Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Premature expression of a muscle fibrosis axis in chronic HIV infection

Premature expression of a muscle fibrosis axis in chronic HIV infection Background: Despite the success of highly active antiretroviral therapy (HAART), HIV infected individuals remain at increased risk for frailty and declines in physical function that are more often observed in older uninfected individuals. This may reflect premature or accelerated muscle aging. Methods: Skeletal muscle gene expression profiles were evaluated in three uninfected independent microarray datasets including young (19 to 29 years old), middle aged (40 to 45 years old) and older (65 to 85 years old) subjects, and a muscle dataset from HIV infected subjects (36 to 51 years old). Using Bayesian analysis, a ten gene muscle aging signature was identified that distinguished young from old uninfected muscle and included the senescence and cell cycle arrest gene p21/Cip1 (CDKN1A). This ten gene signature was then evaluated in muscle specimens from a cohort of middle aged (30 to 55 years old) HIV infected individuals. Expression of p21/Cip1 and related pathways were validated and further analyzed in a rodent model for HIV infection. Results: We identify and replicate the expression of a set of muscle aging genes that were prematurely expressed in HIV infected, but not uninfected, middle aged subjects. We validated select genes in a rodent model of chronic HIV infection. Because the signature included p21/Cip1, a cell cycle arrest gene previously associated with muscle aging and fibrosis, we explored pathways related to senescence and fibrosis. In addition to p21/Cip1, we observed HIV associated upregulation of the senescence factor p16INK4a (CDKN2A) and fibrosis associated TGFβ1, CTGF, COL1A1 and COL1A2. Fibrosis in muscle tissue was quantified based on collagen deposition and confirmed to be elevated in association with infection status. Fiber type composition was also measured and displayed a significant increase in slow twitch fibers associated with infection. Conclusions: The expression of genes associated with a muscle aging signature is prematurely upregulated in HIV infection, with a prominent role for fibrotic pathways. Based on these data, therapeutic interventions that promote muscle function and attenuate pro-fibrotic gene expression should be considered in future studies. Keywords: Skeletal muscle, Aging, Gene expression, HIV infection, Senescence Background are more often seen in the elderly. However, the molecu- Despite the considerable success of highly active anti- lar and regulatory pathways that underlie this process re- retroviral therapy (HAART), individuals chronically main vaguely defined. infected with HIV remain at higher risk for declines in Studies on muscle aging in both humans and rodent musculoskeletal function and increased frailty [1-3], a models have shown increases in collagen deposition and phenotype also observed in rodent models for HIV in- fibrotic tissue in aging muscle [6-10], suggesting a skew- fection [4,5]. In humans, this functional decline resem- ing in the balance of muscle and fibroblasts with in- bles an aging phenotype, since many of these risk factors creasing age. Transforming growth factor β (TGFβ)isa known key regulator in maintaining the balance of colla- gen in the extracellular matrix as well as in modulating * Correspondence: mmontano@bu.edu 1 inflammatory responses [11,12] . It is normally expressed Boston University School of Medicine, 650 Albany St. EBRC 646, Boston, in muscle after injury but also has the potential to MA02118USA Full list of author information is available at the end of the article © 2012 Kusko et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Kusko et al. Skeletal Muscle 2012, 2:10 Page 2 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 induce fibrosis around myofibers (for review see [13]). therapy for at least 12 weeks or not starting antiretro- Injection of TGFβ for ten days has been shown to in- viral therapy in the next four months, CD4 cell count duce cachexia and generalized tissue fibrosis in nude greater than 50/mm and HIV copy number less than mice [14]. Furthermore, Carlson and colleagues have 10,000 copies/ml (less than 400 in six of nine subjects), shown an upregulation of TGFβ and associated path- and were able and willing to provide informed consent ways in muscle in the aging rodent [15]. Based on these and comply with the protocol. Expression profiles were observations of muscle aging in model systems and a from biopsies of the vastus lateralis at baseline that were similar frailty phenotype in rodent models for infection, not previously published in a testosterone supplementa- we were interested in determining whether premature tion study [19]. Arrays were run using Affymetrix HG- muscle aging occurs during chronic HIV infection, par- U133A microarray chips. ticularly in the context of successful HAART and whether this phenotype is recapitulated in rodent mod- GEO datasets els for HIV. The online datasets GEO362 [20] and GEO 1428 [16] To evaluate potential muscle aging within the context are expression profiles of muscle tissue from normal of HIV infection, we chose to first evaluate gene expres- human muscle biopsies of the vastus lateralis. GEO362 sion of muscle specimens (that is, vastus lateralis) in un- arrayed young men (age 21 to 27) and older men (age 67 infected individuals ranging in age from 19 to 85 using to 75). GSE 1428 looked at young men (age 19 to 25) previously published datasets for healthy aging and mild and older men (age 70 to 80) who were identified as sarcopenia to identify an aging gene signature [16,17]. having mild sarcopenia. The de-identified data were To assess the possibility of accelerated muscle aging in downloaded from the Gene Expression Omnibus (GEO) HIV, we then evaluated muscle gene expression profiles web repository and were used in our analysis. Arrays for in HIV-infected individuals ranging in age from 30 to both these studies were run using Affymetrix HG- 55 years old and in a rodent model for HIV infection U133A microarray chips. and used this to identify associated pathways that might explain the phenotype seen. Senescence, a hallmark of Supplemental healthy HIV negative dataset aging, has been defined as an irreversible state of cell These subjects were enrolled at McMaster University cycle arrest [18]. In this study, genes and pathways and Hamilton Health Sciences and were all healthy non- related to muscle senescence and fibrosis were found to exercising males. None were athletes nor were they on be upregulated and were evaluated further. Here, we de- medications known to adversely affect muscle (that is, scribe a role for HIV driven fibrosis in skeletal muscle. statins). The age intervals for these subjects were 20 to This is an understudied potential mediator of functional 25 years old, 40 to 45 years old, and 70 to 75 years old. decline in muscle that could open novel avenues for Muscle biopsies of the vastus lateralis were taken at the therapeutic intervention. same time of day and fasted, as previously described [21] and profiled on Roche NimbleGen Human Gene Expres- Methods sion 12x135K Arrays. Ethics statement These studies were approved by the Boston University Data processing Medical Center Institutional Review Board, and the Initial processing McMaster University and Hamilton Health Sciences Re- All expression data were globally scaled to a per sample search Ethics Board. These studies were conducted in mean of 500. Probes were assigned to be present or ab- accordance with the principles of the Declaration of Hel- sent based on the per sample median. Probes with more sinki and all subjects gave written informed consent for than 80% absent calls were removed from GSE1428 and participation. GSE362. Only probes in GSE362 and GSE1428 with at least one sample intensity above the median for each re- Study population spective set were considered for analysis using Bayesian HIV-infected inclusion criteria Analysis of Differentially Expressed Genes (BADGE) This study included HIV-positive men, 30 to 55 years [22]. As a result, a total of 9,872 probes from GSE362 old (average age = 43 years), who had documented and 11,016 probes from GSE1428 were included in our weight loss within the previous six months of between analysis. Remaining probes were analyzed for differential 5% and 15% of body weight or an actual body mass expression using BADGE [22]. index (BMI) at screening of between 17 and 20 (equiva- lent to 85% to 95% of the lower limit of ideal weight), an Differential expression energy intake in excess of 80% of the recommended diet- The GSE362 and GSE1428 data sets were analyzed in- ary allowance, on stable and potent antiretroviral dependently. Our analysis found 26 upregulated and Kusko et al. Skeletal Muscle 2012, 2:10 Page 3 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 36 downregulated genes (relative to average gene ex- RNA quantitative realtime PCR pression in the arrays being compared) for GSE362 RNA was generated from gastrocnemius muscles. Briefly, and 19 upregulated and 65 downregulated genes for the gastrocnemius muscles were cleaned of all fat and ex- GSE1428 using a 0.5% posterior probability of false cess connective tissue, cut into smaller pieces and homo- positive detection. Ten genes overlapped between the genized in TRIzol reagent (Invitrogen, Carlsbad, CA, two analyses. USA}) then processed for RNA. Phase separation was done using chloroform and centrifugation. RNA was pre- Specificity assessment cipitated from the aqueous phase using isopropynol and To assess whether the ten gene muscle aging signature washed using ethanol. The RNA was then cleaned using reflected a generic muscle disease phenotype, we evalu- the RNeasy Mini Kit (Qiagen Sciences, Valencia, CA, ated our ten gene signature in several other muscle USA) and quantified using a Nanodrop spectrophotom- aging diseases such as myositis, amyotrophic lateral eter. Primers for rat GAPDH, CDKN1A, FEZ2 and H3F3B sclerosis (ALS), and 48 hour immobilization using PEPR were purchased from Superarray (SABiosciences, Fred- (Public Expression Profile Resource; http://pepr.cnmcre- erick, MD, USA) and analyzed using quantitative realtime search.org). Our profile was only significant in 48 hour PCR detection with SYBR green. For genes associated immobilization, and not any of the other diseases stud- with fibrosis, COL1A1 (F-GGAATGAAGGGACACA- ied (data not shown). To test whether the ten gene GAGGT, R- GAGCTCCATTTTCACCAGGA), COL1A2 muscle aging profile in HIV samples clustered selectively (F-GAGCTCCATTTTCACCAGGA, R- CAGCAGCTC- with the expression profiles of older subjects’ muscles, CACTCTCACCT), CTGF (F-ATGCTGTGAGGAGTGG- we used a Bayesian model based cluster analysis of the GTGT, R- GGCCAAATGTGTCTTCCAGT) and GAPDH ten genes. The cluster method was implemented in the (F- ATGACTCTACCCACGGCAAG, R- GGAAGATGGT- software CAGED (Cluster Analysis of Gene Expression GATGGGTTTC), primers were used - a kind gift from Dr. Dynamics) which was also used to generate the unsuper- Maria Trojanowska (Boston University, MA). They were vised clustered heatmaps [23]. analyzed using quantitative realtime PCR detection using SYBR green. TaqMan probes for rat p16INK4a, MT1A, EASE annotation MLF1, TPPP3 (also known as CGI-38), MYH8, PDHA1 Annotation of our gene lists was performed using the and GAPDH were purchased from Applied Biosystems National Center for Biotechnology Information (NCBI) (Life Technologies, Carlsbad, CA, USA). Both sets were software EASE [24]. EASE is an integrated knowledge analyzed using an ABI Prism 7000 Sequence Detection Sys- database that integrates information from OMIM, tem (Applied Biosystems, Life Technologies, CA, USA). Refseq, Unigene, and Gene Ontology to search for over- Samples were confirmed to have no DNA contamination represented gene categories in user submitted gene lists by using a realtime PCR reaction without reverse transcript- [25]. ase. Amplification results were normalized to GAPDH using the ΔΔCt method. A Students t-test of the data was Ex vivo validation and pathway analysis used to test differential expression with a P-value< 0.05 TGFβ protein measurement considered as significant. Muscle homogenates were obtained from the gastrocne- mius muscle of the wild type and HIV Tg rodent. Briefly, Collagen staining and fibrotic index calculation samples were cleaned of all fat and connective tissue and Gastrocnemius muscle was flash frozen in liquid nitro- cut into smaller pieces. Specimens were homogenized in gen and later embedded in paraffin. Sections of tissue RIPA buffer (25 mM Tris pH7.6, 150 mM NaCl, 1% NP- were processed at 5 μm thickness. Tissue was stained 40, 1% sodium deoxycholate, 0.1% SDS) with complete using Picrosirius Red (Sigma-Aldrich, St. Louis, MO, mini protease inhibitor tablets added (Roche, IN, USA). USA}) and Fast Green (Fisher Scientific, Hampton, NH, Homogenates were centrifuged at 21,000 g for 15 min- USA) to look for collagen deposition in the extracellular utes to pellet insoluble matter. Protein concentrations space. The images for analysis of fibrotic index were were determined using the BCA reagent (Pierce, Rock- taken using Olympus BX41 microscope (Olympus, Cen- ford IL, USA). TGFβ was measured by ELISA using a ter Valley, PA, USA) using DP Controller (Version Quantikine kit (R&D Systems, Minneapolis, MN, USA) 3.2.1.276) and DP Manager (Version 3,1,1,208). Bright according to the manufacturer’s recommendations and field images were exposed for 1/1500 seconds. The fi- values were normalized to total protein concentration. brotic index was calculated as percent area of collagen Three HIV Tg and three wild type rodents were used for of the total tissue area using NIH Image J Software these measurements. A Students t-test of the data was (http://rsbweb.nih.gov/ij/). The calculation for fibrotic used to test differential expression with a P-value< 0.05 index is based on the algorithm described in [26]. Six considered as significant. HIV Tg and three wild type rodent muscles were Kusko et al. Skeletal Muscle 2012, 2:10 Page 4 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 quantified after staining. A Students t-test of the data GSE1428. Ten genes were common to both expression was used to test differential expression with a P-value< sets and are shown for the two datasets as heatmaps in 0.05 considered as significant. Figures 1A and B. Notably the mild sarcopenia in the GEO 1428 series displayed a larger number of differen- Myosin heavy chain isoform quantification tially expressed genes compared to healthy subjects (data Gastrocnemius muscles were embedded in OCT and im- not shown). This ten gene signature was evaluated in an- mediately frozen in isopentane cooled in liquid nitrogen. other supplemental healthy male dataset run on a Nim- Serial sections from the mid-belly of the gastrocnemius bleGen microarray platform, comparing subjects 20 to were cut at 8 μm and processed for immunohistochem- 25 years old with subjects 70 to 75 years old. Most genes ical detection of slow or fast MHC protein expression (the top six of ten in the heatmap) in the signature were using the ABC method (Vector Labs, Burlingame, CA, recapitulated in the third set (Figure 1C). The compos- USA). Sections were visualized with a Leica microscope ition of the ten genes shown in all three datasets is as and measured using ImageJ software (NIH, Bethesda, follows: CDKN1A (p21/Cip1), FEZ2, H3F3B DAAM2, MD, USA). Approximately 200 fibers per muscle were MFL1, PDHA1 MT1F, MYH8, CRIM1, and CGI-38. analyzed. Data are expressed as the percentage of slow The GSE362 and GSE1428 genome-wide expression (type I) and fast (type II) MHC types relative to the total data have been previously published and are available pool of MHC isoforms. Four HIV Tg and four wild type online [16,20]. The HIV baseline muscle profiles and the rodent muscles were quantified. A Students t-test was supplemental healthy muscle expression profiles have used to test differential expression with a P-value of less not been previously published. Cells/CMM = cells per than 0.05 considered as significant. cubic milliliter. Results and discussion Muscle gene expression of middle-aged HIV-infected men Identification of common genes that change expression resembles older uninfected samples with muscle aging Using the muscle aging profile common to both data- To profile muscle in healthy aging, we identified a sets, we evaluated muscle expression profiles from HIV- shared gene expression pattern in healthy and mildly infected individuals using the same tissue source (vastus sarcopenic individuals using previously published ex- lateralis) and microarray platform (Affymetrix HG- pression data obtained from the same tissue and micro- U133A). The samples are described in [19]. Muscle pro- array platform (that is, Affymetrix HG-U133A). We then files from these subjects clustered with the older samples evaluated this expression pattern with microarray data in both GSE362 (shown in Figure 2A) and GSE1428 from our HIV muscle specimens using the same micro- (data not shown) using CAGED [23] cluster analysis. array platform (that is, Affymetrix HG-U133A) as well Notably, the clustering was not influenced by viral load, as with a distinct microarray dataset of young, middle extent of weight loss or CD4 levels (data not shown). aged and older men using a NimbleGen platform Collectively, these data suggest that muscle derived from (Table 1). A Bayesian modeling approach was applied, HIV + men, on average in their 40s, more closely resem- implemented in BADGE [22,23], using muscle expres- bles muscle profiles from individuals in their 70s consist- sion datasets obtained from the vastus lateralis in GEO ent with our premise of accelerated muscle aging. series 362 (a dataset including seven young healthy men ages 21 to 27 and eight older men ages 67 to 75 [20]) Muscle gene expression of age-matched healthy HIV and GEO series 1428 (a dataset including ten young negative men do not resemble older samples healthy men ages 19 to 25 and twelve older men with We evaluated muscle profiles from young, middle aged mild sarcopenia ages 70 to 80 [16]). The initial analysis and older uninfected men, all derived using the same tis- identified 62 age-associated probes that were differen- sue site and microarray platform (Table 1), to determine tially expressed in the dataset GSE362 and 85 age-asso- whether age, rather than HIV, might account for the ciated probes differentially expressed in the dataset observed clustering in Figure 2A. However, CAGED Table 1 Description of datasets used in this study Dataset Age(yrs) Sample Size(all male) Tissue source Array Condition GSE362 [20] 21-2767-75 N = 7N = 8 Vastus lateralis HG-U133A Healthy GSE1428 [16] 19-2570-80 N = 10N = 12 Vastus lateralis HG-U133A Older with sarcopenia HIV + [19] 36-51 N = 9 Vastus lateralis HG-U133A Median VL = 400 copies/ML (400–56,844)Median CD4 = 362 cells/CMM (61–765) Supplemental Healthy 20-2540–4570-75 N = 10N = 10N = 10 Vastus lateralis NimbleGen Healthy Kusko et al. Skeletal Muscle 2012, 2:10 Page 5 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 Figure 1 Muscle age profiling. Heatmaps displaying the relative expression of the ten gene muscle aging profile are shown comparing young males to older males in a supervised manner using Affymetrix U133A microarray gene set data for GSE362 (A) and GSE1428 (B) and in a healthy aging dataset using a NimbleGen microarray data (C). The gene expression of the profile is displayed in a supervised manner where intensity reflects relative expression (green = higher, red = lower). Heatmaps were generated using the Heatplus package in the statistical software R 2.14.0. cluster analysis of all three groups showed the middle consistent with the possibility that HIV infection pro- aged men clustering randomly with the young group motes premature expression of this gene signature in and the old group, see Figure 2B. Notably, when middle muscle. aged healthy men were removed from the analysis, we again observed clear partitioning of the young from the Expression of the aging signature in a transgenic rodent old (Figure 1C), confirming that young and old in this model for chronic HIV infection dataset also recapitulate the ten gene muscle signature, One of the genes in our signature, the cyclin dependent as observed in Figure 1 A and B. These data are kinase inhibitor (CDKi) p21/Cip1, has been associated Figure 2 A. Muscle age profiling with HIV. Heatmap displaying the ten gene profile shown in Figure 1, with the HIV group added using GSE1428 (Figure 2A) and GSE362 (similar results, data not shown). The CAGED software was used to cluster samples (shown as rows of the heat map) based on the ten gene muscle aging profile (columns of the heat map). The analysis shows that the young men form a cluster, while HIV samples (designated by arrows and in bold, 36 to 51 years old) cluster with old subjects using the ten gene muscle aging profile. The CAGED cluster analysis uses a model-based procedure that assigns samples to the same cluster if their merging increases the posterior probability of the model. Numbers attached to the branches of the dendrogram represent the posterior odds of the model that merges the branches versus the model that does not. B. CAGED analysis of the expression of the ten gene muscle aging profile is an HIV negative dataset with young (20 to 25 years old), intermediate (40 to 45 years old designated by arrows), and old (70 to 75 years old) subjects (this entire dataset used the microarray NimbleGen platform). The gene expression of the profile is displayed in a supervised manner where intensity reflects relative expression (green = higher than average, red = lower than average). CAGED, Cluster Analysis of Gene Expression Dynamics. Kusko et al. Skeletal Muscle 2012, 2:10 Page 6 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 with muscle aging in rodent models for aging [6,15]. We H3F3b(H3), CGI-38, MT1, MYH8) using quantitative were, therefore, interested in whether a transgenic ro- real time PCR analysis in concordance with expression dent model for HIV infection (HIV Tg) would display in the microarray profiles observed in our human premature elevation of p21/Cip1 expression as well as muscle specimens. CRIM1 was found to show a trend the other genes in our signature. The HIV Tg rodent increase with the HIV Tg compared to the wild type but expresses a transgene consisting of a HIV provirus with did not show statistical significance (P = 0.08). Notably, a functional deletion of pol and gag regulated by the viral three genes, PDHA, DAAM2 and MLF1 were not sig- long terminal repeat. These rodents share many similar- nificantly different between the wild type and HIV ities to human HIV infection, compared to other rodent transgenic rat (data not shown), possibly indicating spe- models. Specifically, these rodents express the virus in cies-specific regulation. lymph nodes, spleen, kidney, thymus and immune cells including macrophages, T cells and B cells, are antigenic p16INK4a is upregulated in a transgenic rodent model for to gp120 and shed gp120 into the peripheral blood chronic HIV infection stream and have immune suppression compared to wild Recent data have linked elevated p21/Cip1 to other cell type animals. Furthermore, by five to nine months of cycle arrest genes such as p16INK4a, with healthy aging age, these animals develop weight loss, neurological ab- in muscle stem cells [15] and other tissue specific stem normalities, respiratory difficulties and other symptoms cells [29,30]. To assess whether cell cycle arrest was a of AIDS [27,28]. We chose to use the HIV Tg rodent general feature in the muscle in our rodent model, we model for chronic infection because this model displays measured p16INK4a RNA levels in both the HIV Tg and musculoskeletal decline that includes loss in lean wild type rodent. Figure 3B shows that the levels of muscle and resorption of bone, both phenotypes p16INK4a were significantly elevated compared with observed in human HIV infection [4,5]. As shown in wild type age-matched controls. This further suggests Figure 3A, we observed significant up-regulated expres- that cell cycle arrest genes are prematurely expressed in sion of p21/Cip1, as well as most of the other aging sig- muscle during HIV infection, specifically that both the nature genes or gene homologues (for example, Fez2, Cip and Ink4 families are induced. Figure 3 Expression of p21/Cip1, p16INK4a and TGFβ1 in the HIV transgenic rodent. A. Realtime RNA PCR validation was observed for p21/Cip1, Fez2, H3, MFL1, MT1F and MYH8 in muscle from HIV transgenic gastrocnemius (n = 4) muscle or wild type gastrocnemius muscle (n = 3) and shows an increase in genes in HIV Tg compared to age matched wild type controls. All bar plots show mean fold change with error bars indicating the standard deviation. The difference between wild type and HIV Tg is significant to P ≤ 0.05. B. RT-PCR shows an increase in the cell cycle arrest gene, p16INK4a, in HIV Tg rat (n =4) compared to wild type (n = 3). The difference is significant to P< 0.05. The bar plot indicates mean fold change with the error bars indicative of the standard deviation. C. TGFβ1 protein levels based on ELISA of muscle homogenates from HIV transgenic gastrocnemius muscle (n = 3) or wild type gastrocnemius muscle (n = 3) show increased levels in the HIV Tg rodent at a significance of P< 0.05. Bar plots indicate mean protein levels with error bars indicative of the standard deviation. TGFβ, transforming growth factor β. Kusko et al. Skeletal Muscle 2012, 2:10 Page 7 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 TGFβ is upregulated in a transgenic rodent model for with TGFβ and collagen deposition in the hindlimb chronic HIV infection muscle (gastrocnemius) of the wild type and HIV Tg ro- The TGFβ family members, including TGFβ itself, as dent. We first examined the collagen transcriptional in- well as the growth antagonist myostatin, have been ducer, connective tissue growth factor (CTGF), a factor shown to upregulate p21/Cip1 and p16INK4a in aging that mediates TGFβ induced collagen gene expression muscle in both the stem cell population and the muscle [42,43]. As shown in Figure 4A, there was an increase in fibers in mice [6,15]. Expression of both p21/Cip1 and expression in CTGF in the HIV Tg rodents. We then p16INK4a has also been shown to be upregulated in a measured the expression of collagen genes, COL1A1 number of human aging studies in leukocytes, fibro- and COL1A2. As shown in Figure 4B, these genes were blasts, neural tissue and pancreatic islet cells [18,29-39]. also upregulated in the HIV Tg rodent. This upregulation of p16INK4a is thought to be asso- ciated with aging and senescence. To evaluate whether The HIV tg rodent muscle exhibits fibrosis and fiber type TGFβ protein might also be upregulated in our HIV switching in muscle muscle in addition to the senescence-associated genes, Because we saw evidence of the upregulation of collagen we measured protein levels in muscle homogenates from genes in HIV, to evaluate whether collagen deposition was HIV Tg and age-matched wild type rodents at the onset detectable in association with upregulated TGFβ and col- of bone and muscle loss (approximately seven months of lagen genes, we analyzed gastrocnemius tissue sections age). As shown in Figure 3C, we observed a dramatic in- and quantified collagen content. As shown in Figure 5, crease in TGFβ protein levels in HIV Tg animals com- there was a significant increase in muscle collagen depos- pared to wild type controls, consistent with elevated ition in the HIV Tg rodent compared to the wild type con- TGFβ in muscle aging studies in rodents [15]. trols. This is consistent with aging muscle, which also shows an increase in collagen deposition [6]. Since aging The collagen gene inducer, CTGF, as well as collagen is also associated with a shift in fiber types, specifically an gene expression are induced in a transgenic rodent increase in slow twitch and a decrease in fast twitch [44- model for chronic HIV infection 46], we analyzed the types of fibers seen in the gastrocne- Elevated TGFβ levels have been previously linked to de- mius in the wild type compared to the HIV Tg. We found position of collagen and tissue fibrosis of lymph nodes that as with aging, there is a significant increase in slow in both human HIV infection and in simian immuno- twitch fibers and decrease in the fast twitch fibers in the deficiency virus (SIV) models of infection [40,41]. Fur- HIV Tg rat compared to the wild type. thermore, in aging, muscle from rodents has been shown to convert to a fibrogenic phenotype [6]. How- Conclusions ever, fibrotic genes and collagen deposition in skeletal With the success of anti-retroviral therapy in suppressing muscle have not yet been described in the context of viral burden there has been a profound influence on the HIV infection. We, therefore, measured genes associated course of HIV infection from a lethal to a managed Figure 4 Expression of collagen genes in the HIV transgenic rodent model. A. The collagen transcriptional regulator, CTGF, is increased in HIV Tg rat muscle (n = 3) compared to wild type (n = 3) using realtime RNA PCR at a significance of P <0.05. The bar plots indicate mean fold change with error bars indicative of standard deviation. B. The collagen genes, COL1A1 and COL1A2 are increase in HIV Tg rat muscle (n =3) compared to wild type (n = 3) using realtime RNA PCR. The bar plots indicate mean fold change with the error bars indicative of standard deviation. The difference between wild type and HIV Tg rodents are significant to P< 0.05. CTGF, connective tissue growth factor. Kusko et al. Skeletal Muscle 2012, 2:10 Page 8 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 Figure 5 Collagen deposition and fiber type switching in the HIV transgenic rat. Histological muscle sections of the gastrocnemius muscle of HIV Tg (n = 6) and control wild type rats (n = 3) were stained using Picrosirius Red for collagen. Representative images are shown in A and B. The scale bar equals 200 μm. A. Tissue section of the gastrocnemius muscle in wild type rat shows collagen deposition in red in intracellular space. B. Tissue section of gastrocnemius muscle from HIV Tg rat shows increased collagen deposition in red in the intracellular spaces. C. Quantification of the area of picrosirius red staining using Image J shows that there is an increase in fibrotic index in the HIV Tg rat compared to the wild type at a significance of P< 0.05. The bar plot indicates mean percent area of collagen with the error bars indicative of the standard deviation. D. Quantification of fiber type was done using Image J on control wild type (n = 4) and HIV Tg (n = 4). The bar plot indicates the percentage of fibers of each type with error bars indicative of standard deviation. chronic disease. Nevertheless, HIV-infected individuals re- detailed study of fibrosis in skeletal muscle in chronic main at higher than expected risk for a number of compli- HIV infection has not been done to date. In this study, cations typically associated with aging [47]. Aging is often we use an aging signature in muscle to identify and defined on the basis of functional capacity, or frailty, ra- evaluate aging- and fibrosis-related pathways in the ro- ther than the collection of age-associated diseases [48,49]. dent model of HIV. We show gene expression changes Frailty, as defined in the elderly by Fried and colleagues, and phenotypic changes in muscle in an HIV Tg rodent [50] has been previously evaluated in men with HIV [1,2] model similar to that seen in aging. We see an upregula- wherein a significant frailty-related phenotype (FRP) has tion of genes associated with aging muscle prematurely been observed. Margolick and colleagues have also expressed in HIV in both the human and the rat. We, reported the premature occurrence of age-adjusted frailty furthermore, show changes in both fiber type compos- with HIV infection [1-3]. ition and in fibrotic collagen deposition in the HIV ro- With the advancing age of the HIV-infected popula- dent. Previous work by our laboratory in humans has tion, the role of aging-associated inflammation in com- also shown that an increase in CTGF expression in vas- promising normal tissue remodeling is becoming tus lateralis from HIV-positive men was downregulated increasingly more relevant. In 2006, approximately one with anabolic supplementation in microarray analysis third of people with AIDS in the US were over age 50 (see supplemental data in [19]), consistent with our find- [49]. Chronic inflammation that occurs with increasing ings of a dysregulation of CTGF in HIV. Collectively age has been shown to adversely affect muscle homeo- these data suggest that the genotypic and phenotypic stasis [51-53], with aging muscle increasingly likely to changes that we see might be related to HIV infection. exhibit changes in extracellular matrix resembling a This data also elucidate pathways HIV might use that re- fibrogenic phenotype [6-9]. Recently, SIV infection has sult in increased risk for a frailty-related phenotype. been linked with fibroblast deposition of collagen and Three independent datasets were used in this study to increased fibrosis in lymph nodes associated with an in- identify an aging gene signature that differs between crease in local TGFβ production [40,54,55]. However, a older individuals and younger individuals. This signature Kusko et al. Skeletal Muscle 2012, 2:10 Page 9 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 is prematurely expressed in HIV-positive subjects. The factors that includes multiple inflammatory cytokines. aging profile genes include: CDKN1A/p21, FEZ2, Previous studies on senescence show that the cells respon- H3F3B, DAAM2, MLF1, PDHA1, MT1F, MYH8 and sible for the release of SASP factors show an upregulation CRIM1. FEZ2 is a factor that interacts with a number of in key senescence-associated genes including p21 and transcription controlling proteins to influence chromatin p16INK4a [35-37,39,65]. In muscle, these genes are remodeling and apoptosis [56]. H3F3B is a replacement thought to contribute to a decreased regenerative capacity histone that constitutes the major form of histone H3 in with aging that has been seen in rodents as they have been senescent cells [57]. DAAM2 regulates cell fate and detected in both fibers and satellite cells [15,53]. We show actin-cytoskeleton re-organization through WNT signal- the premature upregulation of p21/Cip1 in both human ing [58]. Previous studies have shown that changes in and rodent muscle tissue with HIV and the premature actin cytoskeleton turnover can trigger an increase in upregulation of p16INK4a in rodent muscle tissue sug- levels of reactive oxygen species (ROS) in the cytosol gesting that a senescence axis might be activated early and, therefore, decrease cellular viability [59]. MLF1 with HIV infection. What cell types in the muscle (that is, suppresses COP1 through COP9 thereby stabilizing p53 satellite cells, fibroblast or mature muscle cells) contribute [60]. PDHA1 is a mitochondrial metabolic enzyme that to the changes in gene expression is beyond the scope of provides the link between glycolysis and the TCA cycle this study and will require further analysis. Furthermore, [61]. MT1F and MT1A have a metalloregulatory function whether or not the upregulation of these genes contri- in repair, growth, and differentiation [62] with MT1A being butes to a dysregulation of the satellite cells in HIV a similar family methallothionein to MT1F in the rat. muscle leading to an aging phenotype is an intriguing area MYH8 is a member of the myosin protein family and is of future study. involved in muscle contraction by interacting with actin As previously mentioned, many of the factors that in- filaments [63]. CRIM1 is a membrane bound protein that is crease in serum with aging include inflammatory cyto- known to interact with the TGFβ superfamily [64]. kines including TGFβ, TNFα and IL-6 [34-36,38,39,67- CDKN1A (p21/Cip1) is a well-recognized cell cyclin 69]. Some of these circulating factors have been shown dependent kinase inhibitor that has been associated with to dampen proliferation of satellite cells, lead to remod- muscle aging and cellular senescence that has not been pre- eling of the stem cell niche and lead to dysregulation of viously linked with muscle aging in HIV infection. Whether stem cell function specifically in muscle [15,53,70]. HIV these genes reflect a larger network of regulators in aging is also associated with an increase in systemic inflamma- that are co-opted in HIV is beyond the scope of this study tory burden, especially in serum factors like IL-6 and will require further network and pathway analysis of [1,2,69,71,72]. Increases in systemic inflammatory cyto- these genes and their potential interactions during healthy kines are also known to lead to a loss of muscle mass and dysregulated muscle aging.Itisofnotethatwhile these [73-78]. Whether the gene signature that we see in HIV genes displayed a robust signature in our two initial data- and aging is due to a common increase in inflammatory sets, GSE363 and GSE 1428, the signature did not fully re- burden or whether HIV infection itself drives both the capitulate in a third cohort (shown in Figure 1C). signature and inflammatory process is an intriguing Furthermore, the genes that erode in the heatmap for the question that remains beyond the scope of this study. third cohort include PDHA, MLF1 and DAAM2 and are In addition to inflammation, previous studies dissect- the same genes that did not show significant changes in the ing acute conditions leading to muscle atrophy have HIV Tg rat model compared to the wild type (data not revealed a common role for the ubiquitin proteasome shown). This data suggest that these three genes may not pathway mediated by the E3 ligases MuRF1 and MAFBx remain as robust as the others and will require further ana- to promote muscle protein degradation, notably the lysis of additional independent datasets. muscle structural protein myosin heavy chain [79-82]. Upstream activators for these atrogenes include FOXO In this study, we see selected senescence-ssociated path- ways in addition to the fibrosis pathways prematurely and NFκB pathways [83] and have been identified in expressed in HIV infection. Based on these results, we multiple rodent models of induced wasting, notably can- cer-associated cachexia [84] and also HIV in a rodent propose that HIV infection may represent an uncoupled and dysregulated aging phenotype that increases the risk model for infection [5]. While we do not see an upregu- for muscle fibrosis. Senescence-associated pathways have lation of atrogenes in our genetic signature in aging, the HIV transgenic rodent model has previously been shown been previously implicated in muscle aging, but have not been directly linked to HIV infection. Recent studies on to have an increase in MuRF1 compared to the wild type senescence and aging indicate that cellular senescence is [4]. Therefore, the atrogene pathway may represent an- accompanied by a striking increase in the secretion of 40 other pathway in addition to the fibrotic and senescence to 80 factors [34,38,65,66], termed the ‘senescence-asso- pathways we study that shows dysregulation from the ciated secretory phenotype’ or SASP [35], an ensemble of normal aging pattern seen specifically in HIV. Kusko et al. Skeletal Muscle 2012, 2:10 Page 10 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 The cause of HIV-related frailty and muscle loss is an 2. Desquilbet L, Margolick JB, Fried LP, Phair JP, Jamieson BD, Holloway M, Jacobson LP: Relationship between a frailty-related phenotype and area that has been understudied with the etiology poorly progressive deterioration of the immune system in HIV-infected men. J understood. Further evaluation of both the senescent and Acquir Immune Defic Syndr 2009, 50:299–306. fibrotic pathways and genes in association with muscle 3. Margolick J, Detels R: Phair JP, Rinaldo C, Jacobson LP: Earlier Occurrence of the Frailty Phenotype in HIV + Men than in HIV- Men: The MACS. In: CROI. function in healthy aging and in HIV infection should bet- Boston; 2011. ter assist in identifying molecular pathways associated with 4. Otis JS, Ashikhmin YI, Brown LA, Guidot DM: Effect of HIV-1-related protein frailty in both conditions. Increased frailty is likely to cre- expression on cardiac and skeletal muscles from transgenic rats. AIDS Res Ther 2008, 5:8. ate a substantial burden on future health care, underscor- 5. Vikulina T, Fan X, Yamaguchi M, Roser-Page S, Zayzafoon M, Guidot DM, ing a need for diagnostic biomarkers and early detection in Ofotokun I, Weitzmann MN: Alterations in the immuno-skeletal interface this population. The role of chronic inflammation driven drive bone destruction in HIV-1 transgenic rats. Proc Natl Acad Sci U S A 2010, 107:13848–13853. fibrosis in HIV is an understudied potential mediator of 6. Brack AS, Conboy MJ, Roy S, Lee M, Kuo CJ, Keller C, Rando TA: Increased functional decline. Further characterization of this pheno- Wnt signaling during aging alters muscle stem cell fate and increases type could open avenues for therapeutic intervention to fibrosis. Science 2007, 317:807–810. 7. Grounds MD: Age-associated changes in the response of skeletal muscle prevent fibrosis associated declines in physical function. cells to exercise and regeneration. Ann N Y Acad Sci 1998, 854:78–91. 8. Schiaffino S, Partridge T: Skeletal Muscle Repair and Regeneration. Dordrecht: Abbreviations Springer; 2008. AIDS: Acquired Immunodeficiency Syndrome; ALS: amyotrophic lateral 9. Goldspink G, Fernandes K, Williams PE, Wells DJ: Age-related changes in sclerosis; BADGE: Bayesian analysis of differential gene expression; collagen gene expression in the muscles of mdx dystrophic and normal CAGED: cluster analysis of gene expression dynamics; CDKi: cyclin dependent mice. Neuromuscul Disord 1994, 4:183–191. kinase inhibitor; CMM: cubic millimeter; CTGF: connective tissue growth 10. Sadeh M: Effects of aging on skeletal muscle regeneration. J Neurol Sci factor; ELISA: enzyme-linked immunoassay; FRP: frailty related phenotype; 1988, 87:67–74. GEO: gene expression omnibus; HAART: highly active antiretroviral therapy; 11. Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA: Transforming growth HIV Tg: HIV transgenic; HIV: human immunodeficiency virus; IL-6: interleukin factor-beta regulation of immune responses. Annu Rev Immunol 2006, 6; MAFBx: muscle atrophy F-box; MHC: myosin heavy chain; MuRF1: muscle 24:99–146. RING finger protein 1; NCBI: National Center for Biotechnology Information; 12. Branton MH, Kopp JB: TGF-beta and fibrosis. Microbes Infect 1999, 1:1349– OCT: optimal cutting temperature medium; OMIM: Online Mendelian Inheritance in Man; PCR: polymerase chain reaction; RNA: ribonucleic acid; 13. Wynn TA: Cellular and molecular mechanisms of fibrosis. J Pathol 2008, ROS: reactive oxygen species; SASP: senescence associated secretory 214:199–210. phenotype; SIV: simian immunodeficiency virus; TCA: tricarboxylic acid cycle; 14. Zugmaier G, Paik S, Wilding G, Knabbe C, Bano M, Lupu R, Deschauer B, TGFβ1: transforming growth factor β 1; TNFα: tumor necrosis factor α; Simpson S, Dickson RB, Lippman M: Transforming growth factor beta 1 US: United States; WT: wild type. induces cachexia and systemic fibrosis without an antitumor effect in nude mice. Cancer Res 1991, 51:3590–3594. Competing interests 15. Carlson ME, Hsu M, Conboy IM: Imbalance between pSmad3 and Notch The authors declare that they have no competing interests. induces CDK inhibitors in old muscle stem cells. Nature 2008, 454:528–532. Acknowledgments 16. Giresi PG, Stevenson EJ, Theilhaber J, Koncarevic A, Parkington J, Fielding The authors wish to acknowledge the Boston OAIC Pepper Center and the RA, Kandarian SC: Identification of a molecular signature of sarcopenia. Longevity Consortium for their encouragement and support of this study, Physiol Genomics 2005, 21:253–263. and thank M. Trojanowska for the gift of the rodent COL1A1, COL1A2, CTGF 17. Welle S, Brooks A, Thornton CA: Senescence-related changes in gene and GAPDH primers and P. Haines for technical expertise. This work was expression in muscle: similarities and differences between mice and supported by U.S. National Institutes of Health grants R01 AR055115 (M.M.) men. Physiol Genomics 2001, 5:67–73. and the Boston OAIC Pepper Center grant 5P30 AG31679 (S.B.) The following 18. Krishnamurthy J, Torrice C, Ramsey MR, Kovalev GI, Al-Regaiey K, Su L, reagent was obtained through the AIDS Research and Reference Reagent Sharpless NE: Ink4a/Arf expression is a biomarker of aging. J Clin Invest Program, Division of AIDS, NIAID, NIH: U1/HIV-1 from Dr. Thomas Folks. 2004, 114:1299–1307. 19. Montano M, Flanagan JN, Jiang L, Sebastiani P, Rarick M, LeBrasseur NK, Author details Morris CA, Jasuja R, Bhasin S: Transcriptional profiling of testosterone- Boston University School of Medicine, 650 Albany St. EBRC 646, Boston, 2 3 regulated genes in the skeletal muscle of human immunodeficiency MA02118USA. Emory University, Atlanta, GA 30322, USA. Boston University virus-infected men experiencing weight loss. J Clin Endocrinol Metab 2007, School of Public Health, Boston, MA 02118, USA. Buck Institute, Novato, CA 92:2793–2802. 94945, USA. McMaster University, Toronto, ON L8S, Canada. 20. Welle S, Brooks AI, Delehanty JM, Needler N, Thornton CA: Gene expression profile of aging in human muscle. Physiol Genomics 2003, 14:149–159. Authors’ contributions 21. Abadi A, Glover EI, Isfort RJ, Raha S, Safdar A, Yasuda N, Kaczor JJ, Melov S, BK and CB contributed equally to this work. BK, CB and MM wrote the Hubbard A, Qu X, Phillips SM, Tarnopolsky M: Limb immobilization induces manuscript. KL, CB and AD performed the experiments. JO, SM, MT and SB a coordinate down-regulation of mitochondrial and other metabolic provided muscle tissue and/or unpublished microarray expression data. BK, pathways in men and women. PLoS One 2009, 4:e6518. PS and MM conceived of the study, coordinated the experimental approach 22. Sebastiani P, Mandl KD, Szolovits P, Kohane IS, Ramoni MF: A Bayesian and drafted the manuscript. All authors read and approved the final dynamic model for influenza surveillance. Stat Med 2006, 25:1803–1816. manuscript. discussion 1817–1825. Received: 8 February 2012 Accepted: 7 June 2012 23. Ramoni MF, Sebastiani P, Kohane IS: Cluster analysis of gene expression Published: 7 June 2012 dynamics. Proc Natl Acad Sci U S A 2002, 99:9121–9126. 24. Hosack DA, Dennis G Jr, Sherman BT, Lane HC, Lempicki RA: Identifying References biological themes within lists of genes with EASE. Genome Biol 2003, 4: 1. Desquilbet L, Jacobson LP, Fried LP, Phair JP, Jamieson BD, Holloway M, R70. Margolick JB: HIV-1 infection is associated with an earlier occurrence of a 25. da Huang W, Sherman BT, Lempicki RA: Systematic and integrative phenotype related to frailty. J Gerontol A Biol Sci Med Sci 2007, analysis of large gene lists using DAVID bioinformatics resources. Nat 62:1279–1286. Protoc 2009, 4:44–57. Kusko et al. Skeletal Muscle 2012, 2:10 Page 11 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 26. Tanano H, Hasegawa T, Kimura T, Sasaki T, Kawahara H, Kubota A, Okada A: Ashworth JR, Campanelli C, Clayton CP, Rada B, Woolard NF, High KP: Aging Proposal of fibrosis index using image analyzer as a quantitative and infectious diseases: workshop on HIV infection and aging: what is histological evaluation of liver fibrosis in biliary atresia. Pediatr Surg Int known and future research directions. Clin Infect Dis 2008, 47:542–553. 2003, 19:52–56. 48. Walston J, Hadley EC, Ferrucci L, Guralnik JM, Newman AB, Studenski SA, 27. Ray PE, Liu XH, Robinson LR, Reid W, Xu L, Owens JW, Jones OD, Denaro F, Ershler WB, Harris T, Fried LP: Research agenda for frailty in older adults: Davis HG, Bryant JL: A novel HIV-1 transgenic rat model of childhood HIV- toward a better understanding of physiology and etiology: summary 1-associated nephropathy. Kidney Int 2003, 63:2242–2253. from the American Geriatrics Society/National Institute on Aging 28. Reid W, Sadowska M, Denaro F, Rao S, Foulke J Jr, Hayes N, Jones O, Research Conference on frailty in older adults. J Am Geriatr Soc 2006, Doodnauth D, Davis H, Sill A, O'Driscoll P, Huso D, Fouts T, Lewis G, Hill M, 54:991–1001. Kamin-Lewis R, Wei C, Ray P, Gallo RC, Reitz M, Bryant J: An HIV-1 49. Ruiz M, Cefalu C: Characteristics of frail patients in a geriatric-HIV transgenic rat that develops HIV-related pathology and immunologic program: the experience of an urban academic center at one year dysfunction. Proc Natl Acad Sci U S A 2001, 98:9271–9276. follow-up. J Int Assoc Physicians AIDS Care 2011, 10:138–143. 29. Itahana K, Zou Y, Itahana Y, Martinez JL, Beausejour C, Jacobs JJ, Van 50. Fried LP, Tangen CM, Walston J, Newman AB, Hirsch C, Gottdiener J, Lohuizen M, Band V, Campisi J, Dimri GP: Control of the replicative life Seeman T, Tracy R, Kop WJ, Burke G, McBurnie MA, Cardiovascular Health span of human fibroblasts by p16 and the polycomb protein Bmi-1. Mol Study Collaborative Research Group: Frailty in older adults: evidence for a Cell Biol 2003, 23:389–401. phenotype. J Gerontol A Biol Sci Med Sci 2001, 56:M146–M156. 30. Liu Q, Song LJ, Xu WQ, Zhao L, Zheng L, Yan ZW, Fu GH: Expression of 51. Barbieri M, Ferrucci L, Ragno E, Corsi A, Bandinelli S, Bonafe M, Olivieri F, cytoplasmic p16 and anion exchanger 1 is associated with the invasion Giovagnetti S, Franceschi C, Guralnik JM, Paolisso G: Chronic inflammation and absence of lymph metastasis in gastric carcinoma. Mol Med Report and the effect of IGF-I on muscle strength and power in older persons. 2009, 2:169–174. Am J Physiol Endocrinol Metab 2003, 284:E481–E487. 31. Campisi J: Cellular senescence as a tumor-suppressor mechanism. Trends 52. Krabbe KS, Pedersen M, Bruunsgaard H: Inflammatory mediators in the Cell Biol 2001, 11:S27–S31. elderly. Exp Gerontol 2004, 39:687–699. 32. Krishnamurthy J, Ramsey MR, Ligon KL, Torrice C, Koh A, Bonner-Weir S, 53. Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL, Rando TA: Sharpless NE: p16INK4a induces an age-dependent decline in islet Rejuvenation of aged progenitor cells by exposure to a young systemic regenerative potential. Nature 2006, 443:453–457. environment. Nature 2005, 433:760–764. 33. Molofsky AV,Slutsky SG,JosephNM, He S, Pardal R, KrishnamurthyJ,Sharpless 54. Estes JD: Role of collagen deposition in lymphatic tissues and immune NE, Morrison SJ: Increasing p16INK4a expression decreases forebrain reconstruction during HIV-1 and SIV infections. Curr HIV/AIDS Rep 2009, progenitors and neurogenesis during ageing. Nature 2006, 443:448–452. 6:29–35. 34. Coppe JP, Desprez PY, Krtolica A, Campisi J: The senescence-associated 55. Estes JD, Haase AT, Schacker TW: The role of collagen deposition in secretory phenotype: the dark side of tumor suppression. Annu Rev depleting CD4+ T cells and limiting reconstitution in HIV-1 and SIV Pathol 2010, 5:99–118. infections through damage to the secondary lymphoid organ niche. 35. Coppe JP, Patil CK, Rodier F, Sun Y, Munoz DP, Goldstein J, Nelson PS, Semin Immunol 2008, 20:181–186. Desprez PY, Campisi J: Senescence-associated secretory phenotypes 56. Assmann EM, Alborghetti MR, Camargo ME, Kobarg J: FEZ1 dimerization reveal cell-nonautonomous functions of oncogenic RAS and the p53 and interaction with transcription regulatory proteins involves its coiled- tumor suppressor. PLoS Biol 2008, 6:2853–2868. coil region. J Biol Chem 2006, 281:9869–9881. 36. Kuilman T, Peeper DS: Senescence-messaging secretome: SMS-ing cellular 57. Hardy RR, Hayakawa K: Development of B cells producing natural stress. Nat Rev Cancer 2009, 9:81–94. autoantibodies to thymocytes and senescent erythrocytes. Springer Semin 37. Beausejour CM, Krtolica A, Galimi F, Narita M, Lowe SW, Yaswen P, Campisi Immunopathol 2005, 26:363–375. J: Reversal of human cellular senescence: roles of the p53 and p16 58. Katoh M: Identification and characterization of human DAAM2 gene in pathways. EMBO J 2003, 22:4212–4222. silico. Int J Oncol 2003, 22:915–920. 38. Freund A, Orjalo AV, Desprez PY, Campisi J: Inflammatory networks during 59. Gourlay CW, Carpp LN, Timpson P, Winder SJ, Ayscough KR: A role for the cellular senescence: causes and consequences. Trends Mol Med 2010, actin cytoskeleton in cell death and aging in yeast. J Cell Biol 2004, 16:238–246. 164:803–809. 39. Rodier F, Campisi J: Four faces of cellular senescence. J Cell Biol 2011, 60. Kato JY, Yoneda-Kato N: Mammalian COP9 signalosome. Genes Cells 2009, 192:547–556. 14:1209–1225. 40. Zeng M, Smith AJ, Wietgrefe SW, Southern PJ, Schacker TW, Reilly CS, Estes 61. Dahl HH, Brown GK, Brown RM, Hansen LL, Kerr DS, Wexler ID, Patel MS, De JD, Burton GF, Silvestri G, Lifson JD, Carlis JV, Haase AT: Cumulative Meirleir L, Lissens W, Chun K, et al: Mutations and polymorphisms in the mechanisms of lymphoid tissue fibrosis and T cell depletion in HIV-1 pyruvate dehydrogenase E1 alpha gene. Hum Mutat 1992, 1:97–102. and SIV infections. J Clin Invest 2011, 121:998–1008. 62. Kagi JH: Overview of metallothionein. Methods Enzymol 1991, 205:613–626. 41. Schacker TW, Reilly C, Beilman GJ, Taylor J, Skarda D, Krason D, Larson M, 63. Bober E, Buchberger-Seidl A, Braun T, Singh S, Goedde HW, Arnold HH: Haase AT: Amount of lymphatic tissue fibrosis in HIV infection predicts Identification of three developmentally controlled isoforms of human magnitude of HAART-associated change in peripheral CD4 cell count. myosin heavy chains. Eur J Biochem 1990, 189:55–65. AIDS 2005, 19:2169–2171. 64. Nystrom J, Hultenby K, Ek S, Sjolund J, Axelson H, Jirstrom K, Saleem MA, 42. Chujo S, Shirasaki F, Kawara S, Inagaki Y, Kinbara T, Inaoki M, Takigawa M, Nilsson K, Johansson ME: CRIM1 is localized to the podocyte filtration slit Takehara K: Connective tissue growth factor causes persistent proalpha2 diaphragm of the adult human kidney. Nephrol Dial Transplant 2009, (I) collagen gene expression induced by transforming growth factor-beta 24:2038–2044. in a mouse fibrosis model. J Cell Physiol 2005, 203:447–456. 65. Coppe JP, Patil CK, Rodier F, Krtolica A, Beausejour CM, Parrinello S, 43. Arnott JA, Nuglozeh E, Rico MC, Arango-Hisijara I, Odgren PR, Safadi FF, Hodgson JG, Chin K, Desprez PY, Campisi J: A human-like senescence- Popoff SN: Connective tissue growth factor (CTGF/CCN2) is a associated secretory phenotype is conserved in mouse cells dependent downstream mediator for TGF-beta1-induced extracellular matrix on physiological oxygen. PLoS One 2010, 12;5:e9188. production in osteoblasts. J Cell Physiol 2007, 210:843–852. 66. Young AR, Narita M: SASP reflects senescence. EMBO Rep 2009, 44. Close GL, Kayani A, Vasilaki A, McArdle A: Skeletal muscle damage with 10:228–230. exercise and aging. Sports Med 2005, 35:413–427. 67. Bruunsgaard H, Andersen-Ranberg K, Jeune B, Pedersen AN, Skinhoj P, 45. Lexell J, Taylor CC, Sjostrom M: What is the cause of the ageing atrophy? Pedersen BK: A high plasma concentration of TNF-alpha is associated Total number, size and proportion of different fiber types studied in with dementia in centenarians. J Gerontol A Biol Sci Med Sci 1999, 54: whole vastus lateralis muscle from 15- to 83-year-old men. J Neurol Sci M357–M364. 1988, 84:275–294. 68. Bruunsgaard H, Pedersen M, Pedersen BK: Aging and proinflammatory 46. Porter MM, Vandervoort AA, Lexell J: Aging of human muscle: structure, cytokines. Curr Opin Hematol 2001, 8:131–136. function and adaptability. Scand J Med Sci Sports 1995, 5:129–142. 69. De Martinis M, Franceschi C, Monti D, Ginaldi L: Inflamm-ageing and 47. Effros RB, Fletcher CV, Gebo K, Halter JB, Hazzard WR, Horne FM, Huebner lifelong antigenic load as major determinants of ageing rate and RE, Janoff EN, Justice AC, Kuritzkes D, Nayfield SG, Plaeger SF, Schmader KE, longevity. FEBS Lett 2005, 579:2035–2039. Kusko et al. Skeletal Muscle 2012, 2:10 Page 12 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 70. Gopinath SD, Rando TA: Stem cell review series: aging of the skeletal muscle stem cell niche. Aging Cell 2008, 7:590–598. 71. Appay V, Rowland-Jones SL: Premature ageing of the immune system: the cause of AIDS? Trends Immunol 2002, 23:580–585. 72. Margolick JB, Chopra RK: Relationship between the immune system and frailty: pathogenesis of immune deficiency in HIV infection and aging. Aging 1992, 4:255–257. 73. Abad LW, Schmitz HR, Parker R, Roubenoff R: Cytokine responses differ by compartment and wasting status in patients with HIV infection and healthy controls. Cytokine 2002, 18:286–293. 74. Baracos V, Rodemann HP, Dinarello CA, Goldberg AL: Stimulation of muscle protein degradation and prostaglandin E2 release by leukocytic pyrogen (interleukin-1). A mechanism for the increased degradation of muscle proteins during fever. N Engl J Med 1983, 308:553–558. 75. Clowes GH Jr, George BC, Jr Villee CA, Saravis CA: Muscle proteolysis induced by a circulating peptide in patients with sepsis or trauma. N Engl J Med 1983, 308:545–552. 76. Thea DM, Porat R, Nagimbi K, Baangi M, St Louis ME, Kaplan G, Dinarello CA, Keusch GT: Plasma cytokines, cytokine antagonists, and disease progression in African women infected with HIV-1. Ann Intern Med 1996, 124:757–762. 77. Zoico E, Roubenoff R: The role of cytokines in regulating protein metabolism and muscle function. Nutr Rev 2002, 60:39–51. 78. Tracey KJ, Wei H, Manogue KR, Fong Y, Hesse DG, Nguyen HT, Kuo GC, Beutler B, Cotran RS, Cerami A, et al: Cachectin/tumor necrosis factor induces cachexia, anemia, and inflammation. J Exp Med 1988, 167:1211– 79. Cao PR, Kim HJ, Lecker SH: Ubiquitin-protein ligases in muscle wasting. Int J Biochem Cell Biol 2005, 37:2088–2097. 80. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE, Goldberg AL: Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J 2004, 18:39– 81. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH, Goldberg AL: Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117:399–412. 82. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, Glass DJ: Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 2001, 294:1704–1708. 83. Glass DJ: Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol 2005, 37:1974–1984. 84. Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ, Shoelson SE: IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 2004, 119:285–298. doi:10.1186/2044-5040-2-10 Cite this article as: Kusko et al.: Premature expression of a muscle fibrosis axis in chronic HIV infection. Skeletal Muscle 2012 2:10. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Skeletal Muscle Springer Journals

Premature expression of a muscle fibrosis axis in chronic HIV infection

Loading next page...
 
/lp/springer-journals/premature-expression-of-a-muscle-fibrosis-axis-in-chronic-hiv-kTePkCJeEu
Publisher
Springer Journals
Copyright
Copyright © 2012 by Kusko et al.; licensee BioMed Central Ltd.
Subject
Life Sciences; Cell Biology; Developmental Biology; Biochemistry, general; Systems Biology; Biotechnology
eISSN
2044-5040
DOI
10.1186/2044-5040-2-10
pmid
22676806
Publisher site
See Article on Publisher Site

Abstract

Background: Despite the success of highly active antiretroviral therapy (HAART), HIV infected individuals remain at increased risk for frailty and declines in physical function that are more often observed in older uninfected individuals. This may reflect premature or accelerated muscle aging. Methods: Skeletal muscle gene expression profiles were evaluated in three uninfected independent microarray datasets including young (19 to 29 years old), middle aged (40 to 45 years old) and older (65 to 85 years old) subjects, and a muscle dataset from HIV infected subjects (36 to 51 years old). Using Bayesian analysis, a ten gene muscle aging signature was identified that distinguished young from old uninfected muscle and included the senescence and cell cycle arrest gene p21/Cip1 (CDKN1A). This ten gene signature was then evaluated in muscle specimens from a cohort of middle aged (30 to 55 years old) HIV infected individuals. Expression of p21/Cip1 and related pathways were validated and further analyzed in a rodent model for HIV infection. Results: We identify and replicate the expression of a set of muscle aging genes that were prematurely expressed in HIV infected, but not uninfected, middle aged subjects. We validated select genes in a rodent model of chronic HIV infection. Because the signature included p21/Cip1, a cell cycle arrest gene previously associated with muscle aging and fibrosis, we explored pathways related to senescence and fibrosis. In addition to p21/Cip1, we observed HIV associated upregulation of the senescence factor p16INK4a (CDKN2A) and fibrosis associated TGFβ1, CTGF, COL1A1 and COL1A2. Fibrosis in muscle tissue was quantified based on collagen deposition and confirmed to be elevated in association with infection status. Fiber type composition was also measured and displayed a significant increase in slow twitch fibers associated with infection. Conclusions: The expression of genes associated with a muscle aging signature is prematurely upregulated in HIV infection, with a prominent role for fibrotic pathways. Based on these data, therapeutic interventions that promote muscle function and attenuate pro-fibrotic gene expression should be considered in future studies. Keywords: Skeletal muscle, Aging, Gene expression, HIV infection, Senescence Background are more often seen in the elderly. However, the molecu- Despite the considerable success of highly active anti- lar and regulatory pathways that underlie this process re- retroviral therapy (HAART), individuals chronically main vaguely defined. infected with HIV remain at higher risk for declines in Studies on muscle aging in both humans and rodent musculoskeletal function and increased frailty [1-3], a models have shown increases in collagen deposition and phenotype also observed in rodent models for HIV in- fibrotic tissue in aging muscle [6-10], suggesting a skew- fection [4,5]. In humans, this functional decline resem- ing in the balance of muscle and fibroblasts with in- bles an aging phenotype, since many of these risk factors creasing age. Transforming growth factor β (TGFβ)isa known key regulator in maintaining the balance of colla- gen in the extracellular matrix as well as in modulating * Correspondence: mmontano@bu.edu 1 inflammatory responses [11,12] . It is normally expressed Boston University School of Medicine, 650 Albany St. EBRC 646, Boston, in muscle after injury but also has the potential to MA02118USA Full list of author information is available at the end of the article © 2012 Kusko et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Kusko et al. Skeletal Muscle 2012, 2:10 Page 2 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 induce fibrosis around myofibers (for review see [13]). therapy for at least 12 weeks or not starting antiretro- Injection of TGFβ for ten days has been shown to in- viral therapy in the next four months, CD4 cell count duce cachexia and generalized tissue fibrosis in nude greater than 50/mm and HIV copy number less than mice [14]. Furthermore, Carlson and colleagues have 10,000 copies/ml (less than 400 in six of nine subjects), shown an upregulation of TGFβ and associated path- and were able and willing to provide informed consent ways in muscle in the aging rodent [15]. Based on these and comply with the protocol. Expression profiles were observations of muscle aging in model systems and a from biopsies of the vastus lateralis at baseline that were similar frailty phenotype in rodent models for infection, not previously published in a testosterone supplementa- we were interested in determining whether premature tion study [19]. Arrays were run using Affymetrix HG- muscle aging occurs during chronic HIV infection, par- U133A microarray chips. ticularly in the context of successful HAART and whether this phenotype is recapitulated in rodent mod- GEO datasets els for HIV. The online datasets GEO362 [20] and GEO 1428 [16] To evaluate potential muscle aging within the context are expression profiles of muscle tissue from normal of HIV infection, we chose to first evaluate gene expres- human muscle biopsies of the vastus lateralis. GEO362 sion of muscle specimens (that is, vastus lateralis) in un- arrayed young men (age 21 to 27) and older men (age 67 infected individuals ranging in age from 19 to 85 using to 75). GSE 1428 looked at young men (age 19 to 25) previously published datasets for healthy aging and mild and older men (age 70 to 80) who were identified as sarcopenia to identify an aging gene signature [16,17]. having mild sarcopenia. The de-identified data were To assess the possibility of accelerated muscle aging in downloaded from the Gene Expression Omnibus (GEO) HIV, we then evaluated muscle gene expression profiles web repository and were used in our analysis. Arrays for in HIV-infected individuals ranging in age from 30 to both these studies were run using Affymetrix HG- 55 years old and in a rodent model for HIV infection U133A microarray chips. and used this to identify associated pathways that might explain the phenotype seen. Senescence, a hallmark of Supplemental healthy HIV negative dataset aging, has been defined as an irreversible state of cell These subjects were enrolled at McMaster University cycle arrest [18]. In this study, genes and pathways and Hamilton Health Sciences and were all healthy non- related to muscle senescence and fibrosis were found to exercising males. None were athletes nor were they on be upregulated and were evaluated further. Here, we de- medications known to adversely affect muscle (that is, scribe a role for HIV driven fibrosis in skeletal muscle. statins). The age intervals for these subjects were 20 to This is an understudied potential mediator of functional 25 years old, 40 to 45 years old, and 70 to 75 years old. decline in muscle that could open novel avenues for Muscle biopsies of the vastus lateralis were taken at the therapeutic intervention. same time of day and fasted, as previously described [21] and profiled on Roche NimbleGen Human Gene Expres- Methods sion 12x135K Arrays. Ethics statement These studies were approved by the Boston University Data processing Medical Center Institutional Review Board, and the Initial processing McMaster University and Hamilton Health Sciences Re- All expression data were globally scaled to a per sample search Ethics Board. These studies were conducted in mean of 500. Probes were assigned to be present or ab- accordance with the principles of the Declaration of Hel- sent based on the per sample median. Probes with more sinki and all subjects gave written informed consent for than 80% absent calls were removed from GSE1428 and participation. GSE362. Only probes in GSE362 and GSE1428 with at least one sample intensity above the median for each re- Study population spective set were considered for analysis using Bayesian HIV-infected inclusion criteria Analysis of Differentially Expressed Genes (BADGE) This study included HIV-positive men, 30 to 55 years [22]. As a result, a total of 9,872 probes from GSE362 old (average age = 43 years), who had documented and 11,016 probes from GSE1428 were included in our weight loss within the previous six months of between analysis. Remaining probes were analyzed for differential 5% and 15% of body weight or an actual body mass expression using BADGE [22]. index (BMI) at screening of between 17 and 20 (equiva- lent to 85% to 95% of the lower limit of ideal weight), an Differential expression energy intake in excess of 80% of the recommended diet- The GSE362 and GSE1428 data sets were analyzed in- ary allowance, on stable and potent antiretroviral dependently. Our analysis found 26 upregulated and Kusko et al. Skeletal Muscle 2012, 2:10 Page 3 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 36 downregulated genes (relative to average gene ex- RNA quantitative realtime PCR pression in the arrays being compared) for GSE362 RNA was generated from gastrocnemius muscles. Briefly, and 19 upregulated and 65 downregulated genes for the gastrocnemius muscles were cleaned of all fat and ex- GSE1428 using a 0.5% posterior probability of false cess connective tissue, cut into smaller pieces and homo- positive detection. Ten genes overlapped between the genized in TRIzol reagent (Invitrogen, Carlsbad, CA, two analyses. USA}) then processed for RNA. Phase separation was done using chloroform and centrifugation. RNA was pre- Specificity assessment cipitated from the aqueous phase using isopropynol and To assess whether the ten gene muscle aging signature washed using ethanol. The RNA was then cleaned using reflected a generic muscle disease phenotype, we evalu- the RNeasy Mini Kit (Qiagen Sciences, Valencia, CA, ated our ten gene signature in several other muscle USA) and quantified using a Nanodrop spectrophotom- aging diseases such as myositis, amyotrophic lateral eter. Primers for rat GAPDH, CDKN1A, FEZ2 and H3F3B sclerosis (ALS), and 48 hour immobilization using PEPR were purchased from Superarray (SABiosciences, Fred- (Public Expression Profile Resource; http://pepr.cnmcre- erick, MD, USA) and analyzed using quantitative realtime search.org). Our profile was only significant in 48 hour PCR detection with SYBR green. For genes associated immobilization, and not any of the other diseases stud- with fibrosis, COL1A1 (F-GGAATGAAGGGACACA- ied (data not shown). To test whether the ten gene GAGGT, R- GAGCTCCATTTTCACCAGGA), COL1A2 muscle aging profile in HIV samples clustered selectively (F-GAGCTCCATTTTCACCAGGA, R- CAGCAGCTC- with the expression profiles of older subjects’ muscles, CACTCTCACCT), CTGF (F-ATGCTGTGAGGAGTGG- we used a Bayesian model based cluster analysis of the GTGT, R- GGCCAAATGTGTCTTCCAGT) and GAPDH ten genes. The cluster method was implemented in the (F- ATGACTCTACCCACGGCAAG, R- GGAAGATGGT- software CAGED (Cluster Analysis of Gene Expression GATGGGTTTC), primers were used - a kind gift from Dr. Dynamics) which was also used to generate the unsuper- Maria Trojanowska (Boston University, MA). They were vised clustered heatmaps [23]. analyzed using quantitative realtime PCR detection using SYBR green. TaqMan probes for rat p16INK4a, MT1A, EASE annotation MLF1, TPPP3 (also known as CGI-38), MYH8, PDHA1 Annotation of our gene lists was performed using the and GAPDH were purchased from Applied Biosystems National Center for Biotechnology Information (NCBI) (Life Technologies, Carlsbad, CA, USA). Both sets were software EASE [24]. EASE is an integrated knowledge analyzed using an ABI Prism 7000 Sequence Detection Sys- database that integrates information from OMIM, tem (Applied Biosystems, Life Technologies, CA, USA). Refseq, Unigene, and Gene Ontology to search for over- Samples were confirmed to have no DNA contamination represented gene categories in user submitted gene lists by using a realtime PCR reaction without reverse transcript- [25]. ase. Amplification results were normalized to GAPDH using the ΔΔCt method. A Students t-test of the data was Ex vivo validation and pathway analysis used to test differential expression with a P-value< 0.05 TGFβ protein measurement considered as significant. Muscle homogenates were obtained from the gastrocne- mius muscle of the wild type and HIV Tg rodent. Briefly, Collagen staining and fibrotic index calculation samples were cleaned of all fat and connective tissue and Gastrocnemius muscle was flash frozen in liquid nitro- cut into smaller pieces. Specimens were homogenized in gen and later embedded in paraffin. Sections of tissue RIPA buffer (25 mM Tris pH7.6, 150 mM NaCl, 1% NP- were processed at 5 μm thickness. Tissue was stained 40, 1% sodium deoxycholate, 0.1% SDS) with complete using Picrosirius Red (Sigma-Aldrich, St. Louis, MO, mini protease inhibitor tablets added (Roche, IN, USA). USA}) and Fast Green (Fisher Scientific, Hampton, NH, Homogenates were centrifuged at 21,000 g for 15 min- USA) to look for collagen deposition in the extracellular utes to pellet insoluble matter. Protein concentrations space. The images for analysis of fibrotic index were were determined using the BCA reagent (Pierce, Rock- taken using Olympus BX41 microscope (Olympus, Cen- ford IL, USA). TGFβ was measured by ELISA using a ter Valley, PA, USA) using DP Controller (Version Quantikine kit (R&D Systems, Minneapolis, MN, USA) 3.2.1.276) and DP Manager (Version 3,1,1,208). Bright according to the manufacturer’s recommendations and field images were exposed for 1/1500 seconds. The fi- values were normalized to total protein concentration. brotic index was calculated as percent area of collagen Three HIV Tg and three wild type rodents were used for of the total tissue area using NIH Image J Software these measurements. A Students t-test of the data was (http://rsbweb.nih.gov/ij/). The calculation for fibrotic used to test differential expression with a P-value< 0.05 index is based on the algorithm described in [26]. Six considered as significant. HIV Tg and three wild type rodent muscles were Kusko et al. Skeletal Muscle 2012, 2:10 Page 4 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 quantified after staining. A Students t-test of the data GSE1428. Ten genes were common to both expression was used to test differential expression with a P-value< sets and are shown for the two datasets as heatmaps in 0.05 considered as significant. Figures 1A and B. Notably the mild sarcopenia in the GEO 1428 series displayed a larger number of differen- Myosin heavy chain isoform quantification tially expressed genes compared to healthy subjects (data Gastrocnemius muscles were embedded in OCT and im- not shown). This ten gene signature was evaluated in an- mediately frozen in isopentane cooled in liquid nitrogen. other supplemental healthy male dataset run on a Nim- Serial sections from the mid-belly of the gastrocnemius bleGen microarray platform, comparing subjects 20 to were cut at 8 μm and processed for immunohistochem- 25 years old with subjects 70 to 75 years old. Most genes ical detection of slow or fast MHC protein expression (the top six of ten in the heatmap) in the signature were using the ABC method (Vector Labs, Burlingame, CA, recapitulated in the third set (Figure 1C). The compos- USA). Sections were visualized with a Leica microscope ition of the ten genes shown in all three datasets is as and measured using ImageJ software (NIH, Bethesda, follows: CDKN1A (p21/Cip1), FEZ2, H3F3B DAAM2, MD, USA). Approximately 200 fibers per muscle were MFL1, PDHA1 MT1F, MYH8, CRIM1, and CGI-38. analyzed. Data are expressed as the percentage of slow The GSE362 and GSE1428 genome-wide expression (type I) and fast (type II) MHC types relative to the total data have been previously published and are available pool of MHC isoforms. Four HIV Tg and four wild type online [16,20]. The HIV baseline muscle profiles and the rodent muscles were quantified. A Students t-test was supplemental healthy muscle expression profiles have used to test differential expression with a P-value of less not been previously published. Cells/CMM = cells per than 0.05 considered as significant. cubic milliliter. Results and discussion Muscle gene expression of middle-aged HIV-infected men Identification of common genes that change expression resembles older uninfected samples with muscle aging Using the muscle aging profile common to both data- To profile muscle in healthy aging, we identified a sets, we evaluated muscle expression profiles from HIV- shared gene expression pattern in healthy and mildly infected individuals using the same tissue source (vastus sarcopenic individuals using previously published ex- lateralis) and microarray platform (Affymetrix HG- pression data obtained from the same tissue and micro- U133A). The samples are described in [19]. Muscle pro- array platform (that is, Affymetrix HG-U133A). We then files from these subjects clustered with the older samples evaluated this expression pattern with microarray data in both GSE362 (shown in Figure 2A) and GSE1428 from our HIV muscle specimens using the same micro- (data not shown) using CAGED [23] cluster analysis. array platform (that is, Affymetrix HG-U133A) as well Notably, the clustering was not influenced by viral load, as with a distinct microarray dataset of young, middle extent of weight loss or CD4 levels (data not shown). aged and older men using a NimbleGen platform Collectively, these data suggest that muscle derived from (Table 1). A Bayesian modeling approach was applied, HIV + men, on average in their 40s, more closely resem- implemented in BADGE [22,23], using muscle expres- bles muscle profiles from individuals in their 70s consist- sion datasets obtained from the vastus lateralis in GEO ent with our premise of accelerated muscle aging. series 362 (a dataset including seven young healthy men ages 21 to 27 and eight older men ages 67 to 75 [20]) Muscle gene expression of age-matched healthy HIV and GEO series 1428 (a dataset including ten young negative men do not resemble older samples healthy men ages 19 to 25 and twelve older men with We evaluated muscle profiles from young, middle aged mild sarcopenia ages 70 to 80 [16]). The initial analysis and older uninfected men, all derived using the same tis- identified 62 age-associated probes that were differen- sue site and microarray platform (Table 1), to determine tially expressed in the dataset GSE362 and 85 age-asso- whether age, rather than HIV, might account for the ciated probes differentially expressed in the dataset observed clustering in Figure 2A. However, CAGED Table 1 Description of datasets used in this study Dataset Age(yrs) Sample Size(all male) Tissue source Array Condition GSE362 [20] 21-2767-75 N = 7N = 8 Vastus lateralis HG-U133A Healthy GSE1428 [16] 19-2570-80 N = 10N = 12 Vastus lateralis HG-U133A Older with sarcopenia HIV + [19] 36-51 N = 9 Vastus lateralis HG-U133A Median VL = 400 copies/ML (400–56,844)Median CD4 = 362 cells/CMM (61–765) Supplemental Healthy 20-2540–4570-75 N = 10N = 10N = 10 Vastus lateralis NimbleGen Healthy Kusko et al. Skeletal Muscle 2012, 2:10 Page 5 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 Figure 1 Muscle age profiling. Heatmaps displaying the relative expression of the ten gene muscle aging profile are shown comparing young males to older males in a supervised manner using Affymetrix U133A microarray gene set data for GSE362 (A) and GSE1428 (B) and in a healthy aging dataset using a NimbleGen microarray data (C). The gene expression of the profile is displayed in a supervised manner where intensity reflects relative expression (green = higher, red = lower). Heatmaps were generated using the Heatplus package in the statistical software R 2.14.0. cluster analysis of all three groups showed the middle consistent with the possibility that HIV infection pro- aged men clustering randomly with the young group motes premature expression of this gene signature in and the old group, see Figure 2B. Notably, when middle muscle. aged healthy men were removed from the analysis, we again observed clear partitioning of the young from the Expression of the aging signature in a transgenic rodent old (Figure 1C), confirming that young and old in this model for chronic HIV infection dataset also recapitulate the ten gene muscle signature, One of the genes in our signature, the cyclin dependent as observed in Figure 1 A and B. These data are kinase inhibitor (CDKi) p21/Cip1, has been associated Figure 2 A. Muscle age profiling with HIV. Heatmap displaying the ten gene profile shown in Figure 1, with the HIV group added using GSE1428 (Figure 2A) and GSE362 (similar results, data not shown). The CAGED software was used to cluster samples (shown as rows of the heat map) based on the ten gene muscle aging profile (columns of the heat map). The analysis shows that the young men form a cluster, while HIV samples (designated by arrows and in bold, 36 to 51 years old) cluster with old subjects using the ten gene muscle aging profile. The CAGED cluster analysis uses a model-based procedure that assigns samples to the same cluster if their merging increases the posterior probability of the model. Numbers attached to the branches of the dendrogram represent the posterior odds of the model that merges the branches versus the model that does not. B. CAGED analysis of the expression of the ten gene muscle aging profile is an HIV negative dataset with young (20 to 25 years old), intermediate (40 to 45 years old designated by arrows), and old (70 to 75 years old) subjects (this entire dataset used the microarray NimbleGen platform). The gene expression of the profile is displayed in a supervised manner where intensity reflects relative expression (green = higher than average, red = lower than average). CAGED, Cluster Analysis of Gene Expression Dynamics. Kusko et al. Skeletal Muscle 2012, 2:10 Page 6 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 with muscle aging in rodent models for aging [6,15]. We H3F3b(H3), CGI-38, MT1, MYH8) using quantitative were, therefore, interested in whether a transgenic ro- real time PCR analysis in concordance with expression dent model for HIV infection (HIV Tg) would display in the microarray profiles observed in our human premature elevation of p21/Cip1 expression as well as muscle specimens. CRIM1 was found to show a trend the other genes in our signature. The HIV Tg rodent increase with the HIV Tg compared to the wild type but expresses a transgene consisting of a HIV provirus with did not show statistical significance (P = 0.08). Notably, a functional deletion of pol and gag regulated by the viral three genes, PDHA, DAAM2 and MLF1 were not sig- long terminal repeat. These rodents share many similar- nificantly different between the wild type and HIV ities to human HIV infection, compared to other rodent transgenic rat (data not shown), possibly indicating spe- models. Specifically, these rodents express the virus in cies-specific regulation. lymph nodes, spleen, kidney, thymus and immune cells including macrophages, T cells and B cells, are antigenic p16INK4a is upregulated in a transgenic rodent model for to gp120 and shed gp120 into the peripheral blood chronic HIV infection stream and have immune suppression compared to wild Recent data have linked elevated p21/Cip1 to other cell type animals. Furthermore, by five to nine months of cycle arrest genes such as p16INK4a, with healthy aging age, these animals develop weight loss, neurological ab- in muscle stem cells [15] and other tissue specific stem normalities, respiratory difficulties and other symptoms cells [29,30]. To assess whether cell cycle arrest was a of AIDS [27,28]. We chose to use the HIV Tg rodent general feature in the muscle in our rodent model, we model for chronic infection because this model displays measured p16INK4a RNA levels in both the HIV Tg and musculoskeletal decline that includes loss in lean wild type rodent. Figure 3B shows that the levels of muscle and resorption of bone, both phenotypes p16INK4a were significantly elevated compared with observed in human HIV infection [4,5]. As shown in wild type age-matched controls. This further suggests Figure 3A, we observed significant up-regulated expres- that cell cycle arrest genes are prematurely expressed in sion of p21/Cip1, as well as most of the other aging sig- muscle during HIV infection, specifically that both the nature genes or gene homologues (for example, Fez2, Cip and Ink4 families are induced. Figure 3 Expression of p21/Cip1, p16INK4a and TGFβ1 in the HIV transgenic rodent. A. Realtime RNA PCR validation was observed for p21/Cip1, Fez2, H3, MFL1, MT1F and MYH8 in muscle from HIV transgenic gastrocnemius (n = 4) muscle or wild type gastrocnemius muscle (n = 3) and shows an increase in genes in HIV Tg compared to age matched wild type controls. All bar plots show mean fold change with error bars indicating the standard deviation. The difference between wild type and HIV Tg is significant to P ≤ 0.05. B. RT-PCR shows an increase in the cell cycle arrest gene, p16INK4a, in HIV Tg rat (n =4) compared to wild type (n = 3). The difference is significant to P< 0.05. The bar plot indicates mean fold change with the error bars indicative of the standard deviation. C. TGFβ1 protein levels based on ELISA of muscle homogenates from HIV transgenic gastrocnemius muscle (n = 3) or wild type gastrocnemius muscle (n = 3) show increased levels in the HIV Tg rodent at a significance of P< 0.05. Bar plots indicate mean protein levels with error bars indicative of the standard deviation. TGFβ, transforming growth factor β. Kusko et al. Skeletal Muscle 2012, 2:10 Page 7 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 TGFβ is upregulated in a transgenic rodent model for with TGFβ and collagen deposition in the hindlimb chronic HIV infection muscle (gastrocnemius) of the wild type and HIV Tg ro- The TGFβ family members, including TGFβ itself, as dent. We first examined the collagen transcriptional in- well as the growth antagonist myostatin, have been ducer, connective tissue growth factor (CTGF), a factor shown to upregulate p21/Cip1 and p16INK4a in aging that mediates TGFβ induced collagen gene expression muscle in both the stem cell population and the muscle [42,43]. As shown in Figure 4A, there was an increase in fibers in mice [6,15]. Expression of both p21/Cip1 and expression in CTGF in the HIV Tg rodents. We then p16INK4a has also been shown to be upregulated in a measured the expression of collagen genes, COL1A1 number of human aging studies in leukocytes, fibro- and COL1A2. As shown in Figure 4B, these genes were blasts, neural tissue and pancreatic islet cells [18,29-39]. also upregulated in the HIV Tg rodent. This upregulation of p16INK4a is thought to be asso- ciated with aging and senescence. To evaluate whether The HIV tg rodent muscle exhibits fibrosis and fiber type TGFβ protein might also be upregulated in our HIV switching in muscle muscle in addition to the senescence-associated genes, Because we saw evidence of the upregulation of collagen we measured protein levels in muscle homogenates from genes in HIV, to evaluate whether collagen deposition was HIV Tg and age-matched wild type rodents at the onset detectable in association with upregulated TGFβ and col- of bone and muscle loss (approximately seven months of lagen genes, we analyzed gastrocnemius tissue sections age). As shown in Figure 3C, we observed a dramatic in- and quantified collagen content. As shown in Figure 5, crease in TGFβ protein levels in HIV Tg animals com- there was a significant increase in muscle collagen depos- pared to wild type controls, consistent with elevated ition in the HIV Tg rodent compared to the wild type con- TGFβ in muscle aging studies in rodents [15]. trols. This is consistent with aging muscle, which also shows an increase in collagen deposition [6]. Since aging The collagen gene inducer, CTGF, as well as collagen is also associated with a shift in fiber types, specifically an gene expression are induced in a transgenic rodent increase in slow twitch and a decrease in fast twitch [44- model for chronic HIV infection 46], we analyzed the types of fibers seen in the gastrocne- Elevated TGFβ levels have been previously linked to de- mius in the wild type compared to the HIV Tg. We found position of collagen and tissue fibrosis of lymph nodes that as with aging, there is a significant increase in slow in both human HIV infection and in simian immuno- twitch fibers and decrease in the fast twitch fibers in the deficiency virus (SIV) models of infection [40,41]. Fur- HIV Tg rat compared to the wild type. thermore, in aging, muscle from rodents has been shown to convert to a fibrogenic phenotype [6]. How- Conclusions ever, fibrotic genes and collagen deposition in skeletal With the success of anti-retroviral therapy in suppressing muscle have not yet been described in the context of viral burden there has been a profound influence on the HIV infection. We, therefore, measured genes associated course of HIV infection from a lethal to a managed Figure 4 Expression of collagen genes in the HIV transgenic rodent model. A. The collagen transcriptional regulator, CTGF, is increased in HIV Tg rat muscle (n = 3) compared to wild type (n = 3) using realtime RNA PCR at a significance of P <0.05. The bar plots indicate mean fold change with error bars indicative of standard deviation. B. The collagen genes, COL1A1 and COL1A2 are increase in HIV Tg rat muscle (n =3) compared to wild type (n = 3) using realtime RNA PCR. The bar plots indicate mean fold change with the error bars indicative of standard deviation. The difference between wild type and HIV Tg rodents are significant to P< 0.05. CTGF, connective tissue growth factor. Kusko et al. Skeletal Muscle 2012, 2:10 Page 8 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 Figure 5 Collagen deposition and fiber type switching in the HIV transgenic rat. Histological muscle sections of the gastrocnemius muscle of HIV Tg (n = 6) and control wild type rats (n = 3) were stained using Picrosirius Red for collagen. Representative images are shown in A and B. The scale bar equals 200 μm. A. Tissue section of the gastrocnemius muscle in wild type rat shows collagen deposition in red in intracellular space. B. Tissue section of gastrocnemius muscle from HIV Tg rat shows increased collagen deposition in red in the intracellular spaces. C. Quantification of the area of picrosirius red staining using Image J shows that there is an increase in fibrotic index in the HIV Tg rat compared to the wild type at a significance of P< 0.05. The bar plot indicates mean percent area of collagen with the error bars indicative of the standard deviation. D. Quantification of fiber type was done using Image J on control wild type (n = 4) and HIV Tg (n = 4). The bar plot indicates the percentage of fibers of each type with error bars indicative of standard deviation. chronic disease. Nevertheless, HIV-infected individuals re- detailed study of fibrosis in skeletal muscle in chronic main at higher than expected risk for a number of compli- HIV infection has not been done to date. In this study, cations typically associated with aging [47]. Aging is often we use an aging signature in muscle to identify and defined on the basis of functional capacity, or frailty, ra- evaluate aging- and fibrosis-related pathways in the ro- ther than the collection of age-associated diseases [48,49]. dent model of HIV. We show gene expression changes Frailty, as defined in the elderly by Fried and colleagues, and phenotypic changes in muscle in an HIV Tg rodent [50] has been previously evaluated in men with HIV [1,2] model similar to that seen in aging. We see an upregula- wherein a significant frailty-related phenotype (FRP) has tion of genes associated with aging muscle prematurely been observed. Margolick and colleagues have also expressed in HIV in both the human and the rat. We, reported the premature occurrence of age-adjusted frailty furthermore, show changes in both fiber type compos- with HIV infection [1-3]. ition and in fibrotic collagen deposition in the HIV ro- With the advancing age of the HIV-infected popula- dent. Previous work by our laboratory in humans has tion, the role of aging-associated inflammation in com- also shown that an increase in CTGF expression in vas- promising normal tissue remodeling is becoming tus lateralis from HIV-positive men was downregulated increasingly more relevant. In 2006, approximately one with anabolic supplementation in microarray analysis third of people with AIDS in the US were over age 50 (see supplemental data in [19]), consistent with our find- [49]. Chronic inflammation that occurs with increasing ings of a dysregulation of CTGF in HIV. Collectively age has been shown to adversely affect muscle homeo- these data suggest that the genotypic and phenotypic stasis [51-53], with aging muscle increasingly likely to changes that we see might be related to HIV infection. exhibit changes in extracellular matrix resembling a This data also elucidate pathways HIV might use that re- fibrogenic phenotype [6-9]. Recently, SIV infection has sult in increased risk for a frailty-related phenotype. been linked with fibroblast deposition of collagen and Three independent datasets were used in this study to increased fibrosis in lymph nodes associated with an in- identify an aging gene signature that differs between crease in local TGFβ production [40,54,55]. However, a older individuals and younger individuals. This signature Kusko et al. Skeletal Muscle 2012, 2:10 Page 9 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 is prematurely expressed in HIV-positive subjects. The factors that includes multiple inflammatory cytokines. aging profile genes include: CDKN1A/p21, FEZ2, Previous studies on senescence show that the cells respon- H3F3B, DAAM2, MLF1, PDHA1, MT1F, MYH8 and sible for the release of SASP factors show an upregulation CRIM1. FEZ2 is a factor that interacts with a number of in key senescence-associated genes including p21 and transcription controlling proteins to influence chromatin p16INK4a [35-37,39,65]. In muscle, these genes are remodeling and apoptosis [56]. H3F3B is a replacement thought to contribute to a decreased regenerative capacity histone that constitutes the major form of histone H3 in with aging that has been seen in rodents as they have been senescent cells [57]. DAAM2 regulates cell fate and detected in both fibers and satellite cells [15,53]. We show actin-cytoskeleton re-organization through WNT signal- the premature upregulation of p21/Cip1 in both human ing [58]. Previous studies have shown that changes in and rodent muscle tissue with HIV and the premature actin cytoskeleton turnover can trigger an increase in upregulation of p16INK4a in rodent muscle tissue sug- levels of reactive oxygen species (ROS) in the cytosol gesting that a senescence axis might be activated early and, therefore, decrease cellular viability [59]. MLF1 with HIV infection. What cell types in the muscle (that is, suppresses COP1 through COP9 thereby stabilizing p53 satellite cells, fibroblast or mature muscle cells) contribute [60]. PDHA1 is a mitochondrial metabolic enzyme that to the changes in gene expression is beyond the scope of provides the link between glycolysis and the TCA cycle this study and will require further analysis. Furthermore, [61]. MT1F and MT1A have a metalloregulatory function whether or not the upregulation of these genes contri- in repair, growth, and differentiation [62] with MT1A being butes to a dysregulation of the satellite cells in HIV a similar family methallothionein to MT1F in the rat. muscle leading to an aging phenotype is an intriguing area MYH8 is a member of the myosin protein family and is of future study. involved in muscle contraction by interacting with actin As previously mentioned, many of the factors that in- filaments [63]. CRIM1 is a membrane bound protein that is crease in serum with aging include inflammatory cyto- known to interact with the TGFβ superfamily [64]. kines including TGFβ, TNFα and IL-6 [34-36,38,39,67- CDKN1A (p21/Cip1) is a well-recognized cell cyclin 69]. Some of these circulating factors have been shown dependent kinase inhibitor that has been associated with to dampen proliferation of satellite cells, lead to remod- muscle aging and cellular senescence that has not been pre- eling of the stem cell niche and lead to dysregulation of viously linked with muscle aging in HIV infection. Whether stem cell function specifically in muscle [15,53,70]. HIV these genes reflect a larger network of regulators in aging is also associated with an increase in systemic inflamma- that are co-opted in HIV is beyond the scope of this study tory burden, especially in serum factors like IL-6 and will require further network and pathway analysis of [1,2,69,71,72]. Increases in systemic inflammatory cyto- these genes and their potential interactions during healthy kines are also known to lead to a loss of muscle mass and dysregulated muscle aging.Itisofnotethatwhile these [73-78]. Whether the gene signature that we see in HIV genes displayed a robust signature in our two initial data- and aging is due to a common increase in inflammatory sets, GSE363 and GSE 1428, the signature did not fully re- burden or whether HIV infection itself drives both the capitulate in a third cohort (shown in Figure 1C). signature and inflammatory process is an intriguing Furthermore, the genes that erode in the heatmap for the question that remains beyond the scope of this study. third cohort include PDHA, MLF1 and DAAM2 and are In addition to inflammation, previous studies dissect- the same genes that did not show significant changes in the ing acute conditions leading to muscle atrophy have HIV Tg rat model compared to the wild type (data not revealed a common role for the ubiquitin proteasome shown). This data suggest that these three genes may not pathway mediated by the E3 ligases MuRF1 and MAFBx remain as robust as the others and will require further ana- to promote muscle protein degradation, notably the lysis of additional independent datasets. muscle structural protein myosin heavy chain [79-82]. Upstream activators for these atrogenes include FOXO In this study, we see selected senescence-ssociated path- ways in addition to the fibrosis pathways prematurely and NFκB pathways [83] and have been identified in expressed in HIV infection. Based on these results, we multiple rodent models of induced wasting, notably can- cer-associated cachexia [84] and also HIV in a rodent propose that HIV infection may represent an uncoupled and dysregulated aging phenotype that increases the risk model for infection [5]. While we do not see an upregu- for muscle fibrosis. Senescence-associated pathways have lation of atrogenes in our genetic signature in aging, the HIV transgenic rodent model has previously been shown been previously implicated in muscle aging, but have not been directly linked to HIV infection. Recent studies on to have an increase in MuRF1 compared to the wild type senescence and aging indicate that cellular senescence is [4]. Therefore, the atrogene pathway may represent an- accompanied by a striking increase in the secretion of 40 other pathway in addition to the fibrotic and senescence to 80 factors [34,38,65,66], termed the ‘senescence-asso- pathways we study that shows dysregulation from the ciated secretory phenotype’ or SASP [35], an ensemble of normal aging pattern seen specifically in HIV. Kusko et al. Skeletal Muscle 2012, 2:10 Page 10 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 The cause of HIV-related frailty and muscle loss is an 2. Desquilbet L, Margolick JB, Fried LP, Phair JP, Jamieson BD, Holloway M, Jacobson LP: Relationship between a frailty-related phenotype and area that has been understudied with the etiology poorly progressive deterioration of the immune system in HIV-infected men. J understood. Further evaluation of both the senescent and Acquir Immune Defic Syndr 2009, 50:299–306. fibrotic pathways and genes in association with muscle 3. Margolick J, Detels R: Phair JP, Rinaldo C, Jacobson LP: Earlier Occurrence of the Frailty Phenotype in HIV + Men than in HIV- Men: The MACS. In: CROI. function in healthy aging and in HIV infection should bet- Boston; 2011. ter assist in identifying molecular pathways associated with 4. Otis JS, Ashikhmin YI, Brown LA, Guidot DM: Effect of HIV-1-related protein frailty in both conditions. Increased frailty is likely to cre- expression on cardiac and skeletal muscles from transgenic rats. AIDS Res Ther 2008, 5:8. ate a substantial burden on future health care, underscor- 5. Vikulina T, Fan X, Yamaguchi M, Roser-Page S, Zayzafoon M, Guidot DM, ing a need for diagnostic biomarkers and early detection in Ofotokun I, Weitzmann MN: Alterations in the immuno-skeletal interface this population. The role of chronic inflammation driven drive bone destruction in HIV-1 transgenic rats. Proc Natl Acad Sci U S A 2010, 107:13848–13853. fibrosis in HIV is an understudied potential mediator of 6. Brack AS, Conboy MJ, Roy S, Lee M, Kuo CJ, Keller C, Rando TA: Increased functional decline. Further characterization of this pheno- Wnt signaling during aging alters muscle stem cell fate and increases type could open avenues for therapeutic intervention to fibrosis. Science 2007, 317:807–810. 7. Grounds MD: Age-associated changes in the response of skeletal muscle prevent fibrosis associated declines in physical function. cells to exercise and regeneration. Ann N Y Acad Sci 1998, 854:78–91. 8. Schiaffino S, Partridge T: Skeletal Muscle Repair and Regeneration. Dordrecht: Abbreviations Springer; 2008. AIDS: Acquired Immunodeficiency Syndrome; ALS: amyotrophic lateral 9. Goldspink G, Fernandes K, Williams PE, Wells DJ: Age-related changes in sclerosis; BADGE: Bayesian analysis of differential gene expression; collagen gene expression in the muscles of mdx dystrophic and normal CAGED: cluster analysis of gene expression dynamics; CDKi: cyclin dependent mice. Neuromuscul Disord 1994, 4:183–191. kinase inhibitor; CMM: cubic millimeter; CTGF: connective tissue growth 10. Sadeh M: Effects of aging on skeletal muscle regeneration. J Neurol Sci factor; ELISA: enzyme-linked immunoassay; FRP: frailty related phenotype; 1988, 87:67–74. GEO: gene expression omnibus; HAART: highly active antiretroviral therapy; 11. Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA: Transforming growth HIV Tg: HIV transgenic; HIV: human immunodeficiency virus; IL-6: interleukin factor-beta regulation of immune responses. Annu Rev Immunol 2006, 6; MAFBx: muscle atrophy F-box; MHC: myosin heavy chain; MuRF1: muscle 24:99–146. RING finger protein 1; NCBI: National Center for Biotechnology Information; 12. Branton MH, Kopp JB: TGF-beta and fibrosis. Microbes Infect 1999, 1:1349– OCT: optimal cutting temperature medium; OMIM: Online Mendelian Inheritance in Man; PCR: polymerase chain reaction; RNA: ribonucleic acid; 13. Wynn TA: Cellular and molecular mechanisms of fibrosis. J Pathol 2008, ROS: reactive oxygen species; SASP: senescence associated secretory 214:199–210. phenotype; SIV: simian immunodeficiency virus; TCA: tricarboxylic acid cycle; 14. Zugmaier G, Paik S, Wilding G, Knabbe C, Bano M, Lupu R, Deschauer B, TGFβ1: transforming growth factor β 1; TNFα: tumor necrosis factor α; Simpson S, Dickson RB, Lippman M: Transforming growth factor beta 1 US: United States; WT: wild type. induces cachexia and systemic fibrosis without an antitumor effect in nude mice. Cancer Res 1991, 51:3590–3594. Competing interests 15. Carlson ME, Hsu M, Conboy IM: Imbalance between pSmad3 and Notch The authors declare that they have no competing interests. induces CDK inhibitors in old muscle stem cells. Nature 2008, 454:528–532. Acknowledgments 16. Giresi PG, Stevenson EJ, Theilhaber J, Koncarevic A, Parkington J, Fielding The authors wish to acknowledge the Boston OAIC Pepper Center and the RA, Kandarian SC: Identification of a molecular signature of sarcopenia. Longevity Consortium for their encouragement and support of this study, Physiol Genomics 2005, 21:253–263. and thank M. Trojanowska for the gift of the rodent COL1A1, COL1A2, CTGF 17. Welle S, Brooks A, Thornton CA: Senescence-related changes in gene and GAPDH primers and P. Haines for technical expertise. This work was expression in muscle: similarities and differences between mice and supported by U.S. National Institutes of Health grants R01 AR055115 (M.M.) men. Physiol Genomics 2001, 5:67–73. and the Boston OAIC Pepper Center grant 5P30 AG31679 (S.B.) The following 18. Krishnamurthy J, Torrice C, Ramsey MR, Kovalev GI, Al-Regaiey K, Su L, reagent was obtained through the AIDS Research and Reference Reagent Sharpless NE: Ink4a/Arf expression is a biomarker of aging. J Clin Invest Program, Division of AIDS, NIAID, NIH: U1/HIV-1 from Dr. Thomas Folks. 2004, 114:1299–1307. 19. Montano M, Flanagan JN, Jiang L, Sebastiani P, Rarick M, LeBrasseur NK, Author details Morris CA, Jasuja R, Bhasin S: Transcriptional profiling of testosterone- Boston University School of Medicine, 650 Albany St. EBRC 646, Boston, 2 3 regulated genes in the skeletal muscle of human immunodeficiency MA02118USA. Emory University, Atlanta, GA 30322, USA. Boston University virus-infected men experiencing weight loss. J Clin Endocrinol Metab 2007, School of Public Health, Boston, MA 02118, USA. Buck Institute, Novato, CA 92:2793–2802. 94945, USA. McMaster University, Toronto, ON L8S, Canada. 20. Welle S, Brooks AI, Delehanty JM, Needler N, Thornton CA: Gene expression profile of aging in human muscle. Physiol Genomics 2003, 14:149–159. Authors’ contributions 21. Abadi A, Glover EI, Isfort RJ, Raha S, Safdar A, Yasuda N, Kaczor JJ, Melov S, BK and CB contributed equally to this work. BK, CB and MM wrote the Hubbard A, Qu X, Phillips SM, Tarnopolsky M: Limb immobilization induces manuscript. KL, CB and AD performed the experiments. JO, SM, MT and SB a coordinate down-regulation of mitochondrial and other metabolic provided muscle tissue and/or unpublished microarray expression data. BK, pathways in men and women. PLoS One 2009, 4:e6518. PS and MM conceived of the study, coordinated the experimental approach 22. Sebastiani P, Mandl KD, Szolovits P, Kohane IS, Ramoni MF: A Bayesian and drafted the manuscript. All authors read and approved the final dynamic model for influenza surveillance. Stat Med 2006, 25:1803–1816. manuscript. discussion 1817–1825. Received: 8 February 2012 Accepted: 7 June 2012 23. Ramoni MF, Sebastiani P, Kohane IS: Cluster analysis of gene expression Published: 7 June 2012 dynamics. Proc Natl Acad Sci U S A 2002, 99:9121–9126. 24. Hosack DA, Dennis G Jr, Sherman BT, Lane HC, Lempicki RA: Identifying References biological themes within lists of genes with EASE. Genome Biol 2003, 4: 1. Desquilbet L, Jacobson LP, Fried LP, Phair JP, Jamieson BD, Holloway M, R70. Margolick JB: HIV-1 infection is associated with an earlier occurrence of a 25. da Huang W, Sherman BT, Lempicki RA: Systematic and integrative phenotype related to frailty. J Gerontol A Biol Sci Med Sci 2007, analysis of large gene lists using DAVID bioinformatics resources. Nat 62:1279–1286. Protoc 2009, 4:44–57. Kusko et al. Skeletal Muscle 2012, 2:10 Page 11 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 26. Tanano H, Hasegawa T, Kimura T, Sasaki T, Kawahara H, Kubota A, Okada A: Ashworth JR, Campanelli C, Clayton CP, Rada B, Woolard NF, High KP: Aging Proposal of fibrosis index using image analyzer as a quantitative and infectious diseases: workshop on HIV infection and aging: what is histological evaluation of liver fibrosis in biliary atresia. Pediatr Surg Int known and future research directions. Clin Infect Dis 2008, 47:542–553. 2003, 19:52–56. 48. Walston J, Hadley EC, Ferrucci L, Guralnik JM, Newman AB, Studenski SA, 27. Ray PE, Liu XH, Robinson LR, Reid W, Xu L, Owens JW, Jones OD, Denaro F, Ershler WB, Harris T, Fried LP: Research agenda for frailty in older adults: Davis HG, Bryant JL: A novel HIV-1 transgenic rat model of childhood HIV- toward a better understanding of physiology and etiology: summary 1-associated nephropathy. Kidney Int 2003, 63:2242–2253. from the American Geriatrics Society/National Institute on Aging 28. Reid W, Sadowska M, Denaro F, Rao S, Foulke J Jr, Hayes N, Jones O, Research Conference on frailty in older adults. J Am Geriatr Soc 2006, Doodnauth D, Davis H, Sill A, O'Driscoll P, Huso D, Fouts T, Lewis G, Hill M, 54:991–1001. Kamin-Lewis R, Wei C, Ray P, Gallo RC, Reitz M, Bryant J: An HIV-1 49. Ruiz M, Cefalu C: Characteristics of frail patients in a geriatric-HIV transgenic rat that develops HIV-related pathology and immunologic program: the experience of an urban academic center at one year dysfunction. Proc Natl Acad Sci U S A 2001, 98:9271–9276. follow-up. J Int Assoc Physicians AIDS Care 2011, 10:138–143. 29. Itahana K, Zou Y, Itahana Y, Martinez JL, Beausejour C, Jacobs JJ, Van 50. Fried LP, Tangen CM, Walston J, Newman AB, Hirsch C, Gottdiener J, Lohuizen M, Band V, Campisi J, Dimri GP: Control of the replicative life Seeman T, Tracy R, Kop WJ, Burke G, McBurnie MA, Cardiovascular Health span of human fibroblasts by p16 and the polycomb protein Bmi-1. Mol Study Collaborative Research Group: Frailty in older adults: evidence for a Cell Biol 2003, 23:389–401. phenotype. J Gerontol A Biol Sci Med Sci 2001, 56:M146–M156. 30. Liu Q, Song LJ, Xu WQ, Zhao L, Zheng L, Yan ZW, Fu GH: Expression of 51. Barbieri M, Ferrucci L, Ragno E, Corsi A, Bandinelli S, Bonafe M, Olivieri F, cytoplasmic p16 and anion exchanger 1 is associated with the invasion Giovagnetti S, Franceschi C, Guralnik JM, Paolisso G: Chronic inflammation and absence of lymph metastasis in gastric carcinoma. Mol Med Report and the effect of IGF-I on muscle strength and power in older persons. 2009, 2:169–174. Am J Physiol Endocrinol Metab 2003, 284:E481–E487. 31. Campisi J: Cellular senescence as a tumor-suppressor mechanism. Trends 52. Krabbe KS, Pedersen M, Bruunsgaard H: Inflammatory mediators in the Cell Biol 2001, 11:S27–S31. elderly. Exp Gerontol 2004, 39:687–699. 32. Krishnamurthy J, Ramsey MR, Ligon KL, Torrice C, Koh A, Bonner-Weir S, 53. Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL, Rando TA: Sharpless NE: p16INK4a induces an age-dependent decline in islet Rejuvenation of aged progenitor cells by exposure to a young systemic regenerative potential. Nature 2006, 443:453–457. environment. Nature 2005, 433:760–764. 33. Molofsky AV,Slutsky SG,JosephNM, He S, Pardal R, KrishnamurthyJ,Sharpless 54. Estes JD: Role of collagen deposition in lymphatic tissues and immune NE, Morrison SJ: Increasing p16INK4a expression decreases forebrain reconstruction during HIV-1 and SIV infections. Curr HIV/AIDS Rep 2009, progenitors and neurogenesis during ageing. Nature 2006, 443:448–452. 6:29–35. 34. Coppe JP, Desprez PY, Krtolica A, Campisi J: The senescence-associated 55. Estes JD, Haase AT, Schacker TW: The role of collagen deposition in secretory phenotype: the dark side of tumor suppression. Annu Rev depleting CD4+ T cells and limiting reconstitution in HIV-1 and SIV Pathol 2010, 5:99–118. infections through damage to the secondary lymphoid organ niche. 35. Coppe JP, Patil CK, Rodier F, Sun Y, Munoz DP, Goldstein J, Nelson PS, Semin Immunol 2008, 20:181–186. Desprez PY, Campisi J: Senescence-associated secretory phenotypes 56. Assmann EM, Alborghetti MR, Camargo ME, Kobarg J: FEZ1 dimerization reveal cell-nonautonomous functions of oncogenic RAS and the p53 and interaction with transcription regulatory proteins involves its coiled- tumor suppressor. PLoS Biol 2008, 6:2853–2868. coil region. J Biol Chem 2006, 281:9869–9881. 36. Kuilman T, Peeper DS: Senescence-messaging secretome: SMS-ing cellular 57. Hardy RR, Hayakawa K: Development of B cells producing natural stress. Nat Rev Cancer 2009, 9:81–94. autoantibodies to thymocytes and senescent erythrocytes. Springer Semin 37. Beausejour CM, Krtolica A, Galimi F, Narita M, Lowe SW, Yaswen P, Campisi Immunopathol 2005, 26:363–375. J: Reversal of human cellular senescence: roles of the p53 and p16 58. Katoh M: Identification and characterization of human DAAM2 gene in pathways. EMBO J 2003, 22:4212–4222. silico. Int J Oncol 2003, 22:915–920. 38. Freund A, Orjalo AV, Desprez PY, Campisi J: Inflammatory networks during 59. Gourlay CW, Carpp LN, Timpson P, Winder SJ, Ayscough KR: A role for the cellular senescence: causes and consequences. Trends Mol Med 2010, actin cytoskeleton in cell death and aging in yeast. J Cell Biol 2004, 16:238–246. 164:803–809. 39. Rodier F, Campisi J: Four faces of cellular senescence. J Cell Biol 2011, 60. Kato JY, Yoneda-Kato N: Mammalian COP9 signalosome. Genes Cells 2009, 192:547–556. 14:1209–1225. 40. Zeng M, Smith AJ, Wietgrefe SW, Southern PJ, Schacker TW, Reilly CS, Estes 61. Dahl HH, Brown GK, Brown RM, Hansen LL, Kerr DS, Wexler ID, Patel MS, De JD, Burton GF, Silvestri G, Lifson JD, Carlis JV, Haase AT: Cumulative Meirleir L, Lissens W, Chun K, et al: Mutations and polymorphisms in the mechanisms of lymphoid tissue fibrosis and T cell depletion in HIV-1 pyruvate dehydrogenase E1 alpha gene. Hum Mutat 1992, 1:97–102. and SIV infections. J Clin Invest 2011, 121:998–1008. 62. Kagi JH: Overview of metallothionein. Methods Enzymol 1991, 205:613–626. 41. Schacker TW, Reilly C, Beilman GJ, Taylor J, Skarda D, Krason D, Larson M, 63. Bober E, Buchberger-Seidl A, Braun T, Singh S, Goedde HW, Arnold HH: Haase AT: Amount of lymphatic tissue fibrosis in HIV infection predicts Identification of three developmentally controlled isoforms of human magnitude of HAART-associated change in peripheral CD4 cell count. myosin heavy chains. Eur J Biochem 1990, 189:55–65. AIDS 2005, 19:2169–2171. 64. Nystrom J, Hultenby K, Ek S, Sjolund J, Axelson H, Jirstrom K, Saleem MA, 42. Chujo S, Shirasaki F, Kawara S, Inagaki Y, Kinbara T, Inaoki M, Takigawa M, Nilsson K, Johansson ME: CRIM1 is localized to the podocyte filtration slit Takehara K: Connective tissue growth factor causes persistent proalpha2 diaphragm of the adult human kidney. Nephrol Dial Transplant 2009, (I) collagen gene expression induced by transforming growth factor-beta 24:2038–2044. in a mouse fibrosis model. J Cell Physiol 2005, 203:447–456. 65. Coppe JP, Patil CK, Rodier F, Krtolica A, Beausejour CM, Parrinello S, 43. Arnott JA, Nuglozeh E, Rico MC, Arango-Hisijara I, Odgren PR, Safadi FF, Hodgson JG, Chin K, Desprez PY, Campisi J: A human-like senescence- Popoff SN: Connective tissue growth factor (CTGF/CCN2) is a associated secretory phenotype is conserved in mouse cells dependent downstream mediator for TGF-beta1-induced extracellular matrix on physiological oxygen. PLoS One 2010, 12;5:e9188. production in osteoblasts. J Cell Physiol 2007, 210:843–852. 66. Young AR, Narita M: SASP reflects senescence. EMBO Rep 2009, 44. Close GL, Kayani A, Vasilaki A, McArdle A: Skeletal muscle damage with 10:228–230. exercise and aging. Sports Med 2005, 35:413–427. 67. Bruunsgaard H, Andersen-Ranberg K, Jeune B, Pedersen AN, Skinhoj P, 45. Lexell J, Taylor CC, Sjostrom M: What is the cause of the ageing atrophy? Pedersen BK: A high plasma concentration of TNF-alpha is associated Total number, size and proportion of different fiber types studied in with dementia in centenarians. J Gerontol A Biol Sci Med Sci 1999, 54: whole vastus lateralis muscle from 15- to 83-year-old men. J Neurol Sci M357–M364. 1988, 84:275–294. 68. Bruunsgaard H, Pedersen M, Pedersen BK: Aging and proinflammatory 46. Porter MM, Vandervoort AA, Lexell J: Aging of human muscle: structure, cytokines. Curr Opin Hematol 2001, 8:131–136. function and adaptability. Scand J Med Sci Sports 1995, 5:129–142. 69. De Martinis M, Franceschi C, Monti D, Ginaldi L: Inflamm-ageing and 47. Effros RB, Fletcher CV, Gebo K, Halter JB, Hazzard WR, Horne FM, Huebner lifelong antigenic load as major determinants of ageing rate and RE, Janoff EN, Justice AC, Kuritzkes D, Nayfield SG, Plaeger SF, Schmader KE, longevity. FEBS Lett 2005, 579:2035–2039. Kusko et al. Skeletal Muscle 2012, 2:10 Page 12 of 12 http://www.skeletalmusclejournal.com/content/2/1/10 70. Gopinath SD, Rando TA: Stem cell review series: aging of the skeletal muscle stem cell niche. Aging Cell 2008, 7:590–598. 71. Appay V, Rowland-Jones SL: Premature ageing of the immune system: the cause of AIDS? Trends Immunol 2002, 23:580–585. 72. Margolick JB, Chopra RK: Relationship between the immune system and frailty: pathogenesis of immune deficiency in HIV infection and aging. Aging 1992, 4:255–257. 73. Abad LW, Schmitz HR, Parker R, Roubenoff R: Cytokine responses differ by compartment and wasting status in patients with HIV infection and healthy controls. Cytokine 2002, 18:286–293. 74. Baracos V, Rodemann HP, Dinarello CA, Goldberg AL: Stimulation of muscle protein degradation and prostaglandin E2 release by leukocytic pyrogen (interleukin-1). A mechanism for the increased degradation of muscle proteins during fever. N Engl J Med 1983, 308:553–558. 75. Clowes GH Jr, George BC, Jr Villee CA, Saravis CA: Muscle proteolysis induced by a circulating peptide in patients with sepsis or trauma. N Engl J Med 1983, 308:545–552. 76. Thea DM, Porat R, Nagimbi K, Baangi M, St Louis ME, Kaplan G, Dinarello CA, Keusch GT: Plasma cytokines, cytokine antagonists, and disease progression in African women infected with HIV-1. Ann Intern Med 1996, 124:757–762. 77. Zoico E, Roubenoff R: The role of cytokines in regulating protein metabolism and muscle function. Nutr Rev 2002, 60:39–51. 78. Tracey KJ, Wei H, Manogue KR, Fong Y, Hesse DG, Nguyen HT, Kuo GC, Beutler B, Cotran RS, Cerami A, et al: Cachectin/tumor necrosis factor induces cachexia, anemia, and inflammation. J Exp Med 1988, 167:1211– 79. Cao PR, Kim HJ, Lecker SH: Ubiquitin-protein ligases in muscle wasting. Int J Biochem Cell Biol 2005, 37:2088–2097. 80. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR, Mitch WE, Goldberg AL: Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J 2004, 18:39– 81. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH, Goldberg AL: Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117:399–412. 82. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, Glass DJ: Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 2001, 294:1704–1708. 83. Glass DJ: Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol 2005, 37:1974–1984. 84. Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ, Shoelson SE: IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 2004, 119:285–298. doi:10.1186/2044-5040-2-10 Cite this article as: Kusko et al.: Premature expression of a muscle fibrosis axis in chronic HIV infection. Skeletal Muscle 2012 2:10. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Journal

Skeletal MuscleSpringer Journals

Published: Jun 7, 2012

References