An assay for the Cpe fat obesity mutation created with a modified primer

An assay for the Cpe fat obesity mutation created with a modified primer Mammalian Genome 8, 783–784 (1997). © Springer-Verlag New York Inc. 1997 fat An assay for the Cpe obesity mutation created with a modified primer Jerilyn A. Walker, Gary E. Truett Pennington Biomedical Research Center, 6400 Perkins Road, Baton Rouge, Louisiana 70808-4124, USA Received: 17 March 1997 / Accepted: 7 May 1997 fat Cpe is an autosomal recessive mutation that causes adult-onset GTCTCCTCCGTGCAGATTGGCCG38, where the altered base obesity (Coleman and Eicher 1990). The mutation arose in the is underlined. The forward primer (CpeF) was selected by Oligo HRS mouse strain and was transferred to C57BLKS for compari- 5.0 to optimize amplification of the target sequence. The sequence son with two other obesity mutations, diabetes (db) and obese (ob), of primer CpeF is 58 CAGCTTGCCCCCGAGACCAAGG 38. which also cause overt diabetes mellitus on the C57BLKS back- The DNA predicted to be amplified by primers CpeF and CpeR ground (Coleman and Eicher 1990; Naggert et al. 1995). is 90 base pairs long. Mutant DNA is predicted to cut with MspI fat fat C57BLKS-Cpe /Cpe mutants differ from C57BLKS-db/db and to generate 64 and 26 bp fragments, and wild-type DNA is pre- C57BLKS-ob/ob mice in several ways. While db/db and ob/ob dicted to http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Mammalian Genome Springer Journals

An assay for the Cpe fat obesity mutation created with a modified primer

Loading next page...
 
/lp/springer_journal/an-assay-for-the-cpe-fat-obesity-mutation-created-with-a-modified-kLrW3QfC0V
Publisher
Springer-Verlag
Copyright
Copyright © 1997 by Springer-Verlag New York Inc.
Subject
Life Sciences; Cell Biology; Animal Genetics and Genomics; Human Genetics
ISSN
0938-8990
eISSN
1432-1777
D.O.I.
10.1007/s003359900568
Publisher site
See Article on Publisher Site

Abstract

Mammalian Genome 8, 783–784 (1997). © Springer-Verlag New York Inc. 1997 fat An assay for the Cpe obesity mutation created with a modified primer Jerilyn A. Walker, Gary E. Truett Pennington Biomedical Research Center, 6400 Perkins Road, Baton Rouge, Louisiana 70808-4124, USA Received: 17 March 1997 / Accepted: 7 May 1997 fat Cpe is an autosomal recessive mutation that causes adult-onset GTCTCCTCCGTGCAGATTGGCCG38, where the altered base obesity (Coleman and Eicher 1990). The mutation arose in the is underlined. The forward primer (CpeF) was selected by Oligo HRS mouse strain and was transferred to C57BLKS for compari- 5.0 to optimize amplification of the target sequence. The sequence son with two other obesity mutations, diabetes (db) and obese (ob), of primer CpeF is 58 CAGCTTGCCCCCGAGACCAAGG 38. which also cause overt diabetes mellitus on the C57BLKS back- The DNA predicted to be amplified by primers CpeF and CpeR ground (Coleman and Eicher 1990; Naggert et al. 1995). is 90 base pairs long. Mutant DNA is predicted to cut with MspI fat fat C57BLKS-Cpe /Cpe mutants differ from C57BLKS-db/db and to generate 64 and 26 bp fragments, and wild-type DNA is pre- C57BLKS-ob/ob mice in several ways. While db/db and ob/ob dicted to

Journal

Mammalian GenomeSpringer Journals

Published: Oct 1, 1997

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off