Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

β-Adrenergic signaling, monoamine oxidase A and antioxidant defence in the myocardium of SHR and SHR-mtBN conplastic rat strains: the effect of chronic hypoxia

β-Adrenergic signaling, monoamine oxidase A and antioxidant defence in the myocardium of SHR and... J Physiol Sci (2018) 68:441–454 https://doi.org/10.1007/s12576-017-0546-8 OR IGINAL PAPER b-Adrenergic signaling, monoamine oxidase A and antioxidant defence in the myocardium of SHR and SHR-mtBN conplastic rat strains: the effect of chronic hypoxia 1 1 2 2 • • • • Klara Hahnova Iveta Brabcova Jan Neckar Romana Weissova 2 1 1 3 • • • • Anna Svatonova Olga Novakova Jitka Zurmanova Martin Kalous 2 2 2 1 • • • Jan Silhavy Michal Pravenec Frantisek Kolar Jiri Novotny Received: 8 February 2017 / Accepted: 23 May 2017 / Published online: 31 May 2017 The Physiological Society of Japan and Springer Japan 2017 Abstract The b-adrenergic signaling pathways and was markedly elevated in both strains after exposure to antioxidant defence mechanisms play important roles in hypoxia. In addition to that, CNH markedly enhanced the maintaining proper heart function. Here, we examined the expression of catalase and aldehyde dehydrogenase-2 in effect of chronic normobaric hypoxia (CNH, 10% O , both strains, and decreased the expression of Cu/Zn 3 weeks) on myocardial b-adrenergic signaling and selec- superoxide dismutase in SHR. Adaptation to CNH inten- ted components of the antioxidant system in spontaneously sified oxidative stress to a similar extent in both strains and hypertensive rats (SHR) and in a conplastic SHR-mtBN elevated the IL-10/TNF-a ratio in SHR-mtBN only. These strain characterized by the selective replacement of the data indicate that alterations in the mitochondrial genome mitochondrial genome of SHR with that of the more can result in peculiar changes in myocardial b-adrenergic ischemia–resistant Brown Norway strain. Our investiga- signaling, MAO-A activity and antioxidant defence and tions revealed some intriguing differences between the two may, thus, affect the adaptive responses to hypoxia. strains at the level of b-adrenergic receptors (b-ARs), activity of adenylyl cyclase (AC) and monoamine oxidase Keywords SHR  Mitochondrial genome  Myocardium A (MAO-A), as well as distinct changes after CNH expo- b-adrenergic receptors  Adenylyl cyclase  Monoamine sure. The b -AR/b -AR ratio was significantly higher in oxidase A  Antioxidant defence  Chronic hypoxia 2 1 SHR-mtBN than in SHR, apparently due to increased expression of b -ARs. Adaptation to hypoxia elevated b - 2 2 ARs in SHR and decreased the total number of b-ARs in Introduction SHR-mtBN. In parallel, the ability of isoprenaline to stimulate AC activity was found to be higher in SHR- The spontaneously hypertensive rat (SHR) is one of the mtBN than that in SHR. Interestingly, the activity of MAO- most commonly used animal models in cardiovascular A was notably lower in SHR-mtBN than in SHR, and it research. This strain, which harbors a deletion variant of the Cd36 gene, is predisposed to the development of hypertension and cardiac hypertrophy in adulthood [1]. The Electronic supplementary material The online version of this hearts of SHR exhibit higher vulnerability to ischemia/ article (doi:10.1007/s12576-017-0546-8) contains supplementary reperfusion (I/R) injury and susceptibility to ventricular material, which is available to authorized users. arrhythmias when compared to normotensive rats [2–4]. & Jiri Novotny Interestingly, despite their reduced ischemic tolerance, [email protected] ischemic preconditioning was found to provide beneficial antiarrhythmic effects in these animals [5]. We have pre- Department of Physiology, Faculty of Science, Charles University, Prague, Czech Republic viously documented that transgenic rescue of defective Cd36 in SHR rat leads to smaller infarct size induced by Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic coronary artery occlusion [6]. In addition, transgenic SHR- Cd36 rats were shown to express a higher number of Department of Cell Biology, Faculty of Science, Charles myocardial b-adrenergic receptors (b-ARs) and displayed University, Prague, Czech Republic 123 442 J Physiol Sci (2018) 68:441–454 increased adenylyl cyclase (AC) activity [7]. These data cardiac ischemic resistance in both strains, the infarct size- imply that transgenic expression of an apparently unrelated limiting effect was stronger in SHR-mtBN than in SHR, and gene may strongly affect b-adrenergic signaling and correlated with reduced sensitivity of mitochondrial per- 2? myocardial resistance to IR injury. meability transition to Ca -induced opening [28]. b-ARs and their signaling machinery are known to play To further define the potential role of mitochondrial a key role in regulating myocardial function [8]. There are genome in the modulation of cardiac function and resis- numerous indications that b-AR-mediated signaling may tance to I/R injury, here we focused on exploring b-AR- also participate in the development of preconditioning-in- mediated signaling and selected components of the duced ischemic tolerance [9–11]. Adaptation to chronic antioxidant defence system in LV preparations from SHR hypoxia, which may provide potent cardioprotection, can and SHR-mtBN. We monitored the levels of selected sig- also be associated with changes in cardiac b-ARs and AC naling molecules, antioxidant enzymes and markers of signaling. Down-regulation of b-ARs and desensitization oxidative stress and inflammation in samples obtained from of AC were occasionally observed in hearts from hypoxia- both normoxic and hypoxia-adapted animals. In addition, adapted animals [12–16]. It is well known that hypoxia we also determined the expression and activity of mono- promotes the activity of the sympathetic adrenergic system amine oxidase A (MAO-A). MAO-A belongs among the [17] and that stimulation of b-ARs may enhance mito- main ROS producers in cardiac cells [29], but as yet there chondrial reactive oxygen species (ROS) generation in is a lack of information about behavior of this mitochon- cardiomyocytes [18]. b-AR activation seems to play an drial enzyme in the chronically hypoxic heart. Interest- essential role in the development of powerful myocardial ingly, replacement of the mitochondrial genome resulted in ischemic resistance conferred by chronic hypoxic exposure distinct changes in myocardial b-ARs and MAO-A, as well [19]. However, the adaptive changes induced by different as in some components of the antioxidant system under conditioning regimens or hypoxia are not limited just to b- both normal and hypoxic conditions. ARs or other membrane-bound receptors and their signal- ing systems, but they are also tightly linked to changes in ROS production and their detoxification. Materials and methods ROS, among other factors, are well-known mediators of the beneficial effects of hypoxic conditioning [20]. Whereas Materials the appropriate rise in ROS is important for achieving suit- able protective outcomes of hypoxic adaptation [21, 22], [ H]CGP-12177 was purchased from PerkinElmer, Inc. high levels of ROS can cause excessive oxidative stress in (Boston, MA, USA), [ H]cAMP was from American cardiomyocytes. In this respect, mitochondria have drawn a Radiolabeled Chemicals, Inc. (St. Louis, MO, USA), great deal of attention as a major site of ROS production and [a- P]ATP was from Hartmann Analytic, GmbH (Braun- control of redox-sensitive transcription factors. At the same schweig, Germany) and EcoLite liquid scintillation cock- time, these organelles are also the major targets of the tail was from MP Biomedicals (Santa Ana, CA, USA). detrimental effects of ROS overproduction [23]. Interest- Acrylamide and bis-acrylamide were from SERVA (Hei- ingly, the functional properties and vulnerability of mito- delberg, Germany), aluminum oxide 90 (neutral, activity I) chondria to oxidative stress may vary somewhat between was from Merck (Darmstadt, Germany) and cOmplete different tissues and species [24, 25]. On the other hand, protease inhibitor cocktail was from Roche Life Science increasing evidence indicates that mitochondrial DNA (Indianapolis, IN, USA). Anti-MAO-A and anti-ALDH-2 (mtDNA) is essential for the cell phenotype and, thus, may antibodies were obtained from Santa Cruz Biotechnology contribute to stress and environmental adaptability [26]. It is (Santa Cruz, CA, USA), anti-catalase antibody was from known that mtDNA modulates cellular bioenergetics and Abcam (Cambridge, UK) and anti-Cu/ZnSOD and anti- mitochondrial ROS generation and mtDNA sequence vari- MnSOD antibodies were from Cayman Chemical Com- ation may, thus, contribute to disease susceptibility [27]. The pany (Ann Arbor, MI, USA). SuperSignal West Dura role of mtDNA in modulating physiological plasticity and chemiluminescent substrate was from Pierce Biotechnol- stress responses at the cellular, tissue and whole organism ogy (Rockford, IL, USA). All other chemicals were pur- level can be investigated using mitochondrial replacement chased from Sigma–Aldrich (St. Louis, MO, USA). technology. We have shown recently that the conplastic SHR-mtBN strain characterized by the selective replace- Animal model ment of the mitochondrial genome with that of the more ischemia–resistant Brown Norway strain exhibited the same The SHR-mtBN conplastic strain harboring the mitochon- myocardial infarct size caused by I/R insult as the progenitor drial genome of a highly inbred strain BN on the nuclear SHR. Although adaptation to chronic hypoxia improved genetic background of SHR was created by selective 123 J Physiol Sci (2018) 68:441–454 443 replacement of a mitochondrial genome of SHR with the Center, Inc.). One microgram of total RNA was loaded to mitochondrial genome of BN rats as described earlier [28]. reverse transcription using RevertAidTM H Minus First Adult male SHR and SHR-mtBN rats (280–300 g body wt) Strand cDNA Synthesis Kit (Thermo Fisher Scientific, were exposed to continuous normobaric hypoxia (CNH; Waltham, MA, USA) with oligo(dT) primers according to inspired O fraction 0.1) in a normobaric chamber (6 m ) the manufacturer’s instructions. Real Time PCR analyses equipped with hypoxic generators (Everest Summit, were, performed on Light Cycler LC 480 (Roche Applied Hypoxico Inc., NY, USA) for 3 weeks. No reoxygenation Science, Branford, CT, USA) using Syber green Master occurred during this period. Animals were used immedi- Mix (Eurogentec SA, Seraing, Belgium). Gene-specific ately after the cessation of hypoxic exposure. The control primers were designed to be compatible with the Roche rats were kept for the same period of time at room air. All Universal Probe Library (UPL) and are listed in Table 1. animals were housed in a controled environment The relative levels of analyzed gene transcripts were cal- (22 ± 2 C; 12:12 h light–dark cycle; light from 5:00 a.m. culated according to Pfaffl [31] using the 18S rRNA gene with free access to water and standard chow diet. The study as a suitable reference gene (18S_F: tctagacaacaagct- was conducted in accordance with the Guide for the Care gcgtga; 18S_R: cctctatgggctcggatttt). This reference gene and Use of Laboratory Animals (published by the National was selected from six candidates using GenEx software Academy of Science, National Academy Press, Washing- (MultiD Analyses AB, Goteborg, Sweden). ton, DC). Experimental protocols were approved by the Animal Care and Use Committee of the Institute of Phys- b-Adrenergic receptor binding iology, Czech Academy of Sciences. Myocardial b-ARs were determined by radioligand binding Processing of heart tissue for biochemical analyses assay with a nonselective b-adrenergic antagonist [ H]CGP 12177 as described previously [32]. Samples of crude Immediately after sacrifice, the hearts were rapidly excised, membranes (100 lg protein) were incubated in incubation washed in ice-cold saline solution and the left ventricles buffer (50 mM Tris, 10 mM MgCl and 1 mM ascorbic (LV) were dissected from the right ventricles and the acid; pH 7.4) containing increasing concentrations of septum. The pieces of frozen tissue were either pulverized [ H]CGP 12177 (0.06–4 nM) for 1 h at 37 C in a total in liquid nitrogen and subsequently homogenized in volume of 0.5 ml; at this time the specific binding of RNAzol RT (Molecular Research Center, Inc.) for iso- radioligand had reached an equilibrium. The binding lation of mRNA or homogenized in TMES buffer (20 mM reaction was terminated by addition of 3 ml of ice-cold Tris, 3 mM MgCl , 1 mM EDTA, 250 mM sucrose; pH washing buffer (50 mM Tris, 10 mM MgCl ; pH 7.4) and 2 2 7.4) supplemented with protease inhibitors for radioligand subsequent filtration through Whatman GF/C filters, which binding assay, Western blotting, enzyme activity determi- nation or other biochemical analyses. In the latter case, the Table 1 PCR primers for the real time PCR ventricles were homogenized on ice by Ultra-Turrax blender for 30 s and subsequently by Potter–Elvehjem Gene Forward primer Reverse primer glass-Teflon homogenizer for 1 min. The homogenates AC5 gggagaaccagcaacagg catctccatggcaacatgac were clarified by centrifugation at 6009g for 10 min AC6 atgagatcatcgcggacttt gccatgtaagtgctaccgatg (4 C) in order to remove nuclei and particulate cellular ACO1 ttgctgtgtctgagattgaaaag cttgaaaacctttaaatccttgct debris. The resulting postnuclear supernatant was cen- ACO2 cgccttacagcctactggtc ggcagaggccacatggta trifuged at 50,0009g for 30 min (4 C) to separate the ALDH2 agacgtcaaagatggcatga ttgaggatctgcatcactgg membrane and cytosolic fractions. The pellet containing CAT cagcgaccagatgaagca ggtcaggacatcgggtttc crude membranes was resuspended in TME buffer (20 mM CuZnSOD taagaaacatggcggtcca tggacacattggccacac Tris, 3 mM MgCl and 1 mM EDTA; pH 7.4). Both GSTO1 aagcttgccagaagatgacc ctcttcgccctaataaaactcg membrane and cytosolic fractions were aliquoted and MAOA tggtatcatgacccagtatgga tgtgcctgcaaagtaaatcct stored at -80 C until use. MnSOD tggacaaacctgagccctaa gacccaaagtcacgcttgata NRF1 atagtcctgtctggggaaacc tccatgcatgaactccatct Real time RT-PCR NRF2 agcatgatggacttggaattg cctccaaaggatgtcaatcaa RNA isolation and real time RT-PCR were performed as PRX3 agaagaacctgcttgacagaca caggggtgtggaatgaaga described previously [30] with a slight modification as PRX5 gactatggccccgatcaa aaaacacctttcttgtccttgaa follows. Briefly, tissue homogenization and total RNA TXN2 cacacagaccttgccattga acgtccccgttcttgatg isolation was performed according manufacturer’s TXNRD2 gcacatggtgaagctacctaga gctccatccacatcttctcag instruction using RNAzol Reagent (Molecular Research 123 444 J Physiol Sci (2018) 68:441–454 were presoaked with 0.3% polyethyleneimine for 1 h. The were added to each reaction mixture as substrate and filters were then washed twice with ice-cold washing buffer incubation was continued for another 30 min at 37 C. The and placed into scintillation vials. After addition of 4 ml reaction was terminated by addition of 200 llof5 M EcoLite scintillation cocktail, radioactivity retained on the perchloric acid. Samples were centrifuged at 15009g for filters was measured by counting for 5 min. Nonspecific 10 min and 500 ll aliquots of supernatant were transferred binding was assessed by incubating the samples with into test tubes containing 2.5 ml of 1 M NaOH. The fluo- radioligand in the presence of 10 lM L-propranolol, and it rescence of the reaction product 4-quinolinol was measured represented less than 30% of the total binding. For com- at Ex 310-nm/Em 380-nm using a Biotek Synergy HT plate petition experiments, samples of crude membranes were reader. A standard curve of 4-quinolinol (in the range of incubated with 1 nM [ H]CGP 12177 and increasing con- 0.03–0.5 mM) was used to calculate MAO-A enzyme centrations of the selective b -AR antagonist ICI 118.551 activity. -4 -10 (10 –10 M). The characteristics of b-adrenergic binding sites and the proportions of b - and b -ARs in Electrophoresis and Western blotting 1 2 myocardial crude membranes were calculated using GraphPad Prism 6 software (GraphPad Software, La Jolla, Individual samples of myocardial preparations were solu- CA, USA). bilized in Laemmli buffer and loaded (10–30 lg per lane) on 10 or 15% acrylamide gels for SDS-PAGE as described Assessment of adenylyl cyclase activity previously [35]. After electrophoresis, the resolved proteins were transferred to nitrocellulose membranes (GE Health- Activity of AC was determined by measuring the conver- care Life Sciences, Buckinghamshire, UK), blocked with 32 32 sion of [a- P]ATP to [ P]cAMP as described previously 5% non-fat dry milk in TBS buffer (10 mM Tris, 150 mM [33]. Samples of crude myocardial membranes (20 lg NaCl; pH 8.0) for 1 h and then incubated for 1.5 h at room protein) were incubated in the reaction mixture (in a total temperature or overnight at 4 C with relevant primary volume 100 ll) containing 48 mM Tris buffer (pH 8), antibodies. After three 10-min washes in TBS containing 2 mM MgCl ,20 lM GTP, 0.8 mg/ml BSA, 40 lM 0.3% Tween 20, the membranes were incubated with sec- 3-isobutyl-1-methylxanthine, 5 mM potassium phospho- ondary antibody conjugated to horseradish peroxidase for enolpyruvate, 3.2 U of pyruvate kinase, 100 mM NaCl, 1 h at room temperature. Immunoreactive proteins on the 0.1 mM cAMP and about 15,000 cpm [ H]cAMP as a blots were visualized by enhanced chemiluminiscence tracer. For stimulation of AC, the following stimulators technique according to the manufacturer’s instructions were used in separate experiments: 10 lM isoprenaline, (Pierce Biotechnology, Rockford, IL, USA) and quantita- 10 lM forskolin, 10 mM MnCl and 10 mM NaF. After tively analyzed by ImageQuant software (Molecular 1 min preincubation, 0.4 mM ATP was added along with Dynamics, Sunnyvale, CA, USA). To correct for errors 2,000,000 cpm [a- P]ATP and incubation proceeded for associated with sample loading and gel transfer, b-actin 20 min at 30 C. The reaction was terminated by addition was used as a housekeeping protein for reliable quantifi- of 200 ll 0.5 M HCl and heating for 5 min at 100 C. cation of Western blot data. Samples were neutralized by 200 ll 1.5 M imidazole. Separation of cAMP produced by stimulated membrane Determination of malondialdehyde preparations from other nucleotides was performed by fil- tration through alumina columns, and the detected amount Lipid peroxidation was quantified by measuring malondi- of [ P]cAMP in each vial was corrected for recovery with aldehyde (MDA) formation. Myocardial samples (100 mg) [ H]cAMP as the internal standard. were pulverized to a fine powder and dissolved in 500 llof ice-cold buffer (25 mM Tris and 0.10% Triton X 100; pH). Assessment of monoamine oxidase A activity The homogenates were sonicated, centrifuged (10009g, 10 min, 4 C) and 100 ll samples of supernatant were MAO-A activity in the LV was determined using kynu- taken and analyzed as described by Pilz et al. [36] with a ramine dihydrobromide as substrate in the presence of slight modification. Briefly, 20 ll of 6 M NaOH was added deprenyl (inhibitor MAO-B) as described previously [34] to each sample, vortexed and incubated for 30 min at with a slight modification. Myocardial crude membranes 60 C. The solution was then cooled on ice and 50 llof (100 lg protein) were lysed by treatment with 2% Triton 35% perchloric acid was added. After centrifugation X-100. Resulting lysate samples (200 ll) were mixed with (10,0009g, 5 min, 4 C), 100 ll of supernatant was taken 0.2 ll of 1 mM deprenyl and 2.5 ml of 50 mM phosphate and derivatization was performed using 10 llof buffer (pH 7.4) and incubated for 60 min at 37 C. After 5 mM 2,4-dinitrophenylhydrazine. After 10 min in the incubation, 30 ll of 2.19 mM kynuramine dihydrobromide dark, the solution was analyzed using a HPLC system 123 J Physiol Sci (2018) 68:441–454 445 (Shimadzu, Kyoto, Japan) with UV detection at 310 nm were conducted to assess the distribution of b-AR subtypes (column: EC Nucleosil 100-5 C18, 4.6 mm 9 125 mm in LV preparations (Fig. 1b). As indicated in Table 3, the heated to 30 C; mobile phase: acetonitrile–water–acetic proportion of b -ARs was significantly increased (by 37%) acid 380:620:2 (v/v/v); flow rate: 1.0 ml/min). MDA con- in SHR-mtBN, compared to SHR. Exposure to hypoxia centration was normalized to total protein content. increased the proportion of b -AR in SHR/H by 30% but did not affect the relative proportion of b-AR subtypes in Determination of TNF-a, IL-6 and IL-10 SHR-mtBN/H. Levels of TNF-a (tumor necrosis factor-a), IL-6 (inter- Adenylyl cyclase leukin-6) and IL-10 (interleukin-10) in myocardial homo- genates from different experimental groups were measured Activity of AC in myocardial membrane preparations was using DuoSet ELISA kits (eBioscience, Vienna, Austria) determined by measuring cAMP production under different according to the standard protocols described by the experimental conditions. Besides determining basal AC manufacturer. The content of cytokines is given in pico- activity, the enzyme activity was modulated by the fol- grams per milligram of total protein [37]. lowing stimulatory agents: isoprenaline, forskolin, MnCl and NaF. Isoprenaline is a b-AR agonist, forskolin or Data analysis MnCl can stimulate the AC catalytic subunit directly and NaF elicits the enzymatic response through activation of Biochemical data were determined in at least three inde- the stimulatory G proteins [38]. Results of experiments in pendent preparations. All results were expressed as the which AC activity was tested under different conditions are mean ± SEM. The Kolmogorov–Smirnov test was used to assess the normality and all parameters were distributed normally. One-way analysis of variance (ANOVA) and subsequent Student–Newman–Keuls tests were used for comparison of differences in normally distributed variables between the groups. Differences between appropriate groups were considered to be statistically significant when the p value was smaller than 0.05 (p \ 0.05). Results All measurements were done on LV myocardial prepara- tions obtained from normoxic rats (SHR and SHR-mtBN) as well as from those exposed to continuous normobaric hypoxia (CNH) for 3 weeks (SHR/H and SHR-mtBN/H). b-Adrenergic receptors The total number of b-ARs and dissociation constants of these receptors in myocardial membrane preparations from LVs were determined by using saturation binding experi- ments (Fig. 1a). We found that the total number of b-ARs, expressed as B , tended to be higher (by about 15%) in max SHR-mtBN than SHR, but this difference was not statis- tically significant. The values of B were also affected by max adaptation of rats to hypoxia. Whereas CNH induced a Fig. 1 Effect of hypoxia on myocardial b-adrenergic receptors. b- significant increase (by 16%) in the total number of b-ARs ARs in LV preparations from SHR (closed triangles), SHR/H (open in SHR/H, the expression of these receptors was markedly squares), SHR-mtBN (closed diamonds) and SHR-mtBN/H (open circles) were characterized by radioligand binding experiments. diminished (by 26%) in SHR-mtBN/H (Table 2). Dissoci- Shown are [ H]CGP 12177 saturation binding curves (a) and ation constants (K ) did not differ significantly between the competitive binding curves (b) which were constructed using the strains and their values were not affected by adaptation to b -AR antagonist ICI 188.551. Data represent means (±SEM) of hypoxia. Subsequently, competition binding experiments three separate experiments performed in triplicate 123 446 J Physiol Sci (2018) 68:441–454 Table 2 Binding SHR SHR/H SHR-mtBN SHR-mtBN/H characteristics of b-ARs -1 ? §# B (fmol mg ) 21.71 ± 0.88 25.20 ± 0.38 24.87 ± 0.73 18.37 ± 0.46 max K (nM) 0.49 ± 0.10 0.58 ± 0.07 0.51 ± 0.03 0.32 ± 0.01 Data are means (±SEM) of three separate experiments performed in triplicates B maximal binding capacity, K equilibrium dissociation constant of radioligand ([ H]CGP 12177) max D ? § # p \ 0.05 SHR vs. SHR/H; p \ 0.05 SHR/H vs. SHR-mtBN/H rats; p \ 0.05 SHR-mtBN vs. SHR- mtBN/H Table 3 Distribution and SHR SHR/H SHR-mtBN SHR-mtBN/H properties of b-AR subtypes ? * b (%) 24.03 ± 0.30 31.12 ± 1.42 32.97 ± 2.01 31.15 ± 0.42 K b (nM) 0.80 ± 0.53 1.43 ± 0.17 4.80 ± 1.25 0.75 ± 0.21 i 2 K b (lM) 0.73 ± 0.06 0.77 ± 0.25 0.70 ± 0.07 0.31 ± 0.03 i 1 Data are means (±SEM) of three separate experiments performed in triplicates b (%) percentage of b -ARs of total myocardial b-ARs, K b (b ) apparent dissociation constant repre- 2 2 i 2 1 senting the affinity of ICI 118.551 to b -ARs (b -ARs) 2 1 * p \ 0.05 SHR vs. SHR-mtBN; p \ 0.05 SHR vs. SHR/H summarized in Fig. 2. Basal AC activity did not signifi- cantly differ between both strains or even after adaptation to hypoxia, but the enzyme activity was diversely influ- enced by different stimulators. Whereas there was no sig- nificant difference between SHR and SHR-mtBN in AC activity stimulated by forskolin or MnCl , the enzyme activity stimulated by isoprenaline and NaF was markedly increased in SHR-mtBN (by about 35%). Adaptation of rats to hypoxia also led to specific changes in variably stimulated AC activity. Whereas CNH increased AC activity stimulated by forskolin or NaF by about 30% in preparations from SHR, there was no change in forskolin- Fig. 2 Effect of hypoxia on activity of myocardial adenylyl cyclase. stimulated AC activity and decrease (by 17%) in NaF- AC activity in LV preparations from SHR (empty bars), SHR/H stimulated AC activity in hypoxia-adapted SHR-mtBN/H, (closed bars), SHR-mtBN (dotted bars) and SHR-mtBN/H (hatched compared to the corresponding normoxic controls. The bars) was determined in the presence of the following stimulators: 10 lM isoprenaline (ISO), 10 lM forskolin (FSK), 10 mM MnCl stimulatory effects on AC activity of forskolin and NaF and 10 mM NaF. Differently stimulated AC activity is expressed as a were lower by 10 and 14%, respectively, in SHR-mtBN/H percentage of the corresponding basal AC activity, which did not than in SHR/H. Hypoxia did not significantly affect the significantly differ between different samples and was in the range of ability of isoprenaline to stimulate AC activity in SHR but 7.9–9.2 pmol cAMP/min per mg protein in all measurements. Data represent means (±SEM) of five independent measurements per- decreased its stimulatory effect by 13% in SHR-mtBN. formed in triplicate. *p \ 0.05 SHR vs. SHR-mtBN rats; p \ 0.05 Interestingly, determination of transcript levels of the SHR vs. SHR/H rats; p \ 0.05 SHR/H vs. SHR-mtBN/H rats; dominant myocardial isoforms of AC (AC5 and AC6) # p \ 0.05 SHR-mtBN vs. SHR-mtBN/H rats revealed a decrease (by about 35%) in mRNA levels of both these isoforms in SHR-mtBN adapted to hypoxia mtBN than in SHR (Fig. 3a). Adaptation to hypoxia (Suppl. Fig. S1). resulted in marked increase of MAO-A mRNA in both strains (by 97 and 132% in SHR and SHR-mtBN, respec- Monoamine oxidase A tively). The same trend was detected at the protein level and in the enzyme activity of MAO-A. The expression of Gene expression and enzyme activity of MAO-A were MAO-A protein was lower by 28% in SHR-mtBN than in assessed in myocardial preparations from both normoxic SHR, and CNH elevated the amount of MAO-A protein by and hypoxia-exposed SHR and SHR-mtBN. The mRNA 66 and 92% in SHR and SHR-mtBN, respectively level of MAO-A was significantly lower (by 30%) in SHR- (Fig. 3b). The enzyme activity of MAO-A in SHR-mtBN 123 J Physiol Sci (2018) 68:441–454 447 was lower by 21% than in SHR, and CNH increased the A similar downward trend was also observed in the enzyme activity by 33 and 22% in SHR and SHR-mtBN, expression of myocardial glutathione S-transferase x1 respectively (Fig. 3c). (GTSO1), thioredoxin 2 (TXN2) and thioredoxin reduc- tase 2 (TXNRD2) and peroxiredoxin 5 (PRX5) after Antioxidant defence enzymes adaptation to hypoxia (Suppl. Fig. S2a–c). The mRNA levels of these enzymes dropped by 19% (GSTO1 and In the next set of experiments, we tested whether TXN2), 18% (TXNRD2) and 16% (PRX5) in SHR/H and adaptation to hypoxia affects expression of selected by 32% (TXN2), 27% (TXNRD2) and 25% (PRX5) in antioxidant defence enzymes in the LV of both rat SHR-mtBN/H. Although hypoxia exposure did not mark- strains. CNH did not change the mRNA level of catalase edly affect comparable levels of PRX3 mRNA in both rat (CAT) in SHR, but markedly increased (by 51%) the strains, the amount of this transcript was higher (by 48%) amount of this transcript in SHR-mtBN (Fig. 4, panel a). in SHR-mtBN/H than in SHR/H (Suppl. Fig. S2c). The The expression of CAT protein was increased by 105 mRNA levels of ACO1 and ACO2 remained without sig- and 68% in hypoxia-exposed SHR/H and SHR-mtBN/H, nificant changes (Suppl. Fig. S2d). In addition, we detected respectively (Fig. 4, panel b). Adaptation to hypoxia increased expression (by 31%) of nuclear respiratory factor elevated the level of aldehyde dehydrogenase 2 (ALDH- 1 (NRF1) mRNA in SHR-mtBN/H and no change in the 2) mRNA in both strains by about 40–50% (Fig. 4, panel mRNA level of nuclear factor (erythroid-derived 2)-like 2 a). The expression of ALDH-2 protein was increased by (NFE2L2, NRF2) (Suppl. Fig. S2e). 25 and 32% in SHR/H and SHR-mtBN/H, respectively, when compared to corresponding normoxic controls Markers of lipid peroxidation and inflammation (Fig. 4, panel b). In contrast to CAT and ALDH-2, mRNA and protein levels of superoxide dismutases Malondialdehyde (MDA) was determined as a marker of (SODs) were decreased (Cu/ZnSOD) or remained oxidative stress-induced lipid peroxidation. Myocardial unchanged (MnSOD) after adaptation to hypoxia (Fig. 5). preparations from both rat strains kept under normoxic The mRNA level of cytosolic Cu/ZnSOD was reduced conditions did not exhibit any differences between MDA by 12 and 16% in SHR/H and SHR-mtBN/H, respec- levels. Adaptation to hypoxia increased the MDA con- tively, but the expression of Cu/ZnSOD protein was centration by 104 and 52% in SHR/H and SHR-mtBN/H, significantly changed (a drop by 31%) just in SHR/H. respectively (Fig. 6a). Levels of anti-inflammatory Fig. 3 Effect of hypoxia on myocardial monoamine oxidase. Expres- shown below the corresponding bar graphs depicting the relative sion levels of mRNA and protein of MAO-A in LV preparations from protein expression levels (b). Specific enzyme activity of MAO-A SHR and SHR-mtBN rats kept in normoxic (empty bars) and hypoxic (c) was determined spectrophotometrically by using kynuramine as (hatched bars) conditions were assessed by RT-PCR and Western substrate. Data represent means (±SEM) of at least three separate * ? blotting, respectively. The amounts of specific mRNA species were experiments. p \ 0.05 SHR vs. SHR-mtBN rats; p \ 0.05 SHR vs. § # normalized with 18S levels (a). The 18S levels were not significantly SHR/H rats; p \ 0.05 SHR/H vs. SHR-mtBN/H rats; p \ 0.05 affected by hypoxic exposure. Representative Western blots are SHR-mtBN vs. SHR-mtBN/H rats 123 448 J Physiol Sci (2018) 68:441–454 Fig. 4 Effect of hypoxia on myocardial catalase and aldehyde a). The 18S levels were not significantly affected by hypoxic dehydrogenase-2. Expression levels of mRNA and protein of CAT exposure. Representative Western blots are shown below the corre- and ALDH-2 in LV preparations from SHR and SHR-mtBN rats kept sponding bar graphs depicting the relative protein expression levels in normoxic (empty bars) and hypoxic (hatched bars) conditions were (column b). Data represent means (±SEM) of at least three separate ? § assessed by RT-PCR and Western blotting, respectively. The amounts experiments. p \ 0.05 SHR vs. SHR/H rats; p \ 0.05 SHR/H vs. of specific mRNA species were normalized with 18S levels (column SHR-mtBN/H rats; p \ 0.05 SHR-mtBN vs. SHR-mtBN/H rats interleukin-10 (IL-10) and pro-inflammatory tumor necro- conditions. The experiments were conducted in parallel on sis factor-a (TNF-a) and interleukin-6 (IL-6) tended to be SHR and SHR-mtBN, i.e., the SHR-based conplastic strain lower in SHR-mtBN than in SHR, and these levels tended carrying the mitochondrial genome from Brown Norway to increase in both strains after hypoxic exposure (Suppl. rats [28]. Our investigation revealed a number of distinct Fig. 3). CNH did not significantly change the IL-10/TNF-a changes at the level of b-ARs, AC and MAO-A, as well as ratio in SHR/H and increased this ratio (by 17%) in SHR- in some components of the antioxidant defence system. mtBN/H (Fig. 6b). We observed that the proportion of myocardial b -ARs was significantly higher in SHR-mtBN than in SHR and that adaptation to hypoxia diversely affected the distribu- Discussion tion of b-ARs in both rat strains. Whereas CNH elevated b- AR density in SHR due to increased expression of b -AR, In the present study, we sought to explore the impact of the total number of b-ARs in SHR-mtBN declined without mitochondria replacement on myocardial b-adrenergic a change in the proportion of b-AR subtypes. The higher b- signaling and antioxidant defence in the spontaneously AR density in SHR-mtBN was reflected by increased hypertensive rat (SHR) under normoxic and hypoxic ability of isoprenaline to stimulate AC activity. However, 123 J Physiol Sci (2018) 68:441–454 449 Fig. 5 Effect of hypoxia on myocardial cytosolic copper/zinc a). The 18S levels were not significantly affected by hypoxic superoxide dismutase and mitochondrial manganese superoxide exposure. Representative Western blots are shown below the corre- dismutase. Expression levels of mRNA and protein of Cu/ZnSOD sponding bar graphs depicting the relative protein expression levels and MnSOD in LV preparations from SHR and SHR-mtBN rats kept (column b). Data represent means (±SEM) of at least five separate ? # in normoxic (empty bars) and hypoxic (hatched bars) conditions were experiments. p \ 0.05 SHR vs. SHR/H rats; p \ 0.05 SHR-mtBN assessed by RT-PCR and Western blotting, respectively. The amounts vs. SHR-mtBN/H rats of specific mRNA species were normalized with 18S levels (column isoprenaline-stimulated AC activity was reduced in enhanced AC activity much more strongly than isopre- preparations from SHR-mtBN exposed to hypoxia, which naline, which is a well-known and commonly reported is in line with the lower expression of b-ARs and AC phenomenon [14]. The observed decline in the number b- determined in these animals. The enzyme activity stimu- ARs in SHR-mtBN after CNH exposure is consistent with lated by forskolin and NaF (the agents capable of stimu- previous findings of lower b-AR expression in rat heart lating AC both directly and through G proteins or only following hypoxia [12, 13, 15]. As a rule, b-AR subtypes through G proteins, respectively) was enhanced in SHR were not discerned in these studies. The only exception is a after their exposure to CNH. Interestingly, no such eleva- study of Mardon et al. [14], which demonstrated a selective tion was found in CNH-adapted SHR-mtBN. By contrast, decrease in b -ARs caused by 5-day hypoxia. These NaF-stimulated AC activity in these rats was already investigators, like others [15, 16], found reduced AC increased under normoxic conditions, and it was dimin- activity in myocardial preparations from hypoxia-exposed ished after exposure to CNH. These strain-specific differ- rats. The reduction in NaF-stimulated AC activity observed ences may presumably be explained by altered ability of G in CNH-exposed SHR-mtBN, thus, conforms well to the proteins to regulate AC activity. Both forskolin and NaF previously published data. On the other hand, the CNH- 123 450 J Physiol Sci (2018) 68:441–454 shown to potentiate the IPC-induced post-ischemic func- tional recovery of a rat heart [43]. In the present study, we found that the expression and activity of MAO-A (the predominant cardiac isoform) was lower in SHR-mtBN than in SHR and that CNH exposure increased similarly the expression and activity of this enzyme in both strains. Nevertheless, MAO-A activity remained still significantly lower in SHR-mtBN under these conditions, which can be considered as a strain-specific feature. The observed ele- vation of myocardial MAO-A after hypoxic exposure may suggest the importance of MAO-A in adaptive responses to chronic hypoxia. It should be mentioned here that our finding of a relatively large increase in MAO-A activity after CNH is in contrast to the work of Maher et al. [44]. These authors did not find any change in MAO activity in a goat heart exposed to chronic hypoxia. However, this dis- crepancy can be explained by using different models and experimental conditions. There are some indications that the possible changes in MAO activity may depend on the duration of hypoxia. Whereas 5-day exposure to hypoxia led to decrease of MAO activity in rat liver, 21-day exposure increased the enzyme activity [45]. The harmful effects of ROS generated from different sources, including mitochondria and MAO activity, are regularly combated by a number of endogenous antioxidant Fig. 6 Effect of hypoxia on myocardial malondialdehyde levels and defence mechanisms. The enzyme antioxidant defence the ratio of interleukin-10/tumor necrosis factor-a. Concentrations of system consists of different types of enzymes with different malondialdehyde (a) and the IL-10/TNF-a ratio (b) were assessed in LV preparations from SHR a SHR-mtBN rats kept in normoxic functions [46]. In the present study, we focused on selected (empty bars) and hypoxic (hatched bars) conditions. Data represent ROS-degrading enzymes (SODs, CAT, PRXs, GSTO1) means (±SEM) of at least five separate experiments. p \ 0.05 SHR and enzymes participating in maintenance of cellular redox vs. SHR/H rats; p \ 0.05 SHR-mtBN vs. SHR-mtBN/H rats homeostasis (TXN2, TXNRD2, ALDH-2, ACO1 and 2). induced increase in the ability of G proteins to stimulate Assessment of expression levels of all these enzymes in myocardial AC activity in SHR has not been previously myocardial preparations from SHR and SHR-mtBN did not noted and may represent a specific feature of this rat strain. reveal any significant differences between both these It is worth mentioning that especially b -AR appears to be 2 strains under normoxic conditions. Moreover, adaptation to important for generating the salutary effects of precondi- hypoxia elicited very similar changes in the levels of most tioning [11, 39]. Accordingly, b -ARs were found to acti- 2 of these enzymes in both progenitor and conplastic SHR vate pro-survival kinases and attenuate mitochondrial strains. CNH appreciably elevated the protein levels of dysfunction during oxidative stress [40]. The increased CAT and ALDH-2, and did not change MnSOD in proportion of b -AR in SHR-mtBN, compared to SHR, and myocardial preparations from both strains. In contrast, reduction in the total number of b-ARs after adaptation to CNH markedly reduced the amount of Cu/ZnSOD protein CNH may, thus, contribute to better protection of this rat in SHR but not in SHR-mtBN. The transcript levels of strain against acute I/R injury [28]. mitochondrial antioxidants TXN2, TXNRD2 and PRX5 It is well known that hypoxic stress is associated with were always significantly lower in CNH-exposed animals increased production and release of catecholamines, and than in corresponding normoxic controls. On the other these compounds may be subjected to oxidative deamina- hand, CNH did not change the mRNA levels of PRX3, tion catalyzed by monoamine oxidases [41]. These ACO1 and ACO2, and decreased GSTO1 in SHR only. enzymes have recently emerged as important mitochon- Interestingly, most changes associated with CNH in the drial sources of oxidative stress in the cardiovascular sys- expression of antioxidant enzymes in SHR and SHR-mtBN tem and MAO inhibition may apparently have a therapeutic markedly differ from those reported in previous studies. In value for treating cardiac affections of ischemic and non- contrast to our current findings, the expression levels of Cu/ ischemic origin [42]. Interestingly, the presence of MAO ZnSOD, MnSOD, TXN2, TXNRD2, PRX5 and ACO2 inhibitors during ischemic preconditioning (IPC) was were found to increase, CAT to decrease and GSTO1 not to 123 J Physiol Sci (2018) 68:441–454 451 Fig. 7 Schematic summarizing the main findings. Replacement of efficient cardioprotection conferred by chronic hypoxia in SHR- the mitochondrial genome of SHR with that of the more ischemia– mtBN, compared to progenitor SHR. The arrows indicate changes resistant Brown Norway strain (mtBN) distinctly affects myocardial relative to SHR or to SHR-mtBN in the case of SHR-mtBN/H. b-ARs, expression of b-ARs and MAO-A. Adaptation to chronic hypoxia is b-adrenergic receptors; b /b , the b -AR/b -AR ratio; MAO-A 1 2 1 2 associated with partially dissimilar changes in b-ARs, MAO-A and monoamine oxidase A, CAT catalase, SOD superoxide dismutase, some components of the antioxidant defence in the myocardium of MDA malondialdehyde, up arrow (double up arrow) and down arrow, SHR and SHR-mtBN. These differences may contribute to more increase (higher increase) and decrease, respectively change after adaptation of Wistar rats to the same cardio- components of the mammalian electron transport chain protective regimen of hypoxia [22]. A significant increase [52, 53]. Moreover, NRF1 has been shown to play a role in in myocardial Cu/ZnSOD and MnSOD was also detected in the mitochondrial DNA replication machinery and other Wistar rats adapted to different hypoxic conditions biosynthetic and degradative pathways [54]. The elevated [47–49]. Hence, the observed discordant changes in NRF1 expression after CNH exposure may promote antioxidant enzymes induced by hypoxic exposure appear mitochondrial biogenesis and, thus, increase cardiac resis- to be strain-specific. The unique downregulation of Cu/ tance to I/R injury of SHR-mtBN/H. ZnSOD and GSTO1 in SHR following hypoxia may partly Chronic hypoxia is usually accompanied by increased ROS explain the lower cardioprotective effect of CNH against formation [55, 56]. Therefore, we decided to assess the extent acute I/R injury in these rats when compared to SHR-mtBN of lipid peroxidation by monitoring MDA content in [28]. The effect of hypoxia on ALDH-2 expression has not myocardial preparations from rats under normoxic and yet been investigated and our finding of increased levels of hypoxic conditions. Interestingly, the MDA concentration ALDH-2 in both rat strains exposed to CNH supports the was markedly increased in both rat strains after CNH expo- notion that this enzyme is highly important for reducing sure, but this increase was much more pronounced in hearts of ischemic heart damage [50] and may follow activation of SHR, which may reflect lower antioxidant capacity of these MAO-A. NRF2 is a transcription factor crucially involved animals when compared to SHR-mtBN. Similar increase in in the regulation of antioxidant enzyme expression, and myocardial MDA concentration was previously found in they can modulate the capacity of the antioxidant system at Wistar rats or mice after exposure to different regimens of the protein level [51]. The observed increase in NRF1 in hypoxia [37, 57–59]. These data indicate that, irrespective of CNH-exposed SHR-mtBN might contribute to upregula- animal model, ROS formation accompanied by increased tion of some nuclear-encoded mitochondrial respiratory lipid peroxidation is a typical sign of chronic hypoxia. genes (such as cytochrome c oxidase (subunit VIc) and It is known that the adaptive response to hypoxia of the reductase, the c subunit of ATP synthase) as NRF1 is one heart tissue can be modulated by inflammatory cytokines of the important transcription factors for structural [60]. In the present study, we found that the amount of the 123 452 J Physiol Sci (2018) 68:441–454 altered glucose metabolism, hyperinsulinemia, and myocardial principal anti-inflammatory (IL-10) and pro-inflammatory hypertrophy. J Biol Chem 276:23661–23666 (TNF-a and IL-6) cytokines tended to be increased under 2. Itter G, Jung W, Juretschke P, Schoelkens BA, Linz W (2004) A hypoxic conditions. In parallel, these animals exhibited a model of chronic heart failure in spontaneous hypertensive rats significant increase in the IL-10/TNF-a ratio. Interestingly, (SHR). Lab Anim 38:138–148 3. Penna C, Pasqua T, Amelio D, Perrelli MG, Angotti C, Tullio F, these results appear rather contradictory with respect to the Mahata SK, Tota B, Pagliaro P, Cerra MC, Angelone T (2014) previously observed decrease in IL-10 and lower IL-10/ Catestatin increases the expression of anti-apoptotic and pro-an- TNF-a ratio in Wistar rats adapted to hypoxia [37]. We giogenetic factors in the post-ischemic hypertrophied heart of think that the disproportionate changes in the content of SHR. PLoS One 9:e102536 4. Ravingerova ´ T, Berna ´tova ´ I, Matejı ´kova ´ J, Ledve ´nyiova ´ V, myocardial cytokines under hypoxic conditions can be Nemc ˇekova ´ M, Pecha ´n ˇ ova ´ O, Tribulova ´ N, Sleza ´k J (2011) ascribed to specific differences between individual rat Impaired cardiac ischemic tolerance in spontaneously hyperten- strains. Moreover, the increased IL-10/TNF-a ratio in sive rats is attenuated by adaptation to chronic and acute stress. SHR-mtBN exposed to CNH can likely contribute to the Exp Clin Cardiol 16:e23–e29 5. Kolar F, Parratt JR (1997) Antiarrhythmic effect of ischemic lesser extent of myocardial damage caused by I/R. preconditioning in hearts of spontaneously hypertensive rats. Exp The main findings obtained in the present study are Clin Cardiol 2:124–128 schematically shown in Fig. 7. Taken together, our results ˇ ˇ 6. Necka ´r ˇ J, Silhavy J, Zı ´dek V, Landa V, Mlejnek P, Sima ´kova ´ M, indicate that the selective replacement of mitochondria of Seidman JG, Seidman C, Kazdova ´ L, Klevstig M, Nova ´kF, Vecka M, Papous ˇek F, Hous ˇte ˇk J, Drahota Z, Kurtz TW, Kola ´r ˇ F, SHR with those of more ischemia–resistant Brown Norway Pravenec M (2012) CD36 overexpression predisposes to strain can modify the functioning of myocardial AC signaling arrhythmias but reduces infarct size in spontaneously hyperten- regulated by b-ARs and G proteins, as well as the expression sive rats: gene expression profile analysis. Physiol Genom and activity of MAO-A and some components of the antiox- 44:173–182 7. Klevstig M, Manakov D, Kasparova D, Brabcova I, Papousek F, idant defence system. This is the first study to demonstrate Zurmanova J, Zidek V, Silhavy J, Neckar J, Pravenec M, Kolar F, relatively far-reaching consequences arising from the Novakova O, Novotny J (2013) Transgenic rescue of defective manipulation of the mitochondrial genome for b-adrenergic Cd36 enhances myocardial adenylyl cyclase signaling in spon- signaling and redox balance in rat heart. Concurrently, these taneously hypertensive rats. Pflugers Arch 465:1477–1486 8. Florea SM, Blatter LA (2012) Regulation of cardiac alternans by data provide new evidence that mitochondria function not b-adrenergic signaling pathways. Am J Physiol Heart Circ only as key ATP-producing organelles, but they may influence Physiol 303:H1047–H1056 other aspects of normal cell functioning. Importantly, 9. Frances C, Nazeyrollas P, Prevost A, Moreau F, Pisani J, Davani manipulating the mitochondrial genome may apparently lead S, Kantelip JP, Millart H (2003) Role of beta 1- and beta 2-adrenoceptor subtypes in preconditioning against myocardial to complex alterations within target cells, and this should be dysfunction after ischemia and reperfusion. J Cardiovasc Phar- taken into account when planning application of such macol 41:396–405 manipulations for research or therapeutic purposes. 10. Tong H, Bernstein D, Murphy E, Steenbergen C (2005) The role of beta-adrenergic receptor signaling in cardioprotection. FASEB Acknowledgements This work was supported by Grant 13-10267 J 19:983–985 from the Czech Science Foundation, Grant 1214214 from the Charles 11. Salie R, Moolman JA, Lochner A (2011) The role of b-adrenergic University Grant Agency, and by the institutional research projects receptors in the cardioprotective effects of beta-preconditioning no. 67985823 (Institute of Physiology, CAS) and SVV-260434/2017 (bPC). Cardiovasc Drugs Ther 25:31–46 (Charles University in Prague). MP was supported by Grants LL1204 12. Mader SL, Downing CL, Van Lunteren E (1991) Effect of age (within the ERC CZ program) from the Ministry of Education, Youth and hypoxia on beta-adrenergic receptors in rat heart. J Appl and Sports and P301/12/0696 from the Czech Science Foundation. Physiol 71:2094–2098 13. Kacimi R, Richalet JP, Corsin A, Abousahl I, Crozatier B (1992) Compliance with ethical standards Hypoxia-induced downregulation of beta-adrenergic receptors in rat heart. J Appl Physiol 73:1377–1382 Conflict of interests The authors have no conflict of interest to ` 14. Mardon K, Merlet P, Syrota A, Maziere B (1998) Effects of 5-day declare. hypoxia on cardiac adrenergic neurotransmission in rats. J Appl Physiol 85:890–897 Ethical approval All applicable international, national, and/or ´ 15. Leon-Velarde F, Bourin MC, Germack R, Mohammadi K, institutional guidelines for the care and use of animals were followed. Crozatier B, Richalet JP (2001) Differential alterations in cardiac This article does not contain any studies with human participants adrenergic signaling in chronic hypoxia or norepinephrine infu- performed by any of the authors. sion. Am J Physiol Regul Integr Comp Physiol 280:R274–R281 16. Hrbasova ´ M, Novotny J, Hejnova ´ L, Kola ´r F, Necka ´r J, Svoboda P (2003) Altered myocardial Gs protein and adenylyl cyclase signaling in rats exposed to chronic hypoxia and normoxic recovery. J Appl Physiol 94:2423–2432 References 17. Johnson TS, Young JB, Landsberg L (1983) Sympathoadrenal responses to acute and chronic hypoxia in the rat. J Clin Invest 1. Hajri T, Ibrahimi A, Coburn CT, Knapp FF, Kurtz T, Pravenec 71:1263–1272 M, Abumrad NA (2001) Defective fatty acid uptake in the 18. Andersson DC, Fauconnier J, Yamada T, Lacampagne A, Zhang spontaneously hypertensive rat is a primary determinant of SJ, Katz A, Westerblad H (2011) Mitochondrial production of 123 J Physiol Sci (2018) 68:441–454 453 reactive oxygen species contributes to the b-adrenergic stimula- G(s)alpha protein: identification of cytosolic forms of G(s)alpha. tion of mouse cardiomycytes. J Physiol 589:1791–1801 J Neurochem 79:88–97 19. Mallet RT, Ryou MG, Williams AG, Howard L, Downey HF 34. Xu Y, Ku BS, Yao HY, Lin YH, Ma X, Zhang YH, Li XJ (2005) (2006) b1-Adrenergic receptor antagonism abrogates cardiopro- The effects of curcumin on depressive-like behaviors in mice. Eur tective effects of intermittent hypoxia. Basic Res Cardiol J Pharmacol 518:40–46 101:436–446 35. Novotny J, Bourova ´ L, Kola ´r F, Svoboda P (2001) Membrane- 20. Zuo L, Roberts WJ, Tolomello RC, Goins AR (2013) Ischemic Bound and cytosolic forms of heterotrimeric G proteins in young and hypoxic preconditioning protect cardiac muscles via intra- and adult rat myocardium: influence of neonatal hypo- and cellular ROS signaling. Front Biol 8:305–311 hyperthyroidism. J Cell Biochem 82:215–224 21. Kola ´r F, Jezkova ´ J, Balkova ´ P, Breh J, Necka ´r J, Nova ´kF, 36. Pilz J, Meineke I, Gleiter CH (2000) Measurement of free and Nova ´kova ´ O, Toma ´sova ´ H, Srbova ´ M, Ost’a ´dal B, Wilhelm J, bound malondialdehyde in plasma by high-performance liquid Herget J (2007) Role of oxidative stress in PKC-delta upregula- chromatography as the 2,4-dinitrophenylhydrazine derivative. tion and cardioprotection induced by chronic intermittent J Chromatogr B Biomed Sci Appl 742:315–325 hypoxia. Am J Physiol Heart Circ Physiol 292:H224–H230 37. Chytilova ´ A, Borchert GH, Mandı ´kova ´-Ala ´nova ´ P, Hlava ´c ˇkova ´ 22. Kasparova D, Neckar J, Dabrowska L, Novotny J, Mraz J, Kolar M, Kopkan L, Khan MA, Imig JD, Kola ´r ˇ F, Necka ´r ˇ J (2015) F, Zurmanova J (2015) Cardioprotective and nonprotective reg- Tumour necrosis factor-a contributes to improved cardiac imens of chronic hypoxia diversely affect the myocardial ischaemic tolerance in rats adapted to chronic continuous antioxidant systems. Physiol Genom 47:612–620 hypoxia. Acta Physiol 214:97–108 23. Cadenas S, Aragone ´s J, Landa ´zuri MO (2010) Mitochondrial 38. Giannuzzi CE, Seidler FJ, Slotkin TA (1995) Beta-adrenoceptor reprogramming through cardiac oxygen sensors in ischaemic control of cardiac adenylyl cyclase during development: agonist heart disease. Cardiovasc Res 88:219–228 pretreatment in the neonate uniquely causes heterologous sensi- 24. Mueller IA, Grim JM, Beers JM, Crockett EL, O’Brien KM tization, not desensitization. Brain Res 694:271–278 (2011) Inter-relationship between mitochondrial function and 39. Mieno S, Horimoto H, Sawa Y, Watanabe F, Furuya E, Horimoto susceptibility to oxidative stress in red- and white-blooded S, Kishida K, Sasaki S (2005) Activation of beta2-adrenergic Antarctic notothenioid fishes. J Exp Biol 214:3732–3741 receptor plays a pivotal role in generating the protective effect of 25. Cortie CH, Hulbert AJ, Hancock SE, Mitchell TW, McAndrew D, ischemic preconditioning in rat hearts. Scand Cardiovasc J Else PL (2015) Of mice, pigs and humans: an analysis of mito- 39:313–319 chondrial phospholipids from mammals with very different 40. Fajardo G, Zhao M, Berry G, Wong LJ, Mochly-Rosen D, maximal lifespans. Exp Gerontol 70:135–143 Bernstein D (2011) b2-adrenergic receptors mediate cardiopro- 26. Kelly RD, Rodda AE, Dickinson A, Mahmud A, Nefzger CM, tection through crosstalk with mitochondrial cell death pathways. Lee W, Forsythe JS, Polo JM, Trounce IA, McKenzie M, Nisbet J Mol Cell Cardiol 51:781–789 DR, St John JC (2013) Mitochondrial DNA haplotypes define 41. Scho ¨ mig A, Fischer S, Kurz T, Richardt G, Scho ¨ mig E (1987) gene expression patterns in pluripotent and differentiating Nonexocytotic release of endogenous noradrenaline in the embryonic stem cells. Stem Cells 31:703–716 ischemic and anoxic rat heart: mechanism and metabolic 27. Wallace DC (2005) A mitochondrial paradigm of metabolic and requirements. Circ Res 60:194–205 degenerative diseases, aging, and cancer: a dawn for evolutionary 42. Kaludercic N, Carpi A, Menabo ` R, Di Lisa F, Paolocci N (2011) medicine. Annu Rev Genet 39:359–407 Monoamine oxidases (MAO) in the pathogenesis of heart failure 28. Necka ´r ˇ J, Svaton ˇ ova ´ A, Weissova ´ R, Drahota Z, Zajı ´c ˇkova ´ P, and ischemia/reperfusion injury. Biochim Biophys Acta Brabcova ´ I, Kola ´r ˇ D, Ala ´nova ´ P, Vas ˇinova ´ J, Silhavy ´ J, Hla- 1813:1323–1332 va ´c ˇkova ´ M, Tauchmannova ´ K, Milerova ´ M, Os ˇt’a ´dal B, Cer- 43. Da ˘nila ˘ MD, Privistirescu AI, Mirica SN, Sturza A, Ordodi V, venka L, Zurmanova ´ J, Kalous M, Nova ´kova ´ O, Novotny ´ J, Noveanu L, Duicu OM, Muntean DM (2015) Acute inhibition of Pravenec M, Kola ´r ˇ F (2017) Selective replacement of mito- monoamine oxidase and ischemic preconditioning in isolated rat chondrial DNA increases the cardioprotective effect of chronic hearts: interference with postischemic functional recovery but no continuous hypoxia in spontaneously hypertensive rats. Clin Sci effect on infarct size reduction. Can J Physiol Pharmacol 131:865–881 93:819–825 29. Anderson EJ, Efird JT, Davies SW, O’Neal WT, Darden TM, 44. Maher JT, Deniiston JC, Wolfe DL, Cymerman A (1978) Thayne KA, Katunga LA, Kindell LC, Ferguson TB, Anderson Mechanism of the attenuated cardiac response to beta-adrenergic CA, Chitwood WR, Koutlas TC, Williams JM, Rodriguez E, stimulation in chronic hypoxia. J Appl Physiol Respir Environ Kypson AP (2014) Monoamine oxidase is a major determinant of Exerc Physiol 44:647–651 redox balance in human atrial myocardium and is associated with 45. Shatemirova KK, Zelenshchikova VA, Min’ko IV (1990) Cat- postoperative atrial fibrillation. J Am Heart Assoc 3:e000713 alytic properties of monoamine oxidases during adaptation to 30. Waskova-Arnostova P, Elsnicova B, Kasparova D, Sebesta O, altitude chamber hypoxia. Kosm Biol Aviakosm Med 24:54–56 Novotny J, Neckar J, Kolar F, Zurmanova J (2013) Right-to-left 46. Yan F, Mu Y, Yan G, Liu J, Shen J, Luo G (2010) Antioxidant ventricular differences in the expression of mitochondrial hex- enzyme mimics with synergism. Mini Rev Med Chem okinase and phosphorylation of Akt. Cell Physiol Biochem 10:342–356 31:66–79 47. Nakanishi K, Tajima F, Nakamura A, Yagura S, Ookawara T, 31. Pfaffl MW (2001) A new mathematical model for relative Yamashita H, Suzuki K, Taniguchi N, Ohno H (1995) Effects of quantification in real-time RT-PCR. Nucleic Acids Res 29:e45 hypobaric hypoxia on antioxidant enzymes in rats. J Physiol 32. Hahnova K, Kasparova D, Zurmanova J, Neckar J, Kolar F, 489(Pt 3):869–876 Novotny J (2016) b-Adrenergic signaling in rat heart is similarly 48. Necka ´r J, Borchert GH, Hlouskova ´ P, Mı ´cova ´ P, Nova ´kova ´ O, affected by continuous and intermittent normobaric hypoxia. Gen Nova ´k F, Hroch M, Papousek F, Ost’a ´dal B, Kola ´r F (2013) Brief Physiol Biophys 35:165–167 daily episode of normoxia inhibits cardioprotection conferred by 33. Ihnatovych I, Hejnova ´ L, Kostrnova ´ A, Mares P, Svoboda P, chronic continuous hypoxia. Role of oxidative stress and BKCa Novotny ´ J (2001) Maturation of rat brain is accompanied by channels. Curr Pharm Des 19:6880–6889 differential expression of the long and short splice variants of 49. Bu HM, Yang CY, Wang ML, Ma HJ, Sun H, Zhang Y (2015) K(ATP) channels and MPTP are involved in the cardioprotection 123 454 J Physiol Sci (2018) 68:441–454 bestowed by chronic intermittent hypobaric hypoxia in the 56. Singh M, Thomas P, Shukla D, Tulsawani R, Saxena S, Bansal A developing rat. J Physiol Sci 65:367–376 (2013) Effect of subchronic hypobaric hypoxia on oxidative 50. Chen CH, Budas GR, Churchill EN, Disatnik MH, Hurley TD, stress in rat heart. Appl Biochem Biotechnol 169:2405–2419 Mochly-Rosen D (2008) Activation of aldehyde dehydrogenase-2 57. Liu JN, Zhang JX, Lu G, Qiu Y, Yang D, Yin GY, Zhang XL reduces ischemic damage to the heart. Science 321:1493–1495 (2010) The effect of oxidative stress in myocardial cell injury in 51. Ohtsuji M, Katsuoka F, Kobayashi A, Aburatani H, Hayes JD, mice exposed to chronic intermittent hypoxia. Chin Med J Yamamoto M (2008) Nrf1 and Nrf2 play distinct roles in acti- 123:74–78 vation of antioxidant response element-dependent genes. J Biol 58. Zhou W, Li S, Wan N, Zhang Z, Guo R, Chen B (2012) Effects of Chem 283:33554–33562 various degrees of oxidative stress induced by intermittent 52. Chau CM, Evans MJ, Scarpulla RC (1992) Nuclear respiratory hypoxia in rat myocardial tissues. Respirology 17:821–829 factor 1 activation sites in genes encoding the gamma-subunit of 59. Wang WY, Wan WY, Zeng YM, Chen XY, Zhang YX (2013) ATP synthase, eukaryotic initiation factor 2 alpha, and tyrosine Effect of Telmisartan on local cardiovascular oxidative stress in aminotransferase. Specific interaction of purified NRF-1 with mouse under chronic intermittent hypoxia condition. Sleep multiple target genes. J Biol Chem 267:6999–7006 Breath 17:181–187 53. Evans MJ, Scarpulla RC (1990) NRF-1: a trans-activator of 60. Lecour S (2009) Activation of the protective Survivor Activating nuclear-encoded respiratory genes in animal cells. Genes Dev Factor Enhancement (SAFE) pathway against reperfusion injury: 4:1023–1034 does it go beyond the RISK pathway? J Mol Cell Cardiol 54. Scarpulla RC (2008) Transcriptional paradigms in mammalian 47:32–40 mitochondrial biogenesis and function. Physiol Rev 88:611–638 55. Fo ¨ ldes-Papp Z, Domej W, Demel U, Tilz GP (2005) Oxidative stress caused by acute and chronic exposition to altitude. Wien Med Wochenschr 155:136–142 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Physiological Sciences Springer Journals

β-Adrenergic signaling, monoamine oxidase A and antioxidant defence in the myocardium of SHR and SHR-mtBN conplastic rat strains: the effect of chronic hypoxia

Download PDF
14 pages

Loading next page...
 
/lp/springer_journal/adrenergic-signaling-monoamine-oxidase-a-and-antioxidant-defence-in-MVU8g0r0OQ

References (70)

Publisher
Springer Journals
Copyright
Copyright © 2017 by The Physiological Society of Japan and Springer Japan
Subject
Biomedicine; Human Physiology; Neurosciences; Animal Biochemistry; Animal Physiology; Cell Physiology; Neurobiology
ISSN
1880-6546
eISSN
1880-6562
DOI
10.1007/s12576-017-0546-8
pmid
28567570
Publisher site
See Article on Publisher Site

Abstract

J Physiol Sci (2018) 68:441–454 https://doi.org/10.1007/s12576-017-0546-8 OR IGINAL PAPER b-Adrenergic signaling, monoamine oxidase A and antioxidant defence in the myocardium of SHR and SHR-mtBN conplastic rat strains: the effect of chronic hypoxia 1 1 2 2 • • • • Klara Hahnova Iveta Brabcova Jan Neckar Romana Weissova 2 1 1 3 • • • • Anna Svatonova Olga Novakova Jitka Zurmanova Martin Kalous 2 2 2 1 • • • Jan Silhavy Michal Pravenec Frantisek Kolar Jiri Novotny Received: 8 February 2017 / Accepted: 23 May 2017 / Published online: 31 May 2017 The Physiological Society of Japan and Springer Japan 2017 Abstract The b-adrenergic signaling pathways and was markedly elevated in both strains after exposure to antioxidant defence mechanisms play important roles in hypoxia. In addition to that, CNH markedly enhanced the maintaining proper heart function. Here, we examined the expression of catalase and aldehyde dehydrogenase-2 in effect of chronic normobaric hypoxia (CNH, 10% O , both strains, and decreased the expression of Cu/Zn 3 weeks) on myocardial b-adrenergic signaling and selec- superoxide dismutase in SHR. Adaptation to CNH inten- ted components of the antioxidant system in spontaneously sified oxidative stress to a similar extent in both strains and hypertensive rats (SHR) and in a conplastic SHR-mtBN elevated the IL-10/TNF-a ratio in SHR-mtBN only. These strain characterized by the selective replacement of the data indicate that alterations in the mitochondrial genome mitochondrial genome of SHR with that of the more can result in peculiar changes in myocardial b-adrenergic ischemia–resistant Brown Norway strain. Our investiga- signaling, MAO-A activity and antioxidant defence and tions revealed some intriguing differences between the two may, thus, affect the adaptive responses to hypoxia. strains at the level of b-adrenergic receptors (b-ARs), activity of adenylyl cyclase (AC) and monoamine oxidase Keywords SHR  Mitochondrial genome  Myocardium A (MAO-A), as well as distinct changes after CNH expo- b-adrenergic receptors  Adenylyl cyclase  Monoamine sure. The b -AR/b -AR ratio was significantly higher in oxidase A  Antioxidant defence  Chronic hypoxia 2 1 SHR-mtBN than in SHR, apparently due to increased expression of b -ARs. Adaptation to hypoxia elevated b - 2 2 ARs in SHR and decreased the total number of b-ARs in Introduction SHR-mtBN. In parallel, the ability of isoprenaline to stimulate AC activity was found to be higher in SHR- The spontaneously hypertensive rat (SHR) is one of the mtBN than that in SHR. Interestingly, the activity of MAO- most commonly used animal models in cardiovascular A was notably lower in SHR-mtBN than in SHR, and it research. This strain, which harbors a deletion variant of the Cd36 gene, is predisposed to the development of hypertension and cardiac hypertrophy in adulthood [1]. The Electronic supplementary material The online version of this hearts of SHR exhibit higher vulnerability to ischemia/ article (doi:10.1007/s12576-017-0546-8) contains supplementary reperfusion (I/R) injury and susceptibility to ventricular material, which is available to authorized users. arrhythmias when compared to normotensive rats [2–4]. & Jiri Novotny Interestingly, despite their reduced ischemic tolerance, [email protected] ischemic preconditioning was found to provide beneficial antiarrhythmic effects in these animals [5]. We have pre- Department of Physiology, Faculty of Science, Charles University, Prague, Czech Republic viously documented that transgenic rescue of defective Cd36 in SHR rat leads to smaller infarct size induced by Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic coronary artery occlusion [6]. In addition, transgenic SHR- Cd36 rats were shown to express a higher number of Department of Cell Biology, Faculty of Science, Charles myocardial b-adrenergic receptors (b-ARs) and displayed University, Prague, Czech Republic 123 442 J Physiol Sci (2018) 68:441–454 increased adenylyl cyclase (AC) activity [7]. These data cardiac ischemic resistance in both strains, the infarct size- imply that transgenic expression of an apparently unrelated limiting effect was stronger in SHR-mtBN than in SHR, and gene may strongly affect b-adrenergic signaling and correlated with reduced sensitivity of mitochondrial per- 2? myocardial resistance to IR injury. meability transition to Ca -induced opening [28]. b-ARs and their signaling machinery are known to play To further define the potential role of mitochondrial a key role in regulating myocardial function [8]. There are genome in the modulation of cardiac function and resis- numerous indications that b-AR-mediated signaling may tance to I/R injury, here we focused on exploring b-AR- also participate in the development of preconditioning-in- mediated signaling and selected components of the duced ischemic tolerance [9–11]. Adaptation to chronic antioxidant defence system in LV preparations from SHR hypoxia, which may provide potent cardioprotection, can and SHR-mtBN. We monitored the levels of selected sig- also be associated with changes in cardiac b-ARs and AC naling molecules, antioxidant enzymes and markers of signaling. Down-regulation of b-ARs and desensitization oxidative stress and inflammation in samples obtained from of AC were occasionally observed in hearts from hypoxia- both normoxic and hypoxia-adapted animals. In addition, adapted animals [12–16]. It is well known that hypoxia we also determined the expression and activity of mono- promotes the activity of the sympathetic adrenergic system amine oxidase A (MAO-A). MAO-A belongs among the [17] and that stimulation of b-ARs may enhance mito- main ROS producers in cardiac cells [29], but as yet there chondrial reactive oxygen species (ROS) generation in is a lack of information about behavior of this mitochon- cardiomyocytes [18]. b-AR activation seems to play an drial enzyme in the chronically hypoxic heart. Interest- essential role in the development of powerful myocardial ingly, replacement of the mitochondrial genome resulted in ischemic resistance conferred by chronic hypoxic exposure distinct changes in myocardial b-ARs and MAO-A, as well [19]. However, the adaptive changes induced by different as in some components of the antioxidant system under conditioning regimens or hypoxia are not limited just to b- both normal and hypoxic conditions. ARs or other membrane-bound receptors and their signal- ing systems, but they are also tightly linked to changes in ROS production and their detoxification. Materials and methods ROS, among other factors, are well-known mediators of the beneficial effects of hypoxic conditioning [20]. Whereas Materials the appropriate rise in ROS is important for achieving suit- able protective outcomes of hypoxic adaptation [21, 22], [ H]CGP-12177 was purchased from PerkinElmer, Inc. high levels of ROS can cause excessive oxidative stress in (Boston, MA, USA), [ H]cAMP was from American cardiomyocytes. In this respect, mitochondria have drawn a Radiolabeled Chemicals, Inc. (St. Louis, MO, USA), great deal of attention as a major site of ROS production and [a- P]ATP was from Hartmann Analytic, GmbH (Braun- control of redox-sensitive transcription factors. At the same schweig, Germany) and EcoLite liquid scintillation cock- time, these organelles are also the major targets of the tail was from MP Biomedicals (Santa Ana, CA, USA). detrimental effects of ROS overproduction [23]. Interest- Acrylamide and bis-acrylamide were from SERVA (Hei- ingly, the functional properties and vulnerability of mito- delberg, Germany), aluminum oxide 90 (neutral, activity I) chondria to oxidative stress may vary somewhat between was from Merck (Darmstadt, Germany) and cOmplete different tissues and species [24, 25]. On the other hand, protease inhibitor cocktail was from Roche Life Science increasing evidence indicates that mitochondrial DNA (Indianapolis, IN, USA). Anti-MAO-A and anti-ALDH-2 (mtDNA) is essential for the cell phenotype and, thus, may antibodies were obtained from Santa Cruz Biotechnology contribute to stress and environmental adaptability [26]. It is (Santa Cruz, CA, USA), anti-catalase antibody was from known that mtDNA modulates cellular bioenergetics and Abcam (Cambridge, UK) and anti-Cu/ZnSOD and anti- mitochondrial ROS generation and mtDNA sequence vari- MnSOD antibodies were from Cayman Chemical Com- ation may, thus, contribute to disease susceptibility [27]. The pany (Ann Arbor, MI, USA). SuperSignal West Dura role of mtDNA in modulating physiological plasticity and chemiluminescent substrate was from Pierce Biotechnol- stress responses at the cellular, tissue and whole organism ogy (Rockford, IL, USA). All other chemicals were pur- level can be investigated using mitochondrial replacement chased from Sigma–Aldrich (St. Louis, MO, USA). technology. We have shown recently that the conplastic SHR-mtBN strain characterized by the selective replace- Animal model ment of the mitochondrial genome with that of the more ischemia–resistant Brown Norway strain exhibited the same The SHR-mtBN conplastic strain harboring the mitochon- myocardial infarct size caused by I/R insult as the progenitor drial genome of a highly inbred strain BN on the nuclear SHR. Although adaptation to chronic hypoxia improved genetic background of SHR was created by selective 123 J Physiol Sci (2018) 68:441–454 443 replacement of a mitochondrial genome of SHR with the Center, Inc.). One microgram of total RNA was loaded to mitochondrial genome of BN rats as described earlier [28]. reverse transcription using RevertAidTM H Minus First Adult male SHR and SHR-mtBN rats (280–300 g body wt) Strand cDNA Synthesis Kit (Thermo Fisher Scientific, were exposed to continuous normobaric hypoxia (CNH; Waltham, MA, USA) with oligo(dT) primers according to inspired O fraction 0.1) in a normobaric chamber (6 m ) the manufacturer’s instructions. Real Time PCR analyses equipped with hypoxic generators (Everest Summit, were, performed on Light Cycler LC 480 (Roche Applied Hypoxico Inc., NY, USA) for 3 weeks. No reoxygenation Science, Branford, CT, USA) using Syber green Master occurred during this period. Animals were used immedi- Mix (Eurogentec SA, Seraing, Belgium). Gene-specific ately after the cessation of hypoxic exposure. The control primers were designed to be compatible with the Roche rats were kept for the same period of time at room air. All Universal Probe Library (UPL) and are listed in Table 1. animals were housed in a controled environment The relative levels of analyzed gene transcripts were cal- (22 ± 2 C; 12:12 h light–dark cycle; light from 5:00 a.m. culated according to Pfaffl [31] using the 18S rRNA gene with free access to water and standard chow diet. The study as a suitable reference gene (18S_F: tctagacaacaagct- was conducted in accordance with the Guide for the Care gcgtga; 18S_R: cctctatgggctcggatttt). This reference gene and Use of Laboratory Animals (published by the National was selected from six candidates using GenEx software Academy of Science, National Academy Press, Washing- (MultiD Analyses AB, Goteborg, Sweden). ton, DC). Experimental protocols were approved by the Animal Care and Use Committee of the Institute of Phys- b-Adrenergic receptor binding iology, Czech Academy of Sciences. Myocardial b-ARs were determined by radioligand binding Processing of heart tissue for biochemical analyses assay with a nonselective b-adrenergic antagonist [ H]CGP 12177 as described previously [32]. Samples of crude Immediately after sacrifice, the hearts were rapidly excised, membranes (100 lg protein) were incubated in incubation washed in ice-cold saline solution and the left ventricles buffer (50 mM Tris, 10 mM MgCl and 1 mM ascorbic (LV) were dissected from the right ventricles and the acid; pH 7.4) containing increasing concentrations of septum. The pieces of frozen tissue were either pulverized [ H]CGP 12177 (0.06–4 nM) for 1 h at 37 C in a total in liquid nitrogen and subsequently homogenized in volume of 0.5 ml; at this time the specific binding of RNAzol RT (Molecular Research Center, Inc.) for iso- radioligand had reached an equilibrium. The binding lation of mRNA or homogenized in TMES buffer (20 mM reaction was terminated by addition of 3 ml of ice-cold Tris, 3 mM MgCl , 1 mM EDTA, 250 mM sucrose; pH washing buffer (50 mM Tris, 10 mM MgCl ; pH 7.4) and 2 2 7.4) supplemented with protease inhibitors for radioligand subsequent filtration through Whatman GF/C filters, which binding assay, Western blotting, enzyme activity determi- nation or other biochemical analyses. In the latter case, the Table 1 PCR primers for the real time PCR ventricles were homogenized on ice by Ultra-Turrax blender for 30 s and subsequently by Potter–Elvehjem Gene Forward primer Reverse primer glass-Teflon homogenizer for 1 min. The homogenates AC5 gggagaaccagcaacagg catctccatggcaacatgac were clarified by centrifugation at 6009g for 10 min AC6 atgagatcatcgcggacttt gccatgtaagtgctaccgatg (4 C) in order to remove nuclei and particulate cellular ACO1 ttgctgtgtctgagattgaaaag cttgaaaacctttaaatccttgct debris. The resulting postnuclear supernatant was cen- ACO2 cgccttacagcctactggtc ggcagaggccacatggta trifuged at 50,0009g for 30 min (4 C) to separate the ALDH2 agacgtcaaagatggcatga ttgaggatctgcatcactgg membrane and cytosolic fractions. The pellet containing CAT cagcgaccagatgaagca ggtcaggacatcgggtttc crude membranes was resuspended in TME buffer (20 mM CuZnSOD taagaaacatggcggtcca tggacacattggccacac Tris, 3 mM MgCl and 1 mM EDTA; pH 7.4). Both GSTO1 aagcttgccagaagatgacc ctcttcgccctaataaaactcg membrane and cytosolic fractions were aliquoted and MAOA tggtatcatgacccagtatgga tgtgcctgcaaagtaaatcct stored at -80 C until use. MnSOD tggacaaacctgagccctaa gacccaaagtcacgcttgata NRF1 atagtcctgtctggggaaacc tccatgcatgaactccatct Real time RT-PCR NRF2 agcatgatggacttggaattg cctccaaaggatgtcaatcaa RNA isolation and real time RT-PCR were performed as PRX3 agaagaacctgcttgacagaca caggggtgtggaatgaaga described previously [30] with a slight modification as PRX5 gactatggccccgatcaa aaaacacctttcttgtccttgaa follows. Briefly, tissue homogenization and total RNA TXN2 cacacagaccttgccattga acgtccccgttcttgatg isolation was performed according manufacturer’s TXNRD2 gcacatggtgaagctacctaga gctccatccacatcttctcag instruction using RNAzol Reagent (Molecular Research 123 444 J Physiol Sci (2018) 68:441–454 were presoaked with 0.3% polyethyleneimine for 1 h. The were added to each reaction mixture as substrate and filters were then washed twice with ice-cold washing buffer incubation was continued for another 30 min at 37 C. The and placed into scintillation vials. After addition of 4 ml reaction was terminated by addition of 200 llof5 M EcoLite scintillation cocktail, radioactivity retained on the perchloric acid. Samples were centrifuged at 15009g for filters was measured by counting for 5 min. Nonspecific 10 min and 500 ll aliquots of supernatant were transferred binding was assessed by incubating the samples with into test tubes containing 2.5 ml of 1 M NaOH. The fluo- radioligand in the presence of 10 lM L-propranolol, and it rescence of the reaction product 4-quinolinol was measured represented less than 30% of the total binding. For com- at Ex 310-nm/Em 380-nm using a Biotek Synergy HT plate petition experiments, samples of crude membranes were reader. A standard curve of 4-quinolinol (in the range of incubated with 1 nM [ H]CGP 12177 and increasing con- 0.03–0.5 mM) was used to calculate MAO-A enzyme centrations of the selective b -AR antagonist ICI 118.551 activity. -4 -10 (10 –10 M). The characteristics of b-adrenergic binding sites and the proportions of b - and b -ARs in Electrophoresis and Western blotting 1 2 myocardial crude membranes were calculated using GraphPad Prism 6 software (GraphPad Software, La Jolla, Individual samples of myocardial preparations were solu- CA, USA). bilized in Laemmli buffer and loaded (10–30 lg per lane) on 10 or 15% acrylamide gels for SDS-PAGE as described Assessment of adenylyl cyclase activity previously [35]. After electrophoresis, the resolved proteins were transferred to nitrocellulose membranes (GE Health- Activity of AC was determined by measuring the conver- care Life Sciences, Buckinghamshire, UK), blocked with 32 32 sion of [a- P]ATP to [ P]cAMP as described previously 5% non-fat dry milk in TBS buffer (10 mM Tris, 150 mM [33]. Samples of crude myocardial membranes (20 lg NaCl; pH 8.0) for 1 h and then incubated for 1.5 h at room protein) were incubated in the reaction mixture (in a total temperature or overnight at 4 C with relevant primary volume 100 ll) containing 48 mM Tris buffer (pH 8), antibodies. After three 10-min washes in TBS containing 2 mM MgCl ,20 lM GTP, 0.8 mg/ml BSA, 40 lM 0.3% Tween 20, the membranes were incubated with sec- 3-isobutyl-1-methylxanthine, 5 mM potassium phospho- ondary antibody conjugated to horseradish peroxidase for enolpyruvate, 3.2 U of pyruvate kinase, 100 mM NaCl, 1 h at room temperature. Immunoreactive proteins on the 0.1 mM cAMP and about 15,000 cpm [ H]cAMP as a blots were visualized by enhanced chemiluminiscence tracer. For stimulation of AC, the following stimulators technique according to the manufacturer’s instructions were used in separate experiments: 10 lM isoprenaline, (Pierce Biotechnology, Rockford, IL, USA) and quantita- 10 lM forskolin, 10 mM MnCl and 10 mM NaF. After tively analyzed by ImageQuant software (Molecular 1 min preincubation, 0.4 mM ATP was added along with Dynamics, Sunnyvale, CA, USA). To correct for errors 2,000,000 cpm [a- P]ATP and incubation proceeded for associated with sample loading and gel transfer, b-actin 20 min at 30 C. The reaction was terminated by addition was used as a housekeeping protein for reliable quantifi- of 200 ll 0.5 M HCl and heating for 5 min at 100 C. cation of Western blot data. Samples were neutralized by 200 ll 1.5 M imidazole. Separation of cAMP produced by stimulated membrane Determination of malondialdehyde preparations from other nucleotides was performed by fil- tration through alumina columns, and the detected amount Lipid peroxidation was quantified by measuring malondi- of [ P]cAMP in each vial was corrected for recovery with aldehyde (MDA) formation. Myocardial samples (100 mg) [ H]cAMP as the internal standard. were pulverized to a fine powder and dissolved in 500 llof ice-cold buffer (25 mM Tris and 0.10% Triton X 100; pH). Assessment of monoamine oxidase A activity The homogenates were sonicated, centrifuged (10009g, 10 min, 4 C) and 100 ll samples of supernatant were MAO-A activity in the LV was determined using kynu- taken and analyzed as described by Pilz et al. [36] with a ramine dihydrobromide as substrate in the presence of slight modification. Briefly, 20 ll of 6 M NaOH was added deprenyl (inhibitor MAO-B) as described previously [34] to each sample, vortexed and incubated for 30 min at with a slight modification. Myocardial crude membranes 60 C. The solution was then cooled on ice and 50 llof (100 lg protein) were lysed by treatment with 2% Triton 35% perchloric acid was added. After centrifugation X-100. Resulting lysate samples (200 ll) were mixed with (10,0009g, 5 min, 4 C), 100 ll of supernatant was taken 0.2 ll of 1 mM deprenyl and 2.5 ml of 50 mM phosphate and derivatization was performed using 10 llof buffer (pH 7.4) and incubated for 60 min at 37 C. After 5 mM 2,4-dinitrophenylhydrazine. After 10 min in the incubation, 30 ll of 2.19 mM kynuramine dihydrobromide dark, the solution was analyzed using a HPLC system 123 J Physiol Sci (2018) 68:441–454 445 (Shimadzu, Kyoto, Japan) with UV detection at 310 nm were conducted to assess the distribution of b-AR subtypes (column: EC Nucleosil 100-5 C18, 4.6 mm 9 125 mm in LV preparations (Fig. 1b). As indicated in Table 3, the heated to 30 C; mobile phase: acetonitrile–water–acetic proportion of b -ARs was significantly increased (by 37%) acid 380:620:2 (v/v/v); flow rate: 1.0 ml/min). MDA con- in SHR-mtBN, compared to SHR. Exposure to hypoxia centration was normalized to total protein content. increased the proportion of b -AR in SHR/H by 30% but did not affect the relative proportion of b-AR subtypes in Determination of TNF-a, IL-6 and IL-10 SHR-mtBN/H. Levels of TNF-a (tumor necrosis factor-a), IL-6 (inter- Adenylyl cyclase leukin-6) and IL-10 (interleukin-10) in myocardial homo- genates from different experimental groups were measured Activity of AC in myocardial membrane preparations was using DuoSet ELISA kits (eBioscience, Vienna, Austria) determined by measuring cAMP production under different according to the standard protocols described by the experimental conditions. Besides determining basal AC manufacturer. The content of cytokines is given in pico- activity, the enzyme activity was modulated by the fol- grams per milligram of total protein [37]. lowing stimulatory agents: isoprenaline, forskolin, MnCl and NaF. Isoprenaline is a b-AR agonist, forskolin or Data analysis MnCl can stimulate the AC catalytic subunit directly and NaF elicits the enzymatic response through activation of Biochemical data were determined in at least three inde- the stimulatory G proteins [38]. Results of experiments in pendent preparations. All results were expressed as the which AC activity was tested under different conditions are mean ± SEM. The Kolmogorov–Smirnov test was used to assess the normality and all parameters were distributed normally. One-way analysis of variance (ANOVA) and subsequent Student–Newman–Keuls tests were used for comparison of differences in normally distributed variables between the groups. Differences between appropriate groups were considered to be statistically significant when the p value was smaller than 0.05 (p \ 0.05). Results All measurements were done on LV myocardial prepara- tions obtained from normoxic rats (SHR and SHR-mtBN) as well as from those exposed to continuous normobaric hypoxia (CNH) for 3 weeks (SHR/H and SHR-mtBN/H). b-Adrenergic receptors The total number of b-ARs and dissociation constants of these receptors in myocardial membrane preparations from LVs were determined by using saturation binding experi- ments (Fig. 1a). We found that the total number of b-ARs, expressed as B , tended to be higher (by about 15%) in max SHR-mtBN than SHR, but this difference was not statis- tically significant. The values of B were also affected by max adaptation of rats to hypoxia. Whereas CNH induced a Fig. 1 Effect of hypoxia on myocardial b-adrenergic receptors. b- significant increase (by 16%) in the total number of b-ARs ARs in LV preparations from SHR (closed triangles), SHR/H (open in SHR/H, the expression of these receptors was markedly squares), SHR-mtBN (closed diamonds) and SHR-mtBN/H (open circles) were characterized by radioligand binding experiments. diminished (by 26%) in SHR-mtBN/H (Table 2). Dissoci- Shown are [ H]CGP 12177 saturation binding curves (a) and ation constants (K ) did not differ significantly between the competitive binding curves (b) which were constructed using the strains and their values were not affected by adaptation to b -AR antagonist ICI 188.551. Data represent means (±SEM) of hypoxia. Subsequently, competition binding experiments three separate experiments performed in triplicate 123 446 J Physiol Sci (2018) 68:441–454 Table 2 Binding SHR SHR/H SHR-mtBN SHR-mtBN/H characteristics of b-ARs -1 ? §# B (fmol mg ) 21.71 ± 0.88 25.20 ± 0.38 24.87 ± 0.73 18.37 ± 0.46 max K (nM) 0.49 ± 0.10 0.58 ± 0.07 0.51 ± 0.03 0.32 ± 0.01 Data are means (±SEM) of three separate experiments performed in triplicates B maximal binding capacity, K equilibrium dissociation constant of radioligand ([ H]CGP 12177) max D ? § # p \ 0.05 SHR vs. SHR/H; p \ 0.05 SHR/H vs. SHR-mtBN/H rats; p \ 0.05 SHR-mtBN vs. SHR- mtBN/H Table 3 Distribution and SHR SHR/H SHR-mtBN SHR-mtBN/H properties of b-AR subtypes ? * b (%) 24.03 ± 0.30 31.12 ± 1.42 32.97 ± 2.01 31.15 ± 0.42 K b (nM) 0.80 ± 0.53 1.43 ± 0.17 4.80 ± 1.25 0.75 ± 0.21 i 2 K b (lM) 0.73 ± 0.06 0.77 ± 0.25 0.70 ± 0.07 0.31 ± 0.03 i 1 Data are means (±SEM) of three separate experiments performed in triplicates b (%) percentage of b -ARs of total myocardial b-ARs, K b (b ) apparent dissociation constant repre- 2 2 i 2 1 senting the affinity of ICI 118.551 to b -ARs (b -ARs) 2 1 * p \ 0.05 SHR vs. SHR-mtBN; p \ 0.05 SHR vs. SHR/H summarized in Fig. 2. Basal AC activity did not signifi- cantly differ between both strains or even after adaptation to hypoxia, but the enzyme activity was diversely influ- enced by different stimulators. Whereas there was no sig- nificant difference between SHR and SHR-mtBN in AC activity stimulated by forskolin or MnCl , the enzyme activity stimulated by isoprenaline and NaF was markedly increased in SHR-mtBN (by about 35%). Adaptation of rats to hypoxia also led to specific changes in variably stimulated AC activity. Whereas CNH increased AC activity stimulated by forskolin or NaF by about 30% in preparations from SHR, there was no change in forskolin- Fig. 2 Effect of hypoxia on activity of myocardial adenylyl cyclase. stimulated AC activity and decrease (by 17%) in NaF- AC activity in LV preparations from SHR (empty bars), SHR/H stimulated AC activity in hypoxia-adapted SHR-mtBN/H, (closed bars), SHR-mtBN (dotted bars) and SHR-mtBN/H (hatched compared to the corresponding normoxic controls. The bars) was determined in the presence of the following stimulators: 10 lM isoprenaline (ISO), 10 lM forskolin (FSK), 10 mM MnCl stimulatory effects on AC activity of forskolin and NaF and 10 mM NaF. Differently stimulated AC activity is expressed as a were lower by 10 and 14%, respectively, in SHR-mtBN/H percentage of the corresponding basal AC activity, which did not than in SHR/H. Hypoxia did not significantly affect the significantly differ between different samples and was in the range of ability of isoprenaline to stimulate AC activity in SHR but 7.9–9.2 pmol cAMP/min per mg protein in all measurements. Data represent means (±SEM) of five independent measurements per- decreased its stimulatory effect by 13% in SHR-mtBN. formed in triplicate. *p \ 0.05 SHR vs. SHR-mtBN rats; p \ 0.05 Interestingly, determination of transcript levels of the SHR vs. SHR/H rats; p \ 0.05 SHR/H vs. SHR-mtBN/H rats; dominant myocardial isoforms of AC (AC5 and AC6) # p \ 0.05 SHR-mtBN vs. SHR-mtBN/H rats revealed a decrease (by about 35%) in mRNA levels of both these isoforms in SHR-mtBN adapted to hypoxia mtBN than in SHR (Fig. 3a). Adaptation to hypoxia (Suppl. Fig. S1). resulted in marked increase of MAO-A mRNA in both strains (by 97 and 132% in SHR and SHR-mtBN, respec- Monoamine oxidase A tively). The same trend was detected at the protein level and in the enzyme activity of MAO-A. The expression of Gene expression and enzyme activity of MAO-A were MAO-A protein was lower by 28% in SHR-mtBN than in assessed in myocardial preparations from both normoxic SHR, and CNH elevated the amount of MAO-A protein by and hypoxia-exposed SHR and SHR-mtBN. The mRNA 66 and 92% in SHR and SHR-mtBN, respectively level of MAO-A was significantly lower (by 30%) in SHR- (Fig. 3b). The enzyme activity of MAO-A in SHR-mtBN 123 J Physiol Sci (2018) 68:441–454 447 was lower by 21% than in SHR, and CNH increased the A similar downward trend was also observed in the enzyme activity by 33 and 22% in SHR and SHR-mtBN, expression of myocardial glutathione S-transferase x1 respectively (Fig. 3c). (GTSO1), thioredoxin 2 (TXN2) and thioredoxin reduc- tase 2 (TXNRD2) and peroxiredoxin 5 (PRX5) after Antioxidant defence enzymes adaptation to hypoxia (Suppl. Fig. S2a–c). The mRNA levels of these enzymes dropped by 19% (GSTO1 and In the next set of experiments, we tested whether TXN2), 18% (TXNRD2) and 16% (PRX5) in SHR/H and adaptation to hypoxia affects expression of selected by 32% (TXN2), 27% (TXNRD2) and 25% (PRX5) in antioxidant defence enzymes in the LV of both rat SHR-mtBN/H. Although hypoxia exposure did not mark- strains. CNH did not change the mRNA level of catalase edly affect comparable levels of PRX3 mRNA in both rat (CAT) in SHR, but markedly increased (by 51%) the strains, the amount of this transcript was higher (by 48%) amount of this transcript in SHR-mtBN (Fig. 4, panel a). in SHR-mtBN/H than in SHR/H (Suppl. Fig. S2c). The The expression of CAT protein was increased by 105 mRNA levels of ACO1 and ACO2 remained without sig- and 68% in hypoxia-exposed SHR/H and SHR-mtBN/H, nificant changes (Suppl. Fig. S2d). In addition, we detected respectively (Fig. 4, panel b). Adaptation to hypoxia increased expression (by 31%) of nuclear respiratory factor elevated the level of aldehyde dehydrogenase 2 (ALDH- 1 (NRF1) mRNA in SHR-mtBN/H and no change in the 2) mRNA in both strains by about 40–50% (Fig. 4, panel mRNA level of nuclear factor (erythroid-derived 2)-like 2 a). The expression of ALDH-2 protein was increased by (NFE2L2, NRF2) (Suppl. Fig. S2e). 25 and 32% in SHR/H and SHR-mtBN/H, respectively, when compared to corresponding normoxic controls Markers of lipid peroxidation and inflammation (Fig. 4, panel b). In contrast to CAT and ALDH-2, mRNA and protein levels of superoxide dismutases Malondialdehyde (MDA) was determined as a marker of (SODs) were decreased (Cu/ZnSOD) or remained oxidative stress-induced lipid peroxidation. Myocardial unchanged (MnSOD) after adaptation to hypoxia (Fig. 5). preparations from both rat strains kept under normoxic The mRNA level of cytosolic Cu/ZnSOD was reduced conditions did not exhibit any differences between MDA by 12 and 16% in SHR/H and SHR-mtBN/H, respec- levels. Adaptation to hypoxia increased the MDA con- tively, but the expression of Cu/ZnSOD protein was centration by 104 and 52% in SHR/H and SHR-mtBN/H, significantly changed (a drop by 31%) just in SHR/H. respectively (Fig. 6a). Levels of anti-inflammatory Fig. 3 Effect of hypoxia on myocardial monoamine oxidase. Expres- shown below the corresponding bar graphs depicting the relative sion levels of mRNA and protein of MAO-A in LV preparations from protein expression levels (b). Specific enzyme activity of MAO-A SHR and SHR-mtBN rats kept in normoxic (empty bars) and hypoxic (c) was determined spectrophotometrically by using kynuramine as (hatched bars) conditions were assessed by RT-PCR and Western substrate. Data represent means (±SEM) of at least three separate * ? blotting, respectively. The amounts of specific mRNA species were experiments. p \ 0.05 SHR vs. SHR-mtBN rats; p \ 0.05 SHR vs. § # normalized with 18S levels (a). The 18S levels were not significantly SHR/H rats; p \ 0.05 SHR/H vs. SHR-mtBN/H rats; p \ 0.05 affected by hypoxic exposure. Representative Western blots are SHR-mtBN vs. SHR-mtBN/H rats 123 448 J Physiol Sci (2018) 68:441–454 Fig. 4 Effect of hypoxia on myocardial catalase and aldehyde a). The 18S levels were not significantly affected by hypoxic dehydrogenase-2. Expression levels of mRNA and protein of CAT exposure. Representative Western blots are shown below the corre- and ALDH-2 in LV preparations from SHR and SHR-mtBN rats kept sponding bar graphs depicting the relative protein expression levels in normoxic (empty bars) and hypoxic (hatched bars) conditions were (column b). Data represent means (±SEM) of at least three separate ? § assessed by RT-PCR and Western blotting, respectively. The amounts experiments. p \ 0.05 SHR vs. SHR/H rats; p \ 0.05 SHR/H vs. of specific mRNA species were normalized with 18S levels (column SHR-mtBN/H rats; p \ 0.05 SHR-mtBN vs. SHR-mtBN/H rats interleukin-10 (IL-10) and pro-inflammatory tumor necro- conditions. The experiments were conducted in parallel on sis factor-a (TNF-a) and interleukin-6 (IL-6) tended to be SHR and SHR-mtBN, i.e., the SHR-based conplastic strain lower in SHR-mtBN than in SHR, and these levels tended carrying the mitochondrial genome from Brown Norway to increase in both strains after hypoxic exposure (Suppl. rats [28]. Our investigation revealed a number of distinct Fig. 3). CNH did not significantly change the IL-10/TNF-a changes at the level of b-ARs, AC and MAO-A, as well as ratio in SHR/H and increased this ratio (by 17%) in SHR- in some components of the antioxidant defence system. mtBN/H (Fig. 6b). We observed that the proportion of myocardial b -ARs was significantly higher in SHR-mtBN than in SHR and that adaptation to hypoxia diversely affected the distribu- Discussion tion of b-ARs in both rat strains. Whereas CNH elevated b- AR density in SHR due to increased expression of b -AR, In the present study, we sought to explore the impact of the total number of b-ARs in SHR-mtBN declined without mitochondria replacement on myocardial b-adrenergic a change in the proportion of b-AR subtypes. The higher b- signaling and antioxidant defence in the spontaneously AR density in SHR-mtBN was reflected by increased hypertensive rat (SHR) under normoxic and hypoxic ability of isoprenaline to stimulate AC activity. However, 123 J Physiol Sci (2018) 68:441–454 449 Fig. 5 Effect of hypoxia on myocardial cytosolic copper/zinc a). The 18S levels were not significantly affected by hypoxic superoxide dismutase and mitochondrial manganese superoxide exposure. Representative Western blots are shown below the corre- dismutase. Expression levels of mRNA and protein of Cu/ZnSOD sponding bar graphs depicting the relative protein expression levels and MnSOD in LV preparations from SHR and SHR-mtBN rats kept (column b). Data represent means (±SEM) of at least five separate ? # in normoxic (empty bars) and hypoxic (hatched bars) conditions were experiments. p \ 0.05 SHR vs. SHR/H rats; p \ 0.05 SHR-mtBN assessed by RT-PCR and Western blotting, respectively. The amounts vs. SHR-mtBN/H rats of specific mRNA species were normalized with 18S levels (column isoprenaline-stimulated AC activity was reduced in enhanced AC activity much more strongly than isopre- preparations from SHR-mtBN exposed to hypoxia, which naline, which is a well-known and commonly reported is in line with the lower expression of b-ARs and AC phenomenon [14]. The observed decline in the number b- determined in these animals. The enzyme activity stimu- ARs in SHR-mtBN after CNH exposure is consistent with lated by forskolin and NaF (the agents capable of stimu- previous findings of lower b-AR expression in rat heart lating AC both directly and through G proteins or only following hypoxia [12, 13, 15]. As a rule, b-AR subtypes through G proteins, respectively) was enhanced in SHR were not discerned in these studies. The only exception is a after their exposure to CNH. Interestingly, no such eleva- study of Mardon et al. [14], which demonstrated a selective tion was found in CNH-adapted SHR-mtBN. By contrast, decrease in b -ARs caused by 5-day hypoxia. These NaF-stimulated AC activity in these rats was already investigators, like others [15, 16], found reduced AC increased under normoxic conditions, and it was dimin- activity in myocardial preparations from hypoxia-exposed ished after exposure to CNH. These strain-specific differ- rats. The reduction in NaF-stimulated AC activity observed ences may presumably be explained by altered ability of G in CNH-exposed SHR-mtBN, thus, conforms well to the proteins to regulate AC activity. Both forskolin and NaF previously published data. On the other hand, the CNH- 123 450 J Physiol Sci (2018) 68:441–454 shown to potentiate the IPC-induced post-ischemic func- tional recovery of a rat heart [43]. In the present study, we found that the expression and activity of MAO-A (the predominant cardiac isoform) was lower in SHR-mtBN than in SHR and that CNH exposure increased similarly the expression and activity of this enzyme in both strains. Nevertheless, MAO-A activity remained still significantly lower in SHR-mtBN under these conditions, which can be considered as a strain-specific feature. The observed ele- vation of myocardial MAO-A after hypoxic exposure may suggest the importance of MAO-A in adaptive responses to chronic hypoxia. It should be mentioned here that our finding of a relatively large increase in MAO-A activity after CNH is in contrast to the work of Maher et al. [44]. These authors did not find any change in MAO activity in a goat heart exposed to chronic hypoxia. However, this dis- crepancy can be explained by using different models and experimental conditions. There are some indications that the possible changes in MAO activity may depend on the duration of hypoxia. Whereas 5-day exposure to hypoxia led to decrease of MAO activity in rat liver, 21-day exposure increased the enzyme activity [45]. The harmful effects of ROS generated from different sources, including mitochondria and MAO activity, are regularly combated by a number of endogenous antioxidant Fig. 6 Effect of hypoxia on myocardial malondialdehyde levels and defence mechanisms. The enzyme antioxidant defence the ratio of interleukin-10/tumor necrosis factor-a. Concentrations of system consists of different types of enzymes with different malondialdehyde (a) and the IL-10/TNF-a ratio (b) were assessed in LV preparations from SHR a SHR-mtBN rats kept in normoxic functions [46]. In the present study, we focused on selected (empty bars) and hypoxic (hatched bars) conditions. Data represent ROS-degrading enzymes (SODs, CAT, PRXs, GSTO1) means (±SEM) of at least five separate experiments. p \ 0.05 SHR and enzymes participating in maintenance of cellular redox vs. SHR/H rats; p \ 0.05 SHR-mtBN vs. SHR-mtBN/H rats homeostasis (TXN2, TXNRD2, ALDH-2, ACO1 and 2). induced increase in the ability of G proteins to stimulate Assessment of expression levels of all these enzymes in myocardial AC activity in SHR has not been previously myocardial preparations from SHR and SHR-mtBN did not noted and may represent a specific feature of this rat strain. reveal any significant differences between both these It is worth mentioning that especially b -AR appears to be 2 strains under normoxic conditions. Moreover, adaptation to important for generating the salutary effects of precondi- hypoxia elicited very similar changes in the levels of most tioning [11, 39]. Accordingly, b -ARs were found to acti- 2 of these enzymes in both progenitor and conplastic SHR vate pro-survival kinases and attenuate mitochondrial strains. CNH appreciably elevated the protein levels of dysfunction during oxidative stress [40]. The increased CAT and ALDH-2, and did not change MnSOD in proportion of b -AR in SHR-mtBN, compared to SHR, and myocardial preparations from both strains. In contrast, reduction in the total number of b-ARs after adaptation to CNH markedly reduced the amount of Cu/ZnSOD protein CNH may, thus, contribute to better protection of this rat in SHR but not in SHR-mtBN. The transcript levels of strain against acute I/R injury [28]. mitochondrial antioxidants TXN2, TXNRD2 and PRX5 It is well known that hypoxic stress is associated with were always significantly lower in CNH-exposed animals increased production and release of catecholamines, and than in corresponding normoxic controls. On the other these compounds may be subjected to oxidative deamina- hand, CNH did not change the mRNA levels of PRX3, tion catalyzed by monoamine oxidases [41]. These ACO1 and ACO2, and decreased GSTO1 in SHR only. enzymes have recently emerged as important mitochon- Interestingly, most changes associated with CNH in the drial sources of oxidative stress in the cardiovascular sys- expression of antioxidant enzymes in SHR and SHR-mtBN tem and MAO inhibition may apparently have a therapeutic markedly differ from those reported in previous studies. In value for treating cardiac affections of ischemic and non- contrast to our current findings, the expression levels of Cu/ ischemic origin [42]. Interestingly, the presence of MAO ZnSOD, MnSOD, TXN2, TXNRD2, PRX5 and ACO2 inhibitors during ischemic preconditioning (IPC) was were found to increase, CAT to decrease and GSTO1 not to 123 J Physiol Sci (2018) 68:441–454 451 Fig. 7 Schematic summarizing the main findings. Replacement of efficient cardioprotection conferred by chronic hypoxia in SHR- the mitochondrial genome of SHR with that of the more ischemia– mtBN, compared to progenitor SHR. The arrows indicate changes resistant Brown Norway strain (mtBN) distinctly affects myocardial relative to SHR or to SHR-mtBN in the case of SHR-mtBN/H. b-ARs, expression of b-ARs and MAO-A. Adaptation to chronic hypoxia is b-adrenergic receptors; b /b , the b -AR/b -AR ratio; MAO-A 1 2 1 2 associated with partially dissimilar changes in b-ARs, MAO-A and monoamine oxidase A, CAT catalase, SOD superoxide dismutase, some components of the antioxidant defence in the myocardium of MDA malondialdehyde, up arrow (double up arrow) and down arrow, SHR and SHR-mtBN. These differences may contribute to more increase (higher increase) and decrease, respectively change after adaptation of Wistar rats to the same cardio- components of the mammalian electron transport chain protective regimen of hypoxia [22]. A significant increase [52, 53]. Moreover, NRF1 has been shown to play a role in in myocardial Cu/ZnSOD and MnSOD was also detected in the mitochondrial DNA replication machinery and other Wistar rats adapted to different hypoxic conditions biosynthetic and degradative pathways [54]. The elevated [47–49]. Hence, the observed discordant changes in NRF1 expression after CNH exposure may promote antioxidant enzymes induced by hypoxic exposure appear mitochondrial biogenesis and, thus, increase cardiac resis- to be strain-specific. The unique downregulation of Cu/ tance to I/R injury of SHR-mtBN/H. ZnSOD and GSTO1 in SHR following hypoxia may partly Chronic hypoxia is usually accompanied by increased ROS explain the lower cardioprotective effect of CNH against formation [55, 56]. Therefore, we decided to assess the extent acute I/R injury in these rats when compared to SHR-mtBN of lipid peroxidation by monitoring MDA content in [28]. The effect of hypoxia on ALDH-2 expression has not myocardial preparations from rats under normoxic and yet been investigated and our finding of increased levels of hypoxic conditions. Interestingly, the MDA concentration ALDH-2 in both rat strains exposed to CNH supports the was markedly increased in both rat strains after CNH expo- notion that this enzyme is highly important for reducing sure, but this increase was much more pronounced in hearts of ischemic heart damage [50] and may follow activation of SHR, which may reflect lower antioxidant capacity of these MAO-A. NRF2 is a transcription factor crucially involved animals when compared to SHR-mtBN. Similar increase in in the regulation of antioxidant enzyme expression, and myocardial MDA concentration was previously found in they can modulate the capacity of the antioxidant system at Wistar rats or mice after exposure to different regimens of the protein level [51]. The observed increase in NRF1 in hypoxia [37, 57–59]. These data indicate that, irrespective of CNH-exposed SHR-mtBN might contribute to upregula- animal model, ROS formation accompanied by increased tion of some nuclear-encoded mitochondrial respiratory lipid peroxidation is a typical sign of chronic hypoxia. genes (such as cytochrome c oxidase (subunit VIc) and It is known that the adaptive response to hypoxia of the reductase, the c subunit of ATP synthase) as NRF1 is one heart tissue can be modulated by inflammatory cytokines of the important transcription factors for structural [60]. In the present study, we found that the amount of the 123 452 J Physiol Sci (2018) 68:441–454 altered glucose metabolism, hyperinsulinemia, and myocardial principal anti-inflammatory (IL-10) and pro-inflammatory hypertrophy. J Biol Chem 276:23661–23666 (TNF-a and IL-6) cytokines tended to be increased under 2. Itter G, Jung W, Juretschke P, Schoelkens BA, Linz W (2004) A hypoxic conditions. In parallel, these animals exhibited a model of chronic heart failure in spontaneous hypertensive rats significant increase in the IL-10/TNF-a ratio. Interestingly, (SHR). Lab Anim 38:138–148 3. Penna C, Pasqua T, Amelio D, Perrelli MG, Angotti C, Tullio F, these results appear rather contradictory with respect to the Mahata SK, Tota B, Pagliaro P, Cerra MC, Angelone T (2014) previously observed decrease in IL-10 and lower IL-10/ Catestatin increases the expression of anti-apoptotic and pro-an- TNF-a ratio in Wistar rats adapted to hypoxia [37]. We giogenetic factors in the post-ischemic hypertrophied heart of think that the disproportionate changes in the content of SHR. PLoS One 9:e102536 4. Ravingerova ´ T, Berna ´tova ´ I, Matejı ´kova ´ J, Ledve ´nyiova ´ V, myocardial cytokines under hypoxic conditions can be Nemc ˇekova ´ M, Pecha ´n ˇ ova ´ O, Tribulova ´ N, Sleza ´k J (2011) ascribed to specific differences between individual rat Impaired cardiac ischemic tolerance in spontaneously hyperten- strains. Moreover, the increased IL-10/TNF-a ratio in sive rats is attenuated by adaptation to chronic and acute stress. SHR-mtBN exposed to CNH can likely contribute to the Exp Clin Cardiol 16:e23–e29 5. Kolar F, Parratt JR (1997) Antiarrhythmic effect of ischemic lesser extent of myocardial damage caused by I/R. preconditioning in hearts of spontaneously hypertensive rats. Exp The main findings obtained in the present study are Clin Cardiol 2:124–128 schematically shown in Fig. 7. Taken together, our results ˇ ˇ 6. Necka ´r ˇ J, Silhavy J, Zı ´dek V, Landa V, Mlejnek P, Sima ´kova ´ M, indicate that the selective replacement of mitochondria of Seidman JG, Seidman C, Kazdova ´ L, Klevstig M, Nova ´kF, Vecka M, Papous ˇek F, Hous ˇte ˇk J, Drahota Z, Kurtz TW, Kola ´r ˇ F, SHR with those of more ischemia–resistant Brown Norway Pravenec M (2012) CD36 overexpression predisposes to strain can modify the functioning of myocardial AC signaling arrhythmias but reduces infarct size in spontaneously hyperten- regulated by b-ARs and G proteins, as well as the expression sive rats: gene expression profile analysis. Physiol Genom and activity of MAO-A and some components of the antiox- 44:173–182 7. Klevstig M, Manakov D, Kasparova D, Brabcova I, Papousek F, idant defence system. This is the first study to demonstrate Zurmanova J, Zidek V, Silhavy J, Neckar J, Pravenec M, Kolar F, relatively far-reaching consequences arising from the Novakova O, Novotny J (2013) Transgenic rescue of defective manipulation of the mitochondrial genome for b-adrenergic Cd36 enhances myocardial adenylyl cyclase signaling in spon- signaling and redox balance in rat heart. Concurrently, these taneously hypertensive rats. Pflugers Arch 465:1477–1486 8. Florea SM, Blatter LA (2012) Regulation of cardiac alternans by data provide new evidence that mitochondria function not b-adrenergic signaling pathways. Am J Physiol Heart Circ only as key ATP-producing organelles, but they may influence Physiol 303:H1047–H1056 other aspects of normal cell functioning. Importantly, 9. Frances C, Nazeyrollas P, Prevost A, Moreau F, Pisani J, Davani manipulating the mitochondrial genome may apparently lead S, Kantelip JP, Millart H (2003) Role of beta 1- and beta 2-adrenoceptor subtypes in preconditioning against myocardial to complex alterations within target cells, and this should be dysfunction after ischemia and reperfusion. J Cardiovasc Phar- taken into account when planning application of such macol 41:396–405 manipulations for research or therapeutic purposes. 10. Tong H, Bernstein D, Murphy E, Steenbergen C (2005) The role of beta-adrenergic receptor signaling in cardioprotection. FASEB Acknowledgements This work was supported by Grant 13-10267 J 19:983–985 from the Czech Science Foundation, Grant 1214214 from the Charles 11. Salie R, Moolman JA, Lochner A (2011) The role of b-adrenergic University Grant Agency, and by the institutional research projects receptors in the cardioprotective effects of beta-preconditioning no. 67985823 (Institute of Physiology, CAS) and SVV-260434/2017 (bPC). Cardiovasc Drugs Ther 25:31–46 (Charles University in Prague). MP was supported by Grants LL1204 12. Mader SL, Downing CL, Van Lunteren E (1991) Effect of age (within the ERC CZ program) from the Ministry of Education, Youth and hypoxia on beta-adrenergic receptors in rat heart. J Appl and Sports and P301/12/0696 from the Czech Science Foundation. Physiol 71:2094–2098 13. Kacimi R, Richalet JP, Corsin A, Abousahl I, Crozatier B (1992) Compliance with ethical standards Hypoxia-induced downregulation of beta-adrenergic receptors in rat heart. J Appl Physiol 73:1377–1382 Conflict of interests The authors have no conflict of interest to ` 14. Mardon K, Merlet P, Syrota A, Maziere B (1998) Effects of 5-day declare. hypoxia on cardiac adrenergic neurotransmission in rats. J Appl Physiol 85:890–897 Ethical approval All applicable international, national, and/or ´ 15. Leon-Velarde F, Bourin MC, Germack R, Mohammadi K, institutional guidelines for the care and use of animals were followed. Crozatier B, Richalet JP (2001) Differential alterations in cardiac This article does not contain any studies with human participants adrenergic signaling in chronic hypoxia or norepinephrine infu- performed by any of the authors. sion. Am J Physiol Regul Integr Comp Physiol 280:R274–R281 16. Hrbasova ´ M, Novotny J, Hejnova ´ L, Kola ´r F, Necka ´r J, Svoboda P (2003) Altered myocardial Gs protein and adenylyl cyclase signaling in rats exposed to chronic hypoxia and normoxic recovery. J Appl Physiol 94:2423–2432 References 17. Johnson TS, Young JB, Landsberg L (1983) Sympathoadrenal responses to acute and chronic hypoxia in the rat. J Clin Invest 1. Hajri T, Ibrahimi A, Coburn CT, Knapp FF, Kurtz T, Pravenec 71:1263–1272 M, Abumrad NA (2001) Defective fatty acid uptake in the 18. Andersson DC, Fauconnier J, Yamada T, Lacampagne A, Zhang spontaneously hypertensive rat is a primary determinant of SJ, Katz A, Westerblad H (2011) Mitochondrial production of 123 J Physiol Sci (2018) 68:441–454 453 reactive oxygen species contributes to the b-adrenergic stimula- G(s)alpha protein: identification of cytosolic forms of G(s)alpha. tion of mouse cardiomycytes. J Physiol 589:1791–1801 J Neurochem 79:88–97 19. Mallet RT, Ryou MG, Williams AG, Howard L, Downey HF 34. Xu Y, Ku BS, Yao HY, Lin YH, Ma X, Zhang YH, Li XJ (2005) (2006) b1-Adrenergic receptor antagonism abrogates cardiopro- The effects of curcumin on depressive-like behaviors in mice. Eur tective effects of intermittent hypoxia. Basic Res Cardiol J Pharmacol 518:40–46 101:436–446 35. Novotny J, Bourova ´ L, Kola ´r F, Svoboda P (2001) Membrane- 20. Zuo L, Roberts WJ, Tolomello RC, Goins AR (2013) Ischemic Bound and cytosolic forms of heterotrimeric G proteins in young and hypoxic preconditioning protect cardiac muscles via intra- and adult rat myocardium: influence of neonatal hypo- and cellular ROS signaling. Front Biol 8:305–311 hyperthyroidism. J Cell Biochem 82:215–224 21. Kola ´r F, Jezkova ´ J, Balkova ´ P, Breh J, Necka ´r J, Nova ´kF, 36. Pilz J, Meineke I, Gleiter CH (2000) Measurement of free and Nova ´kova ´ O, Toma ´sova ´ H, Srbova ´ M, Ost’a ´dal B, Wilhelm J, bound malondialdehyde in plasma by high-performance liquid Herget J (2007) Role of oxidative stress in PKC-delta upregula- chromatography as the 2,4-dinitrophenylhydrazine derivative. tion and cardioprotection induced by chronic intermittent J Chromatogr B Biomed Sci Appl 742:315–325 hypoxia. Am J Physiol Heart Circ Physiol 292:H224–H230 37. Chytilova ´ A, Borchert GH, Mandı ´kova ´-Ala ´nova ´ P, Hlava ´c ˇkova ´ 22. Kasparova D, Neckar J, Dabrowska L, Novotny J, Mraz J, Kolar M, Kopkan L, Khan MA, Imig JD, Kola ´r ˇ F, Necka ´r ˇ J (2015) F, Zurmanova J (2015) Cardioprotective and nonprotective reg- Tumour necrosis factor-a contributes to improved cardiac imens of chronic hypoxia diversely affect the myocardial ischaemic tolerance in rats adapted to chronic continuous antioxidant systems. Physiol Genom 47:612–620 hypoxia. Acta Physiol 214:97–108 23. Cadenas S, Aragone ´s J, Landa ´zuri MO (2010) Mitochondrial 38. Giannuzzi CE, Seidler FJ, Slotkin TA (1995) Beta-adrenoceptor reprogramming through cardiac oxygen sensors in ischaemic control of cardiac adenylyl cyclase during development: agonist heart disease. Cardiovasc Res 88:219–228 pretreatment in the neonate uniquely causes heterologous sensi- 24. Mueller IA, Grim JM, Beers JM, Crockett EL, O’Brien KM tization, not desensitization. Brain Res 694:271–278 (2011) Inter-relationship between mitochondrial function and 39. Mieno S, Horimoto H, Sawa Y, Watanabe F, Furuya E, Horimoto susceptibility to oxidative stress in red- and white-blooded S, Kishida K, Sasaki S (2005) Activation of beta2-adrenergic Antarctic notothenioid fishes. J Exp Biol 214:3732–3741 receptor plays a pivotal role in generating the protective effect of 25. Cortie CH, Hulbert AJ, Hancock SE, Mitchell TW, McAndrew D, ischemic preconditioning in rat hearts. Scand Cardiovasc J Else PL (2015) Of mice, pigs and humans: an analysis of mito- 39:313–319 chondrial phospholipids from mammals with very different 40. Fajardo G, Zhao M, Berry G, Wong LJ, Mochly-Rosen D, maximal lifespans. Exp Gerontol 70:135–143 Bernstein D (2011) b2-adrenergic receptors mediate cardiopro- 26. Kelly RD, Rodda AE, Dickinson A, Mahmud A, Nefzger CM, tection through crosstalk with mitochondrial cell death pathways. Lee W, Forsythe JS, Polo JM, Trounce IA, McKenzie M, Nisbet J Mol Cell Cardiol 51:781–789 DR, St John JC (2013) Mitochondrial DNA haplotypes define 41. Scho ¨ mig A, Fischer S, Kurz T, Richardt G, Scho ¨ mig E (1987) gene expression patterns in pluripotent and differentiating Nonexocytotic release of endogenous noradrenaline in the embryonic stem cells. Stem Cells 31:703–716 ischemic and anoxic rat heart: mechanism and metabolic 27. Wallace DC (2005) A mitochondrial paradigm of metabolic and requirements. Circ Res 60:194–205 degenerative diseases, aging, and cancer: a dawn for evolutionary 42. Kaludercic N, Carpi A, Menabo ` R, Di Lisa F, Paolocci N (2011) medicine. Annu Rev Genet 39:359–407 Monoamine oxidases (MAO) in the pathogenesis of heart failure 28. Necka ´r ˇ J, Svaton ˇ ova ´ A, Weissova ´ R, Drahota Z, Zajı ´c ˇkova ´ P, and ischemia/reperfusion injury. Biochim Biophys Acta Brabcova ´ I, Kola ´r ˇ D, Ala ´nova ´ P, Vas ˇinova ´ J, Silhavy ´ J, Hla- 1813:1323–1332 va ´c ˇkova ´ M, Tauchmannova ´ K, Milerova ´ M, Os ˇt’a ´dal B, Cer- 43. Da ˘nila ˘ MD, Privistirescu AI, Mirica SN, Sturza A, Ordodi V, venka L, Zurmanova ´ J, Kalous M, Nova ´kova ´ O, Novotny ´ J, Noveanu L, Duicu OM, Muntean DM (2015) Acute inhibition of Pravenec M, Kola ´r ˇ F (2017) Selective replacement of mito- monoamine oxidase and ischemic preconditioning in isolated rat chondrial DNA increases the cardioprotective effect of chronic hearts: interference with postischemic functional recovery but no continuous hypoxia in spontaneously hypertensive rats. Clin Sci effect on infarct size reduction. Can J Physiol Pharmacol 131:865–881 93:819–825 29. Anderson EJ, Efird JT, Davies SW, O’Neal WT, Darden TM, 44. Maher JT, Deniiston JC, Wolfe DL, Cymerman A (1978) Thayne KA, Katunga LA, Kindell LC, Ferguson TB, Anderson Mechanism of the attenuated cardiac response to beta-adrenergic CA, Chitwood WR, Koutlas TC, Williams JM, Rodriguez E, stimulation in chronic hypoxia. J Appl Physiol Respir Environ Kypson AP (2014) Monoamine oxidase is a major determinant of Exerc Physiol 44:647–651 redox balance in human atrial myocardium and is associated with 45. Shatemirova KK, Zelenshchikova VA, Min’ko IV (1990) Cat- postoperative atrial fibrillation. J Am Heart Assoc 3:e000713 alytic properties of monoamine oxidases during adaptation to 30. Waskova-Arnostova P, Elsnicova B, Kasparova D, Sebesta O, altitude chamber hypoxia. Kosm Biol Aviakosm Med 24:54–56 Novotny J, Neckar J, Kolar F, Zurmanova J (2013) Right-to-left 46. Yan F, Mu Y, Yan G, Liu J, Shen J, Luo G (2010) Antioxidant ventricular differences in the expression of mitochondrial hex- enzyme mimics with synergism. Mini Rev Med Chem okinase and phosphorylation of Akt. Cell Physiol Biochem 10:342–356 31:66–79 47. Nakanishi K, Tajima F, Nakamura A, Yagura S, Ookawara T, 31. Pfaffl MW (2001) A new mathematical model for relative Yamashita H, Suzuki K, Taniguchi N, Ohno H (1995) Effects of quantification in real-time RT-PCR. Nucleic Acids Res 29:e45 hypobaric hypoxia on antioxidant enzymes in rats. J Physiol 32. Hahnova K, Kasparova D, Zurmanova J, Neckar J, Kolar F, 489(Pt 3):869–876 Novotny J (2016) b-Adrenergic signaling in rat heart is similarly 48. Necka ´r J, Borchert GH, Hlouskova ´ P, Mı ´cova ´ P, Nova ´kova ´ O, affected by continuous and intermittent normobaric hypoxia. Gen Nova ´k F, Hroch M, Papousek F, Ost’a ´dal B, Kola ´r F (2013) Brief Physiol Biophys 35:165–167 daily episode of normoxia inhibits cardioprotection conferred by 33. Ihnatovych I, Hejnova ´ L, Kostrnova ´ A, Mares P, Svoboda P, chronic continuous hypoxia. Role of oxidative stress and BKCa Novotny ´ J (2001) Maturation of rat brain is accompanied by channels. Curr Pharm Des 19:6880–6889 differential expression of the long and short splice variants of 49. Bu HM, Yang CY, Wang ML, Ma HJ, Sun H, Zhang Y (2015) K(ATP) channels and MPTP are involved in the cardioprotection 123 454 J Physiol Sci (2018) 68:441–454 bestowed by chronic intermittent hypobaric hypoxia in the 56. Singh M, Thomas P, Shukla D, Tulsawani R, Saxena S, Bansal A developing rat. J Physiol Sci 65:367–376 (2013) Effect of subchronic hypobaric hypoxia on oxidative 50. Chen CH, Budas GR, Churchill EN, Disatnik MH, Hurley TD, stress in rat heart. Appl Biochem Biotechnol 169:2405–2419 Mochly-Rosen D (2008) Activation of aldehyde dehydrogenase-2 57. Liu JN, Zhang JX, Lu G, Qiu Y, Yang D, Yin GY, Zhang XL reduces ischemic damage to the heart. Science 321:1493–1495 (2010) The effect of oxidative stress in myocardial cell injury in 51. Ohtsuji M, Katsuoka F, Kobayashi A, Aburatani H, Hayes JD, mice exposed to chronic intermittent hypoxia. Chin Med J Yamamoto M (2008) Nrf1 and Nrf2 play distinct roles in acti- 123:74–78 vation of antioxidant response element-dependent genes. J Biol 58. Zhou W, Li S, Wan N, Zhang Z, Guo R, Chen B (2012) Effects of Chem 283:33554–33562 various degrees of oxidative stress induced by intermittent 52. Chau CM, Evans MJ, Scarpulla RC (1992) Nuclear respiratory hypoxia in rat myocardial tissues. Respirology 17:821–829 factor 1 activation sites in genes encoding the gamma-subunit of 59. Wang WY, Wan WY, Zeng YM, Chen XY, Zhang YX (2013) ATP synthase, eukaryotic initiation factor 2 alpha, and tyrosine Effect of Telmisartan on local cardiovascular oxidative stress in aminotransferase. Specific interaction of purified NRF-1 with mouse under chronic intermittent hypoxia condition. Sleep multiple target genes. J Biol Chem 267:6999–7006 Breath 17:181–187 53. Evans MJ, Scarpulla RC (1990) NRF-1: a trans-activator of 60. Lecour S (2009) Activation of the protective Survivor Activating nuclear-encoded respiratory genes in animal cells. Genes Dev Factor Enhancement (SAFE) pathway against reperfusion injury: 4:1023–1034 does it go beyond the RISK pathway? J Mol Cell Cardiol 54. Scarpulla RC (2008) Transcriptional paradigms in mammalian 47:32–40 mitochondrial biogenesis and function. Physiol Rev 88:611–638 55. Fo ¨ ldes-Papp Z, Domej W, Demel U, Tilz GP (2005) Oxidative stress caused by acute and chronic exposition to altitude. Wien Med Wochenschr 155:136–142

Journal

The Journal of Physiological Sciences – Springer Journals

Published: May 31, 2017

There are no references for this article.