. Clin Infect Dis. 2016;63:S290–7. opment of a highly resolved loop-mediated isothermal amplification 37. Lindblade KA, Steinhardt L, Samuels A, Kachur SP, Slutsker L. The silent method to detect the N526K ftsI mutation of beta-lactamase-negative threat: asymptomatic parasitemia and malaria transmission. Expert Rev ampicillin-resistant Haemophilus influenzae. J Microbiol Methods. Anti Infect Ther. 2013;11:623–39. 2017;141:108–14. 38. Bousema T, Drakeley C. Epidemiology and infectivity of Plasmodium falci- 47. Lee D, Kim EJ, Kilgore PE, Takahashi H, Ohnishi M, Tomono J, et al. A novel parum and Plasmodium vivax gametocytes in relation to malaria control loop-mediated isothermal amplification assay for serogroup identifica- and elimination. Clin Microbiol Rev. 2011;24:377–410. tion of Neisseria meningitidis in cerebrospinal fluid. Front Microbiol. 39. Baltzell KA, Shakely D, Hsiang M, Kemere J, Ali AS, Bjorkman A, et al. Preva- 2015;6:1548. lence of PCR detectable malaria infection among febrile patients with a 48. Torigoe H, Seki M, Yamashita Y, Sugaya A, Maeno M. Detection of Haemo- negative Plasmodium falciparum specific rapid diagnostic test in Zanzibar. philus influenzae by loop-mediated isothermal amplification (LAMP) of Am J Trop Med Hyg. 2013;88:289–91. the outer membrane protein P6 gene. Jpn J Infect Dis. 2007;60:55–8. 40. Kattenberg JH, Tahita CM, Versteeg IA, Tinto H, Traore Coulibaly M, 49. Parida M, Horioke K, Ishida H, Dash PK, Saxena P, Jana AM, et al. Rapid D’Alessandro U, et al. Evaluation of antigen detection tests, microscopy, detection and differentiation of dengue virus serotypes by a real-time and polymerase chain reaction for diagnosis of malaria in peripheral reverse transcription-loop-mediated isothermal amplification assay. J Clin blood in asymptomatic pregnant women in Nanoro, Burkina Faso. Am J Microbiol. 2005;43:2895–903. Trop Med Hyg. 2012;87:251–6. 50. Hu SF, Li M, Zhong LL, Lu SM, Liu ZX, Pu JY, et al. Development of 41. Kyabayinze DJ, Zongo I, Cunningham J, Gatton M, Angutoko P, Ategeka reverse-transcription loop-mediated isothermal amplification assay for J, et al. HRP2 and pLDH-based rapid diagnostic tests, expert microscopy, rapid detection and differentiation of dengue virus serotypes 1-4. BMC and PCR for detection of malaria infection during pregnancy and at deliv- Microbiol. 2015;15:265. ery in areas of varied transmission: a prospective cohort study in Burkina 51. Teoh BT, Sam SS, Tan KK, Johari J, Danlami MB, Hooi PS, et al. Detection Faso and Uganda. PLoS One. 2016;11:e0156954. of dengue viruses using reverse transcription-loop-mediated isothermal 42. Wu L, van den Hoogen LL, Slater H, Walker PG, Ghani AC, Drakeley CJ, amplification. BMC Infect Dis. 2013;13:387. et al. Comparison of diagnostics for the detection of asymptomatic 52. Schirmer M, Ijaz UZ, D’Amore R, Hall N, Sloan WT, Quince C. Insight into Plasmodium falciparum infections to inform control and elimination biases and sequencing errors for amplicon sequencing with the Illumina strategies. Nature. 2015;528:S86–93. MiSeq platform. Nucleic Acids Res. 2015;43:e37. 43. Perandin F, Manca N, Calderaro A, Piccolo G, Galati L, Ricci L, et al. Devel- 53. Shao W, Boltz VF, Spindler JE, Kearney MF, Maldarelli F, Mellors JW, et al. opment of a real-time PCR assay for detection of Plasmodium falciparum, Analysis of 454 sequencing error rate, error sources, and artifact recombi- Plasmodium vivax, and Plasmodium ovale for routine clinical diagnosis. J nation for detection of low-frequency drug resistance mutations in HIV-1 Clin Microbiol. 2004;42:1214–9. DNA. Retrovirology. 2013;10:18. 44. Wongsrichanalai C, Barcus MJ, Muth S, Sutamihardja A, Wernsdorfer WH. 54. Liu L, Li Y, Li S, Hu N, He Y, Pong R, et al. Comparison of next-generation A review of malaria diagnostic tools: microscopy and rapid diagnostic sequencing systems. J Biomed Biotechnol. 2012;2012:251364. test (RDT ). Am J Trop Med Hyg. 2007;77:119–27. 55. Jain M, Tyson JR, Loose M, Ip CLC, Eccles DA, O’Grady J, et al. MinION 45. Milne LM, Kyi MS, Chiodini PL, Warhurst DC. Accuracy of routine analysis and reference consortium: phase 2 data release and analysis of laboratory diagnosis of malaria in the United Kingdom. J Clin Pathol. R9.0 chemistry. F1000Res. 2017;6:760. 1994;47:740–2. Ready to submit your research ? Choose BMC and benefit from: fast, convenient online submission thorough peer review by experienced researchers in your field rapid publication on acceptance support for research data, including large and complex data types • gold Open Access which fosters wider collaboration and increased citations maximum visibility for your research: over 100M website views per year At BMC, research is always in progress. Learn more biomedcentral.com/submissions
Journal
Malaria Journal – Springer Journals
Published: May 29, 2018