Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

A novel PBP3 substitution in Haemophilus influenzae confers reduced aminopenicillin susceptibility

A novel PBP3 substitution in Haemophilus influenzae confers reduced aminopenicillin susceptibility Background: Identification and characterization of non-typeable Haemophilus influenzae (NTHi) with reduced susceptibility to β-lactam antibiotics due to mutations in penicillin binding protein 3 (PBP3) is a clinical challenge. We analyzed a blood isolate, NTHi93–57485, that was categorized as aminopenicillin resistant but lacked key amino acid substitutions in PBP3 that have previously been associated with reduced aminopenicillin susceptibility. The significance of an alternative amino acid substitution (Y528H) in this isolate was examined. Results: Site-directed mutagenesis of a β-lactam susceptible H. influenzae (NTHi3655) was performed to introduce the Y528H substitution into wild-type ftsI (encoding for PBP3). Disc diffusion screening and broth microdilution determination Y528H of MICs for β-lactam agents were done with the NTHi3655-PBP3 mutant and were compared with the NTHi3655 wild-type as well as the original clinical isolate NTHi93–57485. Introduction of the Y528H substitution in NTHi3655 resulted in positive screening for β-lactam resistance. MICs for aminopenicillins were increased in the mutant compared to the wild-type. However, the mutant remained susceptible to aminopenicillins according to EUCAST clinical breakpoints (assuming intravenous treatment) and the introduction of Y528H alone did not increase the resistance to the same level as NTHi93–57485. None of the isolates had frame shift insertions in the acrR gene regulating the AcrAB efflux pump. Conclusions: In parallel to the previously well-described PBP3-substitutions R517H and N526K, we demonstrate that Y528H confers reduced aminopenicillin susceptibility. Keywords: Ampicillin - β-lactam resistance - ftsI - Haemophilus influenzae - PBP3 - penicillin binding proteins - site directed mutagenesis Introduction third group with additional substitutions near the Antimicrobial resistance of the respiratory tract pathogen SSN-motif, S385T (group III or III-like) confers a non-typeable Haemophilus influenzae (NTHi) to β-lactam higher-level of antimicrobial resistance, including resist- antibiotics is conferred either by the production of transfer- ance to third-generation cephalosporins [3–5]. The rable β-lactamases or by amino acid substitutions in peni- group II-rPBP3 variants can be further categorized into cillin binding protein 3 (rPBP3), caused by point mutations the subgroups IIa-d or A-G, depending on the pattern of of the ftsI gene [1]. It has also been shown that loss of mutations within ftsI that appear together with N526K repression of the AcrAB efflux pump in combination with [6, 7]. The evidence of correlation between these key rPBP3 may lead to a further increase in resistance [2]. substitutions and resistance phenotype is strong [3, 8], NTHi strains with rPBP3 variants are classified into but the causal evidence of these substitutions as single three main groups (Table 1), based on the substitution determinants of resistance is less convincing. When of two key amino acids occurring near the KTG-motif: Osaki and co-authors applied site-directed mutagen- R517H (clustered as group I) or N526K (group II) [3]. A esis to introduce PBP3 substitutions into a β-lactam susceptible strain (H. influenzae Rd), neither the * Correspondence: john.thegerstrom@med.lu.se introduction of R517H nor N526K could alone ge- Clinical Microbiology, Department of Translational Medicine, Lund nerate mutants that were aminopenicillin resistant University, Jan Waldenströms gata 59, SE-205 02 Malmö, Sweden (ampicillin MIC = 0.25 mg/L for N526K) according to Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Thegerström et al. BMC Microbiology (2018) 18:48 Page 2 of 7 Table 1 The principal groups of rPBP3 in Haemophilus influenzae with their associated amino acid substitutions and susceptibility to ampicillin. The clinical breakpoint for ampicillin is definied as R > 1 mg/L by EUCAST, which means that a subset of NTHi with rPBP3 genotype are still categorized as susceptible. Table modified after Skaare et al. [7] Main rPBP3 Subgroup according Subgroup according to Key amino acid Associated substitutions MIC range of group to Skaare [7] Ubukata [3] and Dabernat [6] substitutions in subgroups Ampicillin (mg/L) Group I R517H 0.5–2 [5] Group II N526K 0.5–8 [5] A IIb N526K D350N M377I A502V V547I N569S B IId N526K I449V V547I N569S C IIb N526K D350N M377I G490E A502V V547I N569S D II- N526K D350N G490E A530S E IIc N526K A502T F IIa N526K – G II- N526K V547I A554T A561E N569S Group III S385T + N526K 1–32 [4] Group III-like S385T + R517H 0.5–2 [5] clinical breakpoints, although a reduced susceptibility (2011). The isolate did not, however, carry any of the compared to the wild-type (WT) isolate was seen [9]. previously described key mutations in ftsI and was there- A screening algorithm to identify rPBP3 strains in fore chosen for further testing. DNA sequencing of fstI routine diagnostics based on disc diffusion with 1 U ben- revealed an alternative amino acid substitution located zylpenicillin is suggested by the European Committee on near the KTG-motif; Y528H (Fig. 1). Antimicrobial Susceptibility Testing (EUCAST) [10]. This For site-directed mutagenesis, a well-characterized, screening algorithm has demonstrated high sensitivity and β-lactam-susceptible isolate (NTHi3655) previously kindly specificity in detecting rPBP3 isolates, although confirma- donated by R. Munson, St Louis, Mo., was chosen [12]. tory testing of actual MIC levels is recommended to deter- This strain was chosen since its full genome sequence is mine if screening-positive isolates are actually resistant [8, known and it has a wtPBP3 sequence identical to that of 11]. Since current clinical breakpoints for aminopenicillins H.influenzae Rd. (accession no. AAZF01000004.1). split the rPBP3 group, this implies that a subset of rPBP3 ATCC49766 (American Type Culture Collection, LGC isolates are still considered susceptible [8](Table 1). standards, Teddington, UK) was used as quality control in Moreover, the breakpoints assume intravenous dosage, the antimicrobial susceptibility testing. All strains were and therefore there is debate on the optimal treatment of cultured on chocolate agar or in brain heart infusion these strains in infections that do not require intravenous (BHI) broth supplemented with 10 μg/ml each of antibiotic therapy. nicotinamide adenine dinucleotide (NAD) and hemin In the present study, we investigated a clinical NTHi overnight at 37°C and 5% CO . All isolates were con- isolate that was aminopenicillin resistant according to firmed as Haemophilus influenzae by Matrix Assisted initial disc diffusion screening and MIC determination, Laser Desorption Ionization Time of Flight (MALDI-TOF, but lacked resistance-defining substitutions in PBP3, and scores > 2). instead had an alternative substitution near the Only microorganisms and no human material were KTG-motif; Y528H. handled in this project. Methods Site-directed mutagenesis (SDM) Bacterial strains and culture conditions Genomic DNA was purified using the GenElute™ Bacterial A clinical blood isolate from Kronoberg County Genomic DNA kit (Sigma-Aldrich, St Louis, MO). The ftsI (Sweden) (NTHi93–57485) was collected as part of rou- gene and its flanking regions were amplified from the WT tine diagnostics at the laboratory of clinical microbiology NTHi3655 by using the Expand™ High Fidelity PCR in Växjö, Sweden. The isolate was screened as β-lactam System (Roche, Mannheim, Germany) and primers listed resistant by disc diffusion, was β-lactamase negative by in Table 2. nitrocefin testing and had an MIC for amoxicillin of The resulting PCR product was cloned into the ® ® 2 mg/L according to the initial Etest (bioMérieux, Marcy pCR-XL-TOPO vector by using TOPO XL PCR cloning l’Etoile, France), and thus aminopenicillin resistant ac- kit (Invitrogen, Carlsbad, CA). The recombinant plasmid cording to EUCAST clinical breakpoints at the time construct was thereafter transformed into Escherichia Thegerström et al. BMC Microbiology (2018) 18:48 Page 3 of 7 Fig. 1 The amino acid sequence of the transpeptidase domain of PBP3 is shown for the wild-type PBP3 strain NTHi3655 as well as for the mutated Y528H strain NTHi3655-PBP3 and the clinical strain NTHi93–57,485 expressing the Y528H substitution. For comparison, the PBP3 sequence of H.influenzae Rd. is also shown (GenBank:U32793). None of the other resistance-associated substitutions listed in Table 1 is present in any of the isolates coli TOP10. The fstI gene was verified by DNA sequen- and 2 mg/L, respectively). Finally, the ftsI gene sequence cing (Eurofins Genomics, Ebersberg, Germany). in the resulting mutant was verified by DNA Site-directed mutagenesis was carried out using Pfu sequencing. Turbo DNA polymerase (Agilent, Santa Clara, CA) and primers outlined in Table 2. The PCR products were Antimicrobial susceptibility testing digested using DpnI (Thermo Scientific, Waltham, MA) Antimicrobial susceptibility testing was performed at the for 1 h at 37 °C. The mutated ftsI gene with confirmed EUCAST development laboratory (Växjö, Sweden). mutation of Y528H was amplified by PCR and Screening for β-lactam resistance with disc diffusion transformed into the recipient strain NTHi3655 using using 1 U of benzylpenicillin (PcG) on fastidious Mueller the protocol by Poje and Redfield [13]. The generated Hinton (MH-F) solid medium was performed with Y528H Y528H mutant (named NTHi3655-PBP3 ) was selected on NTHi93–57,485, NTHi3655 and NTHi3655-PBP3 BHI agar containing NAD and hemin, and increasing [10]. MICs to common β-lactam agents were also deter- concentrations of ampicillin (0, 0.125, 0.25, 0.5, 0.75, 1 mined by broth microdilution (BMD) according to the Table 2 Primers used for PCR amplification, site directed mutagenesis and sequencing of the ftsI and acrR genes Use of primers Forward primer sequence Reverse primer sequence Ampification of full length ftsI gene 5′– CCTGCGTGTTTGAAAGTTGAAAGAGATG – 3’ 5′– AACAAAGTAAGGGCGAGGATATTCCCAAAG – 3’ Introduction of Y528H substitution in ftsI 5′– GAAAATGGACATTATGTAAATAAGCATGTGGCAT 5′– CCCGCAGTAAATGCCACATGCTTATTTACATAAT in NTHi3655 TTACTGCGGG – 3’ GTCCATTTTC – 3’ Amplification and sequencing of the acrR 5′– TTGTGGGTTTACGGCTTACC – 3’ 5′– CCGATGACACCGACAAAAAT – 3’ gene Sequencing of ftsI gene fw1 (using 5′– CCAATAAACTCTACAGTTAAATGCTCGC – 3’ primer walking) Sequencing of ftsI gene fw2 (using 5′– AGCGGACGATAAACACCGAAACTACCA – 3’ primer walking) Sequencing of ftsI gene fw3 (using 5′– ATACTTAAGGTAACATCTTGTGCATCATAT – 3’ primer walking) Induces nucleotide substitution 1582 T > C to change the codon from a tyrosine residue (TAT) to a histidine residue (CAT) Thegerström et al. BMC Microbiology (2018) 18:48 Page 4 of 7 ISO standard 20776–1[14] using MH-F broth [15]. Ab- When Osaki et al. introduced the key residue substitu- sence of β-lactamase production was confirmed by a tion of N526K into the PBP3 of H. influenzae Rd. strain, standard nitrocefin test [16]. ampicillin MIC increased only 1-fold, in good agreement Y528H with our current findings in NTHi3655-PBP3 [9]. Therefore, despite the fact that these two main mutations Growth curves and sequencing of the acrR gene near the KTG-motif managed to reduce aminopenicillin A few colonies of NTHi were resuspended in supple- susceptibility, it seems that additional factors (PBP3-re- mented BHI broth and diluted to a starting OD of lated or unrelated) are required for resistance surpassing 0.05. The bacterial suspension was incubated at 37°C clinical breakpoints. However, the prevalence of the sub- and 5% CO at 200 rpm and OD was measured at in- 2 600 stitution Y528H in clinical isolates seem to be distinctly dicated time points. The acrR gene, which encodes a lower compared with N526K. To the best of our know- regulator of the AcrAB efflux pump was sequenced ledge, the Y528H substitution has only been sporadically using primers stated in Table 2. described in studies where PBP3 has been sequenced, for instance, in two cefuroxime–resistant isolates where it Results appeared together with N526K and S357N [19]. A Site directed mutagenesis of the susceptible strain BLAST-search on publicly available PBP3 sequences on Y528H NTHi3655 yielded a mutant (NTHi3655-PBP3 )with NCBI only identified one other isolate with this mutation an identical transpeptidase PBP3 sequence to that of the (accession no. BAZ92405.1). The Y528H substitution is clinical isolate NTHi93–57485 (Fig. 1). The introduction not included in the PBP3 substitutions previously investi- of the substitution Y528H into a wtPBP3 rendered the gated by site directed mutagenesis [9]. The reasons why Y528H mutant NTHi3655-PBP3 positive in the disc diffu- this mutation seems less prevalent remain to be eluci- sion β-lactam resistance screening algorithm (Table 3). dated. Its introduction into PBP3 did not affect the growth The mutant also demonstrated a one- or two-fold increase rate of our experimental strain, but other manifestations in MICs for aminopenicillins as revealed by susceptibility of reduced bacterial fitness caused by this mutation still testing with broth microdilution (Table 3). However, the have to be conclusively ruled out. Also, it cannot be ruled clinical isolate NTHi93–57485 still had a higher MIC for out that the studied mutation is less efficient and thus less ampicillin (1 mg/L) and cefuroxime (4 mg/L) compared prone to selection by antibiotic treatment. It can be added Y528H with NTHi3655-PBP3 . All strains were β-lactamase to this discussion that the N526K substitution is rarely negative. None of the isolates had any frame shift inser- seen as a lone substitution in PBP3 in clinical isolates with tions in the acrR gene. reduced susceptibility to aminopenicillins. According to BMD, all isolates had MICs that were Even though additional factors may be needed for re- below current clinical breakpoints proposed by sistance according to clinical breakpoints, several prior EUCAST, contrary to the initial Etest results obtained studies have demonstrated the importance of alterations with NTHi93–57485. It has previously been suggested in PBP3 for the development of β-lactam resistance in that gradient tests have a tendency to overestimate MICs Haemophilus influenzae [3, 4, 9]. Group II strains, with in H. influenzae with modified PBP3 [17]. a low-level aminopenicillin resistance, dominate in most studies [1, 7, 20]. 3D modelling has previously suggested Discussion that the N526K substitution lines the active site pocket The introduction of the amino acid substitution Y528H of PBP3, near the catalytic motif of KTG-514 [3]. Given rendered a fully susceptible isolate to become positive in its proximity to this motif, it is likely that the Y528H the benzylpenicillin screening test. It did not, however, substitution also interferes with the active site pocket. restore zone or MIC levels of ampicillin to those of the The proportional increase in recent years in rPBP3 clinical isolate NTHi93–57485. These results mimic the strains together with increasing rates of resistance to findings from site-direction mutagenesis experiments sulfamethoxazole limits the number of treatment op- performed on substitutions N526K and R517H by Osaki tions for common respiratory tract infections, especially et al. [9]. Our results further support the observation in children [20]. Also, current breakpoints for aminope- that mechanisms other than rPBP3, β-lactamase produc- nicillins assume intravenous dosage, whereas in everyday tion or dysregulation of the AcrAB efflux pump affect treatment of less severe infections, oral amoxicillin is susceptibility to β-lactams in H. influenzae. Interestingly, often used. Pharmacokinetic simulations suggest that we also noted a reduced growth rate in NTHi93–57485 even a high oral amoxicillin dose (750 mg tid) does not (Additional file 1) compared with NTHi3655 and always result in 40% fT > MIC (including 2 standard de- Y528H NTHi3655-PBP3 . Decreased fitness as shown by viations) for an isolate with an MIC of 1 mg/L [21]. Due slower growth rates has been shown to correlate with to this, there is debate whether low-rPBP3 strains that antimicrobial resistance in other bacterial species [18]. are considered as susceptible according to clinical Thegerström et al. BMC Microbiology (2018) 18:48 Page 5 of 7 Table 3 Results of screening for β-lactam resistance and susceptibility testing to various β-lactam antibiotics by BMD Strain ID Geno- Zone diameter Screening Susceptible to MIC MIC MIC amoxicillin MIC MIC MIC MIC MIC mero- β- a b type PCG 1 U (mm) phenotype amino-penicillins amoxicillin ampicillin clavulanic acid cefotaxime ceftriaxone cefuroxime imipenem penem lactamase NTHi3655 Wild- 16 Susceptible Susceptible 0.5 ≤0.25 ≤0.25 ≤0.015 ≤0.015 1 0.5 0.06 Negative type NTHi3655- Y528H 11 Resistant Susceptible 1 0.5 1 ≤0.015 ≤0.015 1 1 0.06 Negative Y528H PBP3 NTHi93– Y528H 6 Resistant Susceptible 1 1 1 0.06 ≤0.015 4 0.5 0.06 Negative As interpreted by EUCAST clinical breakpoints for benzylpenicillin 1 U screening with a zone diameter < 12 mm categorized as resistant Interpreted by EUCAST clinical breakpoints where ampicillin MIC > 1 mg/ L and Amoxicillin MIC > 2 mg/ L are categorized as resistant (assuming i.v. treatment) MIC in mg/ L determined by BMD Thegerström et al. BMC Microbiology (2018) 18:48 Page 6 of 7 breakpoints can be safely treated with oral amoxicillin in Ethics approval and consent to participate Not applicable. Only microorganisms and no human material were handled clinical practice, where a dose of 500 mg tid is com- as part of this project. monly used. Until clinical studies have been performed to address this issue, there is a case for inclusive screen- Competing interests The authors declare that they have no competing interests. ing regimes. Publisher’sNote Conclusions Springer Nature remains neutral with regard to jurisdictional claims in In conclusion, we have identified a novel published maps and institutional affiliations. PBP3-mutation, Y528H, that affects aminopenicillin sus- Author details ceptibility in H. influenzae, and this mutation should be 1 Clinical Microbiology, Department of Translational Medicine, Lund added to rPBP3-defining substitutions. It is clear that University, Jan Waldenströms gata 59, SE-205 02 Malmö, Sweden. EUCAST Development Laboratory, Central Hospital Växjö, SE-351 85 Växjö, Sweden. mechanisms other than β-lactamase production, point mutations in PBP3 or dysregulation of the AcrAB efflux Received: 5 January 2018 Accepted: 23 May 2018 pump can contribute to reduced β-lactam susceptibility. References 1. Tristram S, Jacobs MR, Appelbaum PC. Antimicrobial resistance in Additional file Haemophilus influenzae. Clin Microbiol Rev. 2007;20(2):368–89. 2. Kaczmarek FS, Gootz TD, Dib-Hajj F, Shang W, Hallowell S, Cronan M. Additional file 1: Growth curves demonstrate that the clinical strain Genetic and molecular characterization of beta-lactamase-negative NTHi93–57,485 has a slower growth rate than the rPBP3 WT strain ampicillin-resistant Haemophilus influenzae with unusually high resistance Y528H NTHi3655 and the corresponding mutant NTHi3655-PBP3 . Mean to ampicillin. Antimicrob Agents Chemother. 2004;48(5):1630–9. values from 3 separate experiments are shown. Error bars represent 3. Ubukata K, Shibasaki Y, Yamamoto K, Chiba N, Hasegawa K, Takeuchi Y, standard error of the mean (SEM). Circles represent NTHi3655, squares Sunakawa K, Inoue M, Konno M. Association of amino acid substitutions in Y528H represent NTHi3655-PBP3 and triangles represent NTHi93–57,485. penicillin-binding protein 3 with beta-lactam resistance in beta-lactamase- (DOCX 72 kb) negative ampicillin-resistant Haemophilus influenzae. Antimicrob Agents Chemother. 2001;45(6):1693–9. 4. Hotomi M, Fujihara K, Billal DS, Suzuki K, Nishimura T, Baba S, Yamanaka N. Abbreviations Genetic characteristics and clonal dissemination of beta-lactamase-negative BHI: brain heart infusion (broth and solid medium); BMD: Broth Microdilution; ampicillin-resistant Haemophilus influenzae strains isolated from the upper EUCAST: European Committee on Antimicrobial Susceptibility Testing; fT> respiratory tract of patients in Japan. Antimicrob Agents Chemother. 2007; MIC: The amount of time in which free or non-protein-bound antimicrobial 51(11):3969–76. concentration exceeds the minimum inhibitory concentration (MIC) of the 5. Garcia-Cobos S, Campos J, Lazaro E, Roman F, Cercenado E, Garcia-Rey C, organism; MALDI-TOF: Matrix Assisted Laser Desorption Ionization - Time of Perez-Vazquez M, Oteo J, de Abajo F. Ampicillin-resistant non-beta- Flight; MH-F: fastidious Mueller Hinton (broth and solid medium); lactamase-producing Haemophilus influenzae in Spain: recent emergence MIC: Minimal inhibitory concentration; NAD: nicotinamide adenine of clonal isolates with increased resistance to cefotaxime and cefixime. dinucleotide; NTHi: non-typeable Haemophilus influenzae; PBP3: Penicillin Antimicrob Agents Chemother. 2007;51(7):2564–73. Binding Protein 3; PcG: Benzylpenicillin; rPBP3: PBP3 mediated resistance 6. Dabernat H, Delmas C, Seguy M, Pelissier R, Faucon G, Bennamani S, present (‘Resistant’ PBP3); wtPBP3: wild type PBP3 Pasquier C. Diversity of beta-lactam resistance-conferring amino acid substitutions in penicillin-binding protein 3 of Haemophilus influenzae. Acknowledgements Antimicrob Agents Chemother. 2002;46(7):2208–18. The authors would like to thank Stina Bengtsson who did the initial 7. Skaare D, Allum AG, Anthonisen IL, Jenkins A, Lia A, Strand L, Tveten Y, sequencing of the transpeptidase domain of the ftsI gene in the isolate Kristiansen BE. Mutant ftsI genes in the emergence of penicillin-binding NTHi93-57485. protein-mediated beta-lactam resistance in Haemophilus influenzae in Norway. Clin Microbiol Infec. 2010;16(8):1117–24. 8. Skaare D, Lia A, Hannisdal A, Tveten Y, Matuschek E, Kahlmeter G, Funding Kristiansen BE. Haemophilus influenzae with non-Beta-lactamase-mediated This work was supported by grants from Foundation of Anna and Edwin Beta-lactam resistance: easy to find but hard to categorize. J Clin Microbiol. Berger; the Swedish Medical Research Council (grant number K2015-57X- 2015;53(11):3589–95. 03163-43-4, http://www.vr.se); Forssman’s foundation (Physiographical Society 9. Osaki Y, Sanbongi Y, Ishikawa M, Kataoka H, Suzuki T, Maeda K, Ida T. Lund) and Skåne County Council’s research and development foundation. Genetic approach to study the relationship between penicillin-binding The study bodies had no role in study design, sample collection, analysis of protein 3 mutations and Haemophilus influenzae beta-lactam resistance by data or writing of the manuscript. using site-directed mutagenesis and gene recombinants. Antimicrob Agents Chemother. 2005;49(7):2834–9. Availability of data and materials 10. The European Committee on Antimicrobial Susceptibility Testing. Y528H The nucleotide sequences of ftsI in the isolates NTHi3655-PBP3 and Breakpoint tables for interpretation of MICs and zone diameters. Version. 8: NTHi93–57,485 have been deposited in GenBank under accession no. 0. http://www.eucast.org/ MG366893 and MG366894. The nucleotide sequences of acrR for isolates 11. Sondergaard A, Petersen MT, Fuursted K, Norskov-Lauritsen N. Detection of Y528H NTHi93–57,485 and NTHi3655-PBP3 have been deposited in GenBank N526K-substituted penicillin-binding protein 3 conferring low-level under accession no. MG366895 and MG366896. mutational resistance to beta-lactam antibiotics in Haemophilus influenzae by disc diffusion testing on Mueller-Hinton agar according to EUCAST Authors’ contributions guidelines. The J Antimicrob Chemother. 2012;67(6):1401–4. JT conducted all the experiments apart from the antimicrobial susceptibility 12. Melhus A, Janson H, Westman E, Hermansson A, Forsgren A, Prellner K. testing, analyzed the data and wrote the first draft of the manuscript, EM Amoxicillin treatment of experimental acute otitis media caused by performed the antimicrobial susceptibility testing, YCS and KR contributed to Haemophilus influenzae with non-beta-lactamase-mediated resistance to study design and critically reviewed the manuscript, FR conceived and beta-lactams: aspects of virulence and treatment. Antimicrob Agents coordinated the study. All authors have read and approved the manuscript. Chemother. 1997;41(9):1979–84. Thegerström et al. BMC Microbiology (2018) 18:48 Page 7 of 7 13. Poje G, Redfield RJ. Transformation of Haemophilus influenzae. Methods in molecular medicine. 2003;71:57–70. 14. International Standards Organisation. Reference method for testing the in vitro activity of antimicrobial agents against rapidly growing aerobic bacteria involved in infectious diseases. ISO. 1996:20776–1. 15. The European Committee on Antimicrobial Susceptibility Testing. Media preparation for EUCAST disk diffusion testing and for determination of MIC values by the broth microdilution method. v 4.0, 2014. http://www.eucast.org/, last Accessed 03 Mar 2017. 16. O'Callaghan CH, Morris A, Kirby SM, Shingler AH. Novel method for detection of beta-lactamases by using a chromogenic cephalosporin substrate. Antimicrob Agents Chemother. 1972;1(4):283–8. 17. Karlsson C VA, Matuschek E, Skaare D and Kahlmeter G. : Evaluation of Etest, M.I.C.E. and MIC Test Strip beta-lactam gradient tests for beta-lactamase negative Haemophilus influenzae with beta-lactam resistance due to PBP3 substitutions. 26th ECCMID, Amsterdam, the Netherlands, 2016. 18. Andersson DI, Hughes D. Antibiotic resistance and its cost: is it possible to reverse resistance? Nat Rev Microbiol. 2010;8(4):260–71. 19. Straker K, Wootton M, Simm AM, Bennett PM, MacGowan AP, Walsh TR. Cefuroxime resistance in non-beta-lactamase Haemophilus influenzae is linked to mutations in ftsI. J Antimicrob Chemother. 2003;51(3):523–30. 20. Resman F, Ristovski M, Forsgren A, Kaijser B, Kronvall G, Medstrand P, Melander E, Odenholt I, Riesbeck K. Increase of beta-lactam-resistant invasive Haemophilus influenzae in Sweden, 1997 to 2010. Antimicrob Agents Chemother. 2012;56(8):4408–15. 21. de Velde F, de Winter BC, Koch BC, van Gelder T, Mouton JW. Non-linear absorption pharmacokinetics of amoxicillin: consequences for dosing regimens and clinical breakpoints. J Antimicrob Chemother. 2016;71(10): 2909–17. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png BMC Microbiology Springer Journals

A novel PBP3 substitution in Haemophilus influenzae confers reduced aminopenicillin susceptibility

Download PDF
7 pages

Loading next page...
 
/lp/springer_journal/a-novel-pbp3-substitution-in-haemophilus-influenzae-confers-reduced-BNPteI2kho

References (21)

Publisher
Springer Journals
Copyright
Copyright © 2018 by The Author(s).
Subject
Life Sciences; Microbiology; Biological Microscopy; Mycology; Parasitology; Virology; Life Sciences, general
eISSN
1471-2180
DOI
10.1186/s12866-018-1196-6
Publisher site
See Article on Publisher Site

Abstract

Background: Identification and characterization of non-typeable Haemophilus influenzae (NTHi) with reduced susceptibility to β-lactam antibiotics due to mutations in penicillin binding protein 3 (PBP3) is a clinical challenge. We analyzed a blood isolate, NTHi93–57485, that was categorized as aminopenicillin resistant but lacked key amino acid substitutions in PBP3 that have previously been associated with reduced aminopenicillin susceptibility. The significance of an alternative amino acid substitution (Y528H) in this isolate was examined. Results: Site-directed mutagenesis of a β-lactam susceptible H. influenzae (NTHi3655) was performed to introduce the Y528H substitution into wild-type ftsI (encoding for PBP3). Disc diffusion screening and broth microdilution determination Y528H of MICs for β-lactam agents were done with the NTHi3655-PBP3 mutant and were compared with the NTHi3655 wild-type as well as the original clinical isolate NTHi93–57485. Introduction of the Y528H substitution in NTHi3655 resulted in positive screening for β-lactam resistance. MICs for aminopenicillins were increased in the mutant compared to the wild-type. However, the mutant remained susceptible to aminopenicillins according to EUCAST clinical breakpoints (assuming intravenous treatment) and the introduction of Y528H alone did not increase the resistance to the same level as NTHi93–57485. None of the isolates had frame shift insertions in the acrR gene regulating the AcrAB efflux pump. Conclusions: In parallel to the previously well-described PBP3-substitutions R517H and N526K, we demonstrate that Y528H confers reduced aminopenicillin susceptibility. Keywords: Ampicillin - β-lactam resistance - ftsI - Haemophilus influenzae - PBP3 - penicillin binding proteins - site directed mutagenesis Introduction third group with additional substitutions near the Antimicrobial resistance of the respiratory tract pathogen SSN-motif, S385T (group III or III-like) confers a non-typeable Haemophilus influenzae (NTHi) to β-lactam higher-level of antimicrobial resistance, including resist- antibiotics is conferred either by the production of transfer- ance to third-generation cephalosporins [3–5]. The rable β-lactamases or by amino acid substitutions in peni- group II-rPBP3 variants can be further categorized into cillin binding protein 3 (rPBP3), caused by point mutations the subgroups IIa-d or A-G, depending on the pattern of of the ftsI gene [1]. It has also been shown that loss of mutations within ftsI that appear together with N526K repression of the AcrAB efflux pump in combination with [6, 7]. The evidence of correlation between these key rPBP3 may lead to a further increase in resistance [2]. substitutions and resistance phenotype is strong [3, 8], NTHi strains with rPBP3 variants are classified into but the causal evidence of these substitutions as single three main groups (Table 1), based on the substitution determinants of resistance is less convincing. When of two key amino acids occurring near the KTG-motif: Osaki and co-authors applied site-directed mutagen- R517H (clustered as group I) or N526K (group II) [3]. A esis to introduce PBP3 substitutions into a β-lactam susceptible strain (H. influenzae Rd), neither the * Correspondence: john.thegerstrom@med.lu.se introduction of R517H nor N526K could alone ge- Clinical Microbiology, Department of Translational Medicine, Lund nerate mutants that were aminopenicillin resistant University, Jan Waldenströms gata 59, SE-205 02 Malmö, Sweden (ampicillin MIC = 0.25 mg/L for N526K) according to Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Thegerström et al. BMC Microbiology (2018) 18:48 Page 2 of 7 Table 1 The principal groups of rPBP3 in Haemophilus influenzae with their associated amino acid substitutions and susceptibility to ampicillin. The clinical breakpoint for ampicillin is definied as R > 1 mg/L by EUCAST, which means that a subset of NTHi with rPBP3 genotype are still categorized as susceptible. Table modified after Skaare et al. [7] Main rPBP3 Subgroup according Subgroup according to Key amino acid Associated substitutions MIC range of group to Skaare [7] Ubukata [3] and Dabernat [6] substitutions in subgroups Ampicillin (mg/L) Group I R517H 0.5–2 [5] Group II N526K 0.5–8 [5] A IIb N526K D350N M377I A502V V547I N569S B IId N526K I449V V547I N569S C IIb N526K D350N M377I G490E A502V V547I N569S D II- N526K D350N G490E A530S E IIc N526K A502T F IIa N526K – G II- N526K V547I A554T A561E N569S Group III S385T + N526K 1–32 [4] Group III-like S385T + R517H 0.5–2 [5] clinical breakpoints, although a reduced susceptibility (2011). The isolate did not, however, carry any of the compared to the wild-type (WT) isolate was seen [9]. previously described key mutations in ftsI and was there- A screening algorithm to identify rPBP3 strains in fore chosen for further testing. DNA sequencing of fstI routine diagnostics based on disc diffusion with 1 U ben- revealed an alternative amino acid substitution located zylpenicillin is suggested by the European Committee on near the KTG-motif; Y528H (Fig. 1). Antimicrobial Susceptibility Testing (EUCAST) [10]. This For site-directed mutagenesis, a well-characterized, screening algorithm has demonstrated high sensitivity and β-lactam-susceptible isolate (NTHi3655) previously kindly specificity in detecting rPBP3 isolates, although confirma- donated by R. Munson, St Louis, Mo., was chosen [12]. tory testing of actual MIC levels is recommended to deter- This strain was chosen since its full genome sequence is mine if screening-positive isolates are actually resistant [8, known and it has a wtPBP3 sequence identical to that of 11]. Since current clinical breakpoints for aminopenicillins H.influenzae Rd. (accession no. AAZF01000004.1). split the rPBP3 group, this implies that a subset of rPBP3 ATCC49766 (American Type Culture Collection, LGC isolates are still considered susceptible [8](Table 1). standards, Teddington, UK) was used as quality control in Moreover, the breakpoints assume intravenous dosage, the antimicrobial susceptibility testing. All strains were and therefore there is debate on the optimal treatment of cultured on chocolate agar or in brain heart infusion these strains in infections that do not require intravenous (BHI) broth supplemented with 10 μg/ml each of antibiotic therapy. nicotinamide adenine dinucleotide (NAD) and hemin In the present study, we investigated a clinical NTHi overnight at 37°C and 5% CO . All isolates were con- isolate that was aminopenicillin resistant according to firmed as Haemophilus influenzae by Matrix Assisted initial disc diffusion screening and MIC determination, Laser Desorption Ionization Time of Flight (MALDI-TOF, but lacked resistance-defining substitutions in PBP3, and scores > 2). instead had an alternative substitution near the Only microorganisms and no human material were KTG-motif; Y528H. handled in this project. Methods Site-directed mutagenesis (SDM) Bacterial strains and culture conditions Genomic DNA was purified using the GenElute™ Bacterial A clinical blood isolate from Kronoberg County Genomic DNA kit (Sigma-Aldrich, St Louis, MO). The ftsI (Sweden) (NTHi93–57485) was collected as part of rou- gene and its flanking regions were amplified from the WT tine diagnostics at the laboratory of clinical microbiology NTHi3655 by using the Expand™ High Fidelity PCR in Växjö, Sweden. The isolate was screened as β-lactam System (Roche, Mannheim, Germany) and primers listed resistant by disc diffusion, was β-lactamase negative by in Table 2. nitrocefin testing and had an MIC for amoxicillin of The resulting PCR product was cloned into the ® ® 2 mg/L according to the initial Etest (bioMérieux, Marcy pCR-XL-TOPO vector by using TOPO XL PCR cloning l’Etoile, France), and thus aminopenicillin resistant ac- kit (Invitrogen, Carlsbad, CA). The recombinant plasmid cording to EUCAST clinical breakpoints at the time construct was thereafter transformed into Escherichia Thegerström et al. BMC Microbiology (2018) 18:48 Page 3 of 7 Fig. 1 The amino acid sequence of the transpeptidase domain of PBP3 is shown for the wild-type PBP3 strain NTHi3655 as well as for the mutated Y528H strain NTHi3655-PBP3 and the clinical strain NTHi93–57,485 expressing the Y528H substitution. For comparison, the PBP3 sequence of H.influenzae Rd. is also shown (GenBank:U32793). None of the other resistance-associated substitutions listed in Table 1 is present in any of the isolates coli TOP10. The fstI gene was verified by DNA sequen- and 2 mg/L, respectively). Finally, the ftsI gene sequence cing (Eurofins Genomics, Ebersberg, Germany). in the resulting mutant was verified by DNA Site-directed mutagenesis was carried out using Pfu sequencing. Turbo DNA polymerase (Agilent, Santa Clara, CA) and primers outlined in Table 2. The PCR products were Antimicrobial susceptibility testing digested using DpnI (Thermo Scientific, Waltham, MA) Antimicrobial susceptibility testing was performed at the for 1 h at 37 °C. The mutated ftsI gene with confirmed EUCAST development laboratory (Växjö, Sweden). mutation of Y528H was amplified by PCR and Screening for β-lactam resistance with disc diffusion transformed into the recipient strain NTHi3655 using using 1 U of benzylpenicillin (PcG) on fastidious Mueller the protocol by Poje and Redfield [13]. The generated Hinton (MH-F) solid medium was performed with Y528H Y528H mutant (named NTHi3655-PBP3 ) was selected on NTHi93–57,485, NTHi3655 and NTHi3655-PBP3 BHI agar containing NAD and hemin, and increasing [10]. MICs to common β-lactam agents were also deter- concentrations of ampicillin (0, 0.125, 0.25, 0.5, 0.75, 1 mined by broth microdilution (BMD) according to the Table 2 Primers used for PCR amplification, site directed mutagenesis and sequencing of the ftsI and acrR genes Use of primers Forward primer sequence Reverse primer sequence Ampification of full length ftsI gene 5′– CCTGCGTGTTTGAAAGTTGAAAGAGATG – 3’ 5′– AACAAAGTAAGGGCGAGGATATTCCCAAAG – 3’ Introduction of Y528H substitution in ftsI 5′– GAAAATGGACATTATGTAAATAAGCATGTGGCAT 5′– CCCGCAGTAAATGCCACATGCTTATTTACATAAT in NTHi3655 TTACTGCGGG – 3’ GTCCATTTTC – 3’ Amplification and sequencing of the acrR 5′– TTGTGGGTTTACGGCTTACC – 3’ 5′– CCGATGACACCGACAAAAAT – 3’ gene Sequencing of ftsI gene fw1 (using 5′– CCAATAAACTCTACAGTTAAATGCTCGC – 3’ primer walking) Sequencing of ftsI gene fw2 (using 5′– AGCGGACGATAAACACCGAAACTACCA – 3’ primer walking) Sequencing of ftsI gene fw3 (using 5′– ATACTTAAGGTAACATCTTGTGCATCATAT – 3’ primer walking) Induces nucleotide substitution 1582 T > C to change the codon from a tyrosine residue (TAT) to a histidine residue (CAT) Thegerström et al. BMC Microbiology (2018) 18:48 Page 4 of 7 ISO standard 20776–1[14] using MH-F broth [15]. Ab- When Osaki et al. introduced the key residue substitu- sence of β-lactamase production was confirmed by a tion of N526K into the PBP3 of H. influenzae Rd. strain, standard nitrocefin test [16]. ampicillin MIC increased only 1-fold, in good agreement Y528H with our current findings in NTHi3655-PBP3 [9]. Therefore, despite the fact that these two main mutations Growth curves and sequencing of the acrR gene near the KTG-motif managed to reduce aminopenicillin A few colonies of NTHi were resuspended in supple- susceptibility, it seems that additional factors (PBP3-re- mented BHI broth and diluted to a starting OD of lated or unrelated) are required for resistance surpassing 0.05. The bacterial suspension was incubated at 37°C clinical breakpoints. However, the prevalence of the sub- and 5% CO at 200 rpm and OD was measured at in- 2 600 stitution Y528H in clinical isolates seem to be distinctly dicated time points. The acrR gene, which encodes a lower compared with N526K. To the best of our know- regulator of the AcrAB efflux pump was sequenced ledge, the Y528H substitution has only been sporadically using primers stated in Table 2. described in studies where PBP3 has been sequenced, for instance, in two cefuroxime–resistant isolates where it Results appeared together with N526K and S357N [19]. A Site directed mutagenesis of the susceptible strain BLAST-search on publicly available PBP3 sequences on Y528H NTHi3655 yielded a mutant (NTHi3655-PBP3 )with NCBI only identified one other isolate with this mutation an identical transpeptidase PBP3 sequence to that of the (accession no. BAZ92405.1). The Y528H substitution is clinical isolate NTHi93–57485 (Fig. 1). The introduction not included in the PBP3 substitutions previously investi- of the substitution Y528H into a wtPBP3 rendered the gated by site directed mutagenesis [9]. The reasons why Y528H mutant NTHi3655-PBP3 positive in the disc diffu- this mutation seems less prevalent remain to be eluci- sion β-lactam resistance screening algorithm (Table 3). dated. Its introduction into PBP3 did not affect the growth The mutant also demonstrated a one- or two-fold increase rate of our experimental strain, but other manifestations in MICs for aminopenicillins as revealed by susceptibility of reduced bacterial fitness caused by this mutation still testing with broth microdilution (Table 3). However, the have to be conclusively ruled out. Also, it cannot be ruled clinical isolate NTHi93–57485 still had a higher MIC for out that the studied mutation is less efficient and thus less ampicillin (1 mg/L) and cefuroxime (4 mg/L) compared prone to selection by antibiotic treatment. It can be added Y528H with NTHi3655-PBP3 . All strains were β-lactamase to this discussion that the N526K substitution is rarely negative. None of the isolates had any frame shift inser- seen as a lone substitution in PBP3 in clinical isolates with tions in the acrR gene. reduced susceptibility to aminopenicillins. According to BMD, all isolates had MICs that were Even though additional factors may be needed for re- below current clinical breakpoints proposed by sistance according to clinical breakpoints, several prior EUCAST, contrary to the initial Etest results obtained studies have demonstrated the importance of alterations with NTHi93–57485. It has previously been suggested in PBP3 for the development of β-lactam resistance in that gradient tests have a tendency to overestimate MICs Haemophilus influenzae [3, 4, 9]. Group II strains, with in H. influenzae with modified PBP3 [17]. a low-level aminopenicillin resistance, dominate in most studies [1, 7, 20]. 3D modelling has previously suggested Discussion that the N526K substitution lines the active site pocket The introduction of the amino acid substitution Y528H of PBP3, near the catalytic motif of KTG-514 [3]. Given rendered a fully susceptible isolate to become positive in its proximity to this motif, it is likely that the Y528H the benzylpenicillin screening test. It did not, however, substitution also interferes with the active site pocket. restore zone or MIC levels of ampicillin to those of the The proportional increase in recent years in rPBP3 clinical isolate NTHi93–57485. These results mimic the strains together with increasing rates of resistance to findings from site-direction mutagenesis experiments sulfamethoxazole limits the number of treatment op- performed on substitutions N526K and R517H by Osaki tions for common respiratory tract infections, especially et al. [9]. Our results further support the observation in children [20]. Also, current breakpoints for aminope- that mechanisms other than rPBP3, β-lactamase produc- nicillins assume intravenous dosage, whereas in everyday tion or dysregulation of the AcrAB efflux pump affect treatment of less severe infections, oral amoxicillin is susceptibility to β-lactams in H. influenzae. Interestingly, often used. Pharmacokinetic simulations suggest that we also noted a reduced growth rate in NTHi93–57485 even a high oral amoxicillin dose (750 mg tid) does not (Additional file 1) compared with NTHi3655 and always result in 40% fT > MIC (including 2 standard de- Y528H NTHi3655-PBP3 . Decreased fitness as shown by viations) for an isolate with an MIC of 1 mg/L [21]. Due slower growth rates has been shown to correlate with to this, there is debate whether low-rPBP3 strains that antimicrobial resistance in other bacterial species [18]. are considered as susceptible according to clinical Thegerström et al. BMC Microbiology (2018) 18:48 Page 5 of 7 Table 3 Results of screening for β-lactam resistance and susceptibility testing to various β-lactam antibiotics by BMD Strain ID Geno- Zone diameter Screening Susceptible to MIC MIC MIC amoxicillin MIC MIC MIC MIC MIC mero- β- a b type PCG 1 U (mm) phenotype amino-penicillins amoxicillin ampicillin clavulanic acid cefotaxime ceftriaxone cefuroxime imipenem penem lactamase NTHi3655 Wild- 16 Susceptible Susceptible 0.5 ≤0.25 ≤0.25 ≤0.015 ≤0.015 1 0.5 0.06 Negative type NTHi3655- Y528H 11 Resistant Susceptible 1 0.5 1 ≤0.015 ≤0.015 1 1 0.06 Negative Y528H PBP3 NTHi93– Y528H 6 Resistant Susceptible 1 1 1 0.06 ≤0.015 4 0.5 0.06 Negative As interpreted by EUCAST clinical breakpoints for benzylpenicillin 1 U screening with a zone diameter < 12 mm categorized as resistant Interpreted by EUCAST clinical breakpoints where ampicillin MIC > 1 mg/ L and Amoxicillin MIC > 2 mg/ L are categorized as resistant (assuming i.v. treatment) MIC in mg/ L determined by BMD Thegerström et al. BMC Microbiology (2018) 18:48 Page 6 of 7 breakpoints can be safely treated with oral amoxicillin in Ethics approval and consent to participate Not applicable. Only microorganisms and no human material were handled clinical practice, where a dose of 500 mg tid is com- as part of this project. monly used. Until clinical studies have been performed to address this issue, there is a case for inclusive screen- Competing interests The authors declare that they have no competing interests. ing regimes. Publisher’sNote Conclusions Springer Nature remains neutral with regard to jurisdictional claims in In conclusion, we have identified a novel published maps and institutional affiliations. PBP3-mutation, Y528H, that affects aminopenicillin sus- Author details ceptibility in H. influenzae, and this mutation should be 1 Clinical Microbiology, Department of Translational Medicine, Lund added to rPBP3-defining substitutions. It is clear that University, Jan Waldenströms gata 59, SE-205 02 Malmö, Sweden. EUCAST Development Laboratory, Central Hospital Växjö, SE-351 85 Växjö, Sweden. mechanisms other than β-lactamase production, point mutations in PBP3 or dysregulation of the AcrAB efflux Received: 5 January 2018 Accepted: 23 May 2018 pump can contribute to reduced β-lactam susceptibility. References 1. Tristram S, Jacobs MR, Appelbaum PC. Antimicrobial resistance in Additional file Haemophilus influenzae. Clin Microbiol Rev. 2007;20(2):368–89. 2. Kaczmarek FS, Gootz TD, Dib-Hajj F, Shang W, Hallowell S, Cronan M. Additional file 1: Growth curves demonstrate that the clinical strain Genetic and molecular characterization of beta-lactamase-negative NTHi93–57,485 has a slower growth rate than the rPBP3 WT strain ampicillin-resistant Haemophilus influenzae with unusually high resistance Y528H NTHi3655 and the corresponding mutant NTHi3655-PBP3 . Mean to ampicillin. Antimicrob Agents Chemother. 2004;48(5):1630–9. values from 3 separate experiments are shown. Error bars represent 3. Ubukata K, Shibasaki Y, Yamamoto K, Chiba N, Hasegawa K, Takeuchi Y, standard error of the mean (SEM). Circles represent NTHi3655, squares Sunakawa K, Inoue M, Konno M. Association of amino acid substitutions in Y528H represent NTHi3655-PBP3 and triangles represent NTHi93–57,485. penicillin-binding protein 3 with beta-lactam resistance in beta-lactamase- (DOCX 72 kb) negative ampicillin-resistant Haemophilus influenzae. Antimicrob Agents Chemother. 2001;45(6):1693–9. 4. Hotomi M, Fujihara K, Billal DS, Suzuki K, Nishimura T, Baba S, Yamanaka N. Abbreviations Genetic characteristics and clonal dissemination of beta-lactamase-negative BHI: brain heart infusion (broth and solid medium); BMD: Broth Microdilution; ampicillin-resistant Haemophilus influenzae strains isolated from the upper EUCAST: European Committee on Antimicrobial Susceptibility Testing; fT> respiratory tract of patients in Japan. Antimicrob Agents Chemother. 2007; MIC: The amount of time in which free or non-protein-bound antimicrobial 51(11):3969–76. concentration exceeds the minimum inhibitory concentration (MIC) of the 5. Garcia-Cobos S, Campos J, Lazaro E, Roman F, Cercenado E, Garcia-Rey C, organism; MALDI-TOF: Matrix Assisted Laser Desorption Ionization - Time of Perez-Vazquez M, Oteo J, de Abajo F. Ampicillin-resistant non-beta- Flight; MH-F: fastidious Mueller Hinton (broth and solid medium); lactamase-producing Haemophilus influenzae in Spain: recent emergence MIC: Minimal inhibitory concentration; NAD: nicotinamide adenine of clonal isolates with increased resistance to cefotaxime and cefixime. dinucleotide; NTHi: non-typeable Haemophilus influenzae; PBP3: Penicillin Antimicrob Agents Chemother. 2007;51(7):2564–73. Binding Protein 3; PcG: Benzylpenicillin; rPBP3: PBP3 mediated resistance 6. Dabernat H, Delmas C, Seguy M, Pelissier R, Faucon G, Bennamani S, present (‘Resistant’ PBP3); wtPBP3: wild type PBP3 Pasquier C. Diversity of beta-lactam resistance-conferring amino acid substitutions in penicillin-binding protein 3 of Haemophilus influenzae. Acknowledgements Antimicrob Agents Chemother. 2002;46(7):2208–18. The authors would like to thank Stina Bengtsson who did the initial 7. Skaare D, Allum AG, Anthonisen IL, Jenkins A, Lia A, Strand L, Tveten Y, sequencing of the transpeptidase domain of the ftsI gene in the isolate Kristiansen BE. Mutant ftsI genes in the emergence of penicillin-binding NTHi93-57485. protein-mediated beta-lactam resistance in Haemophilus influenzae in Norway. Clin Microbiol Infec. 2010;16(8):1117–24. 8. Skaare D, Lia A, Hannisdal A, Tveten Y, Matuschek E, Kahlmeter G, Funding Kristiansen BE. Haemophilus influenzae with non-Beta-lactamase-mediated This work was supported by grants from Foundation of Anna and Edwin Beta-lactam resistance: easy to find but hard to categorize. J Clin Microbiol. Berger; the Swedish Medical Research Council (grant number K2015-57X- 2015;53(11):3589–95. 03163-43-4, http://www.vr.se); Forssman’s foundation (Physiographical Society 9. Osaki Y, Sanbongi Y, Ishikawa M, Kataoka H, Suzuki T, Maeda K, Ida T. Lund) and Skåne County Council’s research and development foundation. Genetic approach to study the relationship between penicillin-binding The study bodies had no role in study design, sample collection, analysis of protein 3 mutations and Haemophilus influenzae beta-lactam resistance by data or writing of the manuscript. using site-directed mutagenesis and gene recombinants. Antimicrob Agents Chemother. 2005;49(7):2834–9. Availability of data and materials 10. The European Committee on Antimicrobial Susceptibility Testing. Y528H The nucleotide sequences of ftsI in the isolates NTHi3655-PBP3 and Breakpoint tables for interpretation of MICs and zone diameters. Version. 8: NTHi93–57,485 have been deposited in GenBank under accession no. 0. http://www.eucast.org/ MG366893 and MG366894. The nucleotide sequences of acrR for isolates 11. Sondergaard A, Petersen MT, Fuursted K, Norskov-Lauritsen N. Detection of Y528H NTHi93–57,485 and NTHi3655-PBP3 have been deposited in GenBank N526K-substituted penicillin-binding protein 3 conferring low-level under accession no. MG366895 and MG366896. mutational resistance to beta-lactam antibiotics in Haemophilus influenzae by disc diffusion testing on Mueller-Hinton agar according to EUCAST Authors’ contributions guidelines. The J Antimicrob Chemother. 2012;67(6):1401–4. JT conducted all the experiments apart from the antimicrobial susceptibility 12. Melhus A, Janson H, Westman E, Hermansson A, Forsgren A, Prellner K. testing, analyzed the data and wrote the first draft of the manuscript, EM Amoxicillin treatment of experimental acute otitis media caused by performed the antimicrobial susceptibility testing, YCS and KR contributed to Haemophilus influenzae with non-beta-lactamase-mediated resistance to study design and critically reviewed the manuscript, FR conceived and beta-lactams: aspects of virulence and treatment. Antimicrob Agents coordinated the study. All authors have read and approved the manuscript. Chemother. 1997;41(9):1979–84. Thegerström et al. BMC Microbiology (2018) 18:48 Page 7 of 7 13. Poje G, Redfield RJ. Transformation of Haemophilus influenzae. Methods in molecular medicine. 2003;71:57–70. 14. International Standards Organisation. Reference method for testing the in vitro activity of antimicrobial agents against rapidly growing aerobic bacteria involved in infectious diseases. ISO. 1996:20776–1. 15. The European Committee on Antimicrobial Susceptibility Testing. Media preparation for EUCAST disk diffusion testing and for determination of MIC values by the broth microdilution method. v 4.0, 2014. http://www.eucast.org/, last Accessed 03 Mar 2017. 16. O'Callaghan CH, Morris A, Kirby SM, Shingler AH. Novel method for detection of beta-lactamases by using a chromogenic cephalosporin substrate. Antimicrob Agents Chemother. 1972;1(4):283–8. 17. Karlsson C VA, Matuschek E, Skaare D and Kahlmeter G. : Evaluation of Etest, M.I.C.E. and MIC Test Strip beta-lactam gradient tests for beta-lactamase negative Haemophilus influenzae with beta-lactam resistance due to PBP3 substitutions. 26th ECCMID, Amsterdam, the Netherlands, 2016. 18. Andersson DI, Hughes D. Antibiotic resistance and its cost: is it possible to reverse resistance? Nat Rev Microbiol. 2010;8(4):260–71. 19. Straker K, Wootton M, Simm AM, Bennett PM, MacGowan AP, Walsh TR. Cefuroxime resistance in non-beta-lactamase Haemophilus influenzae is linked to mutations in ftsI. J Antimicrob Chemother. 2003;51(3):523–30. 20. Resman F, Ristovski M, Forsgren A, Kaijser B, Kronvall G, Medstrand P, Melander E, Odenholt I, Riesbeck K. Increase of beta-lactam-resistant invasive Haemophilus influenzae in Sweden, 1997 to 2010. Antimicrob Agents Chemother. 2012;56(8):4408–15. 21. de Velde F, de Winter BC, Koch BC, van Gelder T, Mouton JW. Non-linear absorption pharmacokinetics of amoxicillin: consequences for dosing regimens and clinical breakpoints. J Antimicrob Chemother. 2016;71(10): 2909–17.

Journal

BMC Microbiology – Springer Journals

Published: May 31, 2018

There are no references for this article.