Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You and Your Team.

Learn More →

Muscle atrophy induced by overexpression of ALAS2 is related to muscle mitochondrial dysfunction

Muscle atrophy induced by overexpression of ALAS2 is related to muscle mitochondrial dysfunction Background: ALAS2 (delta-aminolevulinate synthase 2) is one of the two isoenzymes catalyzing the synthesis of delta-aminolevulinic acid (ALA), which is the first precursor of heme synthesis. ALAS2-overexpressing transgenic mice (Tg mice) showed syndrome of porphyria, a series of diseases related to the heme anabolism deficiency. Tg mice showed an obvious decrease in muscle size. Muscle atrophy results from a decrease in protein synthesis and an increase in protein degradation, which ultimately leads to a decrease in myofiber size due to loss of contractile proteins, organelles, nuclei, and cytoplasm. Methods: The forelimb muscle grip strength of age-matched ALAS-2 transgenic mice (Tg mice) and wild-type mice (WT mice) were measured with an automated grip strength meter. The activities of serum LDH and CK-MB were measured by Modular DPP. The histology of skeletal muscle (quadriceps femoris and gastrocnemius) was observed by hematoxylin and eosin (HE) staining, immunohistochemistry, and transmission electron microscope. Real-time PCR was used to detect mtDNA content and UCP3 mRNA expression. Evans blue dye staining was used to detect the membrane damage of the muscle fiber. Single skeletal muscle fiber diameter was measured by single-fiber analyses. Muscle adenosine triphosphate (ATP) levels were detected by a luminometric assay with an ATP assay kit. Results: Compared with WT mice, the strength of forelimb muscle and mass of gastrocnemius were decreased in Tg mice. The activities of serum CK-MB and LDH, the number of central nuclei fibers, and Evans blue positive fibers were more than those in WT mice, while the diameter of single fibers was smaller, which were associated with suppressed expression levels of MHC, myoD1, dystrophin, atrogin1, and MuRF1. Re-expression of eMyHC was only showed in the quadriceps of Tg mice, but not in WT mice. Muscle mitochondria in Tg mice showed dysfunction with descented ATP production and mtDNA content, downregulated UCP3 mRNA expression, and swelling of mitochondria. (Continued on next page) * Correspondence: huiyang79@126.com; rongzhang412@163.com Yahui Peng and Jihong Li contributed equally to this work. Department of Biochemistry and Molecular Biology, Harbin Medical University, Harbin 150086, China Institute of Translational Medicine, National and Local Joint Engineering Laboratory of High-through Molecular Diagnostic Technology, the First People’s Hospital of Chenzhou, The First Affiliated Hospital of Xiangnan University, Chenzhou 423000, China Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Peng et al. Skeletal Muscle (2021) 11:9 Page 2 of 11 (Continued from previous page) Conclusion: ALAS2 overexpressing-transgenic mice (Tg mice) showed muscle dystrophy, which was associated with decreased atrogin-1 and MuRF-1, and closely related to mitochondrial dysfunction. Keywords: Muscle atrophy, Mitochondrial dysfunction, Transgenic mice, Delta-aminolevulinate synthase 2 Background of ALAS2 mRNA and protein among patients with The heme biosynthetic pathway begins from delta- erythropoietic protoporphyria (EPP) [14]. Additionally, aminolevulinic acid synthase (ALAS) catalyzing the con- four recurrent gain-of-function mutations in the densation of glycine and succinyl-CoA to delta- catalytic domain of the ALAS2 enzyme resulting in an aminolevulinic acid (ALA)inthe mitochondria [1]. ALAS increased ALAS2 activity have been described as being is coded by two genes: ALAS1 and ALAS2 [2]. ALAS1 is responsible for X-linked protoporphyria (XLPP) [15]. ubiquitously expressed in all cells, and the negative feed- To-Figueras et al. presented convincing evidence that back is regulated by the heme pool [3, 4]; however, ALAS2 ALAS2 acts as a modifier gene in patients with congeni- is specifically expressed only in erythroid cells [2, 5]and is tal erythropoietic porphyria [16]. In this study, we not inhibited by heme [6]. Bechara reported that reactive reported that ALAS2 overexpressing-transgenic mice oxygen species (ROS) is formed by the metal-catalyzed aer- (Tg mice) showed muscle atrophy, which was associated obic oxidation of ALA at abnormally high levels [6, 7]; with decreased atrogin-1 and MuRF-1, and closely mitochondria are the main source of ROS and are also the related to mitochondrial dysfunction. primary target of oxidant-induced damage.ALA,asaputa- tive endogenous source of ROS, induces mitochondrial Materials and methods swelling and transmembrane potential collapse [7], and Animals ALA-treated rats under swimming training experienced fa- ALAS2 transgenic mice were generated by the standard tigue earlier [8]. Defective mitochondrial function has been pronuclear injection technique using C57BL/6 mice. shown to cause muscle weakness [9]. The loss of mitochon- Briefly, mouse ALAS2 cDNA was cloned into the dria has also been shown to result in muscle wasting [10]. pCAGGS plasmid with the chicken β-actin promoter, Notably, studies have reported abnormalities in the mito- which drove the mouse ALAS2 cDNA expression, and chondria during sarcopenia, muscle wasting, associated terminated with the poly (A) signal. All animals were with chronic illness (cachexia), and disuse atrophy [11, 12]. identified by analysis of tail DNA by PCR. Sequences of The mitochondria produce adenosine triphosphate primers were as follows (5′−3′): forward primer was (ATP) as a source of chemical energy, and skeletal GCCTTCTTCTTTTTCCTACAGCTC; reverse primer muscle contains abundant mitochondria. Increased was GCACAATCTTGCTCTTCCTGTCTTGG. Both mitochondrial ROS production can promote disuse the ALAS2 transgenic mice and wild type mice were muscle atrophy by increasing proteolysis and depressing housed in a temperature-controlled room (22 °C) with a protein synthesis, and ROS can contribute to mitochon- 12-h light to 12-h dark cycle. Unless otherwise noted, 6- drial damage and impaired the ability to produce ATP, to 12-month-old male mice were used in the experi- which results in energy stress [10]. Theoretically, ments. All procedures were approved by the Institutional mitochondrial damage could decrease the level of cellu- Animal Care and Use Committee of Harbin Medical lar energy available for protein synthesis, and energy University. stress could promote proteolysis via the AMPK-FoxO3 axis [10]. Measurement of forelimb muscle grip strength Disorder of the heme biosynthesis pathway could in- The forelimb muscle grip strength was measured by an duce porphyria. Each enzymatic alteration of the heme automated grip strength meter (Jinan, China) as biosynthesis system can cause a specific porphyria [13]. described previously [17]. Briefly, mice were lifted by The clinical manifestations include acute neurovisceral their tails and made to hold a horizontal bar with their attacks, skin lesions, and muscle atrophy, which are as- forelimbs. Next, they were pulled slowly backwards until sociated with the accumulation of porphyrin precursors they could no longer hold the grip. The maximal force (5-aminolevulinic acid, porphobilinogen) and porphy- was recorded during consecutive attempts (at least 20 at- rins. Muscle weakness due to porphyria can progress tempts per mouse), and the average was set as the result. and lead to tetraplegia, with respiratory and bulbar par- alysis [13]. ALAS2-overexpressing transgenic mice (Tg Biochemical assays mice) showed obvious muscle atrophy. Jasmin Barman- Serum samples were separated from whole blood by Aksözen et al. found a significant increase in the amount centrifugation at 1,000×g for 10 minutes after the blood Peng et al. Skeletal Muscle (2021) 11:9 Page 3 of 11 was allowed to clot at room temperature for 30 minutes. were captured with the Olympus Bx51 microscope, and The activities of serum lactate dehydrogenase (LDH), fiber diameter was measured by Olympus Element creatine kinase (CK), and creatine kinase-MB (CK-MB) software. were measured by Modular DPP (Roche). Muscle ATP level Processing of tissues for histology For the muscle ATP level, we used a luminometric assay The gastrocnemius and/or quadriceps muscles were with ATP Assay kit (Beyotime) according to the manu- fixed with 4% formalin for at least 36 h. The tissues were facturer’s instructions. embedded in paraffin and cut into 4 μm thick sections in the transverse myofilament direction. Then, the sec- Real-time PCR tions were stained with hematoxylin and eosin (HE), and The muscles were harvested from ALAS2 transgenic and the images were visualized and captured with the wild-type (WT) mice and were frozen immediately in Olympus Bx51 microscope. liquid nitrogen, and then they were stored frozen at – 80 °C. For RNA isolation, the tissue was homogenized in Immunohistochemistry Trizol reagent (Invitrogen) and total RNA was prepared The sections of paraffin-embedded muscle tissue were according to the manufacturer’s protocol. The RNA was deparaffinized in xylene and rehydrated in ethyl alcohol. reverse transcribed into cDNA by High-Capacity cDNA Then, the sections were blocked with 1% hydrogen Reverse Transcription kit (Applied Biosystems). Real- peroxide (H O ) in distilled water for 10 min, and the 2 2 time PCR (RT-PCR) analyses were performed by the non-specific sites were blocked with bovine serum albu- ABI 7500 real-time PCR system (Applied Biosystems). min (BSA, DAKO) for 20 min at room temperature. For The glyceraldehyde-3-phosphate dehydrogenase (GAPD detecting eMyHC, heat-induced antigen retrieval was H) expression was used to normalize the expression performed (Tris/EDTA buffer, pH 8, DAKO) prior to levels. The relative expression values gained were used staining the muscle samples. The sections were then to calculate fold change. The primer sequences are listed incubated overnight at 4 °C with primary antibody of in Table 1 (5′−3′). anti-eMyHC (clone BF-45, mouse, 1:400). The BF-45 monoclonal antibody was obtained from DSHB at the Mitochondrial DNA (mtDNA) content assay University of Iowa in USA. After thorough washing in The muscles were digested and the DNA was isolated PBS, the sections were incubated with biotin-conjugated using the DNeasy Blood and Tissue kit (QIAGEN). The secondary antibodies (DAKO) at 37 °C for 20 min. We mtDNA content was quantified by qRT-PCR using a used a standard peroxidase-based method with DAB SYBR Green-based detection system by the ABI 7500 (DAKO) to detect the antibody. The sections were dehy- real-time PCR system (Applied Biosystems) according to drated with ethyl alcohol and coverslipped with mount- the manufacturer’s protocol in a similar way as the pre- ing medium. The stained sections were imaged using an vious description [20]. The qRT-PCR primer sequences Olympus BX51 microscope. of mtDNA and nucleus DNA were as follows (5′-3′), mtDNA: Forward primer was AAGTCGTAACAAGG Evans blue assay TAAGCA, and Reverse primer was ATATTTGTGT Evans blue assay was performed as described previously AGGGCTAGGG; Nuc.DNA: Forward primer was [18]. Evans blue dye (10 mg/ml) was dissolved in phos- GGGTATATTTTTGATACCTTCAATGAGTTA, and phate buffered saline (PBS). Then, it was filtered sterilely Reverse primer was TCTGAAACAGTAGGTAGAGAC- by a 0.2-μm pore filter. The Evans blue dye was intraper- CAAAGC. itoneally injected into the mouse (0.1 ml/10 g body weight). The mice were killed 24 h after injection. The quadriceps muscle of these killed mice was prepared and Transmission electron microscopy (TEM) observed under the Olympus Bx51microscope. The muscle blocks were prepared and soaked immedi- ately in 2.5% glutaraldehyde. After 6-8 h at 4 °C, they Single-fiber analyses were cut into 1mm thick coronal slices. Next, the sam- Single fibers were isolated and fiber size was measured ples were rinsed with PBS (0.1 M) before being post- as described previously [19]. The quadriceps muscles fixed by osmium tetroxide for 1-2 h. The muscle blocks were fixed with 4% paraformaldehyde (PFA) for more were dehydrated through a graded series of alcohol and than 2 days. Dissected small bundles of fibers were incu- acetone. Subsequently, we used epoxy resin for embed- bated in 40% NaOH for 2-3 h and vigorously shaken. ding prior to slicing of the ultra-thin sections. Then, Isolated myofibers were washed in PBS and stained with double staining by uranyl acetate and lead citrate was 10 μM DAPI. Images of 40-60 single fibers per animal performed. Finally, the images were acquired by a Peng et al. Skeletal Muscle (2021) 11:9 Page 4 of 11 Table 1 Primers table transmission electron microscope (JEM-1220, JEOL Ltd, Results Tokyo, Japan). Reduction of forelimb muscle grip strength in ALAS2 transgenic mice Western blotting As muscle weakness is a clinical manifestation of About 20 mg muscle tissue was lysed in RIPA Lysis porphyria [18, 21, 22], we measured the forelimb muscle Buffer (Beyotime) for 10 minutes on ice. RIPA Lysis grip strength by the automated grip strength meter. Buffer is configured with 20 mM Tris PH7.5, 150 mM Interestingly, we found that ALAS2 transgenic (Tg) mice NaCl, 1% Triton X-100, 2.5 mM sodium pyrophosphate, had reduced forelimb muscle strength compared with 1 mM EDTA, 1%Na VO , 0.5 μg/ml leupeptin, and 1 the age-matched WT littermates (Fig. 1). The data 3 4 mM phenyl methane sulfonyl fluoride (PMSF). The strongly suggest that muscle weakness is present in lysate homogenate was centrifuged at 12,000×g at 4 °C ALAS2 transgenic (Tg) mice. for 5 min. The protein concentration was measured with the DC Protein Assay kit (Bio-Rad Laboratories). Protein Loss of muscle mass in ALAS2 transgenic mice samples were boiled for 10 min in the presence of 4× Tg mice were smaller and thinner than the age-matched Loading Dye. Equal amounts of total proteins (25 μg) WT littermates (data not shown). On visual analysis, were loaded on a 12% SDS-polyacrylamide gel for elec- overall loss of hindlimb muscle mass was clearly evident trophoresis followed by a transfer to PVDF membranes in Tg mice (Fig. 2a). The wet weight of the quadriceps (Millipore) at 70 V for 1 h. The membranes were femoris was approximately half of that in the age- blocked with 5% non-fat powdered milk in PBS (10 mM, matched WT littermates, and this finding was similar to pH 7.4) for 1 h at 4 °C. The blot was incubated with the that in the gastrocnemius muscle (Fig. 2b). As Tg mice primary antibody (GAPDH, 1:2000, Cell Signaling were smaller and thinner, we normalize the wet weight Technology, HO-1, Santa Cruz Biotechnology) overnight of the quadriceps femoris mass by the body weight. The at 4 °C. The membrane was washed three times by results showed that the muscle mass percentage in Tg PBST, followed by incubation with the appropriate mice was lower than that in WT mice (Fig. 2c). The my- secondary antibody. The signal was detected by an osin heavy chain (MHC) mRNA expression was also Enzymatic Chemiluminescence (ECL) kit (Applygen). measured. We found the MHC mRNA level in Tg mice was decreased compared with that in WT mice (Fig. 2d). Statistics The data indicated muscle mass loss in Tg mice. All quantitative data are expressed as means ± SD. Statistical analysis was performed using either Student’s Muscle atrophy in ALAS2 transgenic mice t test (two groups) or one-way analysis of variance (more To determine the cause of loss of muscle mass, HE- than two groups), followed by Bonferroni post hoc test. stained transverse sections of the quadriceps femoris Differences were considered significant at P < 0.05. from age-matched Tg mice and WT mice were Peng et al. Skeletal Muscle (2021) 11:9 Page 5 of 11 Fig. 1 Reduced forelimb muscle grip strength in ALAS2 transgenic mice. Grip strength in ALAS2 transgenic mice (n = 9) and WT mice (n = 8). Values are means ± SD. *P < 0.05;**P < 0.01;***P < 0.001 compared. A high number of muscle fibers with were compared by immunostaining for quadriceps cross centrally located nuclei was found in Tg mice, a primary section from age-matched Tg mice and WT mice at 6 pathological sign of muscular dystrophy [23], but not in months old. Re-expression of eMyHC was only showed in WT mice (Fig. 3a). Moreover, to detect the regeneration the quadriceps of Tg mice, but not in WT mice (Fig. 3b), of the quadriceps in Tg mice, re-expression of eMyHC indicating that the central nucleation determined in Tg Fig. 2 Loss of muscle mass in the ALAS2 transgenic mice. a Left panel: gross morphology of skinned hindlimb muscles of ALAS2 transgenic mice and WT mice. Right panel: comparison of individual muscles. b Comparison of changes in wet weight of individual muscles mass (n =6–7). c Comparison of in wet weight of individual muscles mass normalized to body weight (n =6–7). d The MHC mRNA expression (n =6–7). Values are means ± SD.*P < 0.05; **P < 0.01; ***P < 0.001 Peng et al. Skeletal Muscle (2021) 11:9 Page 6 of 11 Fig. 3 (See legend on next page.) Peng et al. Skeletal Muscle (2021) 11:9 Page 7 of 11 (See figure on previous page.) Fig. 3 Muscle atrophy in the ALAS2 transgenic mice. a Quadriceps cross section from hematoxylin and eosin stain. (bar, 50 μm). b Expression of eMyHC in WT and ALAS2 transgenic mice (Tg) muscle. (Bar of a-c is 50 μm, and bar of d-e 20 μm). c Single-fiber size comparison of WT and ALAS2 transgenic mice quadriceps muscle. d Quantification of average fiber diameter across single fibers in quadriceps muscle from WT (n =4) and ALAS2 transgenic mice (n = 4). e Evans blue dye was intraperitoneal injected and mice sacked 24 h later. Transverse cross-sections of quadriceps muscle were observed with OLYMPUS BX51 equipped with green activation filters. Evans blue-positive fibers are denoted by red staining. Bar, 50 μm. f Serum LDH levels of WT (n = 7) and ALAS2 transgenic mice (n = 6). g Serum CK-MB levels of WT (n = 7) and ALAS2 transgenic mice (n = 6). h The relative mRNA expression of myod1, myogenin, and S6K1 (n =5–8). i The relative mRNA expression of utrophin, dystrophin, Atrogin-1, and MuRF1. Values are means ± SD.*P < 0.05; **P < 0.01; ***P < 0.001 mice muscles resulted from muscle regeneration [24, 25]. energetic failure played an important role in the expres- With respect to single-fiber analyses [19, 26], the average sion of acute intermittent porphyria (AIP) [28]. diameter of single fibers isolated from the muscle of Tg mice was smaller than that isolated from the muscle of Discussion WT mice (Fig. 3c, d). In addition, to examine leakage into ALAS2-overexpressing Tg mice were developed to in- the muscle fiber, Evans blue assay was employed [18, 27]. vestigate the mechanism of porphyria. The expression of The fluorescent dye accumulated in the interior of dystro- ALAS2 was increased in Tg mice [29]. Tg mice showed phied muscle fibers in Tg mice (Fig. 3e). We showed that obvious muscular atrophy, which is also a clinical char- the myocyte membrane was damaged in dystrophied acteristic of porphyria. Therefore, we explored the muscle of Tg mice. Moreover, we detected the activities of mechanism of muscular atrophy in Tg mice. Firstly, we serum CK, CK-MB, and LDH, and we found the elevation found that Tg mice experienced a decrease in muscle of the activity of serum CK-MB and LDH in Tg mice (Fig. mass and grip strength of the forelimb muscles. Sec- 3f, g). We analyzed the expression of the genes, and we ondly, increased activities of serum CK-MB and LDH, found that the expression levels of MyoD1, dystrophin, increased central nuclear fiber and Evans blue positive Atrogin-1, and MuRF1 were decreased, but the expression fiber and decreased single-fiber diameter confirmed level of utrophin was increased. There was no difference muscle atrophy in Tg mice. In addition, Re-expression in myogenin and S6K1 in Tg mice compared with WT of eMyHC was only showed in the quadriceps of Tg mice (Fig. 3h, i). Albertyn CH et al. also described that mice, but not in WT mice, indicating that the central acute intermittent porphyria presenting as progressive nucleation determined in Tg mice muscles resulted from muscular atrophy in a 23-year-old black South African muscle regeneration. Furthermore, the expression levels man [12]. of MyoD1, S6K1 (anabolic factor), atrogin1, and MuRF1 (catabolic factor) were determined. Finally, muscle mito- Mitochondrial dysfunction in the muscle of ALAS2 chondrial dysfunction in ALAS2 Tg mice was detected transgenic mice based on mitochondrial swelling, decline in ATP pro- To test whether muscle dystrophy in Tg mice was duction and mtDNA content, and downregulation of affected by mitochondrial damage, we examined the UCP3 mRNA expression. ultrastructure of muscle fibers using a transmission elec- We found that the muscle grip strength of forelimbs tron microscope. Mitochondrial swelling was found in of Tg mice was decreased. Since muscle mass deter- muscles of Tg mice (Fig. 4a, right), but not in muscles of mines the skeletal muscle strength [30], the loss of WT mice (Fig. 4a, left). Then we compared the mtDNA muscle strength in Tg mice may be caused by the loss of content, uncoupling protein 3 (UCP-3) mRNA expres- muscle mass. The diameter of single fibers of Tg mice sion, and ATP production in the hind limb muscles of was smaller than that of WT mice, and thinner fiber in- Tg mice and age-matched WT mice. The mtDNA con- dicated less muscle mass. MHC is an important part of tent quantified by qRT-PCR [20] was significantly re- the sarcomere [31]. We found that the mRNA level of duced in the gastrocnemius muscle of Tg mice (Fig. 4b). MHC in Tg mice was decreased, which meant that the The muscle UCP-3 mRNA expression was decreased in loss of muscle mass may be caused by the decrease in Tg mice (Fig. 4c). ATP production in the gastrocnemius MHC content. In addition to the decreased muscle mass muscle of Tg mice was decreased to 21% of the level in of atrophic muscles, a large number of muscle fibers age-matched WT mice (Fig. 4d). Interestingly, increased with centrally located nucleus were observed in Tg mice, expression levels of SOD1 mRNA, HO-1 mRNA, and which is a sign of muscle fiber regeneration [32, 33]. We HO-1 protein showed that SOD1 and HO-1 were in- also found that the re-expression of eMyHC was only duced in the muscle of Tg mice (Fig. 4e, f). Above all, showed in the quadriceps of Tg mice, but not in WT mitochondrial dysfunction and loss were present in the mice, confirming that the central nucleation determined muscle of Tg mice. It was reported that mitochondrial in Tg mice muscles resulted from muscle regeneration. Peng et al. Skeletal Muscle (2021) 11:9 Page 8 of 11 Fig. 4 Mitochondrial dysfunction in the ALAS2 transgenic mice muscle. a TEM images of gastrocnemius of WT and ALAS2 transgenic mice. Bars, 2 μm. b mtDNA content in gastrocnemius of WT (n = 8) and ALAS2 transgenic mice (n = 7). c UCP3 expression in quadriceps of WT (n = 8) and ALAS2 transgenic mice (n = 7). d ATP production in gastrocnemius of WT (n = 8) and ALAS2 transgenic mice (n = 8). e The SOD1 and HO-1 mRNA expression(n =5–8). f The HO-1 protein expression (n = 4). Values are means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 TheEvans blue dyecould enterintothe myocyte myocyte of Tg mice suggested that the myocyte through the damaged cytomembrane and get accu- membrane was damaged in Tg mice. Also, increased mulated in the myocyte, and thus, Evans blue dye activities of serum LDH and CK-MB indicated that was used to identify damaged skeletal myofibers [27, the muscular membrane of Tg mice was damaged 34, 35]. Accumulation of Evans blue dye in the [36–38]. The expression of MyoD1 was decreased in Peng et al. Skeletal Muscle (2021) 11:9 Page 9 of 11 Tg mice compared with WT mice. Since muscle mitochondrial damage. A decrease in the ATP production regeneration has been reported to be delayed in was observed in Tg mice, which was probably induced by MyoD (−/−)mice[39], decreased MyoD1 might mitochondrial damage and loss. The pCAGGS expression cause a disturbance in the regeneration in Tg mice. vector can drive EGFP expression in all tissues, except The expression of utrophin was increased and that of erythrocytes and hair in mice, particularly higher in the dystrophin was decreased in Tg mice compared with muscle [53]. Also, Tg mice have ubiquitous overexpres- WT mice, which was similar to that in other dystrophy sion of ALAS-2 in all tissues and higher expression of reports [33, 40]. MAFbx and MuRF1 belong to the ubi- ALAS-2 in the muscle. Moreover, the accumulation of quitin proteasome pathway, which plays a critical role in ALA is much higher in Tg mice than in WT mice. Be- the intracellular protein degradation of skeletal muscle cause ALA is synthesized in the mitochondria and ALA is [41]. Upregulation of atrophy-related genes atrogin-1 a putative endogenous source of ROS [7], ALA might (MAFbX) and MuRF1 in skeletal muscle atrophy has damage the mitochondria of muscle in Tg mice. been reported previously [42, 43]. However, atrogin-1 Porphyrias are a group of eight metabolic disorders of and MuRF1 were downregulated in aging-related loss of the heme biosynthesis pathway [7]. Every porphyria is skeletal muscle [44] and in mTOR-mice [33], and here, caused by abnormal function of a separate enzymatic we also found that atrogin-1 and MuRF1 levels were step, resulting in a specific accumulation of heme pre- decreased in Tg mice. Inhibition of MuRF1 is sufficient cursors, including ALA, PBG, and porphyrins. In some to maintain the MHC [44]. However, MHC in Tg mice cases, muscle atrophy was present in porphyria; how- was decreased, which indicated that the loss of muscle ever, the underlying mechanism is still unknown. mass in Tg mice was not related to activation of the ubi- ALAS2-overexpressing Tg mice also show accumulation quitin proteasome pathway. A previous study showed of ALA, thus it may be a new model of porphyria. In the that chronic spinal cord-injured patients with severe at- future, we will further verify whether ALAS2- rophy of the quadriceps muscles showed a reduction in overexpressing Tg mice can be used as a porphyria atrogin-1 and MuRF1, which suggested an internal model, and we will use this model to investigate the rela- mechanism aimed at reducing the further loss of muscle tionship of mitochondrial dysfunction and porphyria- proteins [45, 46]. The reduction of atrogin-1 and MuRF1 related muscle weakness. in Tg mice may also be a protective attempt to reduce further muscle wasting in muscle atrophy. Conclusion Mitochondrial dysfunction is a hallmark trait that oc- Muscle weakness in ALAS2-overexpressing mice is re- curs during prolonged muscle inactivity in both animals lated to muscle mitochondrial dysfunction induced by and humans. Mitochondrial fission and remodeling con- the accumulation of ALA. tribute to muscle atrophy [47]. Increased superoxide in vivo accelerates age-associated muscle atrophy through Abbreviations ALAS2: Delta-aminolevulinate synthase 2; ALA: Delta-aminolevulinic acid; Tg mitochondrial dysfunction [19]. Mitochondria play an im- mice: Transgenic mice; WT mice: Wild-type mice; ATP: Adenosine portant role in muscle atrophy [19, 47, 48]. It has been re- triphosphate; HE: Hematoxylin and eosin; ROS: Reactive oxygen species; ported that ALA-generated oxidant promotes dysfunction EPP: Erythropoietic protoporphyria; XLPP: X-linked protoporphyria; mtDNA: Mitochondrial DNA; LDH: Lactate dehydrogenase ; CK: Creatine and swelling of the isolated rat liver mitochondria [7]. kinase; CK-MB: Creatine kinase-MB; GAPDH: Glyceraldehyde-3-phosphate Similarly, mitochondrial swelling and mitochondrial cris- dehydrogenase; TEM: Transmission electron microscopy tae reduction were shown in muscles of Tg mice. As Tg mice have high expression of ALAS2 [29] and accumula- Supplementary Information tion of ALA in the muscles (data not shown), mitochon- The online version contains supplementary material available at https://doi. drial damage in the muscle of Tg mice is most likely to be org/10.1186/s13395-021-00263-8. induced by ALA. There is an increase of SOD-1 in the brain, muscle, and liver of chronic ALA-treated rats [8], Additional file 1 : FigS. 1 Overexpresion ALAS-2 in in mouse myoblasts (C2C12). A, The relative mRNA expression of ALAS-2. B, The relative mRNA and thus, we speculate that SOD-1 and HO-1 are induced expression of myod1, myogein and S6K1. C, The relative mRNA expres- by ALA in Tg mice. Increasing of anti-oxidant enzymes sion of utrophin, dystrophin, Atrogin-1 and MuRF1. Values are means ± in Tg mice indicated oxidant existence. As excessive free SD.*P<0.05;**P<0.01;***P<0.001. radicals accelerate muscle proteolysis [12, 49], the pro- oxidizing nature of ALA [50] may lead to the loss of Acknowledgements Not applicable. muscle mass. Previous studies have indicated that exercise induced up-regulation of UCP-3 and downregulation of Authors’ contributions UCP-3 would damage the muscles [51, 52]. Decreased XG, YH, and RH designed the study. YP, JL, DL, SZ, SL, DW, XW, ZZ, XW, and mtDNA content and UCP-3 expression suggested that the CS performed experiments and analyzed data. YP and RH wrote the mitochondrial loss in Tg mice was correlated with manuscript. All authors read and approved the final manuscript. Peng et al. Skeletal Muscle (2021) 11:9 Page 10 of 11 Funding 12. Albertyn CH, Sonderup M, Bryer A, Corrigall A, Meissner P, Heckmann JM. This work was supported by Natural Science Foundation of China (81773165, Acute intermittent porphyria presenting as progressive muscular atrophy in 81671255), Hunan Province Science Fund for Distinguished Young Scholars a young black man. S Afr Med J. 2014;104(4):283–5. (2018JJ1021), the Natural Science Foundation of Hunan Province 13. Puy H, Gouya L, Deybach JC. Porphyrias. Lancet. 2010;375(9718):924–37. (2020JJ5013), and Chinese Scholarship Council Fund for the Visiting Scholars 14. Barman-Aksozen J, Minder EI, Schubiger C, Biolcati G, Schneider-Yin X. In (No. 201908230108). ferrochelatase-deficient protoporphyria patients, ALAS2 expression is enhanced and erythrocytic protoporphyrin concentration correlates with iron availability. Blood Cells Mol Dis. 2015;54(1):71–7. Availability of data and materials 15. Manceau H, Gouya L, Puy H. Acute hepatic and erythropoietic porphyrias: All the data and material could be traced from the paper or can be from ALA synthases 1 and 2 to new molecular bases and treatments. Curr requested from the corresponding author. Opin Hematol. 2017;24(3):198–207. 16. To-Figueras J, Ducamp S, Clayton J, Badenas C, Delaby C, Ged C, Lyoumi S, Declarations Gouya L, de Verneuil H, Beaumont C, et al. ALAS2 acts as a modifier gene in patients with congenital erythropoietic porphyria. Blood. 2011;118(6):1443– Ethics approval and consent to participate The study was approved by the local Ethic Committee. 17. Windahl SH, Andersson N, Borjesson AE, Swanson C, Svensson J, Moverare- Skrtic S, Sjogren K, Shao R, Lagerquist MK, Ohlsson C. Reduced bone mass and muscle strength in male 5alpha-reductase type 1 inactivated mice. Competing interests PLoS One. 2011;6(6):e21402. The authors declare that they have no competing interests. 18. Crosbie RH, Straub V, Yun HY, Lee JC, Rafael JA, Chamberlain JS, Dawson VL, Author details Dawson TM. Campbell KP: mdx muscle pathology is independent of nNOS Department of Biochemistry and Molecular Biology, Harbin Medical perturbation. Hum Mol Genet. 1998;7(5):823–9. University, Harbin 150086, China. Institute of Translational Medicine, National 19. Jang YC, Lustgarten MS, Liu Y, Muller FL, Bhattacharya A, Liang H, Salmon and Local Joint Engineering Laboratory of High-through Molecular AB, Brooks SV, Larkin L, Hayworth CR, et al. Increased superoxide in vivo Diagnostic Technology, the First People’s Hospital of Chenzhou, The First accelerates age-associated muscle atrophy through mitochondrial Affiliated Hospital of Xiangnan University, Chenzhou 423000, China. dysfunction and neuromuscular junction degeneration. FASEB J. 2010;24(5): 3 4 Heilongjiang Academy of Medical Sciences, Harbin 150086, China. Key 1376–90. Laboratory of Preservation of Human Genetic Resources and Disease Control 20. Viader A, Golden JP, Baloh RH, Schmidt RE, Hunter DA, Milbrandt J. in China (Harbin Medical University), Ministry of Education, Beijing 150086, Schwann cell mitochondrial metabolism supports long-term axonal survival China. Department of Clinical Pharmacology, Xiangya Hospital, Central and peripheral nerve function. J Neurosci. 2011;31(28):10128–40. South University, Changsha 410078, China. 21. Cavanagh JB, Mellick RS. On the Nature of the Peripheral Nerve Lesions Associated with Acute Intermittent Porphyria. J Neurol Neurosurg Received: 15 January 2020 Accepted: 2 March 2021 Psychiatry. 1965;28:320–7. 22. Moorhead PJ, Cooper DJ, Timperley WR. Progressive peripheral neuropathy in patient with primary hyperoxaluria. Br Med J. 1975;2(5966):312–3. 23. Wang B, Li J, Xiao X. Adeno-associated virus vector carrying human References minidystrophin genes effectively ameliorates muscular dystrophy in mdx 1. Tchaikovskii V, Desnick RJ, Bishop DF. Molecular expression, characterization mouse model. Proc Natl Acad Sci U S A. 2000;97(25):13714–9. and mechanism of ALAS2 gain-of-function mutants. Mol Med. 2019;25(1):4. 24. Schiaffino S, Rossi AC, Smerdu V, Leinwand LA, Reggiani C. Developmental 2. Riddle RD, Yamamoto M, Engel JD. Expression of delta-aminolevulinate myosins: expression patterns and functional significance. Skelet Muscle. synthase in avian cells: separate genes encode erythroid-specific and 2015;5:22. nonspecific isozymes. Proc Natl Acad Sci U S A. 1989;86(3):792–6. 25. Silva WJ, Graca FA, Cruz A, Silvestre JG, Labeit S, Miyabara EH, Yan CYI, 3. Yamamoto M, Kure S, Engel JD, Hiraga K. Structure, turnover, and heme- Wang DZ. Moriscot AS: miR-29c improves skeletal muscle mass and mediated suppression of the level of mRNA encoding rat liver delta- function throughout myocyte proliferation and differentiation and by aminolevulinate synthase. J Biol Chem. 1988;263(31):15973–9. repressing atrophy-related genes. Acta Physiol. 2019;226(4):e13278. 4. Kolluri S, Sadlon TJ, May BK, Bonkovsky HL. Haem repression of the 26. Wada KI, Takahashi H, Katsuta S, Soya H. No decrease in myonuclear housekeeping 5-aminolaevulinic acid synthase gene in the hepatoma cell number after long-term denervation in mature mice. Am J Physiol Cell line LMH. Biochem J. 2005;392(Pt 1):173–80. Physiol. 2002;283(2):C484–8. 5. Peoc'h K, Nicolas G, Schmitt C, Mirmiran A, Daher R, Lefebvre T, Gouya L, 27. Matsuda R, Nishikawa A, Tanaka H. Visualization of dystrophic muscle fibers Karim Z, Puy H. Regulation and tissue-specific expression of delta- in mdx mouse by vital staining with Evans blue: evidence of apoptosis in aminolevulinic acid synthases in non-syndromic sideroblastic anemias and dystrophin-deficient muscle. J Biochem. 1995;118(5):959–64. porphyrias. Mol Genet Metab. 2019;128(3):190–7. 28. Homedan C, Schmitt C, Laafi J, Gueguen N, Desquiret-Dumas V, Lenglet H, 6. Smith SJ, Cox TM. Translational control of erythroid delta-aminolevulinate Karim Z, Gouya L, Deybach JC, Simard G, et al. Mitochondrial energetic synthase in immature human erythroid cells by heme. Cell Mol Biol. 1997; defects in muscle and brain of a Hmbs-/- mouse model of acute 43(1):103–14. intermittent porphyria. Hum Mol Genet. 2015;24(17):5015–23. 7. Hermes-Lima M, Castilho RF, Valle VG, Bechara EJ, Vercesi AE. Calcium- 29. Huang H, Wang W, Zou J, Liu Z, Zhou Z, Nakajima O, Zhang L, Luo J, Li M, dependent mitochondrial oxidative damage promoted by 5-aminolevulinic He Q, et al. Over-expression 5-aminolevulinic acid synthase 2 in acid. Biochim Biophys Acta. 1992;1180(2):201–6. nonerythroid cell may causes protoporphyrin IX accumulation. 8. Pereira B, Curi R, Kokubun E, Bechara EJ. 5-aminolevulinic acid-induced Photodiagnosis Photodyn Ther. 2017;17:22–8. alterations of oxidative metabolism in sedentary and exercise-trained rats. J 30. Frontera WR, Hughes VA, Lutz KJ, Evans WJ. A cross-sectional study of Appl Physiol. 1992;72(1):226–30. muscle strength and mass in 45- to 78-yr-old men and women. J Appl 9. Yamada T, Ivarsson N, Hernandez A, Fahlstrom A, Cheng AJ, Zhang SJ, Physiol. 1991;71(2):644–50. Bruton JD, Ulfhake B, Westerblad H. Impaired mitochondrial respiration and decreased fatigue resistance followed by severe muscle weakness 31. Derbre F, Ferrando B, Gomez-Cabrera MC, Sanchis-Gomar F, Martinez-Bello in skeletal muscle of mitochondrial DNA mutator mice. J Physiol. 2012; VE, Olaso-Gonzalez G, Diaz A, Gratas-Delamarche A, Cerda M, Vina J. 590(23):6187–97. Inhibition of xanthine oxidase by allopurinol prevents skeletal muscle 10. Powers SK, Wiggs MP, Duarte JA, Zergeroglu AM, Demirel HA. Mitochondrial atrophy: role of p38 MAPKinase and E3 ubiquitin ligases. PLoS One. 2012; signaling contributes to disuse muscle atrophy. Am J Physiol Endocrinol 7(10):e46668. Metab. 2012;303(1):E31–9. 32. Handschin C, Chin S, Li P, Liu F, Maratos-Flier E, Lebrasseur NK, Yan Z, 11. Peker N, Donipadi V, Sharma M, McFarlane C, Kambadur R. Loss of Parkin Spiegelman BM. Skeletal muscle fiber-type switching, exercise intolerance, impairs mitochondrial function and leads to muscle atrophy. Am J Physiol and myopathy in PGC-1alpha muscle-specific knock-out animals. J Biol Cell Physiol. 2018;315(2):C164–85. Chem. 2007;282(41):30014–21. Peng et al. Skeletal Muscle (2021) 11:9 Page 11 of 11 33. Risson V, Mazelin L, Roceri M, Sanchez H, Moncollin V, Corneloup C, Richard- Bulteau H, Vignaud A, Baas D, Defour A, et al. Muscle inactivation of mTOR causes metabolic and dystrophin defects leading to severe myopathy. J Cell Biol. 2009;187(6):859–74. 34. Brussee V, Tardif F, Tremblay JP. Muscle fibers of mdx mice are more vulnerable to exercise than those of normal mice. Neuromuscul Disord. 1997;7(8):487–92. 35. Hamer PW, McGeachie JM, Davies MJ, Grounds MD. Evans Blue Dye as an in vivo marker of myofibre damage: optimising parameters for detecting initial myofibre membrane permeability. J Anat. 2002;200(Pt 1):69–79. 36. Keshgegian AA, Feinberg NV. Serum creatine kinase MB isoenzyme in chronic muscle disease. Clin Chem. 1984;30(4):575–8. 37. Apple FS, McGue MK. Serum enzyme changes during marathon training. Am J Clin Pathol. 1983;79(6):716–9. 38. Siegel AJ, Silverman LM, Evans WJ. Elevated skeletal muscle creatine kinase MB isoenzyme levels in marathon runners. Jama. 1983;250(20):2835–7. 39. White JD, Scaffidi A, Davies M, McGeachie J, Rudnicki MA, Grounds MD. Myotube formation is delayed but not prevented in MyoD-deficient skeletal muscle: studies in regenerating whole muscle grafts of adult mice. J Histochem Cytochem. 2000;48(11):1531–44. 40. Cifuentes-Diaz C, Frugier T, Tiziano FD, Lacene E, Roblot N, Joshi V, Moreau MH, Melki J. Deletion of murine SMN exon 7 directed to skeletal muscle leads to severe muscular dystrophy. J Cell Biol. 2001;152(5):1107–14. 41. Lecker SH, Solomon V, Mitch WE, Goldberg AL. Muscle protein breakdown and the critical role of the ubiquitin-proteasome pathway in normal and disease states. J Nutr. 1999;129(1S Suppl):227S–37S. 42. Lagirand-Cantaloube J, Offner N, Csibi A, Leibovitch MP, Batonnet-Pichon S, Tintignac LA, Segura CT, Leibovitch SA. The initiation factor eIF3-f is a major target for atrogin1/MAFbx function in skeletal muscle atrophy. EMBO J. 2008;27(8):1266–76. 43. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell. 2004;14(3):395–403. 44. Edstrom E, Altun M, Hagglund M, Ulfhake B. Atrogin-1/MAFbx and MuRF1 are downregulated in aging-related loss of skeletal muscle. J Gerontol A Biol Sci Med Sci. 2006;61(7):663–74. 45. Foletta VC, White LJ, Larsen AE, Leger B, Russell AP. The role and regulation of MAFbx/atrogin-1 and MuRF1 in skeletal muscle atrophy. Pflugers Arch. 2011;461(3):325–35. 46. Leger B, Senese R, Al-Khodairy AW, Deriaz O, Gobelet C, Giacobino JP, Russell AP. Atrogin-1, MuRF1, and FoXO, as well as phosphorylated GSK- 3beta and 4E-BP1 are reduced in skeletal muscle of chronic spinal cord- injured patients. Muscle Nerve. 2009;40(1):69–78. 47. Romanello V, Guadagnin E, Gomes L, Roder I, Sandri C, Petersen Y, Milan G, Masiero E, Del Piccolo P, Foretz M, et al. Mitochondrial fission and remodelling contributes to muscle atrophy. EMBO J. 2010;29(10):1774–85. 48. Chen H, Vermulst M, Wang YE, Chomyn A, Prolla TA, McCaffery JM, Chan DC. Mitochondrial fusion is required for mtDNA stability in skeletal muscle and tolerance of mtDNA mutations. Cell. 2010;141(2):280–9. 49. Romanello V, Sandri M. Mitochondrial quality control and muscle mass maintenance. Front Physiol. 2015;6:422. 50. Bechara EJ, Dutra F, Cardoso VE, Sartori A, Olympio KP, Penatti CA, Adhikari A, Assuncao NA. The dual face of endogenous alpha-aminoketones: pro- oxidizing metabolic weapons. Comp Biochem Physiol Toxicol Pharmacol. 2007;146(1-2):88–110. 51. Jones TE, Baar K, Ojuka E, Chen M, Holloszy JO. Exercise induces an increase in muscle UCP3 as a component of the increase in mitochondrial biogenesis. Am J Physiol Endocrinol Metab. 2003;284(1):E96–101. 52. Tsuboyama-Kasaoka N, Tsunoda N, Maruyama K, Takahashi M, Kim H, Ikemoto S, Ezaki O. Up-regulation of uncoupling protein 3 (UCP3) mRNA by exercise training and down-regulation of UCP3 by denervation in skeletal muscles. Biochem Biophys Res Commun. 1998;247(2):498–503. 53. Okabe M, Ikawa M, Kominami K, Nakanishi T. Nishimune Y: ‘Green mice’ as a source of ubiquitous green cells. FEBS Lett. 1997;407(3):313–9. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Skeletal Muscle Springer Journals

Muscle atrophy induced by overexpression of ALAS2 is related to muscle mitochondrial dysfunction

Loading next page...
 
/lp/springer-journals/muscle-atrophy-induced-by-overexpression-of-alas2-is-related-to-muscle-rae1YtOAVP
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2021
eISSN
2044-5040
DOI
10.1186/s13395-021-00263-8
Publisher site
See Article on Publisher Site

Abstract

Background: ALAS2 (delta-aminolevulinate synthase 2) is one of the two isoenzymes catalyzing the synthesis of delta-aminolevulinic acid (ALA), which is the first precursor of heme synthesis. ALAS2-overexpressing transgenic mice (Tg mice) showed syndrome of porphyria, a series of diseases related to the heme anabolism deficiency. Tg mice showed an obvious decrease in muscle size. Muscle atrophy results from a decrease in protein synthesis and an increase in protein degradation, which ultimately leads to a decrease in myofiber size due to loss of contractile proteins, organelles, nuclei, and cytoplasm. Methods: The forelimb muscle grip strength of age-matched ALAS-2 transgenic mice (Tg mice) and wild-type mice (WT mice) were measured with an automated grip strength meter. The activities of serum LDH and CK-MB were measured by Modular DPP. The histology of skeletal muscle (quadriceps femoris and gastrocnemius) was observed by hematoxylin and eosin (HE) staining, immunohistochemistry, and transmission electron microscope. Real-time PCR was used to detect mtDNA content and UCP3 mRNA expression. Evans blue dye staining was used to detect the membrane damage of the muscle fiber. Single skeletal muscle fiber diameter was measured by single-fiber analyses. Muscle adenosine triphosphate (ATP) levels were detected by a luminometric assay with an ATP assay kit. Results: Compared with WT mice, the strength of forelimb muscle and mass of gastrocnemius were decreased in Tg mice. The activities of serum CK-MB and LDH, the number of central nuclei fibers, and Evans blue positive fibers were more than those in WT mice, while the diameter of single fibers was smaller, which were associated with suppressed expression levels of MHC, myoD1, dystrophin, atrogin1, and MuRF1. Re-expression of eMyHC was only showed in the quadriceps of Tg mice, but not in WT mice. Muscle mitochondria in Tg mice showed dysfunction with descented ATP production and mtDNA content, downregulated UCP3 mRNA expression, and swelling of mitochondria. (Continued on next page) * Correspondence: huiyang79@126.com; rongzhang412@163.com Yahui Peng and Jihong Li contributed equally to this work. Department of Biochemistry and Molecular Biology, Harbin Medical University, Harbin 150086, China Institute of Translational Medicine, National and Local Joint Engineering Laboratory of High-through Molecular Diagnostic Technology, the First People’s Hospital of Chenzhou, The First Affiliated Hospital of Xiangnan University, Chenzhou 423000, China Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Peng et al. Skeletal Muscle (2021) 11:9 Page 2 of 11 (Continued from previous page) Conclusion: ALAS2 overexpressing-transgenic mice (Tg mice) showed muscle dystrophy, which was associated with decreased atrogin-1 and MuRF-1, and closely related to mitochondrial dysfunction. Keywords: Muscle atrophy, Mitochondrial dysfunction, Transgenic mice, Delta-aminolevulinate synthase 2 Background of ALAS2 mRNA and protein among patients with The heme biosynthetic pathway begins from delta- erythropoietic protoporphyria (EPP) [14]. Additionally, aminolevulinic acid synthase (ALAS) catalyzing the con- four recurrent gain-of-function mutations in the densation of glycine and succinyl-CoA to delta- catalytic domain of the ALAS2 enzyme resulting in an aminolevulinic acid (ALA)inthe mitochondria [1]. ALAS increased ALAS2 activity have been described as being is coded by two genes: ALAS1 and ALAS2 [2]. ALAS1 is responsible for X-linked protoporphyria (XLPP) [15]. ubiquitously expressed in all cells, and the negative feed- To-Figueras et al. presented convincing evidence that back is regulated by the heme pool [3, 4]; however, ALAS2 ALAS2 acts as a modifier gene in patients with congeni- is specifically expressed only in erythroid cells [2, 5]and is tal erythropoietic porphyria [16]. In this study, we not inhibited by heme [6]. Bechara reported that reactive reported that ALAS2 overexpressing-transgenic mice oxygen species (ROS) is formed by the metal-catalyzed aer- (Tg mice) showed muscle atrophy, which was associated obic oxidation of ALA at abnormally high levels [6, 7]; with decreased atrogin-1 and MuRF-1, and closely mitochondria are the main source of ROS and are also the related to mitochondrial dysfunction. primary target of oxidant-induced damage.ALA,asaputa- tive endogenous source of ROS, induces mitochondrial Materials and methods swelling and transmembrane potential collapse [7], and Animals ALA-treated rats under swimming training experienced fa- ALAS2 transgenic mice were generated by the standard tigue earlier [8]. Defective mitochondrial function has been pronuclear injection technique using C57BL/6 mice. shown to cause muscle weakness [9]. The loss of mitochon- Briefly, mouse ALAS2 cDNA was cloned into the dria has also been shown to result in muscle wasting [10]. pCAGGS plasmid with the chicken β-actin promoter, Notably, studies have reported abnormalities in the mito- which drove the mouse ALAS2 cDNA expression, and chondria during sarcopenia, muscle wasting, associated terminated with the poly (A) signal. All animals were with chronic illness (cachexia), and disuse atrophy [11, 12]. identified by analysis of tail DNA by PCR. Sequences of The mitochondria produce adenosine triphosphate primers were as follows (5′−3′): forward primer was (ATP) as a source of chemical energy, and skeletal GCCTTCTTCTTTTTCCTACAGCTC; reverse primer muscle contains abundant mitochondria. Increased was GCACAATCTTGCTCTTCCTGTCTTGG. Both mitochondrial ROS production can promote disuse the ALAS2 transgenic mice and wild type mice were muscle atrophy by increasing proteolysis and depressing housed in a temperature-controlled room (22 °C) with a protein synthesis, and ROS can contribute to mitochon- 12-h light to 12-h dark cycle. Unless otherwise noted, 6- drial damage and impaired the ability to produce ATP, to 12-month-old male mice were used in the experi- which results in energy stress [10]. Theoretically, ments. All procedures were approved by the Institutional mitochondrial damage could decrease the level of cellu- Animal Care and Use Committee of Harbin Medical lar energy available for protein synthesis, and energy University. stress could promote proteolysis via the AMPK-FoxO3 axis [10]. Measurement of forelimb muscle grip strength Disorder of the heme biosynthesis pathway could in- The forelimb muscle grip strength was measured by an duce porphyria. Each enzymatic alteration of the heme automated grip strength meter (Jinan, China) as biosynthesis system can cause a specific porphyria [13]. described previously [17]. Briefly, mice were lifted by The clinical manifestations include acute neurovisceral their tails and made to hold a horizontal bar with their attacks, skin lesions, and muscle atrophy, which are as- forelimbs. Next, they were pulled slowly backwards until sociated with the accumulation of porphyrin precursors they could no longer hold the grip. The maximal force (5-aminolevulinic acid, porphobilinogen) and porphy- was recorded during consecutive attempts (at least 20 at- rins. Muscle weakness due to porphyria can progress tempts per mouse), and the average was set as the result. and lead to tetraplegia, with respiratory and bulbar par- alysis [13]. ALAS2-overexpressing transgenic mice (Tg Biochemical assays mice) showed obvious muscle atrophy. Jasmin Barman- Serum samples were separated from whole blood by Aksözen et al. found a significant increase in the amount centrifugation at 1,000×g for 10 minutes after the blood Peng et al. Skeletal Muscle (2021) 11:9 Page 3 of 11 was allowed to clot at room temperature for 30 minutes. were captured with the Olympus Bx51 microscope, and The activities of serum lactate dehydrogenase (LDH), fiber diameter was measured by Olympus Element creatine kinase (CK), and creatine kinase-MB (CK-MB) software. were measured by Modular DPP (Roche). Muscle ATP level Processing of tissues for histology For the muscle ATP level, we used a luminometric assay The gastrocnemius and/or quadriceps muscles were with ATP Assay kit (Beyotime) according to the manu- fixed with 4% formalin for at least 36 h. The tissues were facturer’s instructions. embedded in paraffin and cut into 4 μm thick sections in the transverse myofilament direction. Then, the sec- Real-time PCR tions were stained with hematoxylin and eosin (HE), and The muscles were harvested from ALAS2 transgenic and the images were visualized and captured with the wild-type (WT) mice and were frozen immediately in Olympus Bx51 microscope. liquid nitrogen, and then they were stored frozen at – 80 °C. For RNA isolation, the tissue was homogenized in Immunohistochemistry Trizol reagent (Invitrogen) and total RNA was prepared The sections of paraffin-embedded muscle tissue were according to the manufacturer’s protocol. The RNA was deparaffinized in xylene and rehydrated in ethyl alcohol. reverse transcribed into cDNA by High-Capacity cDNA Then, the sections were blocked with 1% hydrogen Reverse Transcription kit (Applied Biosystems). Real- peroxide (H O ) in distilled water for 10 min, and the 2 2 time PCR (RT-PCR) analyses were performed by the non-specific sites were blocked with bovine serum albu- ABI 7500 real-time PCR system (Applied Biosystems). min (BSA, DAKO) for 20 min at room temperature. For The glyceraldehyde-3-phosphate dehydrogenase (GAPD detecting eMyHC, heat-induced antigen retrieval was H) expression was used to normalize the expression performed (Tris/EDTA buffer, pH 8, DAKO) prior to levels. The relative expression values gained were used staining the muscle samples. The sections were then to calculate fold change. The primer sequences are listed incubated overnight at 4 °C with primary antibody of in Table 1 (5′−3′). anti-eMyHC (clone BF-45, mouse, 1:400). The BF-45 monoclonal antibody was obtained from DSHB at the Mitochondrial DNA (mtDNA) content assay University of Iowa in USA. After thorough washing in The muscles were digested and the DNA was isolated PBS, the sections were incubated with biotin-conjugated using the DNeasy Blood and Tissue kit (QIAGEN). The secondary antibodies (DAKO) at 37 °C for 20 min. We mtDNA content was quantified by qRT-PCR using a used a standard peroxidase-based method with DAB SYBR Green-based detection system by the ABI 7500 (DAKO) to detect the antibody. The sections were dehy- real-time PCR system (Applied Biosystems) according to drated with ethyl alcohol and coverslipped with mount- the manufacturer’s protocol in a similar way as the pre- ing medium. The stained sections were imaged using an vious description [20]. The qRT-PCR primer sequences Olympus BX51 microscope. of mtDNA and nucleus DNA were as follows (5′-3′), mtDNA: Forward primer was AAGTCGTAACAAGG Evans blue assay TAAGCA, and Reverse primer was ATATTTGTGT Evans blue assay was performed as described previously AGGGCTAGGG; Nuc.DNA: Forward primer was [18]. Evans blue dye (10 mg/ml) was dissolved in phos- GGGTATATTTTTGATACCTTCAATGAGTTA, and phate buffered saline (PBS). Then, it was filtered sterilely Reverse primer was TCTGAAACAGTAGGTAGAGAC- by a 0.2-μm pore filter. The Evans blue dye was intraper- CAAAGC. itoneally injected into the mouse (0.1 ml/10 g body weight). The mice were killed 24 h after injection. The quadriceps muscle of these killed mice was prepared and Transmission electron microscopy (TEM) observed under the Olympus Bx51microscope. The muscle blocks were prepared and soaked immedi- ately in 2.5% glutaraldehyde. After 6-8 h at 4 °C, they Single-fiber analyses were cut into 1mm thick coronal slices. Next, the sam- Single fibers were isolated and fiber size was measured ples were rinsed with PBS (0.1 M) before being post- as described previously [19]. The quadriceps muscles fixed by osmium tetroxide for 1-2 h. The muscle blocks were fixed with 4% paraformaldehyde (PFA) for more were dehydrated through a graded series of alcohol and than 2 days. Dissected small bundles of fibers were incu- acetone. Subsequently, we used epoxy resin for embed- bated in 40% NaOH for 2-3 h and vigorously shaken. ding prior to slicing of the ultra-thin sections. Then, Isolated myofibers were washed in PBS and stained with double staining by uranyl acetate and lead citrate was 10 μM DAPI. Images of 40-60 single fibers per animal performed. Finally, the images were acquired by a Peng et al. Skeletal Muscle (2021) 11:9 Page 4 of 11 Table 1 Primers table transmission electron microscope (JEM-1220, JEOL Ltd, Results Tokyo, Japan). Reduction of forelimb muscle grip strength in ALAS2 transgenic mice Western blotting As muscle weakness is a clinical manifestation of About 20 mg muscle tissue was lysed in RIPA Lysis porphyria [18, 21, 22], we measured the forelimb muscle Buffer (Beyotime) for 10 minutes on ice. RIPA Lysis grip strength by the automated grip strength meter. Buffer is configured with 20 mM Tris PH7.5, 150 mM Interestingly, we found that ALAS2 transgenic (Tg) mice NaCl, 1% Triton X-100, 2.5 mM sodium pyrophosphate, had reduced forelimb muscle strength compared with 1 mM EDTA, 1%Na VO , 0.5 μg/ml leupeptin, and 1 the age-matched WT littermates (Fig. 1). The data 3 4 mM phenyl methane sulfonyl fluoride (PMSF). The strongly suggest that muscle weakness is present in lysate homogenate was centrifuged at 12,000×g at 4 °C ALAS2 transgenic (Tg) mice. for 5 min. The protein concentration was measured with the DC Protein Assay kit (Bio-Rad Laboratories). Protein Loss of muscle mass in ALAS2 transgenic mice samples were boiled for 10 min in the presence of 4× Tg mice were smaller and thinner than the age-matched Loading Dye. Equal amounts of total proteins (25 μg) WT littermates (data not shown). On visual analysis, were loaded on a 12% SDS-polyacrylamide gel for elec- overall loss of hindlimb muscle mass was clearly evident trophoresis followed by a transfer to PVDF membranes in Tg mice (Fig. 2a). The wet weight of the quadriceps (Millipore) at 70 V for 1 h. The membranes were femoris was approximately half of that in the age- blocked with 5% non-fat powdered milk in PBS (10 mM, matched WT littermates, and this finding was similar to pH 7.4) for 1 h at 4 °C. The blot was incubated with the that in the gastrocnemius muscle (Fig. 2b). As Tg mice primary antibody (GAPDH, 1:2000, Cell Signaling were smaller and thinner, we normalize the wet weight Technology, HO-1, Santa Cruz Biotechnology) overnight of the quadriceps femoris mass by the body weight. The at 4 °C. The membrane was washed three times by results showed that the muscle mass percentage in Tg PBST, followed by incubation with the appropriate mice was lower than that in WT mice (Fig. 2c). The my- secondary antibody. The signal was detected by an osin heavy chain (MHC) mRNA expression was also Enzymatic Chemiluminescence (ECL) kit (Applygen). measured. We found the MHC mRNA level in Tg mice was decreased compared with that in WT mice (Fig. 2d). Statistics The data indicated muscle mass loss in Tg mice. All quantitative data are expressed as means ± SD. Statistical analysis was performed using either Student’s Muscle atrophy in ALAS2 transgenic mice t test (two groups) or one-way analysis of variance (more To determine the cause of loss of muscle mass, HE- than two groups), followed by Bonferroni post hoc test. stained transverse sections of the quadriceps femoris Differences were considered significant at P < 0.05. from age-matched Tg mice and WT mice were Peng et al. Skeletal Muscle (2021) 11:9 Page 5 of 11 Fig. 1 Reduced forelimb muscle grip strength in ALAS2 transgenic mice. Grip strength in ALAS2 transgenic mice (n = 9) and WT mice (n = 8). Values are means ± SD. *P < 0.05;**P < 0.01;***P < 0.001 compared. A high number of muscle fibers with were compared by immunostaining for quadriceps cross centrally located nuclei was found in Tg mice, a primary section from age-matched Tg mice and WT mice at 6 pathological sign of muscular dystrophy [23], but not in months old. Re-expression of eMyHC was only showed in WT mice (Fig. 3a). Moreover, to detect the regeneration the quadriceps of Tg mice, but not in WT mice (Fig. 3b), of the quadriceps in Tg mice, re-expression of eMyHC indicating that the central nucleation determined in Tg Fig. 2 Loss of muscle mass in the ALAS2 transgenic mice. a Left panel: gross morphology of skinned hindlimb muscles of ALAS2 transgenic mice and WT mice. Right panel: comparison of individual muscles. b Comparison of changes in wet weight of individual muscles mass (n =6–7). c Comparison of in wet weight of individual muscles mass normalized to body weight (n =6–7). d The MHC mRNA expression (n =6–7). Values are means ± SD.*P < 0.05; **P < 0.01; ***P < 0.001 Peng et al. Skeletal Muscle (2021) 11:9 Page 6 of 11 Fig. 3 (See legend on next page.) Peng et al. Skeletal Muscle (2021) 11:9 Page 7 of 11 (See figure on previous page.) Fig. 3 Muscle atrophy in the ALAS2 transgenic mice. a Quadriceps cross section from hematoxylin and eosin stain. (bar, 50 μm). b Expression of eMyHC in WT and ALAS2 transgenic mice (Tg) muscle. (Bar of a-c is 50 μm, and bar of d-e 20 μm). c Single-fiber size comparison of WT and ALAS2 transgenic mice quadriceps muscle. d Quantification of average fiber diameter across single fibers in quadriceps muscle from WT (n =4) and ALAS2 transgenic mice (n = 4). e Evans blue dye was intraperitoneal injected and mice sacked 24 h later. Transverse cross-sections of quadriceps muscle were observed with OLYMPUS BX51 equipped with green activation filters. Evans blue-positive fibers are denoted by red staining. Bar, 50 μm. f Serum LDH levels of WT (n = 7) and ALAS2 transgenic mice (n = 6). g Serum CK-MB levels of WT (n = 7) and ALAS2 transgenic mice (n = 6). h The relative mRNA expression of myod1, myogenin, and S6K1 (n =5–8). i The relative mRNA expression of utrophin, dystrophin, Atrogin-1, and MuRF1. Values are means ± SD.*P < 0.05; **P < 0.01; ***P < 0.001 mice muscles resulted from muscle regeneration [24, 25]. energetic failure played an important role in the expres- With respect to single-fiber analyses [19, 26], the average sion of acute intermittent porphyria (AIP) [28]. diameter of single fibers isolated from the muscle of Tg mice was smaller than that isolated from the muscle of Discussion WT mice (Fig. 3c, d). In addition, to examine leakage into ALAS2-overexpressing Tg mice were developed to in- the muscle fiber, Evans blue assay was employed [18, 27]. vestigate the mechanism of porphyria. The expression of The fluorescent dye accumulated in the interior of dystro- ALAS2 was increased in Tg mice [29]. Tg mice showed phied muscle fibers in Tg mice (Fig. 3e). We showed that obvious muscular atrophy, which is also a clinical char- the myocyte membrane was damaged in dystrophied acteristic of porphyria. Therefore, we explored the muscle of Tg mice. Moreover, we detected the activities of mechanism of muscular atrophy in Tg mice. Firstly, we serum CK, CK-MB, and LDH, and we found the elevation found that Tg mice experienced a decrease in muscle of the activity of serum CK-MB and LDH in Tg mice (Fig. mass and grip strength of the forelimb muscles. Sec- 3f, g). We analyzed the expression of the genes, and we ondly, increased activities of serum CK-MB and LDH, found that the expression levels of MyoD1, dystrophin, increased central nuclear fiber and Evans blue positive Atrogin-1, and MuRF1 were decreased, but the expression fiber and decreased single-fiber diameter confirmed level of utrophin was increased. There was no difference muscle atrophy in Tg mice. In addition, Re-expression in myogenin and S6K1 in Tg mice compared with WT of eMyHC was only showed in the quadriceps of Tg mice (Fig. 3h, i). Albertyn CH et al. also described that mice, but not in WT mice, indicating that the central acute intermittent porphyria presenting as progressive nucleation determined in Tg mice muscles resulted from muscular atrophy in a 23-year-old black South African muscle regeneration. Furthermore, the expression levels man [12]. of MyoD1, S6K1 (anabolic factor), atrogin1, and MuRF1 (catabolic factor) were determined. Finally, muscle mito- Mitochondrial dysfunction in the muscle of ALAS2 chondrial dysfunction in ALAS2 Tg mice was detected transgenic mice based on mitochondrial swelling, decline in ATP pro- To test whether muscle dystrophy in Tg mice was duction and mtDNA content, and downregulation of affected by mitochondrial damage, we examined the UCP3 mRNA expression. ultrastructure of muscle fibers using a transmission elec- We found that the muscle grip strength of forelimbs tron microscope. Mitochondrial swelling was found in of Tg mice was decreased. Since muscle mass deter- muscles of Tg mice (Fig. 4a, right), but not in muscles of mines the skeletal muscle strength [30], the loss of WT mice (Fig. 4a, left). Then we compared the mtDNA muscle strength in Tg mice may be caused by the loss of content, uncoupling protein 3 (UCP-3) mRNA expres- muscle mass. The diameter of single fibers of Tg mice sion, and ATP production in the hind limb muscles of was smaller than that of WT mice, and thinner fiber in- Tg mice and age-matched WT mice. The mtDNA con- dicated less muscle mass. MHC is an important part of tent quantified by qRT-PCR [20] was significantly re- the sarcomere [31]. We found that the mRNA level of duced in the gastrocnemius muscle of Tg mice (Fig. 4b). MHC in Tg mice was decreased, which meant that the The muscle UCP-3 mRNA expression was decreased in loss of muscle mass may be caused by the decrease in Tg mice (Fig. 4c). ATP production in the gastrocnemius MHC content. In addition to the decreased muscle mass muscle of Tg mice was decreased to 21% of the level in of atrophic muscles, a large number of muscle fibers age-matched WT mice (Fig. 4d). Interestingly, increased with centrally located nucleus were observed in Tg mice, expression levels of SOD1 mRNA, HO-1 mRNA, and which is a sign of muscle fiber regeneration [32, 33]. We HO-1 protein showed that SOD1 and HO-1 were in- also found that the re-expression of eMyHC was only duced in the muscle of Tg mice (Fig. 4e, f). Above all, showed in the quadriceps of Tg mice, but not in WT mitochondrial dysfunction and loss were present in the mice, confirming that the central nucleation determined muscle of Tg mice. It was reported that mitochondrial in Tg mice muscles resulted from muscle regeneration. Peng et al. Skeletal Muscle (2021) 11:9 Page 8 of 11 Fig. 4 Mitochondrial dysfunction in the ALAS2 transgenic mice muscle. a TEM images of gastrocnemius of WT and ALAS2 transgenic mice. Bars, 2 μm. b mtDNA content in gastrocnemius of WT (n = 8) and ALAS2 transgenic mice (n = 7). c UCP3 expression in quadriceps of WT (n = 8) and ALAS2 transgenic mice (n = 7). d ATP production in gastrocnemius of WT (n = 8) and ALAS2 transgenic mice (n = 8). e The SOD1 and HO-1 mRNA expression(n =5–8). f The HO-1 protein expression (n = 4). Values are means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 TheEvans blue dyecould enterintothe myocyte myocyte of Tg mice suggested that the myocyte through the damaged cytomembrane and get accu- membrane was damaged in Tg mice. Also, increased mulated in the myocyte, and thus, Evans blue dye activities of serum LDH and CK-MB indicated that was used to identify damaged skeletal myofibers [27, the muscular membrane of Tg mice was damaged 34, 35]. Accumulation of Evans blue dye in the [36–38]. The expression of MyoD1 was decreased in Peng et al. Skeletal Muscle (2021) 11:9 Page 9 of 11 Tg mice compared with WT mice. Since muscle mitochondrial damage. A decrease in the ATP production regeneration has been reported to be delayed in was observed in Tg mice, which was probably induced by MyoD (−/−)mice[39], decreased MyoD1 might mitochondrial damage and loss. The pCAGGS expression cause a disturbance in the regeneration in Tg mice. vector can drive EGFP expression in all tissues, except The expression of utrophin was increased and that of erythrocytes and hair in mice, particularly higher in the dystrophin was decreased in Tg mice compared with muscle [53]. Also, Tg mice have ubiquitous overexpres- WT mice, which was similar to that in other dystrophy sion of ALAS-2 in all tissues and higher expression of reports [33, 40]. MAFbx and MuRF1 belong to the ubi- ALAS-2 in the muscle. Moreover, the accumulation of quitin proteasome pathway, which plays a critical role in ALA is much higher in Tg mice than in WT mice. Be- the intracellular protein degradation of skeletal muscle cause ALA is synthesized in the mitochondria and ALA is [41]. Upregulation of atrophy-related genes atrogin-1 a putative endogenous source of ROS [7], ALA might (MAFbX) and MuRF1 in skeletal muscle atrophy has damage the mitochondria of muscle in Tg mice. been reported previously [42, 43]. However, atrogin-1 Porphyrias are a group of eight metabolic disorders of and MuRF1 were downregulated in aging-related loss of the heme biosynthesis pathway [7]. Every porphyria is skeletal muscle [44] and in mTOR-mice [33], and here, caused by abnormal function of a separate enzymatic we also found that atrogin-1 and MuRF1 levels were step, resulting in a specific accumulation of heme pre- decreased in Tg mice. Inhibition of MuRF1 is sufficient cursors, including ALA, PBG, and porphyrins. In some to maintain the MHC [44]. However, MHC in Tg mice cases, muscle atrophy was present in porphyria; how- was decreased, which indicated that the loss of muscle ever, the underlying mechanism is still unknown. mass in Tg mice was not related to activation of the ubi- ALAS2-overexpressing Tg mice also show accumulation quitin proteasome pathway. A previous study showed of ALA, thus it may be a new model of porphyria. In the that chronic spinal cord-injured patients with severe at- future, we will further verify whether ALAS2- rophy of the quadriceps muscles showed a reduction in overexpressing Tg mice can be used as a porphyria atrogin-1 and MuRF1, which suggested an internal model, and we will use this model to investigate the rela- mechanism aimed at reducing the further loss of muscle tionship of mitochondrial dysfunction and porphyria- proteins [45, 46]. The reduction of atrogin-1 and MuRF1 related muscle weakness. in Tg mice may also be a protective attempt to reduce further muscle wasting in muscle atrophy. Conclusion Mitochondrial dysfunction is a hallmark trait that oc- Muscle weakness in ALAS2-overexpressing mice is re- curs during prolonged muscle inactivity in both animals lated to muscle mitochondrial dysfunction induced by and humans. Mitochondrial fission and remodeling con- the accumulation of ALA. tribute to muscle atrophy [47]. Increased superoxide in vivo accelerates age-associated muscle atrophy through Abbreviations ALAS2: Delta-aminolevulinate synthase 2; ALA: Delta-aminolevulinic acid; Tg mitochondrial dysfunction [19]. Mitochondria play an im- mice: Transgenic mice; WT mice: Wild-type mice; ATP: Adenosine portant role in muscle atrophy [19, 47, 48]. It has been re- triphosphate; HE: Hematoxylin and eosin; ROS: Reactive oxygen species; ported that ALA-generated oxidant promotes dysfunction EPP: Erythropoietic protoporphyria; XLPP: X-linked protoporphyria; mtDNA: Mitochondrial DNA; LDH: Lactate dehydrogenase ; CK: Creatine and swelling of the isolated rat liver mitochondria [7]. kinase; CK-MB: Creatine kinase-MB; GAPDH: Glyceraldehyde-3-phosphate Similarly, mitochondrial swelling and mitochondrial cris- dehydrogenase; TEM: Transmission electron microscopy tae reduction were shown in muscles of Tg mice. As Tg mice have high expression of ALAS2 [29] and accumula- Supplementary Information tion of ALA in the muscles (data not shown), mitochon- The online version contains supplementary material available at https://doi. drial damage in the muscle of Tg mice is most likely to be org/10.1186/s13395-021-00263-8. induced by ALA. There is an increase of SOD-1 in the brain, muscle, and liver of chronic ALA-treated rats [8], Additional file 1 : FigS. 1 Overexpresion ALAS-2 in in mouse myoblasts (C2C12). A, The relative mRNA expression of ALAS-2. B, The relative mRNA and thus, we speculate that SOD-1 and HO-1 are induced expression of myod1, myogein and S6K1. C, The relative mRNA expres- by ALA in Tg mice. Increasing of anti-oxidant enzymes sion of utrophin, dystrophin, Atrogin-1 and MuRF1. Values are means ± in Tg mice indicated oxidant existence. As excessive free SD.*P<0.05;**P<0.01;***P<0.001. radicals accelerate muscle proteolysis [12, 49], the pro- oxidizing nature of ALA [50] may lead to the loss of Acknowledgements Not applicable. muscle mass. Previous studies have indicated that exercise induced up-regulation of UCP-3 and downregulation of Authors’ contributions UCP-3 would damage the muscles [51, 52]. Decreased XG, YH, and RH designed the study. YP, JL, DL, SZ, SL, DW, XW, ZZ, XW, and mtDNA content and UCP-3 expression suggested that the CS performed experiments and analyzed data. YP and RH wrote the mitochondrial loss in Tg mice was correlated with manuscript. All authors read and approved the final manuscript. Peng et al. Skeletal Muscle (2021) 11:9 Page 10 of 11 Funding 12. Albertyn CH, Sonderup M, Bryer A, Corrigall A, Meissner P, Heckmann JM. This work was supported by Natural Science Foundation of China (81773165, Acute intermittent porphyria presenting as progressive muscular atrophy in 81671255), Hunan Province Science Fund for Distinguished Young Scholars a young black man. S Afr Med J. 2014;104(4):283–5. (2018JJ1021), the Natural Science Foundation of Hunan Province 13. Puy H, Gouya L, Deybach JC. Porphyrias. Lancet. 2010;375(9718):924–37. (2020JJ5013), and Chinese Scholarship Council Fund for the Visiting Scholars 14. Barman-Aksozen J, Minder EI, Schubiger C, Biolcati G, Schneider-Yin X. In (No. 201908230108). ferrochelatase-deficient protoporphyria patients, ALAS2 expression is enhanced and erythrocytic protoporphyrin concentration correlates with iron availability. Blood Cells Mol Dis. 2015;54(1):71–7. Availability of data and materials 15. Manceau H, Gouya L, Puy H. Acute hepatic and erythropoietic porphyrias: All the data and material could be traced from the paper or can be from ALA synthases 1 and 2 to new molecular bases and treatments. Curr requested from the corresponding author. Opin Hematol. 2017;24(3):198–207. 16. To-Figueras J, Ducamp S, Clayton J, Badenas C, Delaby C, Ged C, Lyoumi S, Declarations Gouya L, de Verneuil H, Beaumont C, et al. ALAS2 acts as a modifier gene in patients with congenital erythropoietic porphyria. Blood. 2011;118(6):1443– Ethics approval and consent to participate The study was approved by the local Ethic Committee. 17. Windahl SH, Andersson N, Borjesson AE, Swanson C, Svensson J, Moverare- Skrtic S, Sjogren K, Shao R, Lagerquist MK, Ohlsson C. Reduced bone mass and muscle strength in male 5alpha-reductase type 1 inactivated mice. Competing interests PLoS One. 2011;6(6):e21402. The authors declare that they have no competing interests. 18. Crosbie RH, Straub V, Yun HY, Lee JC, Rafael JA, Chamberlain JS, Dawson VL, Author details Dawson TM. Campbell KP: mdx muscle pathology is independent of nNOS Department of Biochemistry and Molecular Biology, Harbin Medical perturbation. Hum Mol Genet. 1998;7(5):823–9. University, Harbin 150086, China. Institute of Translational Medicine, National 19. Jang YC, Lustgarten MS, Liu Y, Muller FL, Bhattacharya A, Liang H, Salmon and Local Joint Engineering Laboratory of High-through Molecular AB, Brooks SV, Larkin L, Hayworth CR, et al. Increased superoxide in vivo Diagnostic Technology, the First People’s Hospital of Chenzhou, The First accelerates age-associated muscle atrophy through mitochondrial Affiliated Hospital of Xiangnan University, Chenzhou 423000, China. dysfunction and neuromuscular junction degeneration. FASEB J. 2010;24(5): 3 4 Heilongjiang Academy of Medical Sciences, Harbin 150086, China. Key 1376–90. Laboratory of Preservation of Human Genetic Resources and Disease Control 20. Viader A, Golden JP, Baloh RH, Schmidt RE, Hunter DA, Milbrandt J. in China (Harbin Medical University), Ministry of Education, Beijing 150086, Schwann cell mitochondrial metabolism supports long-term axonal survival China. Department of Clinical Pharmacology, Xiangya Hospital, Central and peripheral nerve function. J Neurosci. 2011;31(28):10128–40. South University, Changsha 410078, China. 21. Cavanagh JB, Mellick RS. On the Nature of the Peripheral Nerve Lesions Associated with Acute Intermittent Porphyria. J Neurol Neurosurg Received: 15 January 2020 Accepted: 2 March 2021 Psychiatry. 1965;28:320–7. 22. Moorhead PJ, Cooper DJ, Timperley WR. Progressive peripheral neuropathy in patient with primary hyperoxaluria. Br Med J. 1975;2(5966):312–3. 23. Wang B, Li J, Xiao X. Adeno-associated virus vector carrying human References minidystrophin genes effectively ameliorates muscular dystrophy in mdx 1. Tchaikovskii V, Desnick RJ, Bishop DF. Molecular expression, characterization mouse model. Proc Natl Acad Sci U S A. 2000;97(25):13714–9. and mechanism of ALAS2 gain-of-function mutants. Mol Med. 2019;25(1):4. 24. Schiaffino S, Rossi AC, Smerdu V, Leinwand LA, Reggiani C. Developmental 2. Riddle RD, Yamamoto M, Engel JD. Expression of delta-aminolevulinate myosins: expression patterns and functional significance. Skelet Muscle. synthase in avian cells: separate genes encode erythroid-specific and 2015;5:22. nonspecific isozymes. Proc Natl Acad Sci U S A. 1989;86(3):792–6. 25. Silva WJ, Graca FA, Cruz A, Silvestre JG, Labeit S, Miyabara EH, Yan CYI, 3. Yamamoto M, Kure S, Engel JD, Hiraga K. Structure, turnover, and heme- Wang DZ. Moriscot AS: miR-29c improves skeletal muscle mass and mediated suppression of the level of mRNA encoding rat liver delta- function throughout myocyte proliferation and differentiation and by aminolevulinate synthase. J Biol Chem. 1988;263(31):15973–9. repressing atrophy-related genes. Acta Physiol. 2019;226(4):e13278. 4. Kolluri S, Sadlon TJ, May BK, Bonkovsky HL. Haem repression of the 26. Wada KI, Takahashi H, Katsuta S, Soya H. No decrease in myonuclear housekeeping 5-aminolaevulinic acid synthase gene in the hepatoma cell number after long-term denervation in mature mice. Am J Physiol Cell line LMH. Biochem J. 2005;392(Pt 1):173–80. Physiol. 2002;283(2):C484–8. 5. Peoc'h K, Nicolas G, Schmitt C, Mirmiran A, Daher R, Lefebvre T, Gouya L, 27. Matsuda R, Nishikawa A, Tanaka H. Visualization of dystrophic muscle fibers Karim Z, Puy H. Regulation and tissue-specific expression of delta- in mdx mouse by vital staining with Evans blue: evidence of apoptosis in aminolevulinic acid synthases in non-syndromic sideroblastic anemias and dystrophin-deficient muscle. J Biochem. 1995;118(5):959–64. porphyrias. Mol Genet Metab. 2019;128(3):190–7. 28. Homedan C, Schmitt C, Laafi J, Gueguen N, Desquiret-Dumas V, Lenglet H, 6. Smith SJ, Cox TM. Translational control of erythroid delta-aminolevulinate Karim Z, Gouya L, Deybach JC, Simard G, et al. Mitochondrial energetic synthase in immature human erythroid cells by heme. Cell Mol Biol. 1997; defects in muscle and brain of a Hmbs-/- mouse model of acute 43(1):103–14. intermittent porphyria. Hum Mol Genet. 2015;24(17):5015–23. 7. Hermes-Lima M, Castilho RF, Valle VG, Bechara EJ, Vercesi AE. Calcium- 29. Huang H, Wang W, Zou J, Liu Z, Zhou Z, Nakajima O, Zhang L, Luo J, Li M, dependent mitochondrial oxidative damage promoted by 5-aminolevulinic He Q, et al. Over-expression 5-aminolevulinic acid synthase 2 in acid. Biochim Biophys Acta. 1992;1180(2):201–6. nonerythroid cell may causes protoporphyrin IX accumulation. 8. Pereira B, Curi R, Kokubun E, Bechara EJ. 5-aminolevulinic acid-induced Photodiagnosis Photodyn Ther. 2017;17:22–8. alterations of oxidative metabolism in sedentary and exercise-trained rats. J 30. Frontera WR, Hughes VA, Lutz KJ, Evans WJ. A cross-sectional study of Appl Physiol. 1992;72(1):226–30. muscle strength and mass in 45- to 78-yr-old men and women. J Appl 9. Yamada T, Ivarsson N, Hernandez A, Fahlstrom A, Cheng AJ, Zhang SJ, Physiol. 1991;71(2):644–50. Bruton JD, Ulfhake B, Westerblad H. Impaired mitochondrial respiration and decreased fatigue resistance followed by severe muscle weakness 31. Derbre F, Ferrando B, Gomez-Cabrera MC, Sanchis-Gomar F, Martinez-Bello in skeletal muscle of mitochondrial DNA mutator mice. J Physiol. 2012; VE, Olaso-Gonzalez G, Diaz A, Gratas-Delamarche A, Cerda M, Vina J. 590(23):6187–97. Inhibition of xanthine oxidase by allopurinol prevents skeletal muscle 10. Powers SK, Wiggs MP, Duarte JA, Zergeroglu AM, Demirel HA. Mitochondrial atrophy: role of p38 MAPKinase and E3 ubiquitin ligases. PLoS One. 2012; signaling contributes to disuse muscle atrophy. Am J Physiol Endocrinol 7(10):e46668. Metab. 2012;303(1):E31–9. 32. Handschin C, Chin S, Li P, Liu F, Maratos-Flier E, Lebrasseur NK, Yan Z, 11. Peker N, Donipadi V, Sharma M, McFarlane C, Kambadur R. Loss of Parkin Spiegelman BM. Skeletal muscle fiber-type switching, exercise intolerance, impairs mitochondrial function and leads to muscle atrophy. Am J Physiol and myopathy in PGC-1alpha muscle-specific knock-out animals. J Biol Cell Physiol. 2018;315(2):C164–85. Chem. 2007;282(41):30014–21. Peng et al. Skeletal Muscle (2021) 11:9 Page 11 of 11 33. Risson V, Mazelin L, Roceri M, Sanchez H, Moncollin V, Corneloup C, Richard- Bulteau H, Vignaud A, Baas D, Defour A, et al. Muscle inactivation of mTOR causes metabolic and dystrophin defects leading to severe myopathy. J Cell Biol. 2009;187(6):859–74. 34. Brussee V, Tardif F, Tremblay JP. Muscle fibers of mdx mice are more vulnerable to exercise than those of normal mice. Neuromuscul Disord. 1997;7(8):487–92. 35. Hamer PW, McGeachie JM, Davies MJ, Grounds MD. Evans Blue Dye as an in vivo marker of myofibre damage: optimising parameters for detecting initial myofibre membrane permeability. J Anat. 2002;200(Pt 1):69–79. 36. Keshgegian AA, Feinberg NV. Serum creatine kinase MB isoenzyme in chronic muscle disease. Clin Chem. 1984;30(4):575–8. 37. Apple FS, McGue MK. Serum enzyme changes during marathon training. Am J Clin Pathol. 1983;79(6):716–9. 38. Siegel AJ, Silverman LM, Evans WJ. Elevated skeletal muscle creatine kinase MB isoenzyme levels in marathon runners. Jama. 1983;250(20):2835–7. 39. White JD, Scaffidi A, Davies M, McGeachie J, Rudnicki MA, Grounds MD. Myotube formation is delayed but not prevented in MyoD-deficient skeletal muscle: studies in regenerating whole muscle grafts of adult mice. J Histochem Cytochem. 2000;48(11):1531–44. 40. Cifuentes-Diaz C, Frugier T, Tiziano FD, Lacene E, Roblot N, Joshi V, Moreau MH, Melki J. Deletion of murine SMN exon 7 directed to skeletal muscle leads to severe muscular dystrophy. J Cell Biol. 2001;152(5):1107–14. 41. Lecker SH, Solomon V, Mitch WE, Goldberg AL. Muscle protein breakdown and the critical role of the ubiquitin-proteasome pathway in normal and disease states. J Nutr. 1999;129(1S Suppl):227S–37S. 42. Lagirand-Cantaloube J, Offner N, Csibi A, Leibovitch MP, Batonnet-Pichon S, Tintignac LA, Segura CT, Leibovitch SA. The initiation factor eIF3-f is a major target for atrogin1/MAFbx function in skeletal muscle atrophy. EMBO J. 2008;27(8):1266–76. 43. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell. 2004;14(3):395–403. 44. Edstrom E, Altun M, Hagglund M, Ulfhake B. Atrogin-1/MAFbx and MuRF1 are downregulated in aging-related loss of skeletal muscle. J Gerontol A Biol Sci Med Sci. 2006;61(7):663–74. 45. Foletta VC, White LJ, Larsen AE, Leger B, Russell AP. The role and regulation of MAFbx/atrogin-1 and MuRF1 in skeletal muscle atrophy. Pflugers Arch. 2011;461(3):325–35. 46. Leger B, Senese R, Al-Khodairy AW, Deriaz O, Gobelet C, Giacobino JP, Russell AP. Atrogin-1, MuRF1, and FoXO, as well as phosphorylated GSK- 3beta and 4E-BP1 are reduced in skeletal muscle of chronic spinal cord- injured patients. Muscle Nerve. 2009;40(1):69–78. 47. Romanello V, Guadagnin E, Gomes L, Roder I, Sandri C, Petersen Y, Milan G, Masiero E, Del Piccolo P, Foretz M, et al. Mitochondrial fission and remodelling contributes to muscle atrophy. EMBO J. 2010;29(10):1774–85. 48. Chen H, Vermulst M, Wang YE, Chomyn A, Prolla TA, McCaffery JM, Chan DC. Mitochondrial fusion is required for mtDNA stability in skeletal muscle and tolerance of mtDNA mutations. Cell. 2010;141(2):280–9. 49. Romanello V, Sandri M. Mitochondrial quality control and muscle mass maintenance. Front Physiol. 2015;6:422. 50. Bechara EJ, Dutra F, Cardoso VE, Sartori A, Olympio KP, Penatti CA, Adhikari A, Assuncao NA. The dual face of endogenous alpha-aminoketones: pro- oxidizing metabolic weapons. Comp Biochem Physiol Toxicol Pharmacol. 2007;146(1-2):88–110. 51. Jones TE, Baar K, Ojuka E, Chen M, Holloszy JO. Exercise induces an increase in muscle UCP3 as a component of the increase in mitochondrial biogenesis. Am J Physiol Endocrinol Metab. 2003;284(1):E96–101. 52. Tsuboyama-Kasaoka N, Tsunoda N, Maruyama K, Takahashi M, Kim H, Ikemoto S, Ezaki O. Up-regulation of uncoupling protein 3 (UCP3) mRNA by exercise training and down-regulation of UCP3 by denervation in skeletal muscles. Biochem Biophys Res Commun. 1998;247(2):498–503. 53. Okabe M, Ikawa M, Kominami K, Nakanishi T. Nishimune Y: ‘Green mice’ as a source of ubiquitous green cells. FEBS Lett. 1997;407(3):313–9. Publisher’sNote Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Journal

Skeletal MuscleSpringer Journals

Published: Mar 30, 2021

There are no references for this article.