Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You and Your Team.

Learn More →

Transcription factor signal transducer and activator of transcription 6 (STAT6) is an inhibitory factor for adult myogenesis

Transcription factor signal transducer and activator of transcription 6 (STAT6) is an inhibitory... Background: The signal transducer and activator of transcription 6 (STAT6) transcription factor plays a vitally important role in immune cells, where it is activated mainly by interleukin-4 (IL-4). Because IL-4 is an essential cytokine for myotube formation, STAT6 might also be involved in myogenesis as part of IL-4 signaling. This study was conducted to elucidate the role of STAT6 in adult myogenesis in vitro and in vivo. Methods: Myoblasts were isolated from male mice and were differentiated on a culture dish to evaluate the change in STAT6 during myotube formation. Then, the effects of STAT6 overexpression and inhibition on proliferation, differentiation, and fusion in those cells were studied. Additionally, to elucidate the myogenic role of STAT6 in vivo, muscle regeneration after injury was evaluated in STAT6 knockout mice. Results: IL-4 can increase STAT6 phosphorylation, but STAT6 phosphorylation decreased during myotube formation in culture. STAT6 overexpression decreased, but STAT6 knockdown increased the differentiation index and the fusion index. Results indicate that STAT6 inhibited myogenin protein expression. Results of in vivo experiments show that STAT6 knockout mice exhibited better regeneration than wild-type mice 5 days after cardiotoxin-induced injury. It is particularly interesting that results obtained using cells from STAT6 knockout mice suggest that this STAT6 inhibitory action for myogenesis was not mediated by IL-4 but might instead be associated with p38 mitogen- activated protein kinase phosphorylation. However, STAT6 was not involved in the proliferation of myogenic cells in vitro and in vivo. Conclusion: Results suggest that STAT6 functions as an inhibitor of adult myogenesis. Moreover, results suggest that the IL-4-STAT6 signaling axis is unlikely to be responsible for myotube formation. Keywords: Myotube, Myoblast fusion, Differentiation, Primary myoblast, Interleukin-4 Background myofibers in adults, resident myogenic stem cells undergo a The skeletal muscle, which constitutes 40% of human body unique process called myogenesis [3–5]. Upon request, mass, is indispensable for locomotion, respiration, and me- myogenic stem cells are activated and committed to differ- tabolism [1, 2]. Theskeletalmusclecomprises numerous entiation. The activated myogenic stem cells (i.e., myofibers, each of which contains multiple postmitotic myoblasts) subsequently fusetogetherorwith(nascent) myonuclei. During the formation of multinucleated myotubes to form mature myofibers [3, 6–9]. Obstruction of myogenesis inhibits proper muscle regeneration after in- jury, leading to decline of skeletal muscle function [3–5]. * Correspondence: yuji_ogura@marianna-u.ac.jp Many molecules have been presently identified as triggering Department of Physiology, St. Marianna University School of Medicine, and coordinating myogenic differentiation, fusion, and Kawasaki, Kanagawa 216-8511, Japan Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 2 of 14 maturation of myofibers [8, 10, 11]. Nevertheless, the specific mTFP1-expressing mice as described in earlier re- mechanisms have not been fully elucidated. ports of the literature [24, 25]. The expression of mTFP1 The signal transducer and activator of transcription 6 was induced by tamoxifen injection (2 mg/animal, four (STAT6) plays a fundamentally important role in immune consecutive days) at 1 week before isolation. After purifi- cells’ cellular function [12, 13]. For instance, STAT6 is in- cation by preplating, myoblasts were maintained in growth volved in T cell proliferation [14]. Also, its activation pre- medium (GM, 20% fetal bovine serum, 1% penicillin/ vents apoptotic cell death in B cells [15]. It is also involved streptomycin, and Ham’s F-10; Life Technologies Inc., in the fusion of macrophages to generate multinucleated CA, USA). The medium was supplemented with 5 ng/mL giant cells in response to inflammation [16]. Recent stud- basic fibroblast growth factor (Peprotech Inc., NJ, USA). ies have also demonstrated the involvement of STAT6 in When cells attained approximately 90% cellular con- microglial activation in the brain tissue [17]. Nevertheless, fluency, fusion of the myoblasts was induced by switching the role of STAT6 in peripheral tissues remains unclear. from GM to differentiation medium (DM, 2% house Earlier studies have revealed STAT6 as an important tar- serum, 1% penicillin/streptomycin, and Dulbecco’s modi- get of interleukin (IL)-4 in nonmuscle cells [12, 13, 17]. fied Eagle’s medium; Life Technologies Inc.). After IL-4 stimulation, STAT6 gets activated by phosphor- ylation and functions as a transcription factor to promote Adenovirus construction and infection context-dependentgeneexpression[12, 13, 17]. In this re- Adenoviruses carrying mouse STAT6 were generated gard, IL-4 is an essential molecule for myogenesis. Studies (AdEasy Adenoviral Vector System; Agilent Technologies have demonstrated that the nuclear factor of activated T Inc., CA, USA) as described in the literature [25]. Mouse cells 2 (NFATc2), a calcium-sensitive transcription factor, STAT6 was amplified from mouse cDNA and ligated into specifically localizes nascent myotubes and stimulates IL-4 the vector (RedTrack-CMV; Addgene, MA, USA) using secretion during myoblast differentiation [18–21]. The se- the KpnI and XbaI sites. The resulting AdTrack-CMV- creted IL-4 binds to IL-4 receptor alpha (IL-4Rα)onthe STAT6 plasmid was linearized with PmeI; then, it was surrounding myoblasts to promote the fusion of those cotransformed into Escherichia coli BJ5183 cells with the myoblasts with nascent myotubes [21]. These results sug- pAdEasy-1 plasmid. Clones undergoing AdTrack–Adeasy gest that STAT6 is also involved in myotube formation recombination were selected with kanamycin and were under the control of IL-4. Nevertheless, the function of confirmed by enzyme digestion. The recombinant plasmid STAT6 at any stage of myogenesis remains unknown. was linearized with PacI and was transfected into the Therefore, this study was designed to elucidate whether Adeno-X cell line (Clontech, Manassas, VA, USA) using STAT6 can be implicated in adult myogenesis in vitro and Lipofectamine 2000 Transfection Reagent (Life Technolo- in vivo. gies Inc.) packaging into active virus particles. The pro- duced viruses (adenoviral-RFP-STAT6: Ad-STAT6 or Methods adenoviral-RFP-empty: Ad-Ctrl) were amplified further by Animals serial passage to concentrate. At 70% confluence, Adeno- Wild-type (WT) male C57BL/6J mice were purchased from X cells were infected with the virus and were maintained SLC Inc. (Hamamatsu, Shizuoka, Japan). R26-CAG-LoxP- for 72–96 h. The viral titer was found using an RFP- monomeric teal fluorescent protein 1 (mTFP1) mice (B6; positive cell number per field. The number of infectious tm1.1(CAG-mTFP1)Imayo 129S6-Gt (ROSA)26Sor ) were obtained units per milliliter for each well were calculated as (in- from RIKEN (ID: RBRC05147; Tsukuba, Ibaraki, Japan) fected cells/field) × (fields/well)/virus volume (mL) × dilu- T2 tm1(cre/ERT2)Gaka 6 [22]. Pax7-CreER (B6.Cg-Pax7 /J) mice tion factor. For adenovirus infection, myoblasts (1 × 10 ) were purchased from The Jackson Laboratory (ID: 017763; were plated and then infected with either a STAT6 vector ME, USA) [23]. Tamoxifen-inducible muscle stem cell- (Ad-STAT6) or an empty vector (Ad-Ctrl) using the same specific mTFP1-expressing mice were generated by cross- concentration of infectious units for 6 h. After the infec- T2 ing R26-CAG-LoxP-mTFP1 and Pax7-CreER mice. tion period, the infected myoblasts were washed carefully STAT6-knockout (KO) mice (B6;129P2-Stat6<tm1Aki>/ and were then maintained in GM for 48 h. Our adenoviral AkiRbrc) were obtained from RIKEN (ID: RBRC00958) infection had infection efficiency of nearly 100%. [13]. Animals were maintained in an animal facility (25°C, 55% relative humidity, lights on 0600–1800 h). All animals Short hairpin RNA (shRNA) had a BL/6 genetic background and were used at 7–8 Procedures using shRNA were conducted as described in weeks of age. an earlier report [25]. The pLKO.1-mCherry-puro plasmid wasprovidedbyDr. Renzhi Han(TheOhioState Univer- Cell culture sity Wexner Medical Center, OH, USA). Target siRNA se- Primary myoblasts were isolated from the hind limb quences for mouse STAT6 (GGTTCAGATGCTTTCTGT muscles of WT, STAT6-KO, and muscle satellite cell- TAC) were designed using BLOCK-iT RNAi Designer (Life Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 3 of 14 Technologies Inc.). After the synthesized siRNA oligonucle- (Life Technologies Inc.) were used for staining. Myonu- otides (Integrated DNA Technologies, Inc., Coralville, IA, clei were stained with DAPI. Images of stained cells were USA) were annealed, they were inserted into the plasmid captured using a microscope (BZ-9000; Keyence Co.) using AgeI and EcoRI sites. The appropriate plasmid was and were analyzed using Fiji software [27]. The fusion amplified using a standard bacterial culture. Then, the index was defined as the ratio of the number of nuclei in siRNA sequence was validated for the knockdown of myotubes to the number of nuclei in each image. Myo- STAT6 mRNA in preliminary experiments. Control cells nucleus numbers of the myosin cells were also found. were transfected with the backbone plasmid harboring the For each experiment, three randomly captured images scramble sequence (CCTAAGGTTAAGTCGCCCTCG). were analyzed per sample. Plasmid delivery to myoblasts Muscle injury Plasmid DNA was transfected by electroporation (1500 Into the tibialis anterior (TA) muscle of the left leg of V, 10 ms, three pulses) using a transfection system each mouse, 100 μlof10 μM cardiotoxin (Latoxan, (Neon; Life Technologies Inc.) as described for an earlier Valence, France) dissolved in saline was injected [24]. study [26]. Our electroporation procedure routinely Saline was injected into the TA muscle of the right leg achieved 70–80% transfection efficiency at 24 h post- as a vehicle. At 5 days post-injection, both TA muscles transfection [26]. were excised for analyses. IL-4 treatment Morphological analysis Recombinant IL-4 (R&D Systems, Minneapolis, MN, Frozen TA muscles were kept below −20°C and were cut USA) was prepared and used similarly to our earlier using a cryostat (Leica Microsystems GmbH, Wetzler, study [24]. After IL-4 (10 ng/mL) was added to the cul- Germany). Sections were stained with hematoxylin and ture medium in WT and STAT6-KO cells, it was incu- eosin. Images were captured using a microscope (BZ- bated for 48 h. Saline was used as the vehicle. 9000). The cross-sectional area (CSA) was analyzed using Fiji software. The size distribution was evaluated. Evaluation of fusion of myoblasts to nascent myotubes in The average number of central nuclei in regenerated a cell mixing experiment myofibers of the TA muscle was also evaluated for For the cell mixing experiment, we used adenoviral in- fusion efficiency during regeneration. fection to achieve the highest degree of efficiency. The myoblasts isolated from muscle satellite cell-specific mTFP1 and WT mice were grown in GM. Based on Immunohistochemistry procedures used for an earlier study [21], mTFP1 myo- Cryosections (9-μm thickness) were made from injured blasts were seeded in 24-well plates (0.25 × 10 cells per and intact TA muscle. They were fixed with 4% parafor- well) in DM for 48 h to induce myotube formation and maldehyde for 15 min at 25°C. After washing with to allow estimation of myotube–myoblast fusion. The phosphate-buffered saline (PBS), the sections were original protocol used 24 h for pre-DM incubation [21], blocked with a blocking buffer containing 3% BSA, 5% but 48 h was found to be necessary to form visible myo- goat serum, and 0.5% Triton-X for 30 min. After several tubes under our experimental conditions. Simultan- washes with PBS, the sections were incubated with eously, WT myoblasts were infected with either Ad- M.O.M. blocking reagent for 45 min at 25°C (Vector STAT6 or Ad-Ctrl in GM for 6 h. After the cells were Laboratories Inc., Burlingame, CA, USA). After washing washed, the well was replenished with fresh GM. The with PBS, they were incubated with primary antibody cells were then maintained until the following day. After against Pax7 (1:10, clone Pax7; DSHB, University of + + forming mTFP1 myotubes, Ad-STAT6 or Ad-Ctrl RFP Iowa, Iowa City, IA), myogenin (1:10, BD Pharmingen, myoblasts were transferred into the plate to fuse the in- San Jose, CA, USA), and polyclonal anti-laminin (1:200; + 5 fected myoblast to mTFP1 myotubes (0.5 × 10 cells Sigma Chemical Co., St. Louis, MO, USA) in staining per well). They were maintained for a further 48 h. solution (Can get signal hist A; Toyobo Co. Ltd., Osaka, Then, the fusion index and the number of unfused cells Osaka, Japan) for 90 min at 25°C. After washing with were studied by immunocytochemistry. PBS, the slides were incubated with Alexa Fluor 488 (antirabbit)-conjugated and 568 (antimouse)-conjugated Immunocytochemistry secondary antibody (1:1,000, Thermo Fisher Scientific K.K.) Cells were prepared for immunocytochemistry as de- for 30 min at 25°C followed by incubation with DAPI solu- scribed earlier [24]. Primary antibodies specific to the tion (0.01 mg/mL in PBS) for 1 min. After washing, the myosin heavy chain (MyHC, MF-20, 1:50, DSHB) and slides were mounted using a fluorescence medium (Aqua- secondary antibodies conjugated with Alexa Fluor 488 Poly/Mount; Polysciences Inc., Warrington, PA, USA) and Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 4 of 14 were visualized using a digital microscope (BZ-X9000) and calculated as the cell number at 48 h divided by the were analyzed using Fiji software. cell number at 24 h [26]. Western blotting Statistical analyses Samples were homogenized in an ice-cold buffer (50 mM Data are presented as mean ± standard deviation (SD). Tris-Cl, 200 mM NaCl, 50 mM NaF, 0.3% NP-40, pH 8.0) One-way analysis of variance (ANOVA) followed by the with protease and phosphatase inhibitors (Nacalai Tesque Tukey–Kramer multiple comparisons test was used to as- Inc., Chukyo-ku, Kyoto, Japan). The protein concentration sess multiple group data. Unpaired t tests were used for was measured using the bicinchoninic acid (BCA) method comparisons between the two groups. All analyses were (BCA assay kit; Thermo Fisher Scientific K.K.). An equal performed using software (Prism v.8.0; GraphPad Software amount of protein was separated using standard SDS- Inc., CA, USA). Significance was inferred for p < .05. PAGE and was transferred to a PVDF membrane. The membrane was blocked with a blocking reagent (Blocking Results One; Nacalai Tesque Inc.) and was incubated with pri- STAT6 is deactivated during myotube formation, but IL-4 mary antibodies. The primary antibodies used were phos- 641 stimulates STAT6 activity phorylated Tyr -STAT6 (1:1000, #9362; Cell Signaling We first isolated myoblasts from WT mice and incubated Technology Inc., MA, USA), STAT6 (1:2000, #6778; Cell 180 the cells in DM for 24 and 48 h myotube formation to in- Signaling Technology Inc.), phosphorylated Thr / vestigate phosphorylated-STAT6 (p-STAT6) (Fig. 1a). Re- Tyr182-p38 Mitogen-activated protein kinase (MAPK; 1: sults showed that p-STAT6 expression decreased at 24 h 1000, #4511; Cell Signaling Technology Inc.), p38 MAPK after adding DM, which was significant at 48 h. We next (1:1000, #9212; Cell Signaling Technology Inc.), and examined the effects of IL-4 on STAT6 activation. After glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1: the cells were treated with IL-4 during DM incubation for 2000, #2118; Cell Signaling Technology Inc.). Lumines- 48 h, we assessed the p-STAT6 expression in those cells. cence signals by ECL reagent (Bio-rad Laboratories Inc., Results showed that p-STAT6 had been increased signifi- Hercules, CA, USA) were captured using an imaging sys- cantly by IL-4 treatment, indicating that STAT6 is a tem (LAS-4000; Fujifilm Corp., Minato-ku, Tokyo, Japan). downstream target for IL-4 during myotube formation Densitometry analysis was conducted using Fiji software. (Fig. 1b). These results indicate that STAT6 activity is de- creased during normal myogenesis, where endogenous IL- Quantitative reverse transcription—polymerase chain 4 is expected to stimulate STAT6 activation [21, 24]. reaction (QRT-PCR) Details of the protocol have been described in an earlier report [24]. Total RNA from the cells was isolated using STAT6 overexpression impairs myoblast fusion RNA extraction reagent (Sepasol-RNA I Super G; After finding that STAT6 can be activated by IL-4 dur- Nacalai Tesque Inc.) and RNA mini-columns (FATRK ing myotube formation, we aimed to clarify whether 001; Favorgen Biotech Corp., Ping-Tung, Taiwan) ac- STAT6 can be involved in myogenesis. Because IL-4 is cording to the manufacturers’ protocols. The first-strand known to contribute to myoblast fusion, we first specif- cDNA for PCR was generated using a commercially ically examined the link between STAT6 and myoblast available kit (FSQ-301; Toyobo Co. Ltd.). Quantification fusion. STAT6 was overexpressed in myoblasts by the of mRNA expression was performed using a real-time adenoviral vector. At 24 h after infection, the myoblasts PCR system (Step One Plus; Life Technologies Japan were induced to differentiate by the DM for 48 h. Western Ltd., Minato-ku, Tokyo) with Syber green master mix re- blot results confirmed that STAT6 protein expression in- agent (QPS-101; Toyobo Co. Ltd.). For delta–delta Ct creased significantly (Fig. 2aand b),indicating thatSTAT6 analysis, β-Actin or GAPDH mRNA was used as an in- was induced successfully. Phosphorylated-STAT6 levels ternal reference. The primer sequences used for this also exhibited the same trend as those of total STAT6 study are presented in the Supplementary Table. protein (Fig. 2c). We performed immunohistochemical analysis to examine myotube formation (Fig. 2d). The fu- Indirect cell number measurement sion index (Fig. 2e) and diameter (Fig. 2f) of cells overex- Adenovirus-infected cells were grown for 24 and 48 h in pressing STAT6 were significantly lower than those of GM. Cells at each time point were counted (cell counting control cells. STAT6 overexpression increased the per- kit-8 #CK04; Dojindo Laboratories, Kamimashiki-gun, centage of myosin-positive cells possessing a single nu- Kumamoto, Japan) according to the manufacturer’sin- cleus significantly but decreased the percentage of cells structions. The indirect cell number was expressed with possessing three or more nuclei (Fig. 2g). These results in- absolute absorbance at 450 nm (Multiskan MS; Life dicate that overexpression of STAT6 impairs myoblast Technologies Inc.). The proliferation rate was fusion. Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 5 of 14 Fig. 1 STAT6 was deactivated during myogenesis and IL-4 increased STAT6 phosphorylation. a pSTAT6 expression during differentiation. Representative images show Western blot bands for phosphorylated STAT6 (p-STAT6), STAT6, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) n =3.*p < .05 vs. 0 h. b Phosphorylation of STAT6 after IL-4 treatment in cultured myotubes. Representative images of Western blot bands for p-STAT6, STAT6, and GAPDH. n =3. *p < .05 vs. 0 h. Data are presented as mean ± standard deviation (SD) Fig. 2 STAT6 overexpression impaired myoblast fusion. a Representative images of Western blot bands for p-STAT6 and GAPDH. Myoblasts were infected with Ad-Ctrl or Ad-STAT6 adenovirus vector in growth medium (GM). After 24 h, the medium was replaced with a differentiation medium and maintained for 48 h. The cells were then used for Western blot and immunocytochemical analysis. b Relative expression of total STAT6. n =6. *p < .05 vs. Ad-Ctrl. c Relative expression of phosphorylated STAT6. n =6.*p < .05 vs. Ad-Ctrl. d Representative immunostained myotubes positive for MyHC (green). Nuclei were stained with DAPI (blue). Scale bar = 50 μm. e Calculation of the fusion index in the Ad-Ctrl and Ad-STAT6 treatments. f Diameters of myotubes in the Ad-Ctrl and Ad-STAT6 treatments. g Percentages of myosin-positive cells with one, two, and three or more nuclei. n = 6 in each group. *p < .05 vs. Ad-Ctrl. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 6 of 14 STAT6 knockdown improves myoblast fusion STAT6 implicates gene expression related to myoblast Given that STAT6 deactivation is necessary during myo- fusion tube formation, we hypothesized that the inhibition of Several molecules are known to be associated with myo- STAT6 promotes myoblast fusion. To test this hypoth- blast fusion. We next tested whether those fusion-related esis, the myoblasts were transfected using a shSTAT6 molecules might be affected by the experimental modula- vector to knockdown STAT6 and was maintained for 48 tion of STAT6. The respective mRNA expressions of myo- h in GM. Control myoblasts were transfected with an maker [28], myomerger [29], Adam12 [30], β1D-integrin empty vector (i.e., Ctrl). After 48 h, the medium was [31], β1-integrin [32], M-cadherin [33], N-cadherin [34], switched to DM. Then incubation continued for 48 h. caveolin-3 [35], and myoferin [36]werecomparedwith Based on Western blot (Fig. 3a), we confirmed that the myotubes differentiated for 48 h between Ad-Ctrl- expression of STAT6 (Fig. 3b) and of p-STAT6 (Fig. 3c) infected and Ad-STAT6-infected cells. As portrayed in decreased significantly after shRNA transfection at 0 and Fig. 4a, many molecules tended to be lower. Myo- 48 h of incubation in DM. We then conducted an im- maker and myomerger were decreased significantly in munohistochemical analysis to find the levels of myo- Ad-STAT6 cells. By contrast, myomaker, myomerger, tube formation (Fig. 3d). The fusion index was modest β1D-integrin, and caveolin-3 mRNAs were increased but significantly higher in STAT6-knocked-down cells significantly in STAT6-knocked-down cells compared than in Ctrl cells (Fig. 3e). The diameter in STAT6- to those in Ctrl cells (Fig. 4b). These results were knocked-down cells was significantly higher than that in comparable to results of morphological analysis shown Ctrl cells (Fig. 3f). The percentage of myosin-positive in Figs. 2 and 3. cells possessing a single nucleus decreased, although the percentage of cells possessing three or more nuclei in- STAT6 affected the differentiation of myoblasts creased significantly in STAT6-knocked-down cells (Fig. Because STAT6 manipulation was performed in myo- 3g). Collectively, these results suggest an inhibitory role blasts, we next investigated whether STAT6 is also in- of STAT6 in myoblast fusion. volved in myoblast differentiation and proliferation as Fig. 3. STAT6 knockdown improved myoblast fusion. Myoblasts were transfected with empty (Ctrl) or shSTAT6 vectors and grown in GM. After 48 h, the cells were harvested to ascertain p-STAT6, STAT6, and GAPDH levels via Western blotting. a representative images of Western blot bands. Relative protein expression levels of b STAT6 and c p-STAT6. n = 6 per group. *p < .05 vs. Ctrl. d representative immunostained myotubes positive for MyHC (green). Nuclei were stained with DAPI (blue). Scale bar = 50 μm. e Calculation of fusion index in the Ctrl and shSTAT6 treatment. n =4. f Diameters of myotubes in the Ctrl and shSTAT6 treatments. g Percentages of myosin-positive cells. n =4.*p < .05 vs. Ctrl. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 7 of 14 Fig. 4 Expression of mRNA related to myoblast fusion in STAT6-overexpressed and STAT6-knockdown cells. a mRNA expression in the Ad-Ctrl and Ad-STAT6 treatments. n = 4 per group. *p < .05 vs. Ctrl. b mRNA expression in the Ctrl and shSTAT6 treatments. n = 6 per group. *p < .05 vs. Ctrl. Data are presented as mean ± SD Fig. 5 Intervention for STAT6 influences differentiation in culture. a Western blot for myogenin and GAPDH in the Ad-Ctrl and Ad-STAT6 treatments. n =6.*p < .05 vs. Ad-Ctrl. b Western blot for myogenin and GAPDH in the Ctrl and shSTAT6 treatments. n =6.*p < .05 vs. Ctrl. (*) p = .08 vs. Ctrl. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 8 of 14 part of prefusion events. First, myogenin expression was the indirect cell number or proliferation rate between analyzed during DM incubation for 0, 24, and 48 h in Ad-Ctrl and Ad-STAT6 myoblasts (Fig. S2A–S2C). Ad-Ctrl and Ad-STAT6 infected cells. The adenoviral Therefore, STAT6 was not suggestive of implicating infection seemed to induce myogenin expression at 0 h, myoblast proliferation. but the expression was found to have no significant dif- ference between Ad-Ctrl and Ad-STAT6 (Fig. 5a). The STAT6-KO mice exhibit improved regeneration after myogenin expression was decreased significantly in Ad- injury STAT6 cells after 24 h of DM incubation (Fig. 5a). No We examined whether the absence of STAT6 affects difference was found at 48 h (Fig. 5a). On the other adult regenerative myogenesis in vivo, or not. No differ- hand, at 0 and after 48 h of DM incubation, myogenin ence was found in the body mass of WT or STAT6-KO expression was increased significantly in STAT6- mice studied (Fig. 6a). Cardiotoxin in saline was injected knocked-down cells compared to in Ctrl cells (Fig. 5b). into the left TA muscles of WT and STAT6-KO mice to A similar result was obtained at 24 h (p = .08). Although induce muscle injury, followed by regeneration. At 5 thetimecoursechangevariedbetween gain-of-function days post-injection, no difference was found in fiber and loss-of-function conditions, these results suggest that CSA distribution in the right intact TA (Fig. 6b and c). STAT6 was implicated in myogenin expression as an in- However, in the regenerated TA, the percentage of myo- hibitory factor during DM incubation. We next analyzed fibers between 300 and 600 μm was significantly lower, the differentiation index in an identical sample used for whereas the percentage of myofibers of more than 900 fusion index analysis in Figs. 2 and 3. Results show that the μm was significantly higher in STAT6-KO than in WT differentiation index was decreased significantly in Ad- mice (Fig. 6b and d). The average number of central nu- STAT6 myotubes (Fig. S1A) butthatitwas increasedsig- clei in regenerating myofibers of the TA muscle was nificantly in STAT6-knocked-down myotubes (Fig. S1B). found to be significantly higher in STAT6-KO than in Considered collectively, these results suggest that STAT6 WT mice (Fig. 6e). Next, mRNA expression of pax7, plays inhibitory roles in the differentiation program. myogenin, myomaker, embryonic MyHC (eMyHC) , and We also tested the effects of overexpression of STAT6 IL-4 was examined in the regenerated TA muscle. No on myoblast proliferation. Results show no difference in change in pax7 or myomaker mRNA, myogenin or Fig. 6 STAT6 knockout (KO) in mice improved muscle regeneration after injury. a Body mass in WT and STAT6-KO mice. b Representative image of hematoxylin and eosin-stained intact TA muscle and regenerating TA muscle sampled at 5 days after injury from WT and STAT6-KO mice. Scale bar = 50 μm. Size distribution of myofiber cross-sectional area (CSA) in intact TA muscle (c) and injured TA muscle (d). e Average central nuclei number in myofiber of regenerating TA muscle. n =5.*p < .05 vs. WT. f mRNA expression in injured TA muscle. n =5.*p < .05 vs. WT. g Representative image of myogenin staining in injured TA. h Quantification of myogenin cells per myofiber in injured TA. n =5.*p < .05 vs. WT. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 9 of 14 eMyHC mRNA was significantly higher in STAT6-KO stimulation of myotube formation. The myoblasts iso- than in WT mice (Fig. 6f). No difference was found in IL-4 lated from WT and STAT6-KO mice were differentiated mRNA between WT and STAT6-KO mice (Fig. 6f). We also by DM incubation for 48 h with or without IL-4. Then, made a cryosection of TA to examine myogenin cell num- the myotubes were fixed and stained with MyHC and bers using immunohistochemistry. Myogenin cell numbers DAPI to examine the fusion index (Fig. 7a). Results indi- were significantly higher in STAT6-KO mice than in WT cate that IL-4 significantly increased the fusion index in mice (Fig. 6g and h). Altogether, these results indicate that WT cells (Fig. 7b). The fusion index in STAT6-KO cells muscle regeneration after injury was facilitated in STAT6- was significantly higher than that in WT cells irrespect- KO mice by enhancing myogenic differentiation and fusion. ive of IL-4 treatment (Fig. 7b). It is particularly interest- ThecomparableIL-4mRNAlevelsimply that theeffects of ing that the fusion index in STAT6-KO cells with IL-4 IL-4 were comparable between WT and STAT6-KO mice ir- treatment was significantly higher than that in WT cells respective of their regeneration discrepancy. with IL-4 treatment. These results suggest that IL-4 and In a separate analysis, we examined pax7 satellite cell STAT6 independently implicate myotube formation. numbers immunohistochemically (Fig. S3A). We found This finding implies that STAT6 did not mediate a posi- no difference between the numbers obtained for WT tive role of IL-4 in myotube formation. and STAT6-KO mice (Fig. S3B). In light of the results of To ascertain the reasons for the separate influence of cell number analysis shown in Fig. S2, we infer that IL-4 and STAT6, we sought candidate molecules for regu- STAT6 does not influence myogenic cell proliferation. lating myogenesis via STAT6. During this process, we found a discrepancy in p38 MAPK, which is an essential Inhibitory action of STAT6 is independent of IL-4 kinase for myogenesis [37], in those cells by Western blot signaling (Fig. 7c). As expected, IL-4 increased p-STAT6 in WT Using the STAT6-KO mice model, we then sought to cells significantly (Fig. 7d). Also, STAT6 was not detected elucidate whether STAT6 can mediate IL-4-induced in STAT6-KO cells (Fig. 7d). In this situation, p- Fig. 7 IL-4 and STAT6 independently regulated myogenesis. Myoblasts were isolated from WT and STAT6-KO mice and maintained in DM with or without IL-4 treatment. a Representative immunostained myotubes positive for MyHC (green). Nuclei were stained with DAPI (blue). Scale bar = 50 μm. b Quantification of fusion index. n =5.*p < .05. c Representative protein bands for p-STAT6, STAT6, p-p38 MAPK, p38 MAPK, and GAPDH. d p-STAT6 protein expression. n =6.*p < .05 by unpaired t test. UD denotes undetected. e p-p38 MAPK protein expression. *p < .05. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 10 of 14 p38MAPK in STAT6-KO cells was significantly decreased STAT6 overexpression instead of IL-4Rα KO in myo- compared to that in WT cells, irrespective of IL-4 treat- blasts [21]. Isolated mTFP1 myoblasts expressing ment (Fig. 7e). These results implicate p38 MAPK in STAT6 normally were pre-incubated in DM for 48 h to STAT6 during myotube formation. Considering the re- form mTFP1 myotubes. Concomitantly, the WT myo- sults obtained for the fusion index (Fig. 7b), that the re- blasts were infected with either Ad-STAT6 or Ad-Ctrl pressive role of STAT6 in myotube formation is mediated expressing RFP. These RFP myoblasts were then added by p38 MAPK activity, independent of IL-4 action. to mTFP1 myotubes and were maintained for the next + + 48 h to induce fusion of RFP myoblasts to mTFP1 Myoblast–myotube fusion is attenuated in STAT6- myotubes (Fig. 8a). The numbers of mTFP1 mono- overexpressed myoblasts nuclear (i.e., unfused) cells were comparable between We further examined the possibility of an unlikely medi- Ad-STAT6 and Ad-Ctrl cultures (Fig. 8b), suggesting ation of STAT6 in IL-4-induced myotube formation. It that their myotube conditions were comparable. The has been established that IL-4 signaling is important for chimeric myotubes, expected mostly to signify the fusion myoblasts to fuse with myotubes [21]. Therefore, it of adenovirus-infected myoblasts with myotubes, were would be expected that myoblast–myotube fusion can significantly fewer in the Ad-STAT6 treatment (Fig. 8c). be enhanced by STAT6 activation if the IL-4-STAT6 The number of unfused RFP mononuclear cells was sig- axis served as a stimulatory pathway for it. To this end, nificantly higher in the Ad-STAT6 than in the Ad-Ctrl we followed an earlier reported protocol but used culture (Fig. 8d). Therefore, although this experimental Fig. 8 STAT6 overexpression in myoblasts impairs its fusion with myotubes. a Representation of cell mixing assay performed to examine fusion between myoblast and myotubes. Representative images show myotube formation in individual and mixed cultures. Arrows indicate myotubes + + + fused with RFP myoblasts. Arrowheads indicate myotubes that are not fused with RFP myoblasts. Scale bar = 50 μm. Numbers of b mTFP1 and c chimeric cells and d adenovirus-infected RFP cells per field in mixed cultures. n = 6 for each treatment. *p < .05 vs. Ad-Ctrl treatment. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 11 of 14 procedure can not entirely eliminate the possibility of regulator. However, although we found that IL-4 can ac- myoblast–myoblast fusion, results seem to support the tivate STAT6 during myogenesis, results showed that notion that STAT6 does not mediate IL-4-linked pro- STAT6 had an inhibitory rather than a stimulatory effect motion of myoblast fusion. on muscle formation. Indeed, STAT6 activity was de- creased during DM incubation. Results suggest that the Discussion deletion of STAT6 and IL-4 treatment independently Mechanisms underlying myoblast differentiation and fu- improved the fusion index in culture. Moreover, sion remain unclear. Our first-time gain-of-function and STAT6-overexpressed myoblasts showed a lower cap- loss-of-function experiments demonstrated that overex- acity to fuse with myotube under culture conditions. In pression of STAT6 inhibits, whereas excessive inhibition addition, whereas IL-4 KO and IL-4Rα KO mice did not of STAT6 improves, myoblast differentiation and fusion exhibit improved CSA at 8 days of post injury [21], we in vitro. In vivo experiments using STAT6-KO mice observed a greater CSA at 5 days post injury in STAT6- demonstrated that the muscle regeneration process was KO mice than in WT mice. Altogether, these findings improved in the absence of STAT6 expression. Results suggest that the IL-4-STAT6 signaling axis is not re- also demonstrate that inhibition of myogenesis by sponsible for myotube formation. Other mechanisms are STAT6 might not be associated with IL-4. These results expected to control STAT6 activity to attenuate myo- suggest that STAT6 is a protein that negatively regulates genesis. Based on results of earlier studies, multiple mol- adult myogenesis. Figure 9 depicts a putative scheme of ecules are potentially involved in myogenesis, which can these study results. regulate STAT6 in cellular events. For instance, the Results of earlier studies have shown that IL-4 facili- mammalian target of rapamycin (mTOR) inhibits tates fusion in cultured myocytes [19, 21] or that IL-4 STAT6 activity in T cells [39]. Also, mTOR-signaling promotes myogenic differentiation in colon carcinoma- activation is important for myogenesis [40, 41]. Conse- bearing mice [38]. Earlier studies in nonmuscle cell types quently, mTOR activation might inhibit STAT6 signal- have demonstrated that STAT6 is activated primarily by ing during myotube formation. Alternatively, interferon- IL-4 [12, 13]. Therefore, we speculated that STAT6 is in- β can activate STAT6 in hepatoma cells [42]. Because volved in the muscle regeneration process as a positive interferon-β impairs myotube formation [43], interferon- Fig. 9 Putative roles of STAT6 in adult myogenesis. IL-4 can activate STAT6 in myotubes. However, STAT6 inhibits myotube formation. IL-4 improves myoblast fusion independently of STAT6 activity. The IL-4-STAT6 signaling axis therefore does not account for IL-4 related myotube formation processes. The red line is based on results from this study. The black line shows data referred from earlier studies. The dashed line represents unvalidated data Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 12 of 14 β signaling might negatively regulate myogenesis via myogenesis occurs in the embryo. Although we currently STAT6. Some molecules such as interferon-α [42, 44], have no explanation related to this point, it is noteworthy IL-13 [45], and leptin [46] interact with STAT6 in non- that molecular machinery might be largely shared but not muscle cell types. Eventually, further study will be neces- be completely identical between de novo developmental sary to identify molecules that control STAT6 activity in and adult myogenesis [53–55]. myogenesis as an inhibitory factor. The physiological significance of STAT6 inhibitory func- We observed an IL-4-independent decrease in p38 tion during myogenesis remains unknown. One supposition MAPK activity in fusion-facilitated STAT6-KO myo- is that STAT6 adjusts the proper timing of myoblasts for tubes. This decrease suggests a possible relation between myogenic commitment. Myogenesis is tightly regulated STAT6 and p38 MAPK during myogenesis. Actually, the by the sequential activation or deactivation of signaling role of p38 MAPK in myogenesis is complicated: p38 cascades [5, 52]. The dysregulation of the cascades im- MAPK is necessary to execute timely myogenic differen- pairs myofiber formation. Our results demonstrate that tiation by activating myocyte enhancer factor 2 (MEF2) STAT6 activity was evident for predifferentiation. [47] or MyoD and its co-molecule E47 [37]. Also, p38 Then, activity levels decreased along with the induction MAPK mediates inhibition of myogenic cell cycling as a of differentiation. We observed that STAT6 can affect molecular switch to regulate myogenic commitment myogenin expression. Consequently, STAT6 might pre- [48]. These results suggest that p38 MAPK contributes vent the progression of myoblast differentiation and fu- to advancement of myotube formation. By contrast, an sion until the myoblasts enter a fusion-competent state. inhibitory role of p38 MAPK in myogenesis has also At this time, fusion is allowed to proceed by decreasing been suggested. Suelves et al. has demonstrated that in- STAT6 activity. Considering this inference as true, our hibition of p38 MAPK activity increased desmin and α- findings related to myogenesis promotion by STAT6 actin expression in C2C12 myoblast differentiated for 5 inhibition imply a harmful influence of intact myofiber days [49]. Contrary to an earlier report by Llouis et al. formation under practical situations. Consequently, the [37], results of at least one study show that p38 MAPK influence of STAT6 inhibition over the entire adult might mediate the inhibition of E47 activity by mitogen myogenesis period, during which a mature myofiber is and extracellular kinase kinase 1 during differentiation established, must be elucidated. in C2C12 cells [50]. Moreover, Weston et al. has shown that p38 MAPK inhibition activated myogenin promoter Conclusion and increased myogenin and MEF2C gene expression in Results indicate that STAT6 plays an inhibitory role in C2C12 cells [51]. They also demonstrated that p38 myoblast differentiation and fusion in adults. Moreover, MAPK inhibition promoted myogenesis in the distal the results suggest that the facilitation of myotube for- limb or proximal mesenchyme myoblasts [51]. Accord- mation by IL-4 is independent of STAT6. Consequently, ingly, findings obtained from the current study agree STAT6 might be a clinical target to achieve efficient with those of the earlier study [52] because STAT6 in- muscle formation. hibition or deletion stimulated differentiation and fusion with attenuated p38 MAPK activity. A specific link be- Abbreviations ANOVA: Analysis of variance; DAPI: 4′, 6-Diamidino-2-phenylinodole; tween STAT6 and p38 MAPK during myogenesis must DM: Differentiation medium; ECL: Enhanced chemiluminescence; GAPD be clarified. H: Glyceraldehyde-3-phosphate dehydrogenase; GM: Growth medium; Although our STAT6-KO animals exhibited interesting IL: Interleukin; MAPK: Mitogen-activated protein kinase; KO: Knockout; mTFP1: Monomeric teal fluorescent protein 1; PVDF: Poly-vinylidene di- results, attention must be devoted to their interpretation. fluoride; RFP: Red fluorescent protein; SDS-PAGE: Sodium dodecyl sulfate – First, our mice lacked STAT6 globally and congenitally. polyacrylamide gel electrophoresis; shRNA: Short hairpin RNA; siRNA: Small Therefore, we cannot rule out the possibility of physio- interfering RNA; STAT: Signal transducer and activator of transcription logical compensation for the loss of STAT6. Moreover, because STAT6 is necessary for immune cell regulation Supplementary Information The online version contains supplementary material available at https://doi. [12, 13], some alteration in the systemic inflammatory org/10.1186/s13395-021-00271-8. situation can be expected. However, results from acute shRNA-based STAT6 knockdown in isolated and STAT6- Additional file 1: Figure S1. Differentiation index in STAT6- KO myoblasts experiments partially counter those con- overexpressed and STAT6-inhibited cells. (A) Differentiation index in the cerns. Second, no significant difference was found in Ad-Ctrl and Ad-STAT6 treatments. n =5.*p < .05 vs. Ad-Ctrl. Images in Fig. 2 were used for analysis. (B) Differentiation index in the Ctrl and cross-sectional area between WT and STAT6-KO intact shSTAT6 treatments. n =5.*p < .05 vs. Ctrl. Images in Fig. 3 were used muscles, implying no developmental problem in the mice. for analysis. Data are presented as mean ± SD. Figure S2. Proliferation of Considering that STAT6 influences myogenic differenti- STAT6-overexpressed myoblasts. (A) Representative bright-field images of myoblasts in Ad-Ctrl and Ad-STAT6 cells. Scale bar = 50 μm. (B) Absorb- ation, it is expected that developmental defects would ance at 450 nm in Ad-Ctrl and Ad-STAT6 cells using a CCK cell counting occur in STAT6-KO mice because considerable Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 13 of 14 7. Blau HM, Cosgrove BD, Ho AT. The central role of muscle stem cells in kit. (C) Proliferation rate in Ad-Ctrl and Ad-STAT6 cells. n = 6. Data are pre- regenerative failure with aging. Nat Med. 2015;21(8):854–62. https://doi. sented as mean ± SD. Figure S3. Pax7-positive cells in regenerating TA org/10.1038/nm.3918. muscle of WT and STAT6-KO mice. (A) Representative images in CTX- + 8. Hindi SM, Tajrishi MM, Kumar A. Signaling mechanisms in mammalian injured TA muscle. Scale bar = 50 μm. (B) Quantification of pax7 cells myoblast fusion. Sci Signal. 2013;6(272):re2. per myofiber. n = 5. Data are presented as mean ± SD. Supplementary 9. Kim JH, Jin P, Duan R, Chen EH. Mechanisms of myoblast fusion during Table S1. Primer sequences for QRT-PCR. muscle development. Curr Opin Genet Dev. 2015;32:162–70. https://doi. org/10.1016/j.gde.2015.03.006. 10. Sampath SC, Sampath SC, Millay DP. Myoblast fusion confusion: the Acknowledgements resolution begins. Skelet Muscle. 2018;8(1):3. https://doi.org/10.1186/s13395- We gratefully acknowledge C. Kakehashi (St. Marianna University School of 017-0149-3. Medicine) for support with the maintenance of genetically modified mouse 11. Brukman NG, Uygur B, Podbilewicz B, Chernomordik LV. How cells fuse. J lines and Dr. T. Yoshihara (Juntendo University) for his constructive Cell Biol. 2019;218(5):1436–51. https://doi.org/10.1083/jcb.201901017. comments to the manuscript draft. 12. Goenka S, Kaplan MH. Transcriptional regulation by STAT6. Immunol Res. 2011;50(1):87–96. https://doi.org/10.1007/s12026-011-8205-2. Authors’ contributions 13. Takeda K, Tanaka T, Shi W, Matsumoto M, Minami M, Kashiwamura S, et al. M.K. and Y.O. designed and performed experiments and analyzed the data. Essential role of Stat6 in IL-4 signalling. Nature. 1996;380(6575):627–30. The manuscript was written by M.K., Y.O., S.S., K.K., and T.F. The author(s) read https://doi.org/10.1038/380627a0. and approved the final manuscript. 14. Kaplan MH, Daniel C, Schindler U, Grusby MJ. Stat proteins control lymphocyte proliferation by regulating p27Kip1 expression. Mol Cell Biol. Funding 1998;18(4):1996–2003. https://doi.org/10.1128/MCB.18.4.1996. We acknowledge the funding support from the Grants-in-Aid for Scientific 15. Wurster AL, Withers DJ, Uchida T, White MF, Grusby MJ. Stat6 and IRS-2 Research (C) to M.K. (15K01633 18K10904, and 21K11428) and to Y.O. cooperate in interleukin 4 (IL-4)-induced proliferation and differentiation but (18K10835). are dispensable for IL-4-dependent rescue from apoptosis. Mol Cell Biol. 2002;22(1):117–26. https://doi.org/10.1128/MCB.22.1.117-126.2002. 16. Moreno JL, Mikhailenko I, Tondravi MM, Keegan AD. IL-4 promotes the Availability of data and materials formation of multinucleated giant cells from macrophage precursors by a All data generated and analyzed during the study are available from the STAT6-dependent, homotypic mechanism: contribution of E-cadherin. J corresponding author upon reasonable request. Leukoc Biol. 2007;82(6):1542–53. https://doi.org/10.1189/jlb.0107058. 17. Xu J, Chen Z, Yu F, Liu H, Ma C, Xie D, et al. IL-4/STAT6 signaling facilitates Declarations innate hematoma resolution and neurological recovery after hemorrhagic stroke in mice. Proc Natl Acad Sci U S A. 2020;117(51):32679–90. https://doi. Ethics approval and consent to participate org/10.1073/pnas.2018497117. All animal experimental procedures were approved by the Committee for 18. Pavlath GK, Horsley V. Cell fusion in skeletal muscle--central role of NFATC2 Animal Experimentation (No.1510012), St. Marianna University School of in regulating muscle cell size. Cell cycle. 2003;2(5):420–3. Medicine and the St. Marianna University Gene Recombination Experiment 19. Horsley V, Friday BB, Matteson S, Kegley KM, Gephart J, Pavlath GK. Regulation Safety Committee (No. 14008, TG181120-4). of the growth of multinucleated muscle cells by an NFATC2-dependent pathway. J Cell Biol. 2001;153(2):329–38. https://doi.org/10.1083/jcb.153.2.329. Consent for publication 20. Abbott KL, Friday BB, Thaloor D, Murphy TJ, Pavlath GK. Activation and All authors read and approved the final manuscript and consented to its cellular localization of the cyclosporine A-sensitive transcription factor NF-AT submission to the Skeletal Muscle. in skeletal muscle cells. Mol Biol Cell. 1998;9(10):2905–16. https://doi.org/10.1 091/mbc.9.10.2905. Competing interests 21. Horsley V, Jansen KM, Mills ST, Pavlath GK. IL-4 acts as a myoblast The authors declare that they have no competing interests. recruitment factor during mammalian muscle growth. Cell. 2003;113(4):483– 94. https://doi.org/10.1016/S0092-8674(03)00319-2. Author details 22. Imayoshi I, Hirano K, Sakamoto M, Miyoshi G, Imura T, Kitano S, et al. A Department of Physiology, St. Marianna University School of Medicine, multifunctional teal-fluorescent Rosa26 reporter mouse line for Cre- and Kawasaki, Kanagawa 216-8511, Japan. School of Kinesiology, The University Flp-mediated recombination. Neurosci Res. 2012;73(1):85–91. https://doi. of Louisiana at Lafayette, Lafayette, LA, USA. New Iberia Research Center, org/10.1016/j.neures.2012.02.003. The University of Louisiana at Lafayette, New Iberia, LA, USA. 23. Murphy MM, Lawson JA, Mathew SJ, Hutcheson DA, Kardon G. Satellite cells, connective tissue fibroblasts and their interactions are crucial for Received: 17 November 2020 Accepted: 18 May 2021 muscle regeneration. Development. 2011;138(17):3625–37. https://doi.org/1 0.1242/dev.064162. 24. Kurosaka M, Ogura Y, Funabashi T, Akema T. Involvement of transient receptor potential cation channel vanilloid 1 (TRPV1) in myoblast fusion. J References Cell Physiol. 2016;231(10):2275–85. https://doi.org/10.1002/jcp.25345. 1. Yoon MS. mTOR as a key regulator in maintaining skeletal muscle mass. 25. Ogura Y, Hindi SM, Sato S, Xiong G, Akira S, Kumar A. TAK1 modulates Front Physiol. 2017;8:788. https://doi.org/10.3389/fphys.2017.00788. satellite stem cell homeostasis and skeletal muscle repair. Nat Commun. 2. Levine S, Nguyen T, Taylor N, Friscia ME, Budak MT, Rothenberg P, et al. 2015;6(1):10123. https://doi.org/10.1038/ncomms10123. Rapid disuse atrophy of diaphragm fibers in mechanically ventilated 26. Kurosaka M, Ogura Y, Funabashi T, Akema T. Early growth response 3 (Egr3) humans. N Engl J Med. 2008;358(13):1327–35. https://doi.org/10.1056/ contributes a maintenance of C2C12 myoblast proliferation. J Cell Physiol. NEJMoa070447. 2017;232(5):1114–22. https://doi.org/10.1002/jcp.25574. 3. Chang NC, Rudnicki MA. Satellite cells: the architects of skeletal muscle. Curr 27. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Top Dev Biol. 2014;107:161–81. https://doi.org/10.1016/B978-0-12-416022-4. et al. Fiji: an open-source platform for biological-image analysis. Nat 00006-8. Methods. 2012;9(7):676–82. https://doi.org/10.1038/nmeth.2019. 4. Le Grand F, Rudnicki M. Satellite and stem cells in muscle growth and repair. Development. 2007;134(22):3953–7. https://doi.org/10.1242/dev. 28. Millay DP, Sutherland LB, Bassel-Duby R, Olson EN. Myomaker is essential for 005934. muscle regeneration. Genes Dev. 2014;28(15):1641–6. https://doi.org/10.11 5. Yin H, Price F, Rudnicki MA. Satellite cells and the muscle stem cell niche. 01/gad.247205.114. Physiol Rev. 2013;93(1):23–67. https://doi.org/10.1152/physrev.00043.2011. 29. Goh Q, Song T, Petrany MJ, Cramer AA, Sun C, Sadayappan S, et al. 6. Cheung TH, Rando TA. Molecular regulation of stem cell quiescence. Nat Myonuclear accretion is a determinant of exercise-induced remodeling in Rev Mol Cell Biol. 2013;14(6):329–40. https://doi.org/10.1038/nrm3591. skeletal muscle. Elife. 2019;8. https://doi.org/10.7554/eLife.44876. Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 14 of 14 30. Lafuste P, Sonnet C, Chazaud B, Dreyfus PA, Gherardi RK, Wewer UM, et al. 49. Suelves M, Lluis F, Ruiz V, Nebreda AR, Munoz-Canoves P. Phosphorylation ADAM12 and alpha9beta1 integrin are instrumental in human myogenic of MRF4 transactivation domain by p38 mediates repression of specific cell differentiation. Mol Biol Cell. 2005;16(2):861–70. https://doi.org/10.1091/ myogenic genes. EMBO J. 2004;23(2):365–75. https://doi.org/10.1038/sj. mbc.e04-03-0226. emboj.7600056. 31. Madaro L, Marrocco V, Fiore P, Aulino P, Smeriglio P, Adamo S, et al. 50. Page JL, Wang X, Sordillo LM, Johnson SE. MEKK1 signaling through p38 PKCtheta signaling is required for myoblast fusion by regulating the leads to transcriptional inactivation of E47 and repression of skeletal expression of caveolin-3 and beta1D integrin upstream focal adhesion myogenesis. J Biol Chem. 2004;279(30):30966–72. https://doi.org/10.1074/ kinase. Mol Biol Cell. 2011;22(8):1409–19. https://doi.org/10.1091/mbc.e10-1 jbc.M402224200. 0-0821. 51. Weston AD, Sampaio AV, Ridgeway AG, Underhill TM. Inhibition of p38 MAPK signaling promotes late stages of myogenesis. J Cell Sci. 2003;116(Pt 32. Schwander M, Leu M, Stumm M, Dorchies OM, Ruegg UT, Schittny J, et al. 14):2885–93. https://doi.org/10.1242/jcs.00525. Beta1 integrins regulate myoblast fusion and sarcomere assembly. Dev Cell. 52. Relaix F, Zammit PS. Satellite cells are essential for skeletal muscle 2003;4(5):673–85. https://doi.org/10.1016/S1534-5807(03)00118-7. regeneration: the cell on the edge returns centre stage. Development. 2012; 33. Cifuentes-Diaz C, Nicolet M, Alameddine H, Goudou D, Dehaupas M, Rieger 139(16):2845–56. https://doi.org/10.1242/dev.069088. F, et al. M-cadherin localization in developing adult and regenerating 53. Wang J, Conboy I. Embryonic vs. adult myogenesis: challenging the mouse skeletal muscle: possible involvement in secondary myogenesis. ‘regeneration recapitulates development’ paradigm. J Mol Cell Biol. 2010; Mech Dev. 1995;50(1):85–97. https://doi.org/10.1016/0925-4773(94)00327-J. 2(1):1–4. https://doi.org/10.1093/jmcb/mjp027. 34. Charrasse S, Comunale F, Grumbach Y, Poulat F, Blangy A, Gauthier-Rouviere 54. Bentzinger CF, Wang YX, Rudnicki MA. Building muscle: molecular C. RhoA GTPase regulates M-cadherin activity and myoblast fusion. Mol Biol regulation of myogenesis. Cold Spring Harb Perspect Biol. 2012;4(2):a008342. Cell. 2006;17(2):749–59. https://doi.org/10.1091/mbc.e05-04-0284. 55. Chal J, Pourquie O. Making muscle: skeletal myogenesis in vivo and in vitro. 35. Quach NL, Biressi S, Reichardt LF, Keller C, Rando TA. Focal adhesion kinase Development. 2017;144(12):2104–22. https://doi.org/10.1242/dev.151035. signaling regulates the expression of caveolin 3 and beta1 integrin, genes essential for normal myoblast fusion. Mol Biol Cell. 2009;20(14):3422–35. https://doi.org/10.1091/mbc.e09-02-0175. Publisher’sNote 36. Doherty KR, Cave A, Davis DB, Delmonte AJ, Posey A, Earley JU, et al. Springer Nature remains neutral with regard to jurisdictional claims in Normal myoblast fusion requires myoferlin. Development. 2005;132(24): published maps and institutional affiliations. 5565–75. https://doi.org/10.1242/dev.02155. 37. Lluis F, Ballestar E, Suelves M, Esteller M, Munoz-Canoves P. E47 phosphorylation by p38 MAPK promotes MyoD/E47 association and muscle-specific gene transcription. EMBO J. 2005;24(5):974–84. https://doi. org/10.1038/sj.emboj.7600528. 38. Costamagna D, Duelen R, Penna F, Neumann D, Costelli P, Sampaolesi M. Interleukin-4 administration improves muscle function, adult myogenesis, and lifespan of colon carcinoma-bearing mice. J Cachexia Sarcopenia Muscle. 2020;11(3):783–801. https://doi.org/10.1002/jcsm.12539. 39. Chi H. Regulation and function of mTOR signalling in T cell fate decisions. Nat Rev Immunol. 2012;12(5):325–38. https://doi.org/10.1038/nri3198. 40. Ge Y, Chen J. Mammalian target of rapamycin (mTOR) signaling network in skeletal myogenesis. J Biol Chem. 2012;287(52):43928–35. https://doi.org/1 0.1074/jbc.R112.406942. 41. Kikani CK, Wu X, Fogarty S, Kang SAW, Dephoure N, Gygi SP, et al. Activation of PASK by mTORC1 is required for the onset of the terminal differentiation program. Proc Natl Acad Sci U S A. 2019;116(21):10382–91. https://doi.org/10.1073/pnas.1804013116. 42. Wan L, Lin CW, Lin YJ, Sheu JJ, Chen BH, Liao CC, et al. Type I IFN induced IL1-Ra expression in hepatocytes is mediated by activating STAT6 through the formation of STAT2: STAT6 heterodimer. J Cell Mol Med. 2008;12(3):876– 88. https://doi.org/10.1111/j.1582-4934.2008.00143.x. 43. Franzi S, Salajegheh M, Nazareno R, Greenberg SA. Type 1 interferons inhibit myotube formation independently of upregulation of interferon-stimulated gene 15. PLoS One. 2013;8(6):e65362. https://doi.org/10.1371/journal.pone. 44. Gupta S, Jiang M, Pernis AB. IFN-alpha activates Stat6 and leads to the formation of Stat2:Stat6 complexes in B cells. J Immunol. 1999;163(7):3834– 45. Cao H, Zhang J, Liu H, Wan L, Zhang H, Huang Q, et al. IL-13/STAT6 signaling plays a critical role in the epithelial-mesenchymal transition of colorectal cancer cells. Oncotarget. 2016;7(38):61183–98. https://doi.org/10.1 8632/oncotarget.11282. 46. Zhou Y, Yu X, Chen H, Sjoberg S, Roux J, Zhang L, et al. Leptin deficiency shifts mast cells toward anti-inflammatory actions and protects mice from obesity and diabetes by polarizing M2 macrophages. Cell Metab. 2015;22(6): 1045–58. https://doi.org/10.1016/j.cmet.2015.09.013. 47. Zetser A, Gredinger E, Bengal E. p38 mitogen-activated protein kinase pathway promotes skeletal muscle differentiation. Participation of the Mef2c transcription factor. J Biol Chem. 1999;274(8):5193–200. https://doi.org/10.1 074/jbc.274.8.5193. 48. Jones NC, Tyner KJ, Nibarger L, Stanley HM, Cornelison DD, Fedorov YV, et al. The p38alpha/beta MAPK functions as a molecular switch to activate the quiescent satellite cell. J Cell Biol. 2005;169(1):105–16. https://doi.org/1 0.1083/jcb.200408066. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Skeletal Muscle Springer Journals

Transcription factor signal transducer and activator of transcription 6 (STAT6) is an inhibitory factor for adult myogenesis

Loading next page...
 
/lp/springer-journals/transcription-factor-signal-transducer-and-activator-of-transcription-mqu1dTNRcA
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2021
eISSN
2044-5040
DOI
10.1186/s13395-021-00271-8
Publisher site
See Article on Publisher Site

Abstract

Background: The signal transducer and activator of transcription 6 (STAT6) transcription factor plays a vitally important role in immune cells, where it is activated mainly by interleukin-4 (IL-4). Because IL-4 is an essential cytokine for myotube formation, STAT6 might also be involved in myogenesis as part of IL-4 signaling. This study was conducted to elucidate the role of STAT6 in adult myogenesis in vitro and in vivo. Methods: Myoblasts were isolated from male mice and were differentiated on a culture dish to evaluate the change in STAT6 during myotube formation. Then, the effects of STAT6 overexpression and inhibition on proliferation, differentiation, and fusion in those cells were studied. Additionally, to elucidate the myogenic role of STAT6 in vivo, muscle regeneration after injury was evaluated in STAT6 knockout mice. Results: IL-4 can increase STAT6 phosphorylation, but STAT6 phosphorylation decreased during myotube formation in culture. STAT6 overexpression decreased, but STAT6 knockdown increased the differentiation index and the fusion index. Results indicate that STAT6 inhibited myogenin protein expression. Results of in vivo experiments show that STAT6 knockout mice exhibited better regeneration than wild-type mice 5 days after cardiotoxin-induced injury. It is particularly interesting that results obtained using cells from STAT6 knockout mice suggest that this STAT6 inhibitory action for myogenesis was not mediated by IL-4 but might instead be associated with p38 mitogen- activated protein kinase phosphorylation. However, STAT6 was not involved in the proliferation of myogenic cells in vitro and in vivo. Conclusion: Results suggest that STAT6 functions as an inhibitor of adult myogenesis. Moreover, results suggest that the IL-4-STAT6 signaling axis is unlikely to be responsible for myotube formation. Keywords: Myotube, Myoblast fusion, Differentiation, Primary myoblast, Interleukin-4 Background myofibers in adults, resident myogenic stem cells undergo a The skeletal muscle, which constitutes 40% of human body unique process called myogenesis [3–5]. Upon request, mass, is indispensable for locomotion, respiration, and me- myogenic stem cells are activated and committed to differ- tabolism [1, 2]. Theskeletalmusclecomprises numerous entiation. The activated myogenic stem cells (i.e., myofibers, each of which contains multiple postmitotic myoblasts) subsequently fusetogetherorwith(nascent) myonuclei. During the formation of multinucleated myotubes to form mature myofibers [3, 6–9]. Obstruction of myogenesis inhibits proper muscle regeneration after in- jury, leading to decline of skeletal muscle function [3–5]. * Correspondence: yuji_ogura@marianna-u.ac.jp Many molecules have been presently identified as triggering Department of Physiology, St. Marianna University School of Medicine, and coordinating myogenic differentiation, fusion, and Kawasaki, Kanagawa 216-8511, Japan Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 2 of 14 maturation of myofibers [8, 10, 11]. Nevertheless, the specific mTFP1-expressing mice as described in earlier re- mechanisms have not been fully elucidated. ports of the literature [24, 25]. The expression of mTFP1 The signal transducer and activator of transcription 6 was induced by tamoxifen injection (2 mg/animal, four (STAT6) plays a fundamentally important role in immune consecutive days) at 1 week before isolation. After purifi- cells’ cellular function [12, 13]. For instance, STAT6 is in- cation by preplating, myoblasts were maintained in growth volved in T cell proliferation [14]. Also, its activation pre- medium (GM, 20% fetal bovine serum, 1% penicillin/ vents apoptotic cell death in B cells [15]. It is also involved streptomycin, and Ham’s F-10; Life Technologies Inc., in the fusion of macrophages to generate multinucleated CA, USA). The medium was supplemented with 5 ng/mL giant cells in response to inflammation [16]. Recent stud- basic fibroblast growth factor (Peprotech Inc., NJ, USA). ies have also demonstrated the involvement of STAT6 in When cells attained approximately 90% cellular con- microglial activation in the brain tissue [17]. Nevertheless, fluency, fusion of the myoblasts was induced by switching the role of STAT6 in peripheral tissues remains unclear. from GM to differentiation medium (DM, 2% house Earlier studies have revealed STAT6 as an important tar- serum, 1% penicillin/streptomycin, and Dulbecco’s modi- get of interleukin (IL)-4 in nonmuscle cells [12, 13, 17]. fied Eagle’s medium; Life Technologies Inc.). After IL-4 stimulation, STAT6 gets activated by phosphor- ylation and functions as a transcription factor to promote Adenovirus construction and infection context-dependentgeneexpression[12, 13, 17]. In this re- Adenoviruses carrying mouse STAT6 were generated gard, IL-4 is an essential molecule for myogenesis. Studies (AdEasy Adenoviral Vector System; Agilent Technologies have demonstrated that the nuclear factor of activated T Inc., CA, USA) as described in the literature [25]. Mouse cells 2 (NFATc2), a calcium-sensitive transcription factor, STAT6 was amplified from mouse cDNA and ligated into specifically localizes nascent myotubes and stimulates IL-4 the vector (RedTrack-CMV; Addgene, MA, USA) using secretion during myoblast differentiation [18–21]. The se- the KpnI and XbaI sites. The resulting AdTrack-CMV- creted IL-4 binds to IL-4 receptor alpha (IL-4Rα)onthe STAT6 plasmid was linearized with PmeI; then, it was surrounding myoblasts to promote the fusion of those cotransformed into Escherichia coli BJ5183 cells with the myoblasts with nascent myotubes [21]. These results sug- pAdEasy-1 plasmid. Clones undergoing AdTrack–Adeasy gest that STAT6 is also involved in myotube formation recombination were selected with kanamycin and were under the control of IL-4. Nevertheless, the function of confirmed by enzyme digestion. The recombinant plasmid STAT6 at any stage of myogenesis remains unknown. was linearized with PacI and was transfected into the Therefore, this study was designed to elucidate whether Adeno-X cell line (Clontech, Manassas, VA, USA) using STAT6 can be implicated in adult myogenesis in vitro and Lipofectamine 2000 Transfection Reagent (Life Technolo- in vivo. gies Inc.) packaging into active virus particles. The pro- duced viruses (adenoviral-RFP-STAT6: Ad-STAT6 or Methods adenoviral-RFP-empty: Ad-Ctrl) were amplified further by Animals serial passage to concentrate. At 70% confluence, Adeno- Wild-type (WT) male C57BL/6J mice were purchased from X cells were infected with the virus and were maintained SLC Inc. (Hamamatsu, Shizuoka, Japan). R26-CAG-LoxP- for 72–96 h. The viral titer was found using an RFP- monomeric teal fluorescent protein 1 (mTFP1) mice (B6; positive cell number per field. The number of infectious tm1.1(CAG-mTFP1)Imayo 129S6-Gt (ROSA)26Sor ) were obtained units per milliliter for each well were calculated as (in- from RIKEN (ID: RBRC05147; Tsukuba, Ibaraki, Japan) fected cells/field) × (fields/well)/virus volume (mL) × dilu- T2 tm1(cre/ERT2)Gaka 6 [22]. Pax7-CreER (B6.Cg-Pax7 /J) mice tion factor. For adenovirus infection, myoblasts (1 × 10 ) were purchased from The Jackson Laboratory (ID: 017763; were plated and then infected with either a STAT6 vector ME, USA) [23]. Tamoxifen-inducible muscle stem cell- (Ad-STAT6) or an empty vector (Ad-Ctrl) using the same specific mTFP1-expressing mice were generated by cross- concentration of infectious units for 6 h. After the infec- T2 ing R26-CAG-LoxP-mTFP1 and Pax7-CreER mice. tion period, the infected myoblasts were washed carefully STAT6-knockout (KO) mice (B6;129P2-Stat6<tm1Aki>/ and were then maintained in GM for 48 h. Our adenoviral AkiRbrc) were obtained from RIKEN (ID: RBRC00958) infection had infection efficiency of nearly 100%. [13]. Animals were maintained in an animal facility (25°C, 55% relative humidity, lights on 0600–1800 h). All animals Short hairpin RNA (shRNA) had a BL/6 genetic background and were used at 7–8 Procedures using shRNA were conducted as described in weeks of age. an earlier report [25]. The pLKO.1-mCherry-puro plasmid wasprovidedbyDr. Renzhi Han(TheOhioState Univer- Cell culture sity Wexner Medical Center, OH, USA). Target siRNA se- Primary myoblasts were isolated from the hind limb quences for mouse STAT6 (GGTTCAGATGCTTTCTGT muscles of WT, STAT6-KO, and muscle satellite cell- TAC) were designed using BLOCK-iT RNAi Designer (Life Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 3 of 14 Technologies Inc.). After the synthesized siRNA oligonucle- (Life Technologies Inc.) were used for staining. Myonu- otides (Integrated DNA Technologies, Inc., Coralville, IA, clei were stained with DAPI. Images of stained cells were USA) were annealed, they were inserted into the plasmid captured using a microscope (BZ-9000; Keyence Co.) using AgeI and EcoRI sites. The appropriate plasmid was and were analyzed using Fiji software [27]. The fusion amplified using a standard bacterial culture. Then, the index was defined as the ratio of the number of nuclei in siRNA sequence was validated for the knockdown of myotubes to the number of nuclei in each image. Myo- STAT6 mRNA in preliminary experiments. Control cells nucleus numbers of the myosin cells were also found. were transfected with the backbone plasmid harboring the For each experiment, three randomly captured images scramble sequence (CCTAAGGTTAAGTCGCCCTCG). were analyzed per sample. Plasmid delivery to myoblasts Muscle injury Plasmid DNA was transfected by electroporation (1500 Into the tibialis anterior (TA) muscle of the left leg of V, 10 ms, three pulses) using a transfection system each mouse, 100 μlof10 μM cardiotoxin (Latoxan, (Neon; Life Technologies Inc.) as described for an earlier Valence, France) dissolved in saline was injected [24]. study [26]. Our electroporation procedure routinely Saline was injected into the TA muscle of the right leg achieved 70–80% transfection efficiency at 24 h post- as a vehicle. At 5 days post-injection, both TA muscles transfection [26]. were excised for analyses. IL-4 treatment Morphological analysis Recombinant IL-4 (R&D Systems, Minneapolis, MN, Frozen TA muscles were kept below −20°C and were cut USA) was prepared and used similarly to our earlier using a cryostat (Leica Microsystems GmbH, Wetzler, study [24]. After IL-4 (10 ng/mL) was added to the cul- Germany). Sections were stained with hematoxylin and ture medium in WT and STAT6-KO cells, it was incu- eosin. Images were captured using a microscope (BZ- bated for 48 h. Saline was used as the vehicle. 9000). The cross-sectional area (CSA) was analyzed using Fiji software. The size distribution was evaluated. Evaluation of fusion of myoblasts to nascent myotubes in The average number of central nuclei in regenerated a cell mixing experiment myofibers of the TA muscle was also evaluated for For the cell mixing experiment, we used adenoviral in- fusion efficiency during regeneration. fection to achieve the highest degree of efficiency. The myoblasts isolated from muscle satellite cell-specific mTFP1 and WT mice were grown in GM. Based on Immunohistochemistry procedures used for an earlier study [21], mTFP1 myo- Cryosections (9-μm thickness) were made from injured blasts were seeded in 24-well plates (0.25 × 10 cells per and intact TA muscle. They were fixed with 4% parafor- well) in DM for 48 h to induce myotube formation and maldehyde for 15 min at 25°C. After washing with to allow estimation of myotube–myoblast fusion. The phosphate-buffered saline (PBS), the sections were original protocol used 24 h for pre-DM incubation [21], blocked with a blocking buffer containing 3% BSA, 5% but 48 h was found to be necessary to form visible myo- goat serum, and 0.5% Triton-X for 30 min. After several tubes under our experimental conditions. Simultan- washes with PBS, the sections were incubated with eously, WT myoblasts were infected with either Ad- M.O.M. blocking reagent for 45 min at 25°C (Vector STAT6 or Ad-Ctrl in GM for 6 h. After the cells were Laboratories Inc., Burlingame, CA, USA). After washing washed, the well was replenished with fresh GM. The with PBS, they were incubated with primary antibody cells were then maintained until the following day. After against Pax7 (1:10, clone Pax7; DSHB, University of + + forming mTFP1 myotubes, Ad-STAT6 or Ad-Ctrl RFP Iowa, Iowa City, IA), myogenin (1:10, BD Pharmingen, myoblasts were transferred into the plate to fuse the in- San Jose, CA, USA), and polyclonal anti-laminin (1:200; + 5 fected myoblast to mTFP1 myotubes (0.5 × 10 cells Sigma Chemical Co., St. Louis, MO, USA) in staining per well). They were maintained for a further 48 h. solution (Can get signal hist A; Toyobo Co. Ltd., Osaka, Then, the fusion index and the number of unfused cells Osaka, Japan) for 90 min at 25°C. After washing with were studied by immunocytochemistry. PBS, the slides were incubated with Alexa Fluor 488 (antirabbit)-conjugated and 568 (antimouse)-conjugated Immunocytochemistry secondary antibody (1:1,000, Thermo Fisher Scientific K.K.) Cells were prepared for immunocytochemistry as de- for 30 min at 25°C followed by incubation with DAPI solu- scribed earlier [24]. Primary antibodies specific to the tion (0.01 mg/mL in PBS) for 1 min. After washing, the myosin heavy chain (MyHC, MF-20, 1:50, DSHB) and slides were mounted using a fluorescence medium (Aqua- secondary antibodies conjugated with Alexa Fluor 488 Poly/Mount; Polysciences Inc., Warrington, PA, USA) and Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 4 of 14 were visualized using a digital microscope (BZ-X9000) and calculated as the cell number at 48 h divided by the were analyzed using Fiji software. cell number at 24 h [26]. Western blotting Statistical analyses Samples were homogenized in an ice-cold buffer (50 mM Data are presented as mean ± standard deviation (SD). Tris-Cl, 200 mM NaCl, 50 mM NaF, 0.3% NP-40, pH 8.0) One-way analysis of variance (ANOVA) followed by the with protease and phosphatase inhibitors (Nacalai Tesque Tukey–Kramer multiple comparisons test was used to as- Inc., Chukyo-ku, Kyoto, Japan). The protein concentration sess multiple group data. Unpaired t tests were used for was measured using the bicinchoninic acid (BCA) method comparisons between the two groups. All analyses were (BCA assay kit; Thermo Fisher Scientific K.K.). An equal performed using software (Prism v.8.0; GraphPad Software amount of protein was separated using standard SDS- Inc., CA, USA). Significance was inferred for p < .05. PAGE and was transferred to a PVDF membrane. The membrane was blocked with a blocking reagent (Blocking Results One; Nacalai Tesque Inc.) and was incubated with pri- STAT6 is deactivated during myotube formation, but IL-4 mary antibodies. The primary antibodies used were phos- 641 stimulates STAT6 activity phorylated Tyr -STAT6 (1:1000, #9362; Cell Signaling We first isolated myoblasts from WT mice and incubated Technology Inc., MA, USA), STAT6 (1:2000, #6778; Cell 180 the cells in DM for 24 and 48 h myotube formation to in- Signaling Technology Inc.), phosphorylated Thr / vestigate phosphorylated-STAT6 (p-STAT6) (Fig. 1a). Re- Tyr182-p38 Mitogen-activated protein kinase (MAPK; 1: sults showed that p-STAT6 expression decreased at 24 h 1000, #4511; Cell Signaling Technology Inc.), p38 MAPK after adding DM, which was significant at 48 h. We next (1:1000, #9212; Cell Signaling Technology Inc.), and examined the effects of IL-4 on STAT6 activation. After glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1: the cells were treated with IL-4 during DM incubation for 2000, #2118; Cell Signaling Technology Inc.). Lumines- 48 h, we assessed the p-STAT6 expression in those cells. cence signals by ECL reagent (Bio-rad Laboratories Inc., Results showed that p-STAT6 had been increased signifi- Hercules, CA, USA) were captured using an imaging sys- cantly by IL-4 treatment, indicating that STAT6 is a tem (LAS-4000; Fujifilm Corp., Minato-ku, Tokyo, Japan). downstream target for IL-4 during myotube formation Densitometry analysis was conducted using Fiji software. (Fig. 1b). These results indicate that STAT6 activity is de- creased during normal myogenesis, where endogenous IL- Quantitative reverse transcription—polymerase chain 4 is expected to stimulate STAT6 activation [21, 24]. reaction (QRT-PCR) Details of the protocol have been described in an earlier report [24]. Total RNA from the cells was isolated using STAT6 overexpression impairs myoblast fusion RNA extraction reagent (Sepasol-RNA I Super G; After finding that STAT6 can be activated by IL-4 dur- Nacalai Tesque Inc.) and RNA mini-columns (FATRK ing myotube formation, we aimed to clarify whether 001; Favorgen Biotech Corp., Ping-Tung, Taiwan) ac- STAT6 can be involved in myogenesis. Because IL-4 is cording to the manufacturers’ protocols. The first-strand known to contribute to myoblast fusion, we first specif- cDNA for PCR was generated using a commercially ically examined the link between STAT6 and myoblast available kit (FSQ-301; Toyobo Co. Ltd.). Quantification fusion. STAT6 was overexpressed in myoblasts by the of mRNA expression was performed using a real-time adenoviral vector. At 24 h after infection, the myoblasts PCR system (Step One Plus; Life Technologies Japan were induced to differentiate by the DM for 48 h. Western Ltd., Minato-ku, Tokyo) with Syber green master mix re- blot results confirmed that STAT6 protein expression in- agent (QPS-101; Toyobo Co. Ltd.). For delta–delta Ct creased significantly (Fig. 2aand b),indicating thatSTAT6 analysis, β-Actin or GAPDH mRNA was used as an in- was induced successfully. Phosphorylated-STAT6 levels ternal reference. The primer sequences used for this also exhibited the same trend as those of total STAT6 study are presented in the Supplementary Table. protein (Fig. 2c). We performed immunohistochemical analysis to examine myotube formation (Fig. 2d). The fu- Indirect cell number measurement sion index (Fig. 2e) and diameter (Fig. 2f) of cells overex- Adenovirus-infected cells were grown for 24 and 48 h in pressing STAT6 were significantly lower than those of GM. Cells at each time point were counted (cell counting control cells. STAT6 overexpression increased the per- kit-8 #CK04; Dojindo Laboratories, Kamimashiki-gun, centage of myosin-positive cells possessing a single nu- Kumamoto, Japan) according to the manufacturer’sin- cleus significantly but decreased the percentage of cells structions. The indirect cell number was expressed with possessing three or more nuclei (Fig. 2g). These results in- absolute absorbance at 450 nm (Multiskan MS; Life dicate that overexpression of STAT6 impairs myoblast Technologies Inc.). The proliferation rate was fusion. Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 5 of 14 Fig. 1 STAT6 was deactivated during myogenesis and IL-4 increased STAT6 phosphorylation. a pSTAT6 expression during differentiation. Representative images show Western blot bands for phosphorylated STAT6 (p-STAT6), STAT6, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) n =3.*p < .05 vs. 0 h. b Phosphorylation of STAT6 after IL-4 treatment in cultured myotubes. Representative images of Western blot bands for p-STAT6, STAT6, and GAPDH. n =3. *p < .05 vs. 0 h. Data are presented as mean ± standard deviation (SD) Fig. 2 STAT6 overexpression impaired myoblast fusion. a Representative images of Western blot bands for p-STAT6 and GAPDH. Myoblasts were infected with Ad-Ctrl or Ad-STAT6 adenovirus vector in growth medium (GM). After 24 h, the medium was replaced with a differentiation medium and maintained for 48 h. The cells were then used for Western blot and immunocytochemical analysis. b Relative expression of total STAT6. n =6. *p < .05 vs. Ad-Ctrl. c Relative expression of phosphorylated STAT6. n =6.*p < .05 vs. Ad-Ctrl. d Representative immunostained myotubes positive for MyHC (green). Nuclei were stained with DAPI (blue). Scale bar = 50 μm. e Calculation of the fusion index in the Ad-Ctrl and Ad-STAT6 treatments. f Diameters of myotubes in the Ad-Ctrl and Ad-STAT6 treatments. g Percentages of myosin-positive cells with one, two, and three or more nuclei. n = 6 in each group. *p < .05 vs. Ad-Ctrl. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 6 of 14 STAT6 knockdown improves myoblast fusion STAT6 implicates gene expression related to myoblast Given that STAT6 deactivation is necessary during myo- fusion tube formation, we hypothesized that the inhibition of Several molecules are known to be associated with myo- STAT6 promotes myoblast fusion. To test this hypoth- blast fusion. We next tested whether those fusion-related esis, the myoblasts were transfected using a shSTAT6 molecules might be affected by the experimental modula- vector to knockdown STAT6 and was maintained for 48 tion of STAT6. The respective mRNA expressions of myo- h in GM. Control myoblasts were transfected with an maker [28], myomerger [29], Adam12 [30], β1D-integrin empty vector (i.e., Ctrl). After 48 h, the medium was [31], β1-integrin [32], M-cadherin [33], N-cadherin [34], switched to DM. Then incubation continued for 48 h. caveolin-3 [35], and myoferin [36]werecomparedwith Based on Western blot (Fig. 3a), we confirmed that the myotubes differentiated for 48 h between Ad-Ctrl- expression of STAT6 (Fig. 3b) and of p-STAT6 (Fig. 3c) infected and Ad-STAT6-infected cells. As portrayed in decreased significantly after shRNA transfection at 0 and Fig. 4a, many molecules tended to be lower. Myo- 48 h of incubation in DM. We then conducted an im- maker and myomerger were decreased significantly in munohistochemical analysis to find the levels of myo- Ad-STAT6 cells. By contrast, myomaker, myomerger, tube formation (Fig. 3d). The fusion index was modest β1D-integrin, and caveolin-3 mRNAs were increased but significantly higher in STAT6-knocked-down cells significantly in STAT6-knocked-down cells compared than in Ctrl cells (Fig. 3e). The diameter in STAT6- to those in Ctrl cells (Fig. 4b). These results were knocked-down cells was significantly higher than that in comparable to results of morphological analysis shown Ctrl cells (Fig. 3f). The percentage of myosin-positive in Figs. 2 and 3. cells possessing a single nucleus decreased, although the percentage of cells possessing three or more nuclei in- STAT6 affected the differentiation of myoblasts creased significantly in STAT6-knocked-down cells (Fig. Because STAT6 manipulation was performed in myo- 3g). Collectively, these results suggest an inhibitory role blasts, we next investigated whether STAT6 is also in- of STAT6 in myoblast fusion. volved in myoblast differentiation and proliferation as Fig. 3. STAT6 knockdown improved myoblast fusion. Myoblasts were transfected with empty (Ctrl) or shSTAT6 vectors and grown in GM. After 48 h, the cells were harvested to ascertain p-STAT6, STAT6, and GAPDH levels via Western blotting. a representative images of Western blot bands. Relative protein expression levels of b STAT6 and c p-STAT6. n = 6 per group. *p < .05 vs. Ctrl. d representative immunostained myotubes positive for MyHC (green). Nuclei were stained with DAPI (blue). Scale bar = 50 μm. e Calculation of fusion index in the Ctrl and shSTAT6 treatment. n =4. f Diameters of myotubes in the Ctrl and shSTAT6 treatments. g Percentages of myosin-positive cells. n =4.*p < .05 vs. Ctrl. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 7 of 14 Fig. 4 Expression of mRNA related to myoblast fusion in STAT6-overexpressed and STAT6-knockdown cells. a mRNA expression in the Ad-Ctrl and Ad-STAT6 treatments. n = 4 per group. *p < .05 vs. Ctrl. b mRNA expression in the Ctrl and shSTAT6 treatments. n = 6 per group. *p < .05 vs. Ctrl. Data are presented as mean ± SD Fig. 5 Intervention for STAT6 influences differentiation in culture. a Western blot for myogenin and GAPDH in the Ad-Ctrl and Ad-STAT6 treatments. n =6.*p < .05 vs. Ad-Ctrl. b Western blot for myogenin and GAPDH in the Ctrl and shSTAT6 treatments. n =6.*p < .05 vs. Ctrl. (*) p = .08 vs. Ctrl. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 8 of 14 part of prefusion events. First, myogenin expression was the indirect cell number or proliferation rate between analyzed during DM incubation for 0, 24, and 48 h in Ad-Ctrl and Ad-STAT6 myoblasts (Fig. S2A–S2C). Ad-Ctrl and Ad-STAT6 infected cells. The adenoviral Therefore, STAT6 was not suggestive of implicating infection seemed to induce myogenin expression at 0 h, myoblast proliferation. but the expression was found to have no significant dif- ference between Ad-Ctrl and Ad-STAT6 (Fig. 5a). The STAT6-KO mice exhibit improved regeneration after myogenin expression was decreased significantly in Ad- injury STAT6 cells after 24 h of DM incubation (Fig. 5a). No We examined whether the absence of STAT6 affects difference was found at 48 h (Fig. 5a). On the other adult regenerative myogenesis in vivo, or not. No differ- hand, at 0 and after 48 h of DM incubation, myogenin ence was found in the body mass of WT or STAT6-KO expression was increased significantly in STAT6- mice studied (Fig. 6a). Cardiotoxin in saline was injected knocked-down cells compared to in Ctrl cells (Fig. 5b). into the left TA muscles of WT and STAT6-KO mice to A similar result was obtained at 24 h (p = .08). Although induce muscle injury, followed by regeneration. At 5 thetimecoursechangevariedbetween gain-of-function days post-injection, no difference was found in fiber and loss-of-function conditions, these results suggest that CSA distribution in the right intact TA (Fig. 6b and c). STAT6 was implicated in myogenin expression as an in- However, in the regenerated TA, the percentage of myo- hibitory factor during DM incubation. We next analyzed fibers between 300 and 600 μm was significantly lower, the differentiation index in an identical sample used for whereas the percentage of myofibers of more than 900 fusion index analysis in Figs. 2 and 3. Results show that the μm was significantly higher in STAT6-KO than in WT differentiation index was decreased significantly in Ad- mice (Fig. 6b and d). The average number of central nu- STAT6 myotubes (Fig. S1A) butthatitwas increasedsig- clei in regenerating myofibers of the TA muscle was nificantly in STAT6-knocked-down myotubes (Fig. S1B). found to be significantly higher in STAT6-KO than in Considered collectively, these results suggest that STAT6 WT mice (Fig. 6e). Next, mRNA expression of pax7, plays inhibitory roles in the differentiation program. myogenin, myomaker, embryonic MyHC (eMyHC) , and We also tested the effects of overexpression of STAT6 IL-4 was examined in the regenerated TA muscle. No on myoblast proliferation. Results show no difference in change in pax7 or myomaker mRNA, myogenin or Fig. 6 STAT6 knockout (KO) in mice improved muscle regeneration after injury. a Body mass in WT and STAT6-KO mice. b Representative image of hematoxylin and eosin-stained intact TA muscle and regenerating TA muscle sampled at 5 days after injury from WT and STAT6-KO mice. Scale bar = 50 μm. Size distribution of myofiber cross-sectional area (CSA) in intact TA muscle (c) and injured TA muscle (d). e Average central nuclei number in myofiber of regenerating TA muscle. n =5.*p < .05 vs. WT. f mRNA expression in injured TA muscle. n =5.*p < .05 vs. WT. g Representative image of myogenin staining in injured TA. h Quantification of myogenin cells per myofiber in injured TA. n =5.*p < .05 vs. WT. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 9 of 14 eMyHC mRNA was significantly higher in STAT6-KO stimulation of myotube formation. The myoblasts iso- than in WT mice (Fig. 6f). No difference was found in IL-4 lated from WT and STAT6-KO mice were differentiated mRNA between WT and STAT6-KO mice (Fig. 6f). We also by DM incubation for 48 h with or without IL-4. Then, made a cryosection of TA to examine myogenin cell num- the myotubes were fixed and stained with MyHC and bers using immunohistochemistry. Myogenin cell numbers DAPI to examine the fusion index (Fig. 7a). Results indi- were significantly higher in STAT6-KO mice than in WT cate that IL-4 significantly increased the fusion index in mice (Fig. 6g and h). Altogether, these results indicate that WT cells (Fig. 7b). The fusion index in STAT6-KO cells muscle regeneration after injury was facilitated in STAT6- was significantly higher than that in WT cells irrespect- KO mice by enhancing myogenic differentiation and fusion. ive of IL-4 treatment (Fig. 7b). It is particularly interest- ThecomparableIL-4mRNAlevelsimply that theeffects of ing that the fusion index in STAT6-KO cells with IL-4 IL-4 were comparable between WT and STAT6-KO mice ir- treatment was significantly higher than that in WT cells respective of their regeneration discrepancy. with IL-4 treatment. These results suggest that IL-4 and In a separate analysis, we examined pax7 satellite cell STAT6 independently implicate myotube formation. numbers immunohistochemically (Fig. S3A). We found This finding implies that STAT6 did not mediate a posi- no difference between the numbers obtained for WT tive role of IL-4 in myotube formation. and STAT6-KO mice (Fig. S3B). In light of the results of To ascertain the reasons for the separate influence of cell number analysis shown in Fig. S2, we infer that IL-4 and STAT6, we sought candidate molecules for regu- STAT6 does not influence myogenic cell proliferation. lating myogenesis via STAT6. During this process, we found a discrepancy in p38 MAPK, which is an essential Inhibitory action of STAT6 is independent of IL-4 kinase for myogenesis [37], in those cells by Western blot signaling (Fig. 7c). As expected, IL-4 increased p-STAT6 in WT Using the STAT6-KO mice model, we then sought to cells significantly (Fig. 7d). Also, STAT6 was not detected elucidate whether STAT6 can mediate IL-4-induced in STAT6-KO cells (Fig. 7d). In this situation, p- Fig. 7 IL-4 and STAT6 independently regulated myogenesis. Myoblasts were isolated from WT and STAT6-KO mice and maintained in DM with or without IL-4 treatment. a Representative immunostained myotubes positive for MyHC (green). Nuclei were stained with DAPI (blue). Scale bar = 50 μm. b Quantification of fusion index. n =5.*p < .05. c Representative protein bands for p-STAT6, STAT6, p-p38 MAPK, p38 MAPK, and GAPDH. d p-STAT6 protein expression. n =6.*p < .05 by unpaired t test. UD denotes undetected. e p-p38 MAPK protein expression. *p < .05. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 10 of 14 p38MAPK in STAT6-KO cells was significantly decreased STAT6 overexpression instead of IL-4Rα KO in myo- compared to that in WT cells, irrespective of IL-4 treat- blasts [21]. Isolated mTFP1 myoblasts expressing ment (Fig. 7e). These results implicate p38 MAPK in STAT6 normally were pre-incubated in DM for 48 h to STAT6 during myotube formation. Considering the re- form mTFP1 myotubes. Concomitantly, the WT myo- sults obtained for the fusion index (Fig. 7b), that the re- blasts were infected with either Ad-STAT6 or Ad-Ctrl pressive role of STAT6 in myotube formation is mediated expressing RFP. These RFP myoblasts were then added by p38 MAPK activity, independent of IL-4 action. to mTFP1 myotubes and were maintained for the next + + 48 h to induce fusion of RFP myoblasts to mTFP1 Myoblast–myotube fusion is attenuated in STAT6- myotubes (Fig. 8a). The numbers of mTFP1 mono- overexpressed myoblasts nuclear (i.e., unfused) cells were comparable between We further examined the possibility of an unlikely medi- Ad-STAT6 and Ad-Ctrl cultures (Fig. 8b), suggesting ation of STAT6 in IL-4-induced myotube formation. It that their myotube conditions were comparable. The has been established that IL-4 signaling is important for chimeric myotubes, expected mostly to signify the fusion myoblasts to fuse with myotubes [21]. Therefore, it of adenovirus-infected myoblasts with myotubes, were would be expected that myoblast–myotube fusion can significantly fewer in the Ad-STAT6 treatment (Fig. 8c). be enhanced by STAT6 activation if the IL-4-STAT6 The number of unfused RFP mononuclear cells was sig- axis served as a stimulatory pathway for it. To this end, nificantly higher in the Ad-STAT6 than in the Ad-Ctrl we followed an earlier reported protocol but used culture (Fig. 8d). Therefore, although this experimental Fig. 8 STAT6 overexpression in myoblasts impairs its fusion with myotubes. a Representation of cell mixing assay performed to examine fusion between myoblast and myotubes. Representative images show myotube formation in individual and mixed cultures. Arrows indicate myotubes + + + fused with RFP myoblasts. Arrowheads indicate myotubes that are not fused with RFP myoblasts. Scale bar = 50 μm. Numbers of b mTFP1 and c chimeric cells and d adenovirus-infected RFP cells per field in mixed cultures. n = 6 for each treatment. *p < .05 vs. Ad-Ctrl treatment. Data are presented as mean ± SD Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 11 of 14 procedure can not entirely eliminate the possibility of regulator. However, although we found that IL-4 can ac- myoblast–myoblast fusion, results seem to support the tivate STAT6 during myogenesis, results showed that notion that STAT6 does not mediate IL-4-linked pro- STAT6 had an inhibitory rather than a stimulatory effect motion of myoblast fusion. on muscle formation. Indeed, STAT6 activity was de- creased during DM incubation. Results suggest that the Discussion deletion of STAT6 and IL-4 treatment independently Mechanisms underlying myoblast differentiation and fu- improved the fusion index in culture. Moreover, sion remain unclear. Our first-time gain-of-function and STAT6-overexpressed myoblasts showed a lower cap- loss-of-function experiments demonstrated that overex- acity to fuse with myotube under culture conditions. In pression of STAT6 inhibits, whereas excessive inhibition addition, whereas IL-4 KO and IL-4Rα KO mice did not of STAT6 improves, myoblast differentiation and fusion exhibit improved CSA at 8 days of post injury [21], we in vitro. In vivo experiments using STAT6-KO mice observed a greater CSA at 5 days post injury in STAT6- demonstrated that the muscle regeneration process was KO mice than in WT mice. Altogether, these findings improved in the absence of STAT6 expression. Results suggest that the IL-4-STAT6 signaling axis is not re- also demonstrate that inhibition of myogenesis by sponsible for myotube formation. Other mechanisms are STAT6 might not be associated with IL-4. These results expected to control STAT6 activity to attenuate myo- suggest that STAT6 is a protein that negatively regulates genesis. Based on results of earlier studies, multiple mol- adult myogenesis. Figure 9 depicts a putative scheme of ecules are potentially involved in myogenesis, which can these study results. regulate STAT6 in cellular events. For instance, the Results of earlier studies have shown that IL-4 facili- mammalian target of rapamycin (mTOR) inhibits tates fusion in cultured myocytes [19, 21] or that IL-4 STAT6 activity in T cells [39]. Also, mTOR-signaling promotes myogenic differentiation in colon carcinoma- activation is important for myogenesis [40, 41]. Conse- bearing mice [38]. Earlier studies in nonmuscle cell types quently, mTOR activation might inhibit STAT6 signal- have demonstrated that STAT6 is activated primarily by ing during myotube formation. Alternatively, interferon- IL-4 [12, 13]. Therefore, we speculated that STAT6 is in- β can activate STAT6 in hepatoma cells [42]. Because volved in the muscle regeneration process as a positive interferon-β impairs myotube formation [43], interferon- Fig. 9 Putative roles of STAT6 in adult myogenesis. IL-4 can activate STAT6 in myotubes. However, STAT6 inhibits myotube formation. IL-4 improves myoblast fusion independently of STAT6 activity. The IL-4-STAT6 signaling axis therefore does not account for IL-4 related myotube formation processes. The red line is based on results from this study. The black line shows data referred from earlier studies. The dashed line represents unvalidated data Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 12 of 14 β signaling might negatively regulate myogenesis via myogenesis occurs in the embryo. Although we currently STAT6. Some molecules such as interferon-α [42, 44], have no explanation related to this point, it is noteworthy IL-13 [45], and leptin [46] interact with STAT6 in non- that molecular machinery might be largely shared but not muscle cell types. Eventually, further study will be neces- be completely identical between de novo developmental sary to identify molecules that control STAT6 activity in and adult myogenesis [53–55]. myogenesis as an inhibitory factor. The physiological significance of STAT6 inhibitory func- We observed an IL-4-independent decrease in p38 tion during myogenesis remains unknown. One supposition MAPK activity in fusion-facilitated STAT6-KO myo- is that STAT6 adjusts the proper timing of myoblasts for tubes. This decrease suggests a possible relation between myogenic commitment. Myogenesis is tightly regulated STAT6 and p38 MAPK during myogenesis. Actually, the by the sequential activation or deactivation of signaling role of p38 MAPK in myogenesis is complicated: p38 cascades [5, 52]. The dysregulation of the cascades im- MAPK is necessary to execute timely myogenic differen- pairs myofiber formation. Our results demonstrate that tiation by activating myocyte enhancer factor 2 (MEF2) STAT6 activity was evident for predifferentiation. [47] or MyoD and its co-molecule E47 [37]. Also, p38 Then, activity levels decreased along with the induction MAPK mediates inhibition of myogenic cell cycling as a of differentiation. We observed that STAT6 can affect molecular switch to regulate myogenic commitment myogenin expression. Consequently, STAT6 might pre- [48]. These results suggest that p38 MAPK contributes vent the progression of myoblast differentiation and fu- to advancement of myotube formation. By contrast, an sion until the myoblasts enter a fusion-competent state. inhibitory role of p38 MAPK in myogenesis has also At this time, fusion is allowed to proceed by decreasing been suggested. Suelves et al. has demonstrated that in- STAT6 activity. Considering this inference as true, our hibition of p38 MAPK activity increased desmin and α- findings related to myogenesis promotion by STAT6 actin expression in C2C12 myoblast differentiated for 5 inhibition imply a harmful influence of intact myofiber days [49]. Contrary to an earlier report by Llouis et al. formation under practical situations. Consequently, the [37], results of at least one study show that p38 MAPK influence of STAT6 inhibition over the entire adult might mediate the inhibition of E47 activity by mitogen myogenesis period, during which a mature myofiber is and extracellular kinase kinase 1 during differentiation established, must be elucidated. in C2C12 cells [50]. Moreover, Weston et al. has shown that p38 MAPK inhibition activated myogenin promoter Conclusion and increased myogenin and MEF2C gene expression in Results indicate that STAT6 plays an inhibitory role in C2C12 cells [51]. They also demonstrated that p38 myoblast differentiation and fusion in adults. Moreover, MAPK inhibition promoted myogenesis in the distal the results suggest that the facilitation of myotube for- limb or proximal mesenchyme myoblasts [51]. Accord- mation by IL-4 is independent of STAT6. Consequently, ingly, findings obtained from the current study agree STAT6 might be a clinical target to achieve efficient with those of the earlier study [52] because STAT6 in- muscle formation. hibition or deletion stimulated differentiation and fusion with attenuated p38 MAPK activity. A specific link be- Abbreviations ANOVA: Analysis of variance; DAPI: 4′, 6-Diamidino-2-phenylinodole; tween STAT6 and p38 MAPK during myogenesis must DM: Differentiation medium; ECL: Enhanced chemiluminescence; GAPD be clarified. H: Glyceraldehyde-3-phosphate dehydrogenase; GM: Growth medium; Although our STAT6-KO animals exhibited interesting IL: Interleukin; MAPK: Mitogen-activated protein kinase; KO: Knockout; mTFP1: Monomeric teal fluorescent protein 1; PVDF: Poly-vinylidene di- results, attention must be devoted to their interpretation. fluoride; RFP: Red fluorescent protein; SDS-PAGE: Sodium dodecyl sulfate – First, our mice lacked STAT6 globally and congenitally. polyacrylamide gel electrophoresis; shRNA: Short hairpin RNA; siRNA: Small Therefore, we cannot rule out the possibility of physio- interfering RNA; STAT: Signal transducer and activator of transcription logical compensation for the loss of STAT6. Moreover, because STAT6 is necessary for immune cell regulation Supplementary Information The online version contains supplementary material available at https://doi. [12, 13], some alteration in the systemic inflammatory org/10.1186/s13395-021-00271-8. situation can be expected. However, results from acute shRNA-based STAT6 knockdown in isolated and STAT6- Additional file 1: Figure S1. Differentiation index in STAT6- KO myoblasts experiments partially counter those con- overexpressed and STAT6-inhibited cells. (A) Differentiation index in the cerns. Second, no significant difference was found in Ad-Ctrl and Ad-STAT6 treatments. n =5.*p < .05 vs. Ad-Ctrl. Images in Fig. 2 were used for analysis. (B) Differentiation index in the Ctrl and cross-sectional area between WT and STAT6-KO intact shSTAT6 treatments. n =5.*p < .05 vs. Ctrl. Images in Fig. 3 were used muscles, implying no developmental problem in the mice. for analysis. Data are presented as mean ± SD. Figure S2. Proliferation of Considering that STAT6 influences myogenic differenti- STAT6-overexpressed myoblasts. (A) Representative bright-field images of myoblasts in Ad-Ctrl and Ad-STAT6 cells. Scale bar = 50 μm. (B) Absorb- ation, it is expected that developmental defects would ance at 450 nm in Ad-Ctrl and Ad-STAT6 cells using a CCK cell counting occur in STAT6-KO mice because considerable Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 13 of 14 7. Blau HM, Cosgrove BD, Ho AT. The central role of muscle stem cells in kit. (C) Proliferation rate in Ad-Ctrl and Ad-STAT6 cells. n = 6. Data are pre- regenerative failure with aging. Nat Med. 2015;21(8):854–62. https://doi. sented as mean ± SD. Figure S3. Pax7-positive cells in regenerating TA org/10.1038/nm.3918. muscle of WT and STAT6-KO mice. (A) Representative images in CTX- + 8. Hindi SM, Tajrishi MM, Kumar A. Signaling mechanisms in mammalian injured TA muscle. Scale bar = 50 μm. (B) Quantification of pax7 cells myoblast fusion. Sci Signal. 2013;6(272):re2. per myofiber. n = 5. Data are presented as mean ± SD. Supplementary 9. Kim JH, Jin P, Duan R, Chen EH. Mechanisms of myoblast fusion during Table S1. Primer sequences for QRT-PCR. muscle development. Curr Opin Genet Dev. 2015;32:162–70. https://doi. org/10.1016/j.gde.2015.03.006. 10. Sampath SC, Sampath SC, Millay DP. Myoblast fusion confusion: the Acknowledgements resolution begins. Skelet Muscle. 2018;8(1):3. https://doi.org/10.1186/s13395- We gratefully acknowledge C. Kakehashi (St. Marianna University School of 017-0149-3. Medicine) for support with the maintenance of genetically modified mouse 11. Brukman NG, Uygur B, Podbilewicz B, Chernomordik LV. How cells fuse. J lines and Dr. T. Yoshihara (Juntendo University) for his constructive Cell Biol. 2019;218(5):1436–51. https://doi.org/10.1083/jcb.201901017. comments to the manuscript draft. 12. Goenka S, Kaplan MH. Transcriptional regulation by STAT6. Immunol Res. 2011;50(1):87–96. https://doi.org/10.1007/s12026-011-8205-2. Authors’ contributions 13. Takeda K, Tanaka T, Shi W, Matsumoto M, Minami M, Kashiwamura S, et al. M.K. and Y.O. designed and performed experiments and analyzed the data. Essential role of Stat6 in IL-4 signalling. Nature. 1996;380(6575):627–30. The manuscript was written by M.K., Y.O., S.S., K.K., and T.F. The author(s) read https://doi.org/10.1038/380627a0. and approved the final manuscript. 14. Kaplan MH, Daniel C, Schindler U, Grusby MJ. Stat proteins control lymphocyte proliferation by regulating p27Kip1 expression. Mol Cell Biol. Funding 1998;18(4):1996–2003. https://doi.org/10.1128/MCB.18.4.1996. We acknowledge the funding support from the Grants-in-Aid for Scientific 15. Wurster AL, Withers DJ, Uchida T, White MF, Grusby MJ. Stat6 and IRS-2 Research (C) to M.K. (15K01633 18K10904, and 21K11428) and to Y.O. cooperate in interleukin 4 (IL-4)-induced proliferation and differentiation but (18K10835). are dispensable for IL-4-dependent rescue from apoptosis. Mol Cell Biol. 2002;22(1):117–26. https://doi.org/10.1128/MCB.22.1.117-126.2002. 16. Moreno JL, Mikhailenko I, Tondravi MM, Keegan AD. IL-4 promotes the Availability of data and materials formation of multinucleated giant cells from macrophage precursors by a All data generated and analyzed during the study are available from the STAT6-dependent, homotypic mechanism: contribution of E-cadherin. J corresponding author upon reasonable request. Leukoc Biol. 2007;82(6):1542–53. https://doi.org/10.1189/jlb.0107058. 17. Xu J, Chen Z, Yu F, Liu H, Ma C, Xie D, et al. IL-4/STAT6 signaling facilitates Declarations innate hematoma resolution and neurological recovery after hemorrhagic stroke in mice. Proc Natl Acad Sci U S A. 2020;117(51):32679–90. https://doi. Ethics approval and consent to participate org/10.1073/pnas.2018497117. All animal experimental procedures were approved by the Committee for 18. Pavlath GK, Horsley V. Cell fusion in skeletal muscle--central role of NFATC2 Animal Experimentation (No.1510012), St. Marianna University School of in regulating muscle cell size. Cell cycle. 2003;2(5):420–3. Medicine and the St. Marianna University Gene Recombination Experiment 19. Horsley V, Friday BB, Matteson S, Kegley KM, Gephart J, Pavlath GK. Regulation Safety Committee (No. 14008, TG181120-4). of the growth of multinucleated muscle cells by an NFATC2-dependent pathway. J Cell Biol. 2001;153(2):329–38. https://doi.org/10.1083/jcb.153.2.329. Consent for publication 20. Abbott KL, Friday BB, Thaloor D, Murphy TJ, Pavlath GK. Activation and All authors read and approved the final manuscript and consented to its cellular localization of the cyclosporine A-sensitive transcription factor NF-AT submission to the Skeletal Muscle. in skeletal muscle cells. Mol Biol Cell. 1998;9(10):2905–16. https://doi.org/10.1 091/mbc.9.10.2905. Competing interests 21. Horsley V, Jansen KM, Mills ST, Pavlath GK. IL-4 acts as a myoblast The authors declare that they have no competing interests. recruitment factor during mammalian muscle growth. Cell. 2003;113(4):483– 94. https://doi.org/10.1016/S0092-8674(03)00319-2. Author details 22. Imayoshi I, Hirano K, Sakamoto M, Miyoshi G, Imura T, Kitano S, et al. A Department of Physiology, St. Marianna University School of Medicine, multifunctional teal-fluorescent Rosa26 reporter mouse line for Cre- and Kawasaki, Kanagawa 216-8511, Japan. School of Kinesiology, The University Flp-mediated recombination. Neurosci Res. 2012;73(1):85–91. https://doi. of Louisiana at Lafayette, Lafayette, LA, USA. New Iberia Research Center, org/10.1016/j.neures.2012.02.003. The University of Louisiana at Lafayette, New Iberia, LA, USA. 23. Murphy MM, Lawson JA, Mathew SJ, Hutcheson DA, Kardon G. Satellite cells, connective tissue fibroblasts and their interactions are crucial for Received: 17 November 2020 Accepted: 18 May 2021 muscle regeneration. Development. 2011;138(17):3625–37. https://doi.org/1 0.1242/dev.064162. 24. Kurosaka M, Ogura Y, Funabashi T, Akema T. Involvement of transient receptor potential cation channel vanilloid 1 (TRPV1) in myoblast fusion. J References Cell Physiol. 2016;231(10):2275–85. https://doi.org/10.1002/jcp.25345. 1. Yoon MS. mTOR as a key regulator in maintaining skeletal muscle mass. 25. Ogura Y, Hindi SM, Sato S, Xiong G, Akira S, Kumar A. TAK1 modulates Front Physiol. 2017;8:788. https://doi.org/10.3389/fphys.2017.00788. satellite stem cell homeostasis and skeletal muscle repair. Nat Commun. 2. Levine S, Nguyen T, Taylor N, Friscia ME, Budak MT, Rothenberg P, et al. 2015;6(1):10123. https://doi.org/10.1038/ncomms10123. Rapid disuse atrophy of diaphragm fibers in mechanically ventilated 26. Kurosaka M, Ogura Y, Funabashi T, Akema T. Early growth response 3 (Egr3) humans. N Engl J Med. 2008;358(13):1327–35. https://doi.org/10.1056/ contributes a maintenance of C2C12 myoblast proliferation. J Cell Physiol. NEJMoa070447. 2017;232(5):1114–22. https://doi.org/10.1002/jcp.25574. 3. Chang NC, Rudnicki MA. Satellite cells: the architects of skeletal muscle. Curr 27. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Top Dev Biol. 2014;107:161–81. https://doi.org/10.1016/B978-0-12-416022-4. et al. Fiji: an open-source platform for biological-image analysis. Nat 00006-8. Methods. 2012;9(7):676–82. https://doi.org/10.1038/nmeth.2019. 4. Le Grand F, Rudnicki M. Satellite and stem cells in muscle growth and repair. Development. 2007;134(22):3953–7. https://doi.org/10.1242/dev. 28. Millay DP, Sutherland LB, Bassel-Duby R, Olson EN. Myomaker is essential for 005934. muscle regeneration. Genes Dev. 2014;28(15):1641–6. https://doi.org/10.11 5. Yin H, Price F, Rudnicki MA. Satellite cells and the muscle stem cell niche. 01/gad.247205.114. Physiol Rev. 2013;93(1):23–67. https://doi.org/10.1152/physrev.00043.2011. 29. Goh Q, Song T, Petrany MJ, Cramer AA, Sun C, Sadayappan S, et al. 6. Cheung TH, Rando TA. Molecular regulation of stem cell quiescence. Nat Myonuclear accretion is a determinant of exercise-induced remodeling in Rev Mol Cell Biol. 2013;14(6):329–40. https://doi.org/10.1038/nrm3591. skeletal muscle. Elife. 2019;8. https://doi.org/10.7554/eLife.44876. Kurosaka et al. Skeletal Muscle (2021) 11:14 Page 14 of 14 30. Lafuste P, Sonnet C, Chazaud B, Dreyfus PA, Gherardi RK, Wewer UM, et al. 49. Suelves M, Lluis F, Ruiz V, Nebreda AR, Munoz-Canoves P. Phosphorylation ADAM12 and alpha9beta1 integrin are instrumental in human myogenic of MRF4 transactivation domain by p38 mediates repression of specific cell differentiation. Mol Biol Cell. 2005;16(2):861–70. https://doi.org/10.1091/ myogenic genes. EMBO J. 2004;23(2):365–75. https://doi.org/10.1038/sj. mbc.e04-03-0226. emboj.7600056. 31. Madaro L, Marrocco V, Fiore P, Aulino P, Smeriglio P, Adamo S, et al. 50. Page JL, Wang X, Sordillo LM, Johnson SE. MEKK1 signaling through p38 PKCtheta signaling is required for myoblast fusion by regulating the leads to transcriptional inactivation of E47 and repression of skeletal expression of caveolin-3 and beta1D integrin upstream focal adhesion myogenesis. J Biol Chem. 2004;279(30):30966–72. https://doi.org/10.1074/ kinase. Mol Biol Cell. 2011;22(8):1409–19. https://doi.org/10.1091/mbc.e10-1 jbc.M402224200. 0-0821. 51. Weston AD, Sampaio AV, Ridgeway AG, Underhill TM. Inhibition of p38 MAPK signaling promotes late stages of myogenesis. J Cell Sci. 2003;116(Pt 32. Schwander M, Leu M, Stumm M, Dorchies OM, Ruegg UT, Schittny J, et al. 14):2885–93. https://doi.org/10.1242/jcs.00525. Beta1 integrins regulate myoblast fusion and sarcomere assembly. Dev Cell. 52. Relaix F, Zammit PS. Satellite cells are essential for skeletal muscle 2003;4(5):673–85. https://doi.org/10.1016/S1534-5807(03)00118-7. regeneration: the cell on the edge returns centre stage. Development. 2012; 33. Cifuentes-Diaz C, Nicolet M, Alameddine H, Goudou D, Dehaupas M, Rieger 139(16):2845–56. https://doi.org/10.1242/dev.069088. F, et al. M-cadherin localization in developing adult and regenerating 53. Wang J, Conboy I. Embryonic vs. adult myogenesis: challenging the mouse skeletal muscle: possible involvement in secondary myogenesis. ‘regeneration recapitulates development’ paradigm. J Mol Cell Biol. 2010; Mech Dev. 1995;50(1):85–97. https://doi.org/10.1016/0925-4773(94)00327-J. 2(1):1–4. https://doi.org/10.1093/jmcb/mjp027. 34. Charrasse S, Comunale F, Grumbach Y, Poulat F, Blangy A, Gauthier-Rouviere 54. Bentzinger CF, Wang YX, Rudnicki MA. Building muscle: molecular C. RhoA GTPase regulates M-cadherin activity and myoblast fusion. Mol Biol regulation of myogenesis. Cold Spring Harb Perspect Biol. 2012;4(2):a008342. Cell. 2006;17(2):749–59. https://doi.org/10.1091/mbc.e05-04-0284. 55. Chal J, Pourquie O. Making muscle: skeletal myogenesis in vivo and in vitro. 35. Quach NL, Biressi S, Reichardt LF, Keller C, Rando TA. Focal adhesion kinase Development. 2017;144(12):2104–22. https://doi.org/10.1242/dev.151035. signaling regulates the expression of caveolin 3 and beta1 integrin, genes essential for normal myoblast fusion. Mol Biol Cell. 2009;20(14):3422–35. https://doi.org/10.1091/mbc.e09-02-0175. Publisher’sNote 36. Doherty KR, Cave A, Davis DB, Delmonte AJ, Posey A, Earley JU, et al. Springer Nature remains neutral with regard to jurisdictional claims in Normal myoblast fusion requires myoferlin. Development. 2005;132(24): published maps and institutional affiliations. 5565–75. https://doi.org/10.1242/dev.02155. 37. Lluis F, Ballestar E, Suelves M, Esteller M, Munoz-Canoves P. E47 phosphorylation by p38 MAPK promotes MyoD/E47 association and muscle-specific gene transcription. EMBO J. 2005;24(5):974–84. https://doi. org/10.1038/sj.emboj.7600528. 38. Costamagna D, Duelen R, Penna F, Neumann D, Costelli P, Sampaolesi M. Interleukin-4 administration improves muscle function, adult myogenesis, and lifespan of colon carcinoma-bearing mice. J Cachexia Sarcopenia Muscle. 2020;11(3):783–801. https://doi.org/10.1002/jcsm.12539. 39. Chi H. Regulation and function of mTOR signalling in T cell fate decisions. Nat Rev Immunol. 2012;12(5):325–38. https://doi.org/10.1038/nri3198. 40. Ge Y, Chen J. Mammalian target of rapamycin (mTOR) signaling network in skeletal myogenesis. J Biol Chem. 2012;287(52):43928–35. https://doi.org/1 0.1074/jbc.R112.406942. 41. Kikani CK, Wu X, Fogarty S, Kang SAW, Dephoure N, Gygi SP, et al. Activation of PASK by mTORC1 is required for the onset of the terminal differentiation program. Proc Natl Acad Sci U S A. 2019;116(21):10382–91. https://doi.org/10.1073/pnas.1804013116. 42. Wan L, Lin CW, Lin YJ, Sheu JJ, Chen BH, Liao CC, et al. Type I IFN induced IL1-Ra expression in hepatocytes is mediated by activating STAT6 through the formation of STAT2: STAT6 heterodimer. J Cell Mol Med. 2008;12(3):876– 88. https://doi.org/10.1111/j.1582-4934.2008.00143.x. 43. Franzi S, Salajegheh M, Nazareno R, Greenberg SA. Type 1 interferons inhibit myotube formation independently of upregulation of interferon-stimulated gene 15. PLoS One. 2013;8(6):e65362. https://doi.org/10.1371/journal.pone. 44. Gupta S, Jiang M, Pernis AB. IFN-alpha activates Stat6 and leads to the formation of Stat2:Stat6 complexes in B cells. J Immunol. 1999;163(7):3834– 45. Cao H, Zhang J, Liu H, Wan L, Zhang H, Huang Q, et al. IL-13/STAT6 signaling plays a critical role in the epithelial-mesenchymal transition of colorectal cancer cells. Oncotarget. 2016;7(38):61183–98. https://doi.org/10.1 8632/oncotarget.11282. 46. Zhou Y, Yu X, Chen H, Sjoberg S, Roux J, Zhang L, et al. Leptin deficiency shifts mast cells toward anti-inflammatory actions and protects mice from obesity and diabetes by polarizing M2 macrophages. Cell Metab. 2015;22(6): 1045–58. https://doi.org/10.1016/j.cmet.2015.09.013. 47. Zetser A, Gredinger E, Bengal E. p38 mitogen-activated protein kinase pathway promotes skeletal muscle differentiation. Participation of the Mef2c transcription factor. J Biol Chem. 1999;274(8):5193–200. https://doi.org/10.1 074/jbc.274.8.5193. 48. Jones NC, Tyner KJ, Nibarger L, Stanley HM, Cornelison DD, Fedorov YV, et al. The p38alpha/beta MAPK functions as a molecular switch to activate the quiescent satellite cell. J Cell Biol. 2005;169(1):105–16. https://doi.org/1 0.1083/jcb.200408066.

Journal

Skeletal MuscleSpringer Journals

Published: May 29, 2021

There are no references for this article.