A simple and cost-effective method for screening of CRISPR/Cas9-induced homozygous/biallelic mutants

A simple and cost-effective method for screening of CRISPR/Cas9-induced homozygous/biallelic mutants Background: The CRISPR/Cas9 system is being used for genome editing purposes by many research groups in mul- tiple plant species. Traditional sequencing methods to identify homozygous mutants are time-consuming, laborious and expensive. Results: We have developed a method to screen CRISPR/Cas9-induced mutants through Mutation Sites Based Specific Primers Polymerase Chain Reaction (MSBSP-PCR). The MSBSP-PCR method was successfully used to identify homozygous/biallelic mutants in Nicotiana tabacum and Arabidopsis thaliana, and we speculate that it can be used for the identification of CRISPR/Cas9-induced mutants in other plant species. Compared to traditional sequencing methods, MSBSP-PCR is simpler, faster and cheaper. Conclusions: The MSBSP-PCR method is simple to implement and can save time and cost in the screening of CRISPR/Cas9-induced homozygous/biallelic mutants. Keywords: CRISPR/Cas9, Genome editing, Tobacco, Arabidopsis thaliana, PCR, Mutant screening Background Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) The availability of genetic mutants is essential for func - [4–6]. All three types of nucleases have been success- tional studies as well as to determine genetic relation- fully used to generate mutations by producing targeted ships such as epistatic associations in genetic pathways. DNA double-strand breaks (DSBs), which are repaired The discovery of sequence-specific nucleases (SSNs) by either the error-prone non-homologous end joining provided the tools for genome editing, allowing the (NHEJ) repair pathway or the high-fidelity homologous introduction of mutations in specific chromosomal loci recombination pathway. In order to perform their func- and conveyed the potential to revolutionize biologi- tion, ZFNs and TALENs contain arrays of peptide-based cal and medical research. The most widely used SSNs DNA-binding domains fused to the nonspecific DNA include zinc-finger nucleases (ZFNs) [ 1, 2], transcrip- cleavage domain from the restriction enzyme FokI. The tion activator-like effector nucleases (TALENs) [ 3] and amino acid sequences of the zinc-finger and TALE arrays Clustered Regularly Interspaced Short Palindromic can be designed to bind almost any target DNA sequence with high specificity [ 7–11]. However, the protein-DNA interactions in ZFNs and TALENs are quite complex and *Correspondence: wangr@ztri.com.cn; miaoych@henu.edu.cn newly designed proteins need to be experimentally vali- Jinggong Guo, Kun Li, Lifeng Jin, Rui Xu have contributed equally to this dated [12–14]. work State Key Laboratory of Cotton Biology, Department of Biology, In addition, construction of the ZFN and TALEN vec- Institute of Plant Stress Biology, Henan University, 85 Minglun Street, tors is technically demanding, limiting their widespread Kaifeng 475001, China adoption by the scientific community. In contrast, DNA Zhengzhou Tabacco Research Institute of CNTC, No. 2 Fengyang Street, Zhengzhou 450001, Henan, China targeting in the CRISPR-Cas9 system is provided by a Full list of author information is available at the end of the article © The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/ publi cdoma in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Guo et al. Plant Methods (2018) 14:40 Page 2 of 10 relatively short RNA sequence, the single-guide RNA d in controlled environmental conditions of 21  °C and a (sgRNA), which directs the Cas9 protein to the correct 16-h-light/8-h-dark photoperiod, with the light intensity −2 −1 chromosomal position by base complementary in order of 150  μmol  m s . The seedlings were transferred to to generate DSBs. The target sequence is approximately 20 soil for 15–20 d for DNA extraction in the same environ- base pairs (bp) long and is located directly upstream of a mental conditions, and about 0.03–0.05  g rosette leaves protospacer-adjacent motif (PAM). Although the CRISPR/ were used for DNA extraction. Cas9 system is somewhat limited by the requirement of Seeds of Nicotiana tabacum L. (K326) were obtained a suitable PAM next to the target sequence, its technical from the seed stocks bank in our laboratory (National simplicity compared to the complex protein design and Tobacco Gene Research Center, Zhengzhou, China). engineering tasks associated with ZFNs and TALENs has Seeds were surface-sterilized with bleach containing made it the tool of choice for genome editing [15]. In a very 30% sodium hypochlorite for 30 min and grown on half- short period of time, the CRISPR-Cas9 system has been strength MS media [29] supplemented with 0.6% aga- successfully used to generate precise mutations in multiple rose for 7 d in controlled environmental conditions of crops including cotton, rice, wheat and potato [16–21]. 25  °C and a 16-h-light/8-h-dark photoperiod, with the −2 −1 Most mutations generated by the CRISPR/Cas9 system light intensity of 150  μmol  m s . The seedlings were are either insertions or deletions usually located close transferred to soil for 15-20 d for DNA extraction with to the DSB site that occur 3  bp upstream of the PAM 0.05–0.1  g true leaves. The tobacco plants were grown [15]. A common approach to elucidate the nature of the in a greenhouse maintaining day/night temperature at mutations generated by CRISPR is to amplify a frag- 28/23 °C and 16-h-light/8-h-dark photoperiod. ment of the targeted-gene by polymerase chain reaction (PCR) and sequence the PCR amplicons. The mutagen - Agrobacterium‑mediated tobacco transformation esis efficiency of the CRISPR system varies according to Agrobacterium-mediated tobacco transformation was the plant species and the targeted sequences, therefore performed as previously described [30]. efficient screening strategies are paramount to identify individuals carrying mutations in the T or subsequent CRISPR/Cas9 generations. A number of different approaches have been The CRISPR/Cas9 vectors were provided by Prof. developed in order to screen for mutants including PCR/ Qijun Chen, from China Agricultural University [31]. restriction enzyme (RE) assay, T7 endonuclease I (T7EI) Sequences of each tobacco gene, the PAM sites and assay, surveyor nuclease assay, polyacrylamide gel elec- CRISPR/Cas9-induced mutants or synthesized templates trophoresis (PAGE)-based methods, high-resolution used in all experiments are listed in Additional file 1. melting (HRM) analysis-based assays, fluorescent PCR- capillary gel electrophoresis methods and annealing at PCR critical temperature PCR (ACT-PCR) assays [15, 22–28]. Tobacco genomic DNA (gDNA) was extracted using All of these approaches have been successfully used but a Plant DNA Isolation Kit following manufacturer’s each has a number of limitations including the amount instructions (Foregene, China). gDNA concentration was of time and labour required, cost, low detection specific - measured using a NANoDROP 2000c spectrophotom- ity, expensive equipment requirements or in the case of eter (Thermo scientific). If the PCR product was used for PAGE-based methods, the inability to identify individuals sequencing analysis, PCR amplification reactions were with homozygous mutations. performed using Phanta Max Super-Fidelity DNA Poly- Here, we describe a simple, reliable and inexpensive merase (Vazyme) in a final volume of 20 μL, containing method to screen for the presence of CRISPR-Cas9- 10 μL of 2 × Phanta Max buffer, 1.6 μL of 2.5 mM dNTP induced mutations. The method, named Mutation Sites Mix, 1 μL of forward primer (10  μM), 1 μL of reverse Based Specific Primers PCR (MSBSP-PCR) uses opti - primer (10 μM), 40 ng of gDNA, and 0.4 μL of DNA poly- mized parameters for tandem PCR-based analysis. The merase (1 U/μL). If the PCR product was used for aga- method has been validated by screening CRISPR/Cas9- rose electrophoretic analysis, PCR amplification were induced mutants in T transgenic tobacco plants and T conducted in final volumes of 20 μL, using Taq Master 0 1 transgenic tobacco and Arabidopsis plants. Mix (novoprotein), which contained 10 μL of 2 × Master Mix, 1 μL of forward primer or target primer (10 μM), 1 Methods μL of reverse primer (10 μM) and 40 ng of gDNA. Plant materials PCR amplifications were performed using the fol - Seeds of Arabidopsis thaliana (ecotype Columbia-0) lowing parameters: 95 °C for 5 min; 16–30 cycles (suit- were grown on half-strength Murashige and Skoog media able cycles were chosen for each gene) of 95 °C for 30 s, (MS) [29] supplemented with 0.6% (w/v) agarose for 7 56–65 °C (proper annealing temperature was chosen for Guo et al. Plant Methods (2018) 14:40 Page 3 of 10 gene) for 30 s, and 72 °C for 50 s, with a final extension lines for our research. Figure  1 shows the schematic step of 72  °C for 5  min. In general, 30 cycles are suit- overview of mutant establishment and MSBSP-PCR able for most genes in the first PCR (with two external screening in tobacco. Agrobacterium mediated transfor- primers) with 40  ng gDNA as templates. The products mation is used to produce T transgenic lines containing of the first PCR are analyzed by gel electrophoresis, CRISPR/Cas9 cassettes targeting a specific chromosomal and same amount of the products (1–2 ng) can be used locus. Individual T plants undergo screening to identify as templates of the second PCR, with a target primer those containing mutations by performing two sequen- (T-primer) expanding the sites of the expected CRISPR- tial rounds of PCR amplification. The first PCR reaction Cas9-induced mutations and one of the external prim- is performed using genomic DNA from the T transgenic ers used in the initial amplification. All primers used in plants with two external primers designed to anneal 200- this study are listed in Additional file 2 . 300  bp upstream and downstream from the PAM site respectively (Locus-primer-F/Locus-primer-R, Fig.  1). Results The amplified PCR product is expected to contain the Principles and schematic overview of MSBSP‑PCR targeted locus and any mutations caused by the CRISPR/ The MSBSP-PCR method was initially developed to iden - Cas9 expression cassette and should be analysed by gel tify CRISPR/Cas9-induced mutants in transgenic tobacco electrophoresis. The product of the first amplification Fig. 1 Schematic overview of the Mutation Sites Based Specific Primers PCR (MSBSP-PCR) method to identify CRISPR/Cas9-induced mutants in tobacco. CRISPR/Cas9 constructs were transferred to tobacco plants using Agrobacterium mediated transformation. Genomic DNA from either T or T plants was purified and subjected to a first PCR amplification using Locus-primer-F (forward primer) and Locus-primer-R (reverse primer). 0 1 The products of the primary amplification were then used in a secondary PCR using a Target-primer and the Locus-primer-R. The target primer is a mutation site-specific primer and expands the recognition site for the sgRNA. WT plants and heterozygous mutants will produce an amplification product in the secondary PCR while homozygous/biallelic mutants will not show any amplification Guo et al. Plant Methods (2018) 14:40 Page 4 of 10 (1–2  ng) is then subjected to a second PCR amplifica - the CRTISO-T primer being positioned exactly in the tion using a target primer (T-primer) expanding the site target site for the sgRNA. The design of suitable primers of the expected CRISPR-induced mutation and one of and determination of the optimal annealing temperature the external primers used in the initial amplification. The is highly dependent on the nature of the mutation gen- PCR parameters for this second amplification are critical erated by the CRISPR/Cas9 system and some additional for the success of the method and need to be optimized. optimization might be needed in some cases. To deter- CRISPR/Cas9 produces DSBs 3  bp upstream of the mine the optimal primers and annealing temperatures PAM that is subsequently repaired by the NHEJ cellular in problematic cases, cloning of the amplicon generated machinery. The error prone nature of the NHEJ will typi - in the first PCR (using CRTISO-T and CRTISO-R prim - cally introduce mutations at the repair site, with the most ers) into TA-based plasmids might be needed followed by frequent ones being small (1-3 bp) deletions or insertions sequencing of a number of recombinant bacterial clones [15]. A primer designed to anneal at the recognition site to confirm the nature of the mutation. Bacterial clones of the sgRNA will have an imperfect match in those cases containing a mutation can then be used to optimize the where a mutation has taken place and under stringent PCR parameters in order to distinguish between WT and annealing conditions will fail to produce an amplification mutated templates. product. It is therefore essential to determine the ideal In conclusion, for the first PCR of MSBSP-PCR, anneal - melting temperature (Tm) for the second PCR in a way ing temperature is determined by the locus-primer-F and that it will allow amplification of WT templates but will locus-primer-R Tms and the cycle number should be fail to amplify mutated templates. experimentally determined by performing an amplifica - To verify the feasibility of MSBSP-PCR in the identifi - tion reaction and taking 3–5 μL samples at 20, 25, 30 and cation of CRISPR/Cas9-induced mutations and provide 35 cycles, analyzing them in an electrophoresis gel and clues for the design of suitable target-primers we used the looking for the minimum amount of cycles that yields Nicotiana tabacum prolycopene isomerase 1 gene: NtCR- a single and clear band. To determine the parameters TISO (GenBank accession number XM_016608861.1). for the secondary PCR, Tms for the target-primer and Multiple NtCRTISO primers (Fig. 2a) and templates con- locus-primer-R are calculated and an optimization PCR taining different mutations (Fig.  2b) in the sgRNA target performed using product of the first PCR (WT genomic site were synthesized. The nature of the mutations were DNA as template) and an annealing temperature gradi- small deletions (1–3  bp) in the vicinity of the PAM as it ent with an upper limit of 7–12  °C above the optimal has been reported that these types of deletions are the temperature. The optimal cycle number is determined as most common ones induced by the CRISPR/Cas9 system explained above, by analysing samples by electrophoresis in plants [15]. Five different target-primers were designed at different cycle numbers, looking for the presence of a around the sgRNA recognition site and the optimal clear and single amplicon band. annealing temperature for the MSBSP-PCR reaction established by performing PCR reactions over a tempera- Identification of CRISPR/Cas9‑induced mutants in tobacco ture gradient (Tm = 55–68  °C, 28 cycles, Fig. 2b). When and Arabidopsis by MSBSP‑PCR PCR was performed with the WT NtCRTISO template To verify the usefulness of the MSBSP-PCR method in and the CRTISO-T & CRTISO-R primer combination, real experimental conditions, a CRISPR/Cas9 construct amplification products were observed at all Tms although targeting the NtCRTISO gene (Fig.  2) was cloned in a the intensity of the bands decreased with increasing Tm. binary vector [31], and 39 putative T transgenic tobacco As expected, PCR reactions using the different mutant lines produced by Agrobacterium-mediated transforma- templates and primer combinations produced a variety tion. For each T plant, a fragment containing the tar- of results. While many of the primer combinations pro- geted region in NtCRTISO was amplified from purified duced an amplicon at the minimum tested temperature genomic DNA using the CRTISO-F/CRTISO-R prim- (55  °C) using mutant templates (Fig.  2b and Additional ers (Tm = 53  °C, 30 cycles) (Additional file  5: Fig.  3A). file  3: Fig. 1), some mutation/primer combinations com- As a preliminary step to validate the parameters for the pletely failed to amplify any DNA (see D123, D34, and secondary PCR reaction, the primary amplification D456 with CRTISO-T/CRTISO-R primers in Additional products from each putative T transgenic tobacco line file  4: Fig. 2). In general, very weak or no amplicon bands were cloned into a TA cloning vector and a number of were observed at annealing temperatures above 60  °C, recombinant clones used as templates to perform PCR some primer combinations showed little products even reactions using primers CRTISO-T/CRTISO-R (Tm = at annealing temperatures above 57  °C. The CRTISO-T/ 62 °C, 20 cycles) to determine the presence of mutations. CRTISO-R primer combination proved to be the most As shown in Fig. 3, with gDNA from a putative T trans- efficient in recognizing the presence of mutations with genic tobacco line (line 29 in Additional file  5: Fig.  3) as Guo et al. Plant Methods (2018) 14:40 Page 5 of 10 WT 5′ GTGGTGGACTTCTTGCTAGGTATGG 3′ CRTISO-T 5′ GGTGGACTTCTTGCTAGGTA 3′ CRTISO-T1 5′ GTGGACTTCTTGCTAGGTAT 3′ CRTISO-T2 5′ TGGACTTCTTGCTAGGTATG3′ 3′ CRTISO-T3 5′ TGGTGGACTTCTTGCTAGGT CRTISO-T4 5′ GTGGTGGACTTCTTGCTAGG 3 ′ Melting temperatures ( C) Templates Primers CRTISO-T+CRTISO-R CRTISO-T1+CRTISO-R WT GGTGGACTTCTTGCTAGGTA CRTISO-T2+CRTISO-R CRTISO-T3+CRTISO-R CRTISO-T4+CRTISO-R CRTISO-T1+CRTISO-R D1 GGTGGACTTCTTGCTAGGT* CRTISO-T2+CRTISO-R D12 GGTGGACTTCTTGCTAGG** CRTISO-T+CRTISO-R D123 GGTGGACTTCTTGCTAG*** CRTISO-T+CRTISO-R CRTISO-T1+CRTISO-R D2 GGTGGACTTCTTGCTAGG*A CRTISO-T2+CRTISO-R D3 GGTGGACTTCTTGCTAG*TA CRTISO-T+CRTISO-R D34 GGTGGACTTCTTGCTA**TA CRTISO-T+CRTISO-R D456 GGTGGACTTCTTGC***GTA CRTISO-T+CRTISO-R D5 GGTGGACTTCTTGCT*GGTA CRTISO-T+CRTISO-R D56 GGTGGACTTCTTGC**GGTA CRTISO-T+CRTISO-R CRTISO-T3+CRTISO-R D6 GGTGGACTTCTTGC*AGGTA CRTISO-T4+CRTISO-R CRTISO-T3+CRTISO-R D7 GGTGGACTTCTTG*TAGGTA CRTISO-T4+CRTISO-R D78GGTGGACTTCTT**TAGGTA CRTISO-T+CRTISO-R CRTISO-T2+CRTISO-R D8 GGTGGACTTCTT*CTAGGTA CRTISO-T3+CRTISO-R Fig. 2 PCR amplification of some synthesized mutated templates with different primer combinations. a WT sequence and PCR primers used in the amplification reactions. The CRISPR/Cas9 target sequence (red) and PAM (blue) are shown in the WT sequence. b Gel electrophoresis was used to analyze the PCR products for different templates and primer combinations. Red asterisks denote the position of the nucleotide deletions in the templates template, the amplification products were cloned into a mutations and where further confirmed by sequencing of TA-vector and recombinant bacteria (verified by PCR the clones (Additional file  6: Fig.  4). PCR amplifications with primers of CRTISO-F/CRTISO-R, Fig.  3a, upper using primers CRTISO-F/CRTISO-R (Tm = 53°C, 30 panel) screened for the presence of mutations (Fig.  3a, cycles) were also performed as positive controls (Fig.  3a, bottom panel), the absence of amplification products top panel). Not all bacterium contained mutations in bacterium B3, B6 and B7 indicated the presence of Guo et al. Plant Methods (2018) 14:40 Page 6 of 10 a a M WT B1 B2 B3 B4 B5 B6 B7 B8 B9 MWT1 2 3 4 500 bp Primers: MYB86-F+MYB86-R Primers: CRTISO-F+CRTISO-R 250 bp Primers: MYB86-T+MYB86-R Primers: CRTISO-T+CRTISO-R MWT1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M WT L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 500 bp Primers: GGPPS1-F+GGPPS1-R Primers: CRTISO-F+CRTISO-R 250 bp Primers: GGPPS1-T+GGPPS1-R Primers: CRTISO-T+CRTISO-R Fig. 3 Identification of CRISPR/Cas9-induced crtiso mutants in tobacco by MSBSP-PCR. a Genomic DNA from T plants was used 0 MWT1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 for PCR amplification using primers CRTISO-F and CRTISO-R. The amplification products (with gDNA from a putative T transgenic Primers: RIN4-F+RIN4-R tobacco line as template) were cloned into a TA-vector and recombinant bacteria screened for the presence of mutations at the target site. The absence of amplification product when using the target specific primer CRTISO-T and CRTISO-R denotes the existence Primers: RIN4-T+RIN4-R of a mutation (bacterium B3, B6 and B7 in lower panel). As a positive Fig. 4 Identification of CRISPR/Cas9-induced mutants in tobacco control bacterial clones were also amplified with CRTISO-F and by MSBSP-PCR. a Identification of MYB86 mutants. M, marker; L1-4 CRTISO-R (upper panel). b Genomic DNA from T tobacco transgenic are homozygous/biallelic MYB86 mutant plants. b Identification of lines was amplified by PCR with primers CRTISO-F and CRTISO-R GGPPS1 mutants. M, marker; samples #2 and 3 are homozygous/ (upper panel) and the amplification products subjected to a second biallelic mutant plants. c Identification of RIN4 mutants. M, marker; PCR using CRTISO-T and CRTISO-R primers (lower panel). The absence samples #3, 8 and 15 are homozygous/biallelic RIN4 mutant plants of an amplification product in the second PCR suggests that the transgenic line is homozygous/biallelic (lower panel lane L4) To further test the accuracy of our method, we per- indicating that the putative T transgenic tobacco line formed CRISPR/Cas9-mediated mutagenesis of three was heterozygous. additional tobacco genes, NtMYB86, NtRIN4 and NtG- To directly screen the T transgenic lines, genomic GPPS1, (GenBank accession numbers XM_016625541.1, DNA was used as template for the first round of PCR XM_009803000.1, XM_016593708.1 respectively) and using primers CRTISO-F/CRTISO-R (Tm= 53  °C, 30 analyzed the presence of mutations by MSBSP-PCR. The cycles) (Fig.  3b, top panel) and the same amounts of primers of CRISPR/Cas9 constructs were designed to tar- amplification products (1.2  ng) used as templates in a get each of the three genes (Additional file  2: Table 1) and second PCR using primers CRTISO-T/CRTISO-R (Tm transgenic plants produced via Agrobacterium-mediated = 62  °C, 20 cycles) (Fig.  3b, bottom panel). The absence transformation. Putative T transgenic tobacco plants for of amplification indicated the presence of mutations in all genes were used to extract genomic DNA and screen both alleles, although this method cannot distinguish for the presence of mutations. For NtMYB86 (Nicotiana between homozygous and biallelic mutations. The sec - tabacum transcription factor MYB86), a primary PCR ond PCR analysis of all 39 T plants were shown in Addi- was performed with primers MYB86-F/MYB86-R (Tm tional file  5: Fig. 3B, and further analyzed by sequencing = 54  °C, 30 cycles) (Fig.  4a, upper panel) and the prod- the primary amplification products (primers CRTISO-F/ ucts used for the secondary amplification using primers CRTISO-R). Sequence analysis identified the three plants MYB86-T/MYB86-R (Tm = 62  °C, 30 cycles) (Fig.  4a, previously identified by MSBSP-PCR to be homozygous lower panel). The absence of amplification in the sec - mutants (Additional file  6: Fig.  4A and 4B) while the ondary PCR indicated the presence of homozygous/ remaining 13 plants contained heterozygous mutations biallelic mutations in the examined plants (Fig. 4a, lower (Additional file 6: Fig. 4C). Guo et al. Plant Methods (2018) 14:40 Page 7 of 10 panel, lanes 1–4). Out of 24 T lines analyzed, three were M WT 1 2 3 4 5 6 identified as homozygous/biallelic (Additional file  7: 750 bp Fig.  5) and confirmed by sequencing the products of the primary amplification (Additional file  8: Fig.  6). In Primers: PVY-F+PVY-R the case of NtGGPPS1 (Nicotiana tabacum geranylgera- nyl diphosphate synthase 1), the primary PCR was per- 500 bp formed using primers GGPPS1-F/GGPPS1-R (Tm = 55  °C, 20 cycles) (Fig.  4b, upper panel), the second PCR Primers: PVY-T+PVY-R using primers GGPPS1-T/GGPPS1-R (Tm = 62  °C, 20 cycles) (Fig.  4b, lower panel). Lines containing homozy- 750 bp gous/biallelic mutations were identified by the absence of secondary amplification and verified by sequencing Primers: PVY-F+PVY-R PvuII digestion the primary amplification products (Fig.  4b, lower panel, lanes 2–3). Out of 23 T lines analyzed, three were iden- Fig. 5 Identification of the CRISPR/Cas9-induced mutants in T 0 1 tobacco plants by MSBSP-PCR. A first PCR reaction was conducted tified as homozygous/biallelic (Additional file  9: Fig.  7) with genomic DNA isolated from T transgenic plants using locus and confirmed by sequencing the products of the pri - primers PVY-F and PVY-R (upper panel) and the amplification mary amplification (Additional file  10: Fig.  8). These products used as template for a secondary PCR with the target three homozygous/biallelic lines have the same mutation specific primer PVY-T and PVY-R (middle panel). Lanes 4-6 were (Additional file  10: Fig.  8), an unusual case in CRISPR/ identified as homozygous/biallelic mutants based on the absence of amplification product. To confirm the results of the MSBSP-PCR, Cas9-induced mutations and it might indicate that the the products of the first PCR were digested with PvuII (lower panel). three T transgenic plants were differentiated from the Complete digestion of the amplification product indicates a WT gene same callus. Finally, T plants containing CRISPR/Cas9 sequence ( WT lane); lanes 1-3 show a combination of digested and constructs targeting NtRIN4 (Nicotiana tabacum RPM1- undigested product indicating that the plants were heterozygous. interacting protein 4) were analyzed by performing the The undigested products in lines 4-6 identify the plants as homozygous or biallelic mutants primary PCR with primers RIN4-F/RIN4-R (Tm = 55 °C, 20 cycles) (Fig.  4c, upper panel) and the secondary PCR using primers RIN4-T/RIN4-R (Tm = 63  °C, 25 cycles) (Fig.  4c, lower panel). A total of three lines containing of the amplicon, while samples 1-3 showed a composite homozygous/biallelic mutations were detected (Fig.  4c, pattern of digested and undigested product, identify- lower panel, lanes 3, 8 and 15 and Additional file  11: ing these plants as putative heterozygous (Fig.  5, lower Fig.  9, lanes 5, 7 and 9) and confirmed by sequencing of panel). Consistent with the results of the MSBSP-PCR the primary PCR products (Additional file 12: Fig. 10). analysis, samples 4-6 were not cut by PvuII confirming Aside from the detection of mutations in the T gen- the presence of either homozygous or biallelic muta- eration, it is important to have a quick screening pro- tions. Analysis of 33 T plants by MSBSP-PCR identi- cedure to analyze the T progeny. For this purpose we fied 3 putative homozygous/biallelic mutants (Additional analyzed the segregating population of a T transformant file  13: Fig.  11), and DNA sequencing further confirmed containing a CRISPR/Cas9 cassette targeting the NtPVY that all 3 T plants contained homozygous mutations gene (Eukaryotic translation initiation factor eIF4E−1, (Additional file 14: Fig. 12). GenBank accession number XM_009769718.1). Genomic To test the effectiveness of MSBSP-PCR to screen DNA was isolated from a number of T individuals; the mutants in additional plant species, we obtained a pre- initial PCR was performed using primers PVY-F/PVY-R viously characterized homozygous Arabidopsis mutant (Tm = 53  °C, 30 cycles) (Fig.  5, upper panel) and the produced by CRISPR/Cas9 targeting the AtETC2 gene amplification products subjected to a secondary PCR (Enhancer of TRY and CPC 2; GENE ID AT2G30420) using primers PVY-T/PVY-R (Tm = 65  °C, 16 cycles) [31]. Wild type and homozygous mutant plants were (Fig.  5, middle panel). The absence of amplification grown and primary PCR of the genomic DNA performed products in samples 4, 5 and 6 indicated the presence of using primers ETC2-F/ETC2-R (Tm = 55  °C, 30 cycles) homozygous or biallelic mutations (Fig. 5, middle panel). (Fig.  6, upper panel). Products from the primary PCR The target site for the CRISPR/Cas9 construct used for were used as templates for the secondary PCR using this gene contained a PvuII cleavage site at the predicted ETC2-T/ETC2-R as primers (Tm = 65  °C, 23 cycles) DSB position in order to detect the presence of muta- (Fig.  6, lower panel). As in the case of tobacco, homozy- tions by the destruction of the restriction site. When the gous mutants were identified by the absence of amplifica - products from the primary amplification were digested tion in the secondary PCR (Fig. 6, lower panel lanes 1–2). with PvuII, the WT sample showed complete digestion Guo et al. Plant Methods (2018) 14:40 Page 8 of 10 Moreover, the numbers of cycles in second PCR to M CK 1 2 WT screen CRISPR/Cas9-induced mutants of NtCRTISO, NtMYB86, NtRIN4 and NtGGPPS1 are distinctive, the ETC2-1 proper number of cycles is determined by PCR param- 750 bp eters, including Tm, concentration of template and amplification efficiency of primers. Generally, 23 cycles Primers: ETC2-F+ETC2-R is used for preliminary experiment. If the second PCR obtains large amount of product with both WT and transgenic lines as templates, the number of cycles can 750 bp ETC2-2 be reduced; while the second PCR obtains little amount of product in WT lines, the number of cycles must be Primers: ETC2-T+ETC2-R increased. Fig. 6 Identification of CRISPR/Cas9-induced etc2 mutants in Arabidopsis by MSBSP-PCR. Genomic DNA was amplified by PCR using the locus primers ETC2-F and ETC2-R (upper panel) and the Conclusion amplification products used as template for a second PCR using he We have developed a fast, cheap and easy screening target specific primer ETC2-T and the locus primer ETC2-R (lower method for CRISPR/Cas9 system-induced homozy- panel). M, marker; CK, negative control with ddH O as template. L1 gous/biallelic mutant identification. This method can be and L2, homozygous etc2 mutant plants; WT, wild type used to screen CRISPR/Cas9 system-induced mutant in tobacco and Arabidopsis. Discussion Additional files In this work, we describe the development of MSBSP- PCR, a new method to identify mutants generated by Additional file 1: Sequences of each gene and CRISPR/Cas9-induced the CRISPR/Cas9 system and prove its efficiency in mutants or synthesized templates used in all experiments. tobacco and Arabidopsis. A number of methods are Additional file 2: Table S1. List of primers used in this study. already available to detect CRISPR/Cas9-induced Additional file 3: Fig. 1. The yield of temperature gradient PCR with mutations [12–28], all of which have advantages and different single point mutation templates of NtCRTISO (synthesized) disadvantages. The main advantages of our method and different combination of primers was detected by agarose gel are its technical simplicity, quickness and low cost, it electrophoresis. could be used to screen homozygous/biallelic mutants Additional file 4: Fig. 2. The yield of temperature gradient PCR with different multiple point mutation templates of NtCRTISO (synthesized) from T plants, or the descendants of heterozygous/ and different combination of primers was detected by agarose gel monoalleic mutants. Moreover, the two-round of PCR electrophoresis. enhanced the accuracy and reproducibility of the PCR Additional file 5: Fig. 3. Identification of CRISPR/Cas9-induced crtiso results. In high complexity genomes such as those of mutants in tobacco by MSBSP-PCR. polyploid species, like cotton, tobacco, wheat, etc., PCR Additional file 6: Fig. 4. The sequencing and sequences analysis of differ - amplifications directly with primer set of primer-T and ent clones of NtCRTISO transgenic lines. primer-R and genomic DNA as templates may cause Additional file 7: Fig. 5. Identification of CRISPR/Cas9-induced myb86 mutants in tobacco by MSBSP-PCR. many nonspecific amplification products. On the other hand, the method cannot distinguish between homozy- Additional file 8: Fig. 6. The sequencing and sequences analysis of differ - ent transgenic lines of NtMYB86. gous and biallelic mutations and it is therefore impor- Additional file 9: Fig. 7. Identification of CRISPR/Cas9-induced ggpps1 tant to sequence the target site once the mutated plants mutants in tobacco by MSBSP-PCR. have been identified. It is also critical to carefully deter - Additional file 10: Fig. 8. The sequencing and sequences analysis of dif- mine the stringency conditions in the secondary PCR ferent transgenic lines of NtGGPPS1. in order to distinguish between WT and mutated tem- Additional file 11: Fig. 9. Identification of CRISPR/Cas9-induced rin4 plates. The MSBSP-PCR method is only useful to detect mutants in tobacco by MSBSP-PCR. mutations close and upstream of the PAM, which are Additional file 12: Fig. 10. The sequencing and sequences analysis of the most frequent when using the CRISPR/Cas9 sys- different transgenic lines of NtRIN4. tem. Mutations far from the PAM will require some Additional file 13: Fig. 11. Identification of CRISPR/Cas9-induced pvy mutants in tobacco by MSBSP-PCR. kind of preliminary characterization by PCR ampli- fication of the targeted genomic fragment followed Additional file 14: Fig. 12. The sequencing and sequences analysis of different transgenic lines of NtPVY. by TA cloning and sequencing of multiple recombi- nant clones, thus allowing us to design a proper target primer. Guo et al. Plant Methods (2018) 14:40 Page 9 of 10 Abbreviations 3. Li T, Huang S, Jiang WZ, Wright D, Spalding MH, Weeks DP, et al. TAL MSBSP-PCR: mutation sites based specific primers polymerase chain reac- nucleases ( TALNs): hybrid proteins composed of TAL effectors and Fok I tion; SSN: ssequence-specific nucleases; ZFNs: zinc-finger nucleases; CRISPR: DNA-cleavage domain. Nucleic Acids Res. 2011;39:359–72. Clustered Regularly Interspaced Short Palindromic Repeats; Cas9: CRISPR- 4. Cho SW, Kim S, Kim JM, Kim JS. Targeted genome engineering in associated protein 9; DSBs: double-strand breaks; NHEJ: non-homologous human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol. end joining; sgRNA: single-guide RNA; PAM: protospacer-adjacent motif; HRM: 2013;31:230–2. high-resolution melting; ACT-PCR: annealing at critical temperature PCR; Tm: 5. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-guided melting temperature. human genome engineering via Cas9. Science. 2013;339:823–6. 6. Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, et al. Efficient Authors’ contributions genome editing in zebrafish using a CRISPR-Cas system. Nat Biotech- YM and RW conceived and designed the experiments. JG, KL, and JL per- nol. 2013;31:227–9. formed the experiments. YM, RW, JG, JB, KM and KL analyzed the data. YM, RW, 7. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, et al. JG, KL, KM, FY, RX, CQ and LZ contributed reagents/materials/analytical tools. Breaking the code of DNA binding specificity of TAL-type III effectors. YM, RW, JB, and KL wrote the paper. All authors read and approved the final Science. 2009;326:1509–12. manuscript. 8. Moscou MJ, Bogdanove AJ. A simple cipher governs DNA recognition by TAL effectors. Science. 2009;326:1501. Author details 9. Wood AJ, Lo T W, Zeitler B, Pickle CS, Ralston EJ, Lee AH, et al. Targeted State Key Laboratory of Cotton Biology, Department of Biology, Institute genome editing across species using ZFNs and TALENs. Science. of Plant Stress Biology, Henan University, 85 Minglun Street, Kaifeng 475001, 2011;333:307. China. Zhengzhou Tabacco Research Institute of CNTC, No. 2 Fengyang 10. Joung JK, Sander JD. TALENs: a widely applicable technology for Street, Zhengzhou 450001, Henan, China. School of Life Science, Southwest targeted genome editing. Nat Rev Mol Cell Biol. 2013;14:49–55. University, No. 1, Tiansheng Road, Beibei 400715, Chongqing, China. College 11. Yi P, Li W, Ou G. The application of transcription activator-like effector of Tobacco Science, Henan Agricultural University, No.63 Agriculture Road, nucleases for genome editing in C. elegans. Methods. 2014;68:389–96. Zhengzhou 450002, Henan, China. School of Agriculture and Food Sciences, 12. Urnov FD, Rebar EJ, Holmes MC, Zhang HS, Gregory PD. Genome University of Queensland, Brisbane, QLD, Australia. editing with engineered zinc finger nucleases. Nat Rev Genet. 2010;11:636–46. Acknowledgements 13. Sander JD, Dahlborg EJ, Goodwin MJ, Cade L, Zhang F, Cifuentes D, We thank Prof. Qijun Chen, from China Agricultural University, for providing et al. Selection-free zinc-finger-nuclease engineering by context- the atetc2 seeds and the vectors of CRISPR/Cas9 system. dependent assembly (CoDA). Nat Methods. 2011;8:67–9. 14. Zhang H, Gou F, Zhang J, Liu W, Li Q, Mao Y, et al. TALEN-mediated Competing interests targeted mutagenesis produces a large variety of heritable mutations All the authors declare that they have no competing interests. in rice. Plant Biotechnol J. 2016;14:186–94. 15. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multi- Accession Numbers plex genome engineering using CRISPR/Cas systems. Science. Sequence data of this report have been listed in Additional file 2. NtGGPPS1 2013;339:819–23. (XM_016593708.1); NtCRTISO (XM_016608861.1); NtMYB86 (XM_016625541.1); 16. Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, et al. The CRISPR/Cas9 NtRIN4 (XM_009803000.1); PVY (XM_009769718.1); AtETC2 (AT2G30420). system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J. 2014;12:797–807. Availability of data and materials 17. Wang S, Zhang S, Wang W, Xiong X, Meng F, Cui X. Efficient targeted The datasets supporting the conclusions of this article are included within the mutagenesis in potato by the CRISPR/Cas9 system. Plant Cell Rep. article and its additional files. 2015;34:1473–6. 18. Iqbal Z, Sattar MN, Shafiq M. CRISPR/Cas9: a tool to circumscribe cotton Consent for publication leaf curl disease. Front Plant Sci. 2016;7:475. Not applicable. 19. Zhang Y, Liang Z, Zong Y, Wang Y, Liu J, Chen K, et al. Efficient and transgene-free genome editing in wheat through transient expression Ethics approval and consent to participate of CRISPR/Cas9 DNA or RNA. Nat Commun. 2016;7:12617. Not applicable. 20. Gao W, Long L, Tian X, Xu F, Liu J, Singh PK, et al. Genome editing in cotton with the CRISPR/Cas9 system. Front Plant Sci. 2017;8:1364. Funding 21. Mao Y, Botella JR, Zhu JK. Heritability of CRISPR/Cas9-targeted gene This work was supported by the National Key Research and Development Pro- modifications in plants. Cell Mol Life Sci. 2017;74:1075–93. gram (2016YFD0101006), Science and Technology project (172102110153) of 22. Montgomery J, Wittwer CT, Palais R, Zhou L. Simultaneous mutation Henan Province,Project of the Tobacco Genomic Program 110201501015(JY- scanning and genotyping by high-resolution DNA melting analysis. 02),the National Natural Science Foundation of China (31770300), and the Pro- Nat Protoc. 2007;2:59–66. gram for Innovative Research Team (in Science and Technology) in University 23. Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, et al. Targeted genome of Henan Province (18IRTSTHN023). modification of crop plants using a CRISPR-Cas system. Nat Biotechnol. 2013;31:686–8. 24. Thomas HR, Percival SM, Yoder BK, Parant JM. High-throughput Publisher’s Note genome editing and phenotyping facilitated by high resolution melt- Springer Nature remains neutral with regard to jurisdictional claims in pub- ing curve analysis. PLoS ONE. 2014;9:e114632. lished maps and institutional affiliations. 25. Zhu X, Xu Y, Yu S, Lu L, Ding M, Cheng J, et al. An efficient genotyping method for genome-modified animals and human cells generated Received: 12 February 2018 Accepted: 7 May 2018 with CRISPR/Cas9 system. Sci Rep. 2014;4:6420. 26. Liu WS, Zhu XH, Lei MG, Xia QY, Botella JR, Zhu JK, et al. A detailed pro- cedure for CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana. Sci Bull. 2015;60:1332–47. 27. Ramlee MK, Yan T, Cheung AM, Chuah CT, Li S. High-throughput References genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR- 1. Bibikova M, Beumer K, Trautman JK, Carroll D. Enhancing gene target- capillary gel electrophoresis. Sci Rep. 2015;5:15587. ing with designed zinc finger nucleases. Science. 2003;300:764. 28. Hua Y, Wang C, Huang J, Wang K. A simple and efficient method 2. Porteus MH, Baltimore D. Chimeric nucleases stimulate gene targeting for CRISPR/Cas9-induced mutant screening. J Genet Genom. in human cells. Science. 2003;300:763. 2017;44:207–13. Guo et al. Plant Methods (2018) 14:40 Page 10 of 10 29. Murashige T, Skoog F. A revised medium for rapid growth and bio 31. Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, et al. Egg assays with tobacco tissue cultures. Physiol Plant. 1962;15:473–97. cell-specific promoter-controlled CRISPR/Cas9 efficiently generates 30. Shi Y, Guo J, Zhang W, Jin L, Liu P, Chen X, et al. Cloning of the lycopene homozygous mutants for multiple target genes in Arabidopsis in a single β-cyclase gene in Nicotiana tabacum and its overexpression confers salt generation. Genome Biol. 2015;16:144. and drought tolerance. Int J Mol Sci. 2015;16:30438–57. Ready to submit your research ? Choose BMC and benefit from: fast, convenient online submission thorough peer review by experienced researchers in your field rapid publication on acceptance support for research data, including large and complex data types • gold Open Access which fosters wider collaboration and increased citations maximum visibility for your research: over 100M website views per year At BMC, research is always in progress. Learn more biomedcentral.com/submissions http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Plant Methods Springer Journals

A simple and cost-effective method for screening of CRISPR/Cas9-induced homozygous/biallelic mutants

Free
10 pages

Loading next page...
 
/lp/springer_journal/a-simple-and-cost-effective-method-for-screening-of-crispr-cas9-Q3heERYSWj
Publisher
BioMed Central
Copyright
Copyright © 2018 by The Author(s)
Subject
Life Sciences; Plant Sciences; Biological Techniques
eISSN
1746-4811
D.O.I.
10.1186/s13007-018-0305-8
Publisher site
See Article on Publisher Site

Abstract

Background: The CRISPR/Cas9 system is being used for genome editing purposes by many research groups in mul- tiple plant species. Traditional sequencing methods to identify homozygous mutants are time-consuming, laborious and expensive. Results: We have developed a method to screen CRISPR/Cas9-induced mutants through Mutation Sites Based Specific Primers Polymerase Chain Reaction (MSBSP-PCR). The MSBSP-PCR method was successfully used to identify homozygous/biallelic mutants in Nicotiana tabacum and Arabidopsis thaliana, and we speculate that it can be used for the identification of CRISPR/Cas9-induced mutants in other plant species. Compared to traditional sequencing methods, MSBSP-PCR is simpler, faster and cheaper. Conclusions: The MSBSP-PCR method is simple to implement and can save time and cost in the screening of CRISPR/Cas9-induced homozygous/biallelic mutants. Keywords: CRISPR/Cas9, Genome editing, Tobacco, Arabidopsis thaliana, PCR, Mutant screening Background Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) The availability of genetic mutants is essential for func - [4–6]. All three types of nucleases have been success- tional studies as well as to determine genetic relation- fully used to generate mutations by producing targeted ships such as epistatic associations in genetic pathways. DNA double-strand breaks (DSBs), which are repaired The discovery of sequence-specific nucleases (SSNs) by either the error-prone non-homologous end joining provided the tools for genome editing, allowing the (NHEJ) repair pathway or the high-fidelity homologous introduction of mutations in specific chromosomal loci recombination pathway. In order to perform their func- and conveyed the potential to revolutionize biologi- tion, ZFNs and TALENs contain arrays of peptide-based cal and medical research. The most widely used SSNs DNA-binding domains fused to the nonspecific DNA include zinc-finger nucleases (ZFNs) [ 1, 2], transcrip- cleavage domain from the restriction enzyme FokI. The tion activator-like effector nucleases (TALENs) [ 3] and amino acid sequences of the zinc-finger and TALE arrays Clustered Regularly Interspaced Short Palindromic can be designed to bind almost any target DNA sequence with high specificity [ 7–11]. However, the protein-DNA interactions in ZFNs and TALENs are quite complex and *Correspondence: wangr@ztri.com.cn; miaoych@henu.edu.cn newly designed proteins need to be experimentally vali- Jinggong Guo, Kun Li, Lifeng Jin, Rui Xu have contributed equally to this dated [12–14]. work State Key Laboratory of Cotton Biology, Department of Biology, In addition, construction of the ZFN and TALEN vec- Institute of Plant Stress Biology, Henan University, 85 Minglun Street, tors is technically demanding, limiting their widespread Kaifeng 475001, China adoption by the scientific community. In contrast, DNA Zhengzhou Tabacco Research Institute of CNTC, No. 2 Fengyang Street, Zhengzhou 450001, Henan, China targeting in the CRISPR-Cas9 system is provided by a Full list of author information is available at the end of the article © The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/ publi cdoma in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Guo et al. Plant Methods (2018) 14:40 Page 2 of 10 relatively short RNA sequence, the single-guide RNA d in controlled environmental conditions of 21  °C and a (sgRNA), which directs the Cas9 protein to the correct 16-h-light/8-h-dark photoperiod, with the light intensity −2 −1 chromosomal position by base complementary in order of 150  μmol  m s . The seedlings were transferred to to generate DSBs. The target sequence is approximately 20 soil for 15–20 d for DNA extraction in the same environ- base pairs (bp) long and is located directly upstream of a mental conditions, and about 0.03–0.05  g rosette leaves protospacer-adjacent motif (PAM). Although the CRISPR/ were used for DNA extraction. Cas9 system is somewhat limited by the requirement of Seeds of Nicotiana tabacum L. (K326) were obtained a suitable PAM next to the target sequence, its technical from the seed stocks bank in our laboratory (National simplicity compared to the complex protein design and Tobacco Gene Research Center, Zhengzhou, China). engineering tasks associated with ZFNs and TALENs has Seeds were surface-sterilized with bleach containing made it the tool of choice for genome editing [15]. In a very 30% sodium hypochlorite for 30 min and grown on half- short period of time, the CRISPR-Cas9 system has been strength MS media [29] supplemented with 0.6% aga- successfully used to generate precise mutations in multiple rose for 7 d in controlled environmental conditions of crops including cotton, rice, wheat and potato [16–21]. 25  °C and a 16-h-light/8-h-dark photoperiod, with the −2 −1 Most mutations generated by the CRISPR/Cas9 system light intensity of 150  μmol  m s . The seedlings were are either insertions or deletions usually located close transferred to soil for 15-20 d for DNA extraction with to the DSB site that occur 3  bp upstream of the PAM 0.05–0.1  g true leaves. The tobacco plants were grown [15]. A common approach to elucidate the nature of the in a greenhouse maintaining day/night temperature at mutations generated by CRISPR is to amplify a frag- 28/23 °C and 16-h-light/8-h-dark photoperiod. ment of the targeted-gene by polymerase chain reaction (PCR) and sequence the PCR amplicons. The mutagen - Agrobacterium‑mediated tobacco transformation esis efficiency of the CRISPR system varies according to Agrobacterium-mediated tobacco transformation was the plant species and the targeted sequences, therefore performed as previously described [30]. efficient screening strategies are paramount to identify individuals carrying mutations in the T or subsequent CRISPR/Cas9 generations. A number of different approaches have been The CRISPR/Cas9 vectors were provided by Prof. developed in order to screen for mutants including PCR/ Qijun Chen, from China Agricultural University [31]. restriction enzyme (RE) assay, T7 endonuclease I (T7EI) Sequences of each tobacco gene, the PAM sites and assay, surveyor nuclease assay, polyacrylamide gel elec- CRISPR/Cas9-induced mutants or synthesized templates trophoresis (PAGE)-based methods, high-resolution used in all experiments are listed in Additional file 1. melting (HRM) analysis-based assays, fluorescent PCR- capillary gel electrophoresis methods and annealing at PCR critical temperature PCR (ACT-PCR) assays [15, 22–28]. Tobacco genomic DNA (gDNA) was extracted using All of these approaches have been successfully used but a Plant DNA Isolation Kit following manufacturer’s each has a number of limitations including the amount instructions (Foregene, China). gDNA concentration was of time and labour required, cost, low detection specific - measured using a NANoDROP 2000c spectrophotom- ity, expensive equipment requirements or in the case of eter (Thermo scientific). If the PCR product was used for PAGE-based methods, the inability to identify individuals sequencing analysis, PCR amplification reactions were with homozygous mutations. performed using Phanta Max Super-Fidelity DNA Poly- Here, we describe a simple, reliable and inexpensive merase (Vazyme) in a final volume of 20 μL, containing method to screen for the presence of CRISPR-Cas9- 10 μL of 2 × Phanta Max buffer, 1.6 μL of 2.5 mM dNTP induced mutations. The method, named Mutation Sites Mix, 1 μL of forward primer (10  μM), 1 μL of reverse Based Specific Primers PCR (MSBSP-PCR) uses opti - primer (10 μM), 40 ng of gDNA, and 0.4 μL of DNA poly- mized parameters for tandem PCR-based analysis. The merase (1 U/μL). If the PCR product was used for aga- method has been validated by screening CRISPR/Cas9- rose electrophoretic analysis, PCR amplification were induced mutants in T transgenic tobacco plants and T conducted in final volumes of 20 μL, using Taq Master 0 1 transgenic tobacco and Arabidopsis plants. Mix (novoprotein), which contained 10 μL of 2 × Master Mix, 1 μL of forward primer or target primer (10 μM), 1 Methods μL of reverse primer (10 μM) and 40 ng of gDNA. Plant materials PCR amplifications were performed using the fol - Seeds of Arabidopsis thaliana (ecotype Columbia-0) lowing parameters: 95 °C for 5 min; 16–30 cycles (suit- were grown on half-strength Murashige and Skoog media able cycles were chosen for each gene) of 95 °C for 30 s, (MS) [29] supplemented with 0.6% (w/v) agarose for 7 56–65 °C (proper annealing temperature was chosen for Guo et al. Plant Methods (2018) 14:40 Page 3 of 10 gene) for 30 s, and 72 °C for 50 s, with a final extension lines for our research. Figure  1 shows the schematic step of 72  °C for 5  min. In general, 30 cycles are suit- overview of mutant establishment and MSBSP-PCR able for most genes in the first PCR (with two external screening in tobacco. Agrobacterium mediated transfor- primers) with 40  ng gDNA as templates. The products mation is used to produce T transgenic lines containing of the first PCR are analyzed by gel electrophoresis, CRISPR/Cas9 cassettes targeting a specific chromosomal and same amount of the products (1–2 ng) can be used locus. Individual T plants undergo screening to identify as templates of the second PCR, with a target primer those containing mutations by performing two sequen- (T-primer) expanding the sites of the expected CRISPR- tial rounds of PCR amplification. The first PCR reaction Cas9-induced mutations and one of the external prim- is performed using genomic DNA from the T transgenic ers used in the initial amplification. All primers used in plants with two external primers designed to anneal 200- this study are listed in Additional file 2 . 300  bp upstream and downstream from the PAM site respectively (Locus-primer-F/Locus-primer-R, Fig.  1). Results The amplified PCR product is expected to contain the Principles and schematic overview of MSBSP‑PCR targeted locus and any mutations caused by the CRISPR/ The MSBSP-PCR method was initially developed to iden - Cas9 expression cassette and should be analysed by gel tify CRISPR/Cas9-induced mutants in transgenic tobacco electrophoresis. The product of the first amplification Fig. 1 Schematic overview of the Mutation Sites Based Specific Primers PCR (MSBSP-PCR) method to identify CRISPR/Cas9-induced mutants in tobacco. CRISPR/Cas9 constructs were transferred to tobacco plants using Agrobacterium mediated transformation. Genomic DNA from either T or T plants was purified and subjected to a first PCR amplification using Locus-primer-F (forward primer) and Locus-primer-R (reverse primer). 0 1 The products of the primary amplification were then used in a secondary PCR using a Target-primer and the Locus-primer-R. The target primer is a mutation site-specific primer and expands the recognition site for the sgRNA. WT plants and heterozygous mutants will produce an amplification product in the secondary PCR while homozygous/biallelic mutants will not show any amplification Guo et al. Plant Methods (2018) 14:40 Page 4 of 10 (1–2  ng) is then subjected to a second PCR amplifica - the CRTISO-T primer being positioned exactly in the tion using a target primer (T-primer) expanding the site target site for the sgRNA. The design of suitable primers of the expected CRISPR-induced mutation and one of and determination of the optimal annealing temperature the external primers used in the initial amplification. The is highly dependent on the nature of the mutation gen- PCR parameters for this second amplification are critical erated by the CRISPR/Cas9 system and some additional for the success of the method and need to be optimized. optimization might be needed in some cases. To deter- CRISPR/Cas9 produces DSBs 3  bp upstream of the mine the optimal primers and annealing temperatures PAM that is subsequently repaired by the NHEJ cellular in problematic cases, cloning of the amplicon generated machinery. The error prone nature of the NHEJ will typi - in the first PCR (using CRTISO-T and CRTISO-R prim - cally introduce mutations at the repair site, with the most ers) into TA-based plasmids might be needed followed by frequent ones being small (1-3 bp) deletions or insertions sequencing of a number of recombinant bacterial clones [15]. A primer designed to anneal at the recognition site to confirm the nature of the mutation. Bacterial clones of the sgRNA will have an imperfect match in those cases containing a mutation can then be used to optimize the where a mutation has taken place and under stringent PCR parameters in order to distinguish between WT and annealing conditions will fail to produce an amplification mutated templates. product. It is therefore essential to determine the ideal In conclusion, for the first PCR of MSBSP-PCR, anneal - melting temperature (Tm) for the second PCR in a way ing temperature is determined by the locus-primer-F and that it will allow amplification of WT templates but will locus-primer-R Tms and the cycle number should be fail to amplify mutated templates. experimentally determined by performing an amplifica - To verify the feasibility of MSBSP-PCR in the identifi - tion reaction and taking 3–5 μL samples at 20, 25, 30 and cation of CRISPR/Cas9-induced mutations and provide 35 cycles, analyzing them in an electrophoresis gel and clues for the design of suitable target-primers we used the looking for the minimum amount of cycles that yields Nicotiana tabacum prolycopene isomerase 1 gene: NtCR- a single and clear band. To determine the parameters TISO (GenBank accession number XM_016608861.1). for the secondary PCR, Tms for the target-primer and Multiple NtCRTISO primers (Fig. 2a) and templates con- locus-primer-R are calculated and an optimization PCR taining different mutations (Fig.  2b) in the sgRNA target performed using product of the first PCR (WT genomic site were synthesized. The nature of the mutations were DNA as template) and an annealing temperature gradi- small deletions (1–3  bp) in the vicinity of the PAM as it ent with an upper limit of 7–12  °C above the optimal has been reported that these types of deletions are the temperature. The optimal cycle number is determined as most common ones induced by the CRISPR/Cas9 system explained above, by analysing samples by electrophoresis in plants [15]. Five different target-primers were designed at different cycle numbers, looking for the presence of a around the sgRNA recognition site and the optimal clear and single amplicon band. annealing temperature for the MSBSP-PCR reaction established by performing PCR reactions over a tempera- Identification of CRISPR/Cas9‑induced mutants in tobacco ture gradient (Tm = 55–68  °C, 28 cycles, Fig. 2b). When and Arabidopsis by MSBSP‑PCR PCR was performed with the WT NtCRTISO template To verify the usefulness of the MSBSP-PCR method in and the CRTISO-T & CRTISO-R primer combination, real experimental conditions, a CRISPR/Cas9 construct amplification products were observed at all Tms although targeting the NtCRTISO gene (Fig.  2) was cloned in a the intensity of the bands decreased with increasing Tm. binary vector [31], and 39 putative T transgenic tobacco As expected, PCR reactions using the different mutant lines produced by Agrobacterium-mediated transforma- templates and primer combinations produced a variety tion. For each T plant, a fragment containing the tar- of results. While many of the primer combinations pro- geted region in NtCRTISO was amplified from purified duced an amplicon at the minimum tested temperature genomic DNA using the CRTISO-F/CRTISO-R prim- (55  °C) using mutant templates (Fig.  2b and Additional ers (Tm = 53  °C, 30 cycles) (Additional file  5: Fig.  3A). file  3: Fig. 1), some mutation/primer combinations com- As a preliminary step to validate the parameters for the pletely failed to amplify any DNA (see D123, D34, and secondary PCR reaction, the primary amplification D456 with CRTISO-T/CRTISO-R primers in Additional products from each putative T transgenic tobacco line file  4: Fig. 2). In general, very weak or no amplicon bands were cloned into a TA cloning vector and a number of were observed at annealing temperatures above 60  °C, recombinant clones used as templates to perform PCR some primer combinations showed little products even reactions using primers CRTISO-T/CRTISO-R (Tm = at annealing temperatures above 57  °C. The CRTISO-T/ 62 °C, 20 cycles) to determine the presence of mutations. CRTISO-R primer combination proved to be the most As shown in Fig. 3, with gDNA from a putative T trans- efficient in recognizing the presence of mutations with genic tobacco line (line 29 in Additional file  5: Fig.  3) as Guo et al. Plant Methods (2018) 14:40 Page 5 of 10 WT 5′ GTGGTGGACTTCTTGCTAGGTATGG 3′ CRTISO-T 5′ GGTGGACTTCTTGCTAGGTA 3′ CRTISO-T1 5′ GTGGACTTCTTGCTAGGTAT 3′ CRTISO-T2 5′ TGGACTTCTTGCTAGGTATG3′ 3′ CRTISO-T3 5′ TGGTGGACTTCTTGCTAGGT CRTISO-T4 5′ GTGGTGGACTTCTTGCTAGG 3 ′ Melting temperatures ( C) Templates Primers CRTISO-T+CRTISO-R CRTISO-T1+CRTISO-R WT GGTGGACTTCTTGCTAGGTA CRTISO-T2+CRTISO-R CRTISO-T3+CRTISO-R CRTISO-T4+CRTISO-R CRTISO-T1+CRTISO-R D1 GGTGGACTTCTTGCTAGGT* CRTISO-T2+CRTISO-R D12 GGTGGACTTCTTGCTAGG** CRTISO-T+CRTISO-R D123 GGTGGACTTCTTGCTAG*** CRTISO-T+CRTISO-R CRTISO-T1+CRTISO-R D2 GGTGGACTTCTTGCTAGG*A CRTISO-T2+CRTISO-R D3 GGTGGACTTCTTGCTAG*TA CRTISO-T+CRTISO-R D34 GGTGGACTTCTTGCTA**TA CRTISO-T+CRTISO-R D456 GGTGGACTTCTTGC***GTA CRTISO-T+CRTISO-R D5 GGTGGACTTCTTGCT*GGTA CRTISO-T+CRTISO-R D56 GGTGGACTTCTTGC**GGTA CRTISO-T+CRTISO-R CRTISO-T3+CRTISO-R D6 GGTGGACTTCTTGC*AGGTA CRTISO-T4+CRTISO-R CRTISO-T3+CRTISO-R D7 GGTGGACTTCTTG*TAGGTA CRTISO-T4+CRTISO-R D78GGTGGACTTCTT**TAGGTA CRTISO-T+CRTISO-R CRTISO-T2+CRTISO-R D8 GGTGGACTTCTT*CTAGGTA CRTISO-T3+CRTISO-R Fig. 2 PCR amplification of some synthesized mutated templates with different primer combinations. a WT sequence and PCR primers used in the amplification reactions. The CRISPR/Cas9 target sequence (red) and PAM (blue) are shown in the WT sequence. b Gel electrophoresis was used to analyze the PCR products for different templates and primer combinations. Red asterisks denote the position of the nucleotide deletions in the templates template, the amplification products were cloned into a mutations and where further confirmed by sequencing of TA-vector and recombinant bacteria (verified by PCR the clones (Additional file  6: Fig.  4). PCR amplifications with primers of CRTISO-F/CRTISO-R, Fig.  3a, upper using primers CRTISO-F/CRTISO-R (Tm = 53°C, 30 panel) screened for the presence of mutations (Fig.  3a, cycles) were also performed as positive controls (Fig.  3a, bottom panel), the absence of amplification products top panel). Not all bacterium contained mutations in bacterium B3, B6 and B7 indicated the presence of Guo et al. Plant Methods (2018) 14:40 Page 6 of 10 a a M WT B1 B2 B3 B4 B5 B6 B7 B8 B9 MWT1 2 3 4 500 bp Primers: MYB86-F+MYB86-R Primers: CRTISO-F+CRTISO-R 250 bp Primers: MYB86-T+MYB86-R Primers: CRTISO-T+CRTISO-R MWT1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M WT L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 500 bp Primers: GGPPS1-F+GGPPS1-R Primers: CRTISO-F+CRTISO-R 250 bp Primers: GGPPS1-T+GGPPS1-R Primers: CRTISO-T+CRTISO-R Fig. 3 Identification of CRISPR/Cas9-induced crtiso mutants in tobacco by MSBSP-PCR. a Genomic DNA from T plants was used 0 MWT1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 for PCR amplification using primers CRTISO-F and CRTISO-R. The amplification products (with gDNA from a putative T transgenic Primers: RIN4-F+RIN4-R tobacco line as template) were cloned into a TA-vector and recombinant bacteria screened for the presence of mutations at the target site. The absence of amplification product when using the target specific primer CRTISO-T and CRTISO-R denotes the existence Primers: RIN4-T+RIN4-R of a mutation (bacterium B3, B6 and B7 in lower panel). As a positive Fig. 4 Identification of CRISPR/Cas9-induced mutants in tobacco control bacterial clones were also amplified with CRTISO-F and by MSBSP-PCR. a Identification of MYB86 mutants. M, marker; L1-4 CRTISO-R (upper panel). b Genomic DNA from T tobacco transgenic are homozygous/biallelic MYB86 mutant plants. b Identification of lines was amplified by PCR with primers CRTISO-F and CRTISO-R GGPPS1 mutants. M, marker; samples #2 and 3 are homozygous/ (upper panel) and the amplification products subjected to a second biallelic mutant plants. c Identification of RIN4 mutants. M, marker; PCR using CRTISO-T and CRTISO-R primers (lower panel). The absence samples #3, 8 and 15 are homozygous/biallelic RIN4 mutant plants of an amplification product in the second PCR suggests that the transgenic line is homozygous/biallelic (lower panel lane L4) To further test the accuracy of our method, we per- indicating that the putative T transgenic tobacco line formed CRISPR/Cas9-mediated mutagenesis of three was heterozygous. additional tobacco genes, NtMYB86, NtRIN4 and NtG- To directly screen the T transgenic lines, genomic GPPS1, (GenBank accession numbers XM_016625541.1, DNA was used as template for the first round of PCR XM_009803000.1, XM_016593708.1 respectively) and using primers CRTISO-F/CRTISO-R (Tm= 53  °C, 30 analyzed the presence of mutations by MSBSP-PCR. The cycles) (Fig.  3b, top panel) and the same amounts of primers of CRISPR/Cas9 constructs were designed to tar- amplification products (1.2  ng) used as templates in a get each of the three genes (Additional file  2: Table 1) and second PCR using primers CRTISO-T/CRTISO-R (Tm transgenic plants produced via Agrobacterium-mediated = 62  °C, 20 cycles) (Fig.  3b, bottom panel). The absence transformation. Putative T transgenic tobacco plants for of amplification indicated the presence of mutations in all genes were used to extract genomic DNA and screen both alleles, although this method cannot distinguish for the presence of mutations. For NtMYB86 (Nicotiana between homozygous and biallelic mutations. The sec - tabacum transcription factor MYB86), a primary PCR ond PCR analysis of all 39 T plants were shown in Addi- was performed with primers MYB86-F/MYB86-R (Tm tional file  5: Fig. 3B, and further analyzed by sequencing = 54  °C, 30 cycles) (Fig.  4a, upper panel) and the prod- the primary amplification products (primers CRTISO-F/ ucts used for the secondary amplification using primers CRTISO-R). Sequence analysis identified the three plants MYB86-T/MYB86-R (Tm = 62  °C, 30 cycles) (Fig.  4a, previously identified by MSBSP-PCR to be homozygous lower panel). The absence of amplification in the sec - mutants (Additional file  6: Fig.  4A and 4B) while the ondary PCR indicated the presence of homozygous/ remaining 13 plants contained heterozygous mutations biallelic mutations in the examined plants (Fig. 4a, lower (Additional file 6: Fig. 4C). Guo et al. Plant Methods (2018) 14:40 Page 7 of 10 panel, lanes 1–4). Out of 24 T lines analyzed, three were M WT 1 2 3 4 5 6 identified as homozygous/biallelic (Additional file  7: 750 bp Fig.  5) and confirmed by sequencing the products of the primary amplification (Additional file  8: Fig.  6). In Primers: PVY-F+PVY-R the case of NtGGPPS1 (Nicotiana tabacum geranylgera- nyl diphosphate synthase 1), the primary PCR was per- 500 bp formed using primers GGPPS1-F/GGPPS1-R (Tm = 55  °C, 20 cycles) (Fig.  4b, upper panel), the second PCR Primers: PVY-T+PVY-R using primers GGPPS1-T/GGPPS1-R (Tm = 62  °C, 20 cycles) (Fig.  4b, lower panel). Lines containing homozy- 750 bp gous/biallelic mutations were identified by the absence of secondary amplification and verified by sequencing Primers: PVY-F+PVY-R PvuII digestion the primary amplification products (Fig.  4b, lower panel, lanes 2–3). Out of 23 T lines analyzed, three were iden- Fig. 5 Identification of the CRISPR/Cas9-induced mutants in T 0 1 tobacco plants by MSBSP-PCR. A first PCR reaction was conducted tified as homozygous/biallelic (Additional file  9: Fig.  7) with genomic DNA isolated from T transgenic plants using locus and confirmed by sequencing the products of the pri - primers PVY-F and PVY-R (upper panel) and the amplification mary amplification (Additional file  10: Fig.  8). These products used as template for a secondary PCR with the target three homozygous/biallelic lines have the same mutation specific primer PVY-T and PVY-R (middle panel). Lanes 4-6 were (Additional file  10: Fig.  8), an unusual case in CRISPR/ identified as homozygous/biallelic mutants based on the absence of amplification product. To confirm the results of the MSBSP-PCR, Cas9-induced mutations and it might indicate that the the products of the first PCR were digested with PvuII (lower panel). three T transgenic plants were differentiated from the Complete digestion of the amplification product indicates a WT gene same callus. Finally, T plants containing CRISPR/Cas9 sequence ( WT lane); lanes 1-3 show a combination of digested and constructs targeting NtRIN4 (Nicotiana tabacum RPM1- undigested product indicating that the plants were heterozygous. interacting protein 4) were analyzed by performing the The undigested products in lines 4-6 identify the plants as homozygous or biallelic mutants primary PCR with primers RIN4-F/RIN4-R (Tm = 55 °C, 20 cycles) (Fig.  4c, upper panel) and the secondary PCR using primers RIN4-T/RIN4-R (Tm = 63  °C, 25 cycles) (Fig.  4c, lower panel). A total of three lines containing of the amplicon, while samples 1-3 showed a composite homozygous/biallelic mutations were detected (Fig.  4c, pattern of digested and undigested product, identify- lower panel, lanes 3, 8 and 15 and Additional file  11: ing these plants as putative heterozygous (Fig.  5, lower Fig.  9, lanes 5, 7 and 9) and confirmed by sequencing of panel). Consistent with the results of the MSBSP-PCR the primary PCR products (Additional file 12: Fig. 10). analysis, samples 4-6 were not cut by PvuII confirming Aside from the detection of mutations in the T gen- the presence of either homozygous or biallelic muta- eration, it is important to have a quick screening pro- tions. Analysis of 33 T plants by MSBSP-PCR identi- cedure to analyze the T progeny. For this purpose we fied 3 putative homozygous/biallelic mutants (Additional analyzed the segregating population of a T transformant file  13: Fig.  11), and DNA sequencing further confirmed containing a CRISPR/Cas9 cassette targeting the NtPVY that all 3 T plants contained homozygous mutations gene (Eukaryotic translation initiation factor eIF4E−1, (Additional file 14: Fig. 12). GenBank accession number XM_009769718.1). Genomic To test the effectiveness of MSBSP-PCR to screen DNA was isolated from a number of T individuals; the mutants in additional plant species, we obtained a pre- initial PCR was performed using primers PVY-F/PVY-R viously characterized homozygous Arabidopsis mutant (Tm = 53  °C, 30 cycles) (Fig.  5, upper panel) and the produced by CRISPR/Cas9 targeting the AtETC2 gene amplification products subjected to a secondary PCR (Enhancer of TRY and CPC 2; GENE ID AT2G30420) using primers PVY-T/PVY-R (Tm = 65  °C, 16 cycles) [31]. Wild type and homozygous mutant plants were (Fig.  5, middle panel). The absence of amplification grown and primary PCR of the genomic DNA performed products in samples 4, 5 and 6 indicated the presence of using primers ETC2-F/ETC2-R (Tm = 55  °C, 30 cycles) homozygous or biallelic mutations (Fig. 5, middle panel). (Fig.  6, upper panel). Products from the primary PCR The target site for the CRISPR/Cas9 construct used for were used as templates for the secondary PCR using this gene contained a PvuII cleavage site at the predicted ETC2-T/ETC2-R as primers (Tm = 65  °C, 23 cycles) DSB position in order to detect the presence of muta- (Fig.  6, lower panel). As in the case of tobacco, homozy- tions by the destruction of the restriction site. When the gous mutants were identified by the absence of amplifica - products from the primary amplification were digested tion in the secondary PCR (Fig. 6, lower panel lanes 1–2). with PvuII, the WT sample showed complete digestion Guo et al. Plant Methods (2018) 14:40 Page 8 of 10 Moreover, the numbers of cycles in second PCR to M CK 1 2 WT screen CRISPR/Cas9-induced mutants of NtCRTISO, NtMYB86, NtRIN4 and NtGGPPS1 are distinctive, the ETC2-1 proper number of cycles is determined by PCR param- 750 bp eters, including Tm, concentration of template and amplification efficiency of primers. Generally, 23 cycles Primers: ETC2-F+ETC2-R is used for preliminary experiment. If the second PCR obtains large amount of product with both WT and transgenic lines as templates, the number of cycles can 750 bp ETC2-2 be reduced; while the second PCR obtains little amount of product in WT lines, the number of cycles must be Primers: ETC2-T+ETC2-R increased. Fig. 6 Identification of CRISPR/Cas9-induced etc2 mutants in Arabidopsis by MSBSP-PCR. Genomic DNA was amplified by PCR using the locus primers ETC2-F and ETC2-R (upper panel) and the Conclusion amplification products used as template for a second PCR using he We have developed a fast, cheap and easy screening target specific primer ETC2-T and the locus primer ETC2-R (lower method for CRISPR/Cas9 system-induced homozy- panel). M, marker; CK, negative control with ddH O as template. L1 gous/biallelic mutant identification. This method can be and L2, homozygous etc2 mutant plants; WT, wild type used to screen CRISPR/Cas9 system-induced mutant in tobacco and Arabidopsis. Discussion Additional files In this work, we describe the development of MSBSP- PCR, a new method to identify mutants generated by Additional file 1: Sequences of each gene and CRISPR/Cas9-induced the CRISPR/Cas9 system and prove its efficiency in mutants or synthesized templates used in all experiments. tobacco and Arabidopsis. A number of methods are Additional file 2: Table S1. List of primers used in this study. already available to detect CRISPR/Cas9-induced Additional file 3: Fig. 1. The yield of temperature gradient PCR with mutations [12–28], all of which have advantages and different single point mutation templates of NtCRTISO (synthesized) disadvantages. The main advantages of our method and different combination of primers was detected by agarose gel are its technical simplicity, quickness and low cost, it electrophoresis. could be used to screen homozygous/biallelic mutants Additional file 4: Fig. 2. The yield of temperature gradient PCR with different multiple point mutation templates of NtCRTISO (synthesized) from T plants, or the descendants of heterozygous/ and different combination of primers was detected by agarose gel monoalleic mutants. Moreover, the two-round of PCR electrophoresis. enhanced the accuracy and reproducibility of the PCR Additional file 5: Fig. 3. Identification of CRISPR/Cas9-induced crtiso results. In high complexity genomes such as those of mutants in tobacco by MSBSP-PCR. polyploid species, like cotton, tobacco, wheat, etc., PCR Additional file 6: Fig. 4. The sequencing and sequences analysis of differ - amplifications directly with primer set of primer-T and ent clones of NtCRTISO transgenic lines. primer-R and genomic DNA as templates may cause Additional file 7: Fig. 5. Identification of CRISPR/Cas9-induced myb86 mutants in tobacco by MSBSP-PCR. many nonspecific amplification products. On the other hand, the method cannot distinguish between homozy- Additional file 8: Fig. 6. The sequencing and sequences analysis of differ - ent transgenic lines of NtMYB86. gous and biallelic mutations and it is therefore impor- Additional file 9: Fig. 7. Identification of CRISPR/Cas9-induced ggpps1 tant to sequence the target site once the mutated plants mutants in tobacco by MSBSP-PCR. have been identified. It is also critical to carefully deter - Additional file 10: Fig. 8. The sequencing and sequences analysis of dif- mine the stringency conditions in the secondary PCR ferent transgenic lines of NtGGPPS1. in order to distinguish between WT and mutated tem- Additional file 11: Fig. 9. Identification of CRISPR/Cas9-induced rin4 plates. The MSBSP-PCR method is only useful to detect mutants in tobacco by MSBSP-PCR. mutations close and upstream of the PAM, which are Additional file 12: Fig. 10. The sequencing and sequences analysis of the most frequent when using the CRISPR/Cas9 sys- different transgenic lines of NtRIN4. tem. Mutations far from the PAM will require some Additional file 13: Fig. 11. Identification of CRISPR/Cas9-induced pvy mutants in tobacco by MSBSP-PCR. kind of preliminary characterization by PCR ampli- fication of the targeted genomic fragment followed Additional file 14: Fig. 12. The sequencing and sequences analysis of different transgenic lines of NtPVY. by TA cloning and sequencing of multiple recombi- nant clones, thus allowing us to design a proper target primer. Guo et al. Plant Methods (2018) 14:40 Page 9 of 10 Abbreviations 3. Li T, Huang S, Jiang WZ, Wright D, Spalding MH, Weeks DP, et al. TAL MSBSP-PCR: mutation sites based specific primers polymerase chain reac- nucleases ( TALNs): hybrid proteins composed of TAL effectors and Fok I tion; SSN: ssequence-specific nucleases; ZFNs: zinc-finger nucleases; CRISPR: DNA-cleavage domain. Nucleic Acids Res. 2011;39:359–72. Clustered Regularly Interspaced Short Palindromic Repeats; Cas9: CRISPR- 4. Cho SW, Kim S, Kim JM, Kim JS. Targeted genome engineering in associated protein 9; DSBs: double-strand breaks; NHEJ: non-homologous human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol. end joining; sgRNA: single-guide RNA; PAM: protospacer-adjacent motif; HRM: 2013;31:230–2. high-resolution melting; ACT-PCR: annealing at critical temperature PCR; Tm: 5. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-guided melting temperature. human genome engineering via Cas9. Science. 2013;339:823–6. 6. Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, et al. Efficient Authors’ contributions genome editing in zebrafish using a CRISPR-Cas system. Nat Biotech- YM and RW conceived and designed the experiments. JG, KL, and JL per- nol. 2013;31:227–9. formed the experiments. YM, RW, JG, JB, KM and KL analyzed the data. YM, RW, 7. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, et al. JG, KL, KM, FY, RX, CQ and LZ contributed reagents/materials/analytical tools. Breaking the code of DNA binding specificity of TAL-type III effectors. YM, RW, JB, and KL wrote the paper. All authors read and approved the final Science. 2009;326:1509–12. manuscript. 8. Moscou MJ, Bogdanove AJ. A simple cipher governs DNA recognition by TAL effectors. Science. 2009;326:1501. Author details 9. Wood AJ, Lo T W, Zeitler B, Pickle CS, Ralston EJ, Lee AH, et al. Targeted State Key Laboratory of Cotton Biology, Department of Biology, Institute genome editing across species using ZFNs and TALENs. Science. of Plant Stress Biology, Henan University, 85 Minglun Street, Kaifeng 475001, 2011;333:307. China. Zhengzhou Tabacco Research Institute of CNTC, No. 2 Fengyang 10. Joung JK, Sander JD. TALENs: a widely applicable technology for Street, Zhengzhou 450001, Henan, China. School of Life Science, Southwest targeted genome editing. Nat Rev Mol Cell Biol. 2013;14:49–55. University, No. 1, Tiansheng Road, Beibei 400715, Chongqing, China. College 11. Yi P, Li W, Ou G. The application of transcription activator-like effector of Tobacco Science, Henan Agricultural University, No.63 Agriculture Road, nucleases for genome editing in C. elegans. Methods. 2014;68:389–96. Zhengzhou 450002, Henan, China. School of Agriculture and Food Sciences, 12. Urnov FD, Rebar EJ, Holmes MC, Zhang HS, Gregory PD. Genome University of Queensland, Brisbane, QLD, Australia. editing with engineered zinc finger nucleases. Nat Rev Genet. 2010;11:636–46. Acknowledgements 13. Sander JD, Dahlborg EJ, Goodwin MJ, Cade L, Zhang F, Cifuentes D, We thank Prof. Qijun Chen, from China Agricultural University, for providing et al. Selection-free zinc-finger-nuclease engineering by context- the atetc2 seeds and the vectors of CRISPR/Cas9 system. dependent assembly (CoDA). Nat Methods. 2011;8:67–9. 14. Zhang H, Gou F, Zhang J, Liu W, Li Q, Mao Y, et al. TALEN-mediated Competing interests targeted mutagenesis produces a large variety of heritable mutations All the authors declare that they have no competing interests. in rice. Plant Biotechnol J. 2016;14:186–94. 15. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multi- Accession Numbers plex genome engineering using CRISPR/Cas systems. Science. Sequence data of this report have been listed in Additional file 2. NtGGPPS1 2013;339:819–23. (XM_016593708.1); NtCRTISO (XM_016608861.1); NtMYB86 (XM_016625541.1); 16. Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, et al. The CRISPR/Cas9 NtRIN4 (XM_009803000.1); PVY (XM_009769718.1); AtETC2 (AT2G30420). system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J. 2014;12:797–807. Availability of data and materials 17. Wang S, Zhang S, Wang W, Xiong X, Meng F, Cui X. Efficient targeted The datasets supporting the conclusions of this article are included within the mutagenesis in potato by the CRISPR/Cas9 system. Plant Cell Rep. article and its additional files. 2015;34:1473–6. 18. Iqbal Z, Sattar MN, Shafiq M. CRISPR/Cas9: a tool to circumscribe cotton Consent for publication leaf curl disease. Front Plant Sci. 2016;7:475. Not applicable. 19. Zhang Y, Liang Z, Zong Y, Wang Y, Liu J, Chen K, et al. Efficient and transgene-free genome editing in wheat through transient expression Ethics approval and consent to participate of CRISPR/Cas9 DNA or RNA. Nat Commun. 2016;7:12617. Not applicable. 20. Gao W, Long L, Tian X, Xu F, Liu J, Singh PK, et al. Genome editing in cotton with the CRISPR/Cas9 system. Front Plant Sci. 2017;8:1364. Funding 21. Mao Y, Botella JR, Zhu JK. Heritability of CRISPR/Cas9-targeted gene This work was supported by the National Key Research and Development Pro- modifications in plants. Cell Mol Life Sci. 2017;74:1075–93. gram (2016YFD0101006), Science and Technology project (172102110153) of 22. Montgomery J, Wittwer CT, Palais R, Zhou L. Simultaneous mutation Henan Province,Project of the Tobacco Genomic Program 110201501015(JY- scanning and genotyping by high-resolution DNA melting analysis. 02),the National Natural Science Foundation of China (31770300), and the Pro- Nat Protoc. 2007;2:59–66. gram for Innovative Research Team (in Science and Technology) in University 23. Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, et al. Targeted genome of Henan Province (18IRTSTHN023). modification of crop plants using a CRISPR-Cas system. Nat Biotechnol. 2013;31:686–8. 24. Thomas HR, Percival SM, Yoder BK, Parant JM. High-throughput Publisher’s Note genome editing and phenotyping facilitated by high resolution melt- Springer Nature remains neutral with regard to jurisdictional claims in pub- ing curve analysis. PLoS ONE. 2014;9:e114632. lished maps and institutional affiliations. 25. Zhu X, Xu Y, Yu S, Lu L, Ding M, Cheng J, et al. An efficient genotyping method for genome-modified animals and human cells generated Received: 12 February 2018 Accepted: 7 May 2018 with CRISPR/Cas9 system. Sci Rep. 2014;4:6420. 26. Liu WS, Zhu XH, Lei MG, Xia QY, Botella JR, Zhu JK, et al. A detailed pro- cedure for CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana. Sci Bull. 2015;60:1332–47. 27. Ramlee MK, Yan T, Cheung AM, Chuah CT, Li S. High-throughput References genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR- 1. Bibikova M, Beumer K, Trautman JK, Carroll D. Enhancing gene target- capillary gel electrophoresis. Sci Rep. 2015;5:15587. ing with designed zinc finger nucleases. Science. 2003;300:764. 28. Hua Y, Wang C, Huang J, Wang K. A simple and efficient method 2. Porteus MH, Baltimore D. Chimeric nucleases stimulate gene targeting for CRISPR/Cas9-induced mutant screening. J Genet Genom. in human cells. Science. 2003;300:763. 2017;44:207–13. Guo et al. Plant Methods (2018) 14:40 Page 10 of 10 29. Murashige T, Skoog F. A revised medium for rapid growth and bio 31. Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, et al. Egg assays with tobacco tissue cultures. Physiol Plant. 1962;15:473–97. cell-specific promoter-controlled CRISPR/Cas9 efficiently generates 30. Shi Y, Guo J, Zhang W, Jin L, Liu P, Chen X, et al. Cloning of the lycopene homozygous mutants for multiple target genes in Arabidopsis in a single β-cyclase gene in Nicotiana tabacum and its overexpression confers salt generation. Genome Biol. 2015;16:144. and drought tolerance. Int J Mol Sci. 2015;16:30438–57. Ready to submit your research ? Choose BMC and benefit from: fast, convenient online submission thorough peer review by experienced researchers in your field rapid publication on acceptance support for research data, including large and complex data types • gold Open Access which fosters wider collaboration and increased citations maximum visibility for your research: over 100M website views per year At BMC, research is always in progress. Learn more biomedcentral.com/submissions

Journal

Plant MethodsSpringer Journals

Published: May 29, 2018

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off