An assay for the Cpe fat obesity mutation created with a modified primer

An assay for the Cpe fat obesity mutation created with a modified primer Mammalian Genome 8, 783–784 (1997). © Springer-Verlag New York Inc. 1997 fat An assay for the Cpe obesity mutation created with a modified primer Jerilyn A. Walker, Gary E. Truett Pennington Biomedical Research Center, 6400 Perkins Road, Baton Rouge, Louisiana 70808-4124, USA Received: 17 March 1997 / Accepted: 7 May 1997 fat Cpe is an autosomal recessive mutation that causes adult-onset GTCTCCTCCGTGCAGATTGGCCG38, where the altered base obesity (Coleman and Eicher 1990). The mutation arose in the is underlined. The forward primer (CpeF) was selected by Oligo HRS mouse strain and was transferred to C57BLKS for compari- 5.0 to optimize amplification of the target sequence. The sequence son with two other obesity mutations, diabetes (db) and obese (ob), of primer CpeF is 58 CAGCTTGCCCCCGAGACCAAGG 38. which also cause overt diabetes mellitus on the C57BLKS back- The DNA predicted to be amplified by primers CpeF and CpeR ground (Coleman and Eicher 1990; Naggert et al. 1995). is 90 base pairs long. Mutant DNA is predicted to cut with MspI fat fat C57BLKS-Cpe /Cpe mutants differ from C57BLKS-db/db and to generate 64 and 26 bp fragments, and wild-type DNA is pre- C57BLKS-ob/ob mice in several ways. While db/db and ob/ob dicted to Mammalian Genome Springer Journals

An assay for the Cpe fat obesity mutation created with a modified primer

Loading next page...
Copyright © 1997 by Springer-Verlag New York Inc.
Life Sciences; Cell Biology; Animal Genetics and Genomics; Human Genetics
Publisher site
See Article on Publisher Site

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.

DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches


Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.



billed annually
Start Free Trial

14-day Free Trial