Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Genome-wide binding of the basic helix-loop-helix myogenic inhibitor musculin has substantial overlap with MyoD: implications for buffering activity

Genome-wide binding of the basic helix-loop-helix myogenic inhibitor musculin has substantial... Background: Musculin (MSC) is a basic helix-loop-helix transcription factor that inhibits myogenesis during normal development and contributes to the differentiation defect in rhabdomyosarcoma. As one of many transcription factors that impede myogenesis, its binding on a genome-wide scale relative to the widespread binding of the myogenic factor MyoD is unknown. Methods: Chromatin immunoprecipitation coupled to high-throughput sequencing was performed for endogenous MSC in rhabdomyosarcoma cells and its binding was compared to that of MyoD in the same type of cells. Results: MSC binds throughout the genome, in a pattern very similar to MyoD. Its binding overlaps strongly with regions enriched for acetylated histone H4, as well as regions that score high for DNase hypersensitivity in human myoblasts. In contrast to MyoD, MSC has a more relaxed binding sequence preference in the nucleotides that flank the core E-box motif. Conclusions: The myogenic inhibitor MSC binds throughout the genome of rhabdomyosarcoma cells, in a pattern highly similar to that of MyoD, suggesting a broad role in buffering the activity of MyoD in development and rhabdomyosarcomas. Keywords: Rhabdomyosarcoma, musculin, MyoD, myogenic inhibitor Background with a subset of the locations it binds, MyoD binding The advent of high-throughput sequencing coupled to also results in histone acetylation at its binding sites chromatin immunoprecipitation (ChIP-seq) has permit- throughout the genome, demonstrating a biological con- ted the global assessment of DNA binding of numerous sequence of its genome-wide binding [3]. transcription factors. While some factors show a rela- The myogenic activity of MyoD can be inhibited by a tively restricted binding pattern near their regulated variety of transcription factors, including other members genes, others bind widely throughout the genome [1]. of the bHLH protein family [4]. Inhibitory mechanisms The basic helix-loop-helix (bHLH) gene MyoD, a key take a variety of forms, including competition for protein regulator for the specification and differentiation of skel- partners [5,6], the occlusion of MyoD binding sites and etal muscle [2], shows widespread binding at tens of transcriptional repression after DNA binding [7,8], and thousands of genomic locations [3]. In addition to dir- binding to MyoD itself [9]. Musculin (MSC) is a small ectly regulating the transcription of genes associated bHLH inhibitor that functions with a variety of mecha- nisms. Like MyoD, MSC forms heterodimers with * Correspondence: stapscot@fhcrc.org E-proteins. The MSC:E-protein heterodimer binds to Equal contributors E-boxes and inhibits myogenic reporters and MyoD- Human Biology Division, Fred Hutchinson Cancer Research Center, 1100 mediated myogenesis [10]. The activity of MSC is quite Fairview Ave N C3-168, Seattle WA 98109, USA Department of Neurology, University of Washington, Seattle WA 98105, USA complex, however, with a critical role in the specification Full list of author information is available at the end of the article © 2013 MacQuarrie et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 2 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 and survival of cells destined to become a subset of cra- Chromatin immunoprecipitation and ChIP-seq niofacial muscles in mice [11], possibly through regula- Chromatin immunoprecipitation (ChIP) was performed tion of the expression of members of the myogenic in RD cells with an approach that has been described regulatory factor (MRF) family such as MyoD and Myf5 previously [3]. Antibodies used were as follows: MyoD [12]. A similar, crucial role in craniofacial muscle devel- [22], MSC (Santa Cruz, sc-9556X). Quantitative PCR opment has been seen in zebrafish models [13], and the (qPCR) was performed using SybrGreen from Bio-Rad Drosophila ortholog of musculin is required for the spe- on an Applied Biosystems 7900HT. Enrichment was cal- cification of certain gut muscle cells [14]. There is also culated as the percentage of input in samples with anti- evidence that musculin is not restricted to expression in body divided by the percentage of input in matched skeletal muscle and functions to affect the differentiation samples without antibody. Primer sequences for site- of non-myogenic cells [15-17]. Together these studies specific confirmatory ChIP were as follows: A – f: indicate that musculin might have either positive or gcttgatgatgcttgcagaa r: cggagaggatcatgtaactgc; B – f: negative activities in gene transcription depending on a ctggtccctttcaggagaca r: gccgtccatctaaaggtcaa; C – f: aat variety of factors and cellular context. gacaagcactcgcacaa r: atcgagaagttgcgtgcttt; D – f: atctg Recently, we have shown that MSC competes with gaatgccttctgtgg r: attgcctaggaagggacaca; E – f: gcgac MyoD for the available pool of E-proteins in rhabdo- gagctccacatctac r: aggatgcccatgactttgag; F – f: ctcaccatcc myosarcoma cells [18], and that it occludes MyoD bind- gaccaagagt r: ggggtcacgtgtgtatgaga. ing sites, interfering with myogenic activation [19]. Rhabdomyosarcoma (RMS) is a pediatric tumor of skel- Liquid chromatography and mass spectrometry etal muscle that fails to undergo terminal myogenic dif- The isolation of complexes associated with TAP-tagged ferentiation properly. These tumors express MyoD [20] MSC was performed identically to prior experiments and many also express MSC [18]. Since the tumors ap- [18], but MSC-associated complexes were only purified pear to represent an arrested state of development of singly through tobacco etch virus (TEV)-mediated elu- normal muscle cells undergoing the transition from pro- tion. Peptides were digested with trypsin before loading liferative myoblasts to terminally differentiated myotubes on a ThermoFinnigan LTQ FT and undergoing liquid [18,19], this makes RMS cells an ideal system for com- chromatography coupled to tandem mass spectrometry paring the binding of MSC and MyoD and further eluci- (LC-MS/MS). The data were searched using X!Comet. dating the ability of MSC to function as an inhibitor of differentiation. Electrophoretic mobility shift assays We have previously performed ChIP-seq for MyoD in Shift assays were performed as described previously [23]. a cell culture model of embryonal RMS, RD cells [21], Proteins were transcribed and translated in vitro from and we now report a genome-wide assessment of MSC CS2-based plasmids using a rabbit reticulocyte lysate kit binding in RD cells. Strikingly, MSC binds widely (Promega). Probe sequences were as follows (forward se- throughout the genome, in an overlapping but non- quences only listed, reverse complement sequences not identical pattern to MyoD, reflecting an overlapping but shown): MSC-specific: cggccgaccagctggagatcct; -1 pos- not identical E-box sequence specificity. The substantial ition mutation (mut): cggccgagcagctggagatcct; -1/+1 pos- direct overlap of MSC and MyoD sites together with the ition mut: cggccgagcagctgcagatcct; MSC-specific T mut: close proximity of many MSC- and MyoD-specific sites cggccgtccagctggagatcct; -1/+1 T mut: cggccgtgcagctgca- suggests that MSC has the potential for broadly modu- gatcct; CG E-box: cggccgaccacgtggagatcct; B1: lating MyoD activity in normal development and in gatccccccaacacctgctgcctga. rhabdomyosarcomas. Peak calling Sequences were extracted by GApipeline-0.3.0. Reads Methods mapping to the X and Y-chromosomes were excluded Cell culture and construct preparation from our analysis. Reads were aligned using BWA to the RD cells were obtained from the American Type Culture human genome (hg19). Duplicate sequences were dis- Collection (ATCC), and all analyses were performed on carded to minimize the effects of PCR amplification. cells that originated from low passage number frozen ali- Each read was extended in the sequencing orientation to quots. RD cells were maintained in DMEM with 10% a total of 200 bases to infer the coverage at each gen- bovine calf serum and 1% Pen-Strep (Gibco). MSC with omic position. Peak calling was performed by an in- a tandem affinity purification (TAP) tag was constructed house developed R package, which models background by cloning the coding sequence for MSC in-frame with a reads by a negative binomial distribution as previously TAP-tagged pBabe plasmid so that the TAP tag is N- described [24]. Peaks in the MyoD and MSC samples terminal to MSC. that overlapped with peaks in the RD no antibody cell- MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 3 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 -5 type specific control sample at a P value cutoff of 10 in intergenic regions. A number of sites identified as be- were removed from the analysis. ing specifically and strongly enriched for either MyoD or MSC by ChIP-seq were tested with biologically inde- Motif analysis pendent site-specific ChIP, and factor-specific enrich- We applied an in-house developed Bioconductor pack- ment in agreement with the ChIP-seq data found at all age motifRG for discriminative de novo motif discovery sites (Additional file 1: Figure S1). as previously described [3,25]. To find discriminative MSC heterodimerizes with E-proteins to bind to E- motifs for MSC-specific peaks, we selected MSC-specific boxes [10], and we have previously shown by LC-MS/ and MSC- and MyoD-shared peaks. Specific peaks were MS that the E-protein E12 associates with MSC in RD defined as peaks present for one transcription factor cells, while MyoD does not associate with MSC [18]. To -10 with a P value cutoff of 10 and absent for the other further confirm that the ChIP-seq data represent distinct -4 with a P value cutoff of 10 . Shared peaks were present MyoD or MSC bHLH dimers, a TAP-tagged MSC was -10 for both factors with a P value cutoff of 10 . created. This was shown to maintain biological activity as measured by its ability to repress myogenic reporters P value peak overlap analysis and bind E-boxes in electrophoretic mobility shift assays We adopted a nonparametric rank-based paradigm to (EMSAs) (data not shown). The tagged MSC was then compare two ChIP-seq samples as previously described introduced stably into RD cells through retroviral trans- [24]. We ranked all peaks by their P values and grouped duction and MSC-associated complexes pulled down ranks into bins of 3,000 (that is, the top 3,000 peaks, and subjected to LC-MS/MS. As expected, all E-proteins then the top 6,000 peaks, and so on). Then we computed were found to associate with MSC, while there was no the fraction of top x peaks in a sample that overlap with indication of a MSC: MyoD interaction (Additional file the top y peaks in another sample, where x and y vary 2: Table S1). from 3,000 to 30,000, and y is equal to or greater than x. A motif analysis of the binding site preferred by MSC found strong enrichment for binding at a GC core Results E-box (Figure 1A, top), one of the two E-box cores we Musculin and MyoD have overlapping, but non-identical, previously identified as being preferred by MyoD genome-wide binding patterns (Figure 1A, bottom). In contrast to MyoD, MSC exhibits To compare the binding pattern of the bHLH myogenic a strong nucleotide preference for a ‘G’ at the first inhibitor MSC to that of the myogenic activator MyoD, nucleotide after the E-box (CAGCTGG), designated ChIP-seq for endogenous MSC was performed in RD position +1 relative to the E-box. Also notable was a dif- cells under growth conditions. MSC binds at a compar- ference in the sequences enriched at the two positions able number of sites as MyoD and with a similar gen- immediately before the E-box, designated positions −1 omic distribution, although there was a slightly greater and −2relativetothe E-box.We havepreviouslyshown enrichment of MSC binding in the region surrounding that MyoD:E and NeuroD2:E heterodimers show a the transcription start site (TSS) compared to MyoD flanking preference for G or A in the −1and −2posi- (Table 1), possibly reflecting the GC-rich nature of pro- tions [3,24], whereas the MSC motif does not demon- moters and the preferred MSC E-box (see below). As strate a similarly strong preference at these positions with MyoD, MSC was found to bind widely at regions (Figure 1A, positions 2 and 3). outside of those generally thought of as gene related, As anticipated from the motif analysis, MyoD and binding to a high degree (approximately 40% of all sites) MSC showed overlapping but not identical binding Table 1 Number and genomic location of musculin and MyoD ChIP-seq peaks in RD cells Factor Number of peaks Genomic location (fraction of peaks) b c d e f g h P value cutoff Promoter Proximal promoter 3 Prime Exon Intron Upstream Downstream Intergenic -5 -7 -10 10 10 10 Musculin 54901 39036 25688 0.165 0.231 0.029 0.204 0.563 0.209 0.170 0.423 MyoD [21] 50320 35203 24501 0.110 0.175 0.027 0.154 0.560 0.187 0.164 0.405 The fraction of MyoD and musculin peaks found in each listed type of genomic region are given. Note that categories are not mutually exclusive, and a single peak may be included in multiple categories. Three P value cutoffs were used to evaluate whether ChIP-seq reads are considered a ‘peak’ and included in the count of the total number of peaks. +/−500 bp from the transcription start site (TSS). +/−2 kb from the TSS. +/−500 nucleotides from the end of the transcript. –2kbto −10 kb upstream of the TSS. +2 kb to +10 kb from the end of the transcript. >10 kb from any annotated gene. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 4 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 Figure 1 MSC has similar, but non-identical, DNA binding characteristics to MyoD and binds at many of the same genomic locations. (A) E-box motif enrichment of MSC and MyoD bound sites in RDs identifies a similar preference for central dinucleotide identity (GC and GG), but differing preferences in the E-box flanking nucleotides. (B) Comparison of the top 30,000 MyoD and MSC peaks in RDs demonstrates substantial overlap in the sites bound by each factor. Peaks were ranked by P value, and grouped into bins that increase by 3,000 peaks each time (that is, first the 3,000 most significant peaks are considered, than the 6,000 most significant, and so on). The fraction of the overlap is indicated by color, as depicted in the legend. (C) De novo motif analysis of peaks specific to MSC identifies an 8 bp motif (row 2) enriched at MSC-specific binding sites. The motif analysis compared MSC-specific binding sites to those sites that bound both MyoD and MSC. bp, base pair; fg.frac, bg.frac: fraction of foreground/background sequences that contain at least one motif occurrence; MSC, musculin; ratio, enriched/depleted ratio of motifs. locations in the genome. MyoD and MSC peaks were motif of CCAGCTGG (Figure 1C). Examination of the assigned to sequential cumulative bins of 3,000 peaks ChIP-seq data at specific loci identified sites bound only based on rank by P value and the percentage overlap by one of the factors, sites bound by both factors in an ranged from approximately 40% to 80% (Figure 1B). A apparently identical pattern, and sites bound by each motif analysis of sites that were found to bind only MSC factor in closely overlapping but non-identical binding (MSC-specific) in comparison to sites bound either patterns (Figure 2). The closely overlapping but distinct solely by MyoD (MyoD-specific) or by both MyoD and patterns suggests each factor is binding to a distinct E- MSC (shared) identified a strong enrichment for C at box in the region; however, this is identified as an ‘over- the −1 position and G at the +1 position, giving an 8-bp lap’ in the analysis shown in Figure 1B. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 5 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 Figure 2 MyoD and MSC bind at unique identical and overlapping but non-identical sites in the genome. MSC and MyoD have both unique and overlapping binding patterns at various sites in the genome. Screenshots are shown from the UCSC Genome browser for MyoD and MSC ChIP-seq results at four distinct genomic locations (indicated below each panel, representing positions in hg19). The identity of the bHLH factor is indicated along the left, and E-boxes are represented as black marks along the bottom of each panel. Note that the number of MyoD reads in the ‘MSC only’ panel is five, in contrast to 298 reads for MSC, and are not centered on an E-box, and thus do not likely represent true MyoD binding. bHLH, basic helix-loop-helix; ChIP-seq, chromatin immunoprecipitation coupled to high-throughput sequencing; MSC, musculin. Musculin binding is enriched at DNase hypersensitive to a TSS (<2 kb from the nearest TSS) (P value of the genomic regions and regions with higher levels of difference between MSC-specific and MyoD-specific -45 histone acetylation peaks: 1 × 10 , P value for MSC-specific versus shared -7 We have previously shown that MyoD binding induces peaks: 1 × 10 ) (Figure 3B). MSC binding did not cor- histone acetylation at binding sites throughout the gen- relate, either positively or negatively, with genes that we ome [3]. To test the hypothesis that the genome-wide have previously identified as being differentially regu- binding of MSC might inhibit acetylation in either a glo- lated in RD cells compared to normal myogenic cells bal manner or at some subset of MyoD-bound locations, [21] (data not shown). we performed ChIP-seq for acetylated histone H4 Given the lack of a global effect on gene expres- (AcH4) from RD cells under conditions similar to the sion, we hypothesized that the association with AcH4 MyoD and MSC ChIP-seq data. AcH4 enrichment was might simply reflect binding of MSC at regions of examined at peaks identified as MSC-specific, MyoD- open chromatin. The MyoD-specific, MSC-specific specific and shared. Surprisingly, the highest levels of and shared peaks in the RD cells were compared to AcH4 enrichment showed a stronger association with publicly available DNase hypersensitivity data from MSC peaks, both MSC specific and shared (Figure 3A). human myoblasts. Shared peaks had the highest This trend became even more evident when peaks were proportion of peaks that overlapped with DNase grouped based on distance from the nearest gene TSS. hypersensitive sites (shared: approximately 80%, While MyoD-specific peaks showed essentially identical MSC-specific: approximately 70%, MyoD-specific: ap- AcH4 enrichment regardless of their location relative to proximately 50%) (Figure 3C), and this relation held a TSS, MSC-specific and shared peaks showed a strong across the entire range of hypersensitive values shift to higher AcH4 enrichment at peaks located closer (Additional file 3: Figure S2A). MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 6 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 Figure 3 MSC binding is associated with open chromatin. (A) Sites bound by MyoD and MSC are associated with acetylated histones. ChIP-seq for acetylated histone H4 (AcH4) was performed in RD cells and density plots constructed to compare the square root of the AcH4 value at all sites bound by MSC, MyoD or both factors. (B) MSC-specific and MyoD/MSC shared peaks are associated with higher levels of AcH4 near the transcription start site (TSS) of genes compared to MyoD-specific peaks. Density plots were constructed as in (A) for categories of peaks first split by peak identity (MyoD, MSC, shared), then subcategorized on distance from the nearest TSS. (C) Sites bound by MSC in RD cells overlap with DNase hypersensitive (HSS) sites in normal human myoblasts. Publicly available DNase HSS data from human myotubes were compared to the sites bound by MyoD and MSC in RD cells. Data for each factor category (for example, MSC-specific) are plotted as the fraction of peaks that overlap with locations that have a signal in the HSS data (that is, the graphed fraction = 1 – fraction of peaks at HSS score of ‘0’). AcH4, acetylated histone H4; bHLH, basic helix-loop-helix; ChIP, chromatin immunoprecipitation; ChIP-seq, chromatin immunoprecipitation coupled to high- throughput sequencing; HSS, hypersensitive; K, thousands of bp; MSC, musculin; TSS, transcription start site. MyoD-specific peaks seemed to have a surprisingly lying in HSS regions in the primary muscle cell dataset. low level of association with hypersensitive sites, but Taken as a whole, the above data identify MSC binding subcategorizing the MyoD-specific peaks based on as largely occurring in the context of areas of open and whether they were unique to RD cells, or common to accessible chromatin. RDs and human myotubes [21] revealed that common peaks were generally associated with hypersensitive sites, Musculin dimers have less restrictive binding site and peaks unique to RDs were not (Additional file 3: preferences at flanking nucleotides than MyoD dimers Figure S2B). We have previously shown that differences Electrophoretic mobility shift assays with in vitro trans- in MyoD binding between myotubes and RD cells can lated proteins were performed to further investigate the be correlated with differences in E-box accessibility be- sequence preference of MyoD and MSC dimers using tween the cell types [21]. This suggests that the MyoD the sequence from a MSC-specific peak at the SKI gene peaks specific to RMS, that is, not present in primary that contained the MSC-specific consensus 8-bp motif skeletal muscle cells, represent binding by MyoD to E- (CCAGCTGG). Shifts comparing binding of MyoD:E boxes that are normally inaccessible to bHLH binding in and MSC:E heterodimers demonstrated that MSC het- primary muscle cells and were therefore not identified as erodimers could bind to the 8-bp motif or a probe in MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 7 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 which the −1 position was changed from a ‘C’ to a ‘G’ and +1 (‘G’ to ‘C’) had been changed (−1/+1 mut) still (−1 mut), making it more reflective of the core MSC occurred, but at reduced levels (Figure 4A, compare motif from Figure 1A (Figure 4A, compare lane 4 to 5). lanes 4 and 5 to 6). In contrast, the ability of MyoD:E Binding of MSC to a probe in which both −1(‘C’ to ‘G’) heterodimers to form complexes improved as the probe Figure 4 MSC dimers have relaxed requirements for flanking sequence compared to MyoD dimers. (A) MyoD homodimers and MyoD:E- protein heterodimers do not bind well to MSC-specific sequences, but bind after a small number of sequence changes. Electrophoretic mobility shift assays (EMSAs) were performed using in vitro translated proteins and probes as indicated. The asterisks indicate the location of what are, judging by their relative mobility, small amounts of E-protein homodimers. (B) MSC heterodimers can be competed off a preferred binding site equally well by competitors with variations in their flanking sequence, while MyoD heterodimers cannot. MyoD:E and MSC:E heterodimers were subjected to competition by excesses of cold probes as indicated. 25× and 50× refer to the excess mass of cold probe relative to hot probe. Variations in competitor sequences are indicated, and ‘CG Ebox’ refers to a probe with an inverted central dinucleotide sequence that abolishes all binding of MyoD and MSC. (C) Single nucleotide changes in flanking sequence can completely abrogate MyoD dimer binding, but still be per- missive of MSC dimer binding. Shift assays were performed using proteins and probes as indicated. Each type of dimer combination was run in two lanes, with one lane having a probe with ‘A’ in the −2 position relative to the E-box, and the other lane having a probe with ‘T’ in that position, as indicated in red. All shifts were performed using a sufficient excess of probe so that visible free probe was present for all lanes (not shown in 4A and 4B). All probe counts were quantitated before addition to ensure there were roughly equivalent amounts in all compared lanes. Negative control lanes indicate lanes where probes were tested with an in vitro translated empty CS2 vector to identify any non-specific binding. EMSA, electrophoretic mobility shift assay; MSC, musculin. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 8 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 was shifted away from the 8-bp MSC motif (Figure 4A, translated proteins, and thus would not reflect the effect compare lane 10 to 12). Taken together with the motif of any post-translational modifications that may occur analysis identifying the differences at positions −1 and in vivo. However, the in vitro binding preferences reflect −2, this suggests that the sequence preference for dimer those preferences seen in the in vivo ChIP-seq results. binding is more stringent for dimers containing MyoD Additionally, work with other bHLH factors has demon- than those containing MSC, even with a common dimer strated excellent correlation between binding sites iden- partner. Similar results were observed with homodimers tified by ChIP-seq and binding seen with EMSA [24]. of both MSC and MyoD, though both types of homodi- Overall, the broad overlap of MyoD and MSC binding mers formed more weakly compared to their heterodi- indicates a potential for MSC to buffer the binding and mer counterparts (Figure 4A, compare lane 1 to 3 and 7 activity of MyoD broadly, as well as other E-box binding to 9, data not shown). factors. To further test this hypothesis, competition assays We have previously shown that MSC can inhibit were performed on MSC and MyoD heterodimers. As MyoD-mediated activation of myogenic targets by oc- expected, MSC was competed off the MSC-specific 8-bp cluding specific E-boxes [19], in addition to competing motif equally well by cold competitors with the consen- for a limiting pool of E-proteins [18]. We have proposed sus 8-bp motif, –1 mut, or −1/+1 mut (Figure 4B, left that this activity controls the growth-versus- panel, compare lanes 3 and 4 to 5 and 6, and to 7 and differentiation decision point in myogenic cells, serving 8), suggesting relatively similar affinity. MSC was not as a component of interlocking oscillating regulatory cir- competed with a sequence in which the core nucleotides cuits that keep myogenic cells balanced between prolif- of the E-box were inverted to a ‘CG’ from ‘GC’ eration and terminal differentiation [19]. (Figure 4B, left panel, compare lanes 9 and 10 to 2), dem- This model suggests that the relationship between onstrating sequence specificity of the competition assays. bHLH proteins and target sites is highly dynamic, in In contrast, MyoD heterodimers were only effectively which dimers form and dissociate, from both their pro- competed by sequences at which it had formed visible tein partners and DNA binding sites, resulting in a fluc- complexes (Figure 4B, right panel, compare lanes 16 and tuating expression of gene targets. In turn, some subset 17 to 12 and 13, and to 14 and 15), and even a single of such targets feed back on the process to regulate nucleotide change had a notable impact on competition growth and differentiation appropriately. MSC has a very (compare −1/+1 mut to −1 mut). As with MSC, MyoD:E similar core binding motif as MyoD dimers but a greater heterodimers failed to form on the CG core E-box (data degree of flexibility for flanking nucleotides, which could not shown). reflect a lower need for tight regulation of the specific E- In addition to the relaxed preference at the positions boxes MSC can bind to compared to MyoD and be the immediately flanking the E-box, relative to MyoD, MSC mechanism by which MSC acts to broadly sequester E- also exhibited a sharp difference in response to sequence proteins and occupy potential MyoD binding sites. changes at the −2 position. The inclusion of a ‘T’ at the −2 Other factors have also been suggested as having an in- position is permissive for MSC heterodimer binding hibitory function during myogenesis by binding at E- (Figure 4C, compare lane 3 to 4), but absolutely abolishes boxes [26,27], further potentially increasing the complex binding of MyoD heterodimers (Figure 4C, compare lane nature of the interplay occurring at bHLH binding sites. 7 to 8), with similar results seen with the homodimers The similar core motif requirements for MyoD and (Figure 4C, compare lane 1 to 2 and 5 to 6). MSC ensure that MSC binds at many sites regulated by MyoD, and the +1 ‘G’ preference of the MSC motif in- Discussion creases the likelihood of it targeting E-boxes located in Our genome-wide comparison of the DNA binding GC-rich gene promoter regions. While the gene regula- characteristics of MyoD and MSC reveals that, even tion analysis did not identify a global role in gene sup- though MSC is one of multiple myogenic inhibitors and pression, MSC does modulate MyoD activity at the might be expected to bind at only a subset of all MyoD myogenic microRNA miR-206 [19], and it may have a binding locations, it binds at a comparable number of similar role at many other MyoD regulated genes, an ef- sites as MyoD, with a similar, but non-identical binding fect that would not be discernible with our current site preference. Even though MSC heterodimerizes with analysis. This model also offers possible insight into the ability the same E-proteins as MyoD and shares the same se- quence preference at the central dinucleotide of E- of MSC to serve apparently as either a positive or nega- boxes, it has less sequence preference for the positions tive regulator of transcription. With a component of MSC’s repressive activity appearing to be through inter- that flank E-boxes than other bHLH dimers we have re- ported [3,24]. It should be noted that the electrophoretic ference with DNA binding by other bHLH factors, MSC mobility shift assays were performed using in vitro activity could be substantially different depending on the MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 9 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 individual cellular context, potentially interfering with Screenshots are from the UCSC genome browser, and the identity of the the binding of inhibitory complexes. It is not known factor used in the ChIP, and the number of reads at the peak of occu- pancy are indicated along the side. ChIP, chromatin immunoprecipitation; what histone modification enzymes MSC might recruit, ChIP-seq, chromatin immunoprecipitation coupled to high-throughput nor is it clear how MSC activity would differ depending sequencing; MSC, musculin. on the extent of competition by other bHLH proteins Additional file 2: Table S1. LC-MS/MS identification of MSC-associated for binding partners and sites, and these additional pa- transcription factors in RD cells. rameters might contribute to a context-specific ability to Additional file 3: Figure S2. MSC binds sites associated with DNase hypersensitivity, and MyoD peaks found only in RD cells, not in normal serve as a positive or negative regulator. myotubes, are associated with areas identified in myotubes as DNase- Both the finding that MSC is associated with regions resistant. (A) Shared MyoD and MSC binding peaks are associated enriched for acetylated histone H4 in RD cells and strongly with DNase hypersensitive (HSS) sites in human myoblasts. The overlap between ChIP-seq peaks and HSS data is graphed for the entirety DNase hypersensitive sites in normal myotubes suggests of the range of HSS values. Values for a DNase signal of ‘0’ are equal to 1 MSC generally binds at areas of open chromatin. It is – the fraction graphed in Figure 3C. The data are plotted as a cumulative unclear at this point why the notable enrichment is seen distribution function, where a value on the y-axis represents the fraction of data that has a value equal to or less than the corresponding x-axis at sites closest to transcription start sites (<2 kb), though DNase HSS value. (B) MyoD-specific sites bound by MyoD only in RD cells, it is possible that part of this enrichment is due to the and not in human myotubes, overlap poorly with HSS sites in human GC-rich nature of promoters and the binding site prefer- myotubes. The MyoD-specific peaks from Figure 3C and (A) were further grouped into those peaks that were found both in RD cells and normal ence of MSC for an additional flanking ‘G’ compared to human myotubes (RD/myotube shared), and those found only in RD cells MyoD (Figure 1). While an effect by MSC on histone (RD-specific). As in Figure 3C, the data for each category (for example, acetylation cannot be formally ruled out, mass spectrom- RD-specific) are plotted as the fraction of peaks that overlap with sites that have some signal in the HSS data (that is, the graphed fraction = 1 – etry data did not identify any association with histone fraction of peaks at HSS score of ‘0’). ChIP-seq, chromatin immunoprecipi- acetyltransferases (KLM, unpublished observations), sug- tation coupled to high-throughput sequencing; HSS, hypersensitive; MSC, gesting that, in skeletal muscle cells, MSC is opportunis- musculin. tic in binding to areas of open chromatin, rather than Abbreviations instructing changes in chromatin structure. This would AcH4: acetylated histone H4; bHLH: basic helix-loop-helix; bp: base pair; be consistent with the model proposed above, serving to ChIP: chromatin immunoprecipitation; ChIP-seq: chromatin assist MSC acting in a role as a dynamic competitor of immunoprecipitation coupled to high-throughput sequencing; EMSA: electrophoretic mobility shift assay; HSS: hypersensitivity; kb: kilobase; MyoD function in the differentiation of skeletal muscle. LC-MS/MS: liquid chromatography coupled to tandem mass spectrometry; MRF: myogenic regulatory factor; MSC: musculin; mut: mutation; qPCR: quantitative PCR; RMS: rhabdomyosarcoma; TAP: tandem affinity Conclusions purification; TEV: tobacco etch virus; TSS: transcription start site. The myogenic bHLH inhibitor musculin binds widely throughout the genome in RD rhabdomyosarcoma cells Competing interests The authors declare they have no potential competing interests. and has a broadly overlapping, but non-identical, set of binding sites and peaks as MyoD. Compared to the pre- Authors’ contributions ferred MyoD E-box sequence, MSC has slightly less KLM contributed to all experimental designs, performed all non- computational experiments and drafted the manuscript. ZY performed the stringency for flanking sequence preference, permitting ChIP-seq and all other computational analyses and contributed to both ex- binding to a slightly broader set of E-boxes and poten- perimental design and data interpretation. APF performed the RD cell-type tially overlapping with other bHLH factors. Together control ChIP-seq. SJT conceived the project, contributed to all experimental designs and edited the manuscript. All authors read and approved the final with prior studies showing the ability of MSC to modu- manuscript. late MyoD activity at overlapping sites at specific pro- moters, these results suggest a broad potential for MSC Acknowledgements KLM was supported by a Developmental Biology Predoctoral Training Grant to modulate the activity of MyoD, and perhaps other (T32HD007183). ZY was supported by the NIH Interdisciplinary Training Grant bHLH proteins, during normal development and in in Cancer Research (T32CA080416). APF was supported by a grant from the cancers. University of Washington Child Health Research Center (NIH U5K12HD043376-10) and Hyundai Hope on Wheels. SJT was supported by NIH NIAMS (R01AR045113). Additional files Author details Human Biology Division, Fred Hutchinson Cancer Research Center, 1100 Additional file 1: Figure S1. MyoD and MSC site-specific ChIP confirms Fairview Ave N C3-168, Seattle WA 98109, USA. Molecular and Cellular the ChIP-seq results. Biologically independent site-specific ChIP was per- Biology Program, University of Washington, Seattle WA 98105, USA. Clinical formed at three sites indicated by the ChIP-seq to be MyoD-specific bind- Research Division, Fred Hutchinson Cancer Research Center, Seattle WA ing sites, three sites indicated as MSC-specific, and one control location 98109, USA. Department of Pediatrics, University of Washington School of with no significant binding of either factor, as indicated by both the chart Medicine, Seattle WA 98105, USA. Department of Neurology, University of and the screenshots. The enrichment was calculated for each location as Washington, Seattle WA 98105, USA. the percentage of input amplified in qPCR with antibody divided by the percentage of input amplified with no antibody, and the value is indi- Received: 17 March 2013 Accepted: 10 October 2013 cated at the top of each bar. Note that the y-axis is non-linear. Published: 1 November 2013 MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 10 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 References 22. Tapscott SJ, Davis RL, Thayer MJ, Cheng PF, Weintraub H, Lassar AB: MyoD1: 1. MacQuarrie KL, Fong AP, Morse RH, Tapscott SJ: Genome-wide a nuclear phosphoprotein requiring a Myc homology region to convert transcription factor binding: beyond direct target regulation. Trends fibroblasts to myoblasts. Science 1988, 242:405–411. Genet 2011, 27:141–148. 23. Davis RL, Cheng PF, Lassar AB, Weintraub H: The MyoD DNA binding 2. Davis RL, Weintraub H, Lassar AB: Expression of a single transfected cDNA domain contains a recognition code for muscle-specific gene activation. converts fibroblasts to myoblasts. Cell 1987, 51:987–1000. Cell 1990, 60:733–746. 3. Cao Y, Yao Z, Sarkar D, Lawrence M, Sanchez GJ, Parker MH, MacQuarrie KL, 24. Fong AP, Yao Z, Zhong JW, Cao Y, Ruzzo WL, Gentleman RC, Tapscott SJ: Davison J, Morgan MT, Ruzzo WL, Gentleman RC, Tapscott SJ: Genome- Genetic and epigenetic determinants of neurogenesis and myogenesis. wide MyoD binding in skeletal muscle cells: a potential for broad cellular Dev Cell 2012, 22:721–735. reprogramming. Dev Cell 2010, 18:662–674. 25. Palii CG, Perez-Iratxeta C, Yao Z, Cao Y, Dai F, Davison J, Atkins H, Allan D, Dilworth FJ, Gentleman R, Tapscott SJ, Brand M: Differential genomic tar- 4. Berkes CA, Tapscott SJ: MyoD and the transcriptional control of geting of the transcription factor TAL1 in alternate haematopoietic line- myogenesis. Semin Cell Dev Biol 2005, 16:585–595. ages. EMBO J 2011, 30:494–509. 5. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H: The protein Id: a 26. Genetta T, Ruezinsky D, Kadesch T: Displacement of an E-box-binding re- negative regulator of helix-loop-helix DNA binding proteins. Cell 1990, pressor by basic helix-loop-helix proteins: implications for B-cell specifi- 61:49–59. city of the immunoglobulin heavy-chain enhancer. Mol Cell Biol 1994, 6. Spicer DB, Rhee J, Cheung WL, Lassar AB: Inhibition of myogenic bHLH 14:6153–6163. and MEF2 transcription factors by the bHLH protein Twist. Science 1996, 27. Soleimani VD, Yin H, Jahani-Asl A, Ming H, Kockx CE, van Ijcken WF, Grosveld 272:1476–1480. F, Rudnicki MA: Snail regulates MyoD binding-site occupancy to direct 7. St-Pierre B, Flock G, Zacksenhaus E, Egan SE: Stra13 homodimers repress enhancer switching and differentiation-specific transcription in myogen- transcription through class B E-box elements. J biol chem 2002, esis. Mol Cell 2012, 47:457–468. 277:46544–46551. 8. Lemercier C, To RQ, Carrasco RA, Konieczny SF: The basic helix-loop-helix doi:10.1186/2044-5040-3-26 transcription factor Mist1 functions as a transcriptional repressor of Cite this article as: MacQuarrie et al.: Genome-wide binding of the basic myoD. EMBO J 1998, 17:1412–1422. helix-loop-helix myogenic inhibitor musculin has substantial overlap 9. Hamamori Y, Wu HY, Sartorelli V, Kedes L: The basic domain of myogenic with MyoD: implications for buffering activity. Skeletal Muscle 2013 3:26. basic helix-loop-helix (bHLH) proteins is the novel target for direct inhib- ition by another bHLH protein, Twist. Mol Cell Biol 1997, 17:6563–6573. 10. Lu J, Webb R, Richardson JA, Olson EN: MyoR: a muscle-restricted basic helix-loop-helix transcription factor that antagonizes the actions of MyoD. Proc Natl Acad Sci USA 1999, 96:552–557. 11. Lu J-R, Bassel-Duby R, Hawkins A, Chang P, Valdez R, Wu H, Gan L, Shelton JM, Richardson JA, Olson EN: Control of facial muscle development by MyoR and capsulin. Science 2002, 298:2378–2381. 12. Moncaut N, Cross JW, Siligan C, Keith A, Taylor K, Rigby PW, Carvajal JJ: Musculin and TCF21 coordinate the maintenance of myogenic regulatory factor expression levels during mouse craniofacial development. Development 2012, 139:958–967. 13. Lee GH, Chang MY, Hsu CH, Chen YH: Essential roles of basic helix-loop- helix transcription factors, capsulin and musculin, during craniofacial myogenesis of zebrafish. Cell Mol Life Sci 2011, 68:4065–4078. 14. Ismat A, Schaub C, Reim I, Kirchner K, Schultheis D, Frasch M: HLH54F is required for the specification and migration of longitudinal gut muscle founders from the caudal mesoderm of Drosophila. Development 2010, 137:3107–3117. 15. Hishikawa K, Marumo T, Miura S, Nakanishi A, Matsuzaki Y, Shibata K, Ichiyanagi T, Kohike H, Komori T, Takahashi I, Takase O, Imai N, Yoshikawa M, Inowa T, Hayashi M, Nakaki T, Nakauchi H, Okano H, Fujita T: Musculin/ MyoR is expressed in kidney side population cells and can regulate their function. J Cell Biol 2005, 169:921–928. 16. Yu L, Sangster N, Perez A, McCormick PJ: The bHLH protein MyoR inhibits the differentiation of early embryonic endoderm. Differentiation 2004, 72:341–347. 17. Yu L, Mikloucich J, Sangster N, Perez A, McCormick PJ: MyoR is expressed in nonmyogenic cells and can inhibit their differentiation. Exp Cell Res 2003, 289:162–173. 18. Yang Z, MacQuarrie KL, Analau E, Tyler AE, Dilworth FJ, Cao Y, Diede SJ, Tapscott SJ: MyoD and E-protein heterodimers switch rhabdomyosar- coma cells from an arrested myoblast phase to a differentiated state. Submit your next manuscript to BioMed Central Genes Dev 2009, 23:694–707. and take full advantage of: 19. MacQuarrie KL, Yao Z, Young JM, Cao Y, Tapscott SJ: miR-206 integrates multiple components of differentiation pathways to control the • Convenient online submission transition from growth to differentiation in rhabdomyosarcoma cells. • Thorough peer review Skeletal Muscle 2012, 2:7. 20. Saab R, Spunt SL, Skapek SX: Chapter 7 – myogenesis and • No space constraints or color figure charges rhabdomyosarcoma: the Jekyll and Hyde of skeletal muscle. Current Top • Immediate publication on acceptance Dev Biol Cancer Dev 2010, 94:197–234. • Inclusion in PubMed, CAS, Scopus and Google Scholar 21. MacQuarrie KL, Yao Z, Fong AP, Diede SJ, Rudzinski ER, Hawkins DS, Tapscott SJ: Comparison of genome-wide binding of MyoD in normal hu- • Research which is freely available for redistribution man myogenic cells and rhabdomyosarcomas identifies regional and local suppression of pro-myogenic transcription factors. Mol Cell Biol Submit your manuscript at 2013, 33:773–784. www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Skeletal Muscle Springer Journals

Genome-wide binding of the basic helix-loop-helix myogenic inhibitor musculin has substantial overlap with MyoD: implications for buffering activity

Loading next page...
 
/lp/springer-journals/genome-wide-binding-of-the-basic-helix-loop-helix-myogenic-inhibitor-MPgnvYh2HT
Publisher
Springer Journals
Copyright
Copyright © 2013 by MacQuarrie et al.; licensee BioMed Central Ltd.
Subject
Life Sciences; Cell Biology; Developmental Biology; Biochemistry, general; Systems Biology; Biotechnology
eISSN
2044-5040
DOI
10.1186/2044-5040-3-26
pmid
24175993
Publisher site
See Article on Publisher Site

Abstract

Background: Musculin (MSC) is a basic helix-loop-helix transcription factor that inhibits myogenesis during normal development and contributes to the differentiation defect in rhabdomyosarcoma. As one of many transcription factors that impede myogenesis, its binding on a genome-wide scale relative to the widespread binding of the myogenic factor MyoD is unknown. Methods: Chromatin immunoprecipitation coupled to high-throughput sequencing was performed for endogenous MSC in rhabdomyosarcoma cells and its binding was compared to that of MyoD in the same type of cells. Results: MSC binds throughout the genome, in a pattern very similar to MyoD. Its binding overlaps strongly with regions enriched for acetylated histone H4, as well as regions that score high for DNase hypersensitivity in human myoblasts. In contrast to MyoD, MSC has a more relaxed binding sequence preference in the nucleotides that flank the core E-box motif. Conclusions: The myogenic inhibitor MSC binds throughout the genome of rhabdomyosarcoma cells, in a pattern highly similar to that of MyoD, suggesting a broad role in buffering the activity of MyoD in development and rhabdomyosarcomas. Keywords: Rhabdomyosarcoma, musculin, MyoD, myogenic inhibitor Background with a subset of the locations it binds, MyoD binding The advent of high-throughput sequencing coupled to also results in histone acetylation at its binding sites chromatin immunoprecipitation (ChIP-seq) has permit- throughout the genome, demonstrating a biological con- ted the global assessment of DNA binding of numerous sequence of its genome-wide binding [3]. transcription factors. While some factors show a rela- The myogenic activity of MyoD can be inhibited by a tively restricted binding pattern near their regulated variety of transcription factors, including other members genes, others bind widely throughout the genome [1]. of the bHLH protein family [4]. Inhibitory mechanisms The basic helix-loop-helix (bHLH) gene MyoD, a key take a variety of forms, including competition for protein regulator for the specification and differentiation of skel- partners [5,6], the occlusion of MyoD binding sites and etal muscle [2], shows widespread binding at tens of transcriptional repression after DNA binding [7,8], and thousands of genomic locations [3]. In addition to dir- binding to MyoD itself [9]. Musculin (MSC) is a small ectly regulating the transcription of genes associated bHLH inhibitor that functions with a variety of mecha- nisms. Like MyoD, MSC forms heterodimers with * Correspondence: stapscot@fhcrc.org E-proteins. The MSC:E-protein heterodimer binds to Equal contributors E-boxes and inhibits myogenic reporters and MyoD- Human Biology Division, Fred Hutchinson Cancer Research Center, 1100 mediated myogenesis [10]. The activity of MSC is quite Fairview Ave N C3-168, Seattle WA 98109, USA Department of Neurology, University of Washington, Seattle WA 98105, USA complex, however, with a critical role in the specification Full list of author information is available at the end of the article © 2013 MacQuarrie et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 2 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 and survival of cells destined to become a subset of cra- Chromatin immunoprecipitation and ChIP-seq niofacial muscles in mice [11], possibly through regula- Chromatin immunoprecipitation (ChIP) was performed tion of the expression of members of the myogenic in RD cells with an approach that has been described regulatory factor (MRF) family such as MyoD and Myf5 previously [3]. Antibodies used were as follows: MyoD [12]. A similar, crucial role in craniofacial muscle devel- [22], MSC (Santa Cruz, sc-9556X). Quantitative PCR opment has been seen in zebrafish models [13], and the (qPCR) was performed using SybrGreen from Bio-Rad Drosophila ortholog of musculin is required for the spe- on an Applied Biosystems 7900HT. Enrichment was cal- cification of certain gut muscle cells [14]. There is also culated as the percentage of input in samples with anti- evidence that musculin is not restricted to expression in body divided by the percentage of input in matched skeletal muscle and functions to affect the differentiation samples without antibody. Primer sequences for site- of non-myogenic cells [15-17]. Together these studies specific confirmatory ChIP were as follows: A – f: indicate that musculin might have either positive or gcttgatgatgcttgcagaa r: cggagaggatcatgtaactgc; B – f: negative activities in gene transcription depending on a ctggtccctttcaggagaca r: gccgtccatctaaaggtcaa; C – f: aat variety of factors and cellular context. gacaagcactcgcacaa r: atcgagaagttgcgtgcttt; D – f: atctg Recently, we have shown that MSC competes with gaatgccttctgtgg r: attgcctaggaagggacaca; E – f: gcgac MyoD for the available pool of E-proteins in rhabdo- gagctccacatctac r: aggatgcccatgactttgag; F – f: ctcaccatcc myosarcoma cells [18], and that it occludes MyoD bind- gaccaagagt r: ggggtcacgtgtgtatgaga. ing sites, interfering with myogenic activation [19]. Rhabdomyosarcoma (RMS) is a pediatric tumor of skel- Liquid chromatography and mass spectrometry etal muscle that fails to undergo terminal myogenic dif- The isolation of complexes associated with TAP-tagged ferentiation properly. These tumors express MyoD [20] MSC was performed identically to prior experiments and many also express MSC [18]. Since the tumors ap- [18], but MSC-associated complexes were only purified pear to represent an arrested state of development of singly through tobacco etch virus (TEV)-mediated elu- normal muscle cells undergoing the transition from pro- tion. Peptides were digested with trypsin before loading liferative myoblasts to terminally differentiated myotubes on a ThermoFinnigan LTQ FT and undergoing liquid [18,19], this makes RMS cells an ideal system for com- chromatography coupled to tandem mass spectrometry paring the binding of MSC and MyoD and further eluci- (LC-MS/MS). The data were searched using X!Comet. dating the ability of MSC to function as an inhibitor of differentiation. Electrophoretic mobility shift assays We have previously performed ChIP-seq for MyoD in Shift assays were performed as described previously [23]. a cell culture model of embryonal RMS, RD cells [21], Proteins were transcribed and translated in vitro from and we now report a genome-wide assessment of MSC CS2-based plasmids using a rabbit reticulocyte lysate kit binding in RD cells. Strikingly, MSC binds widely (Promega). Probe sequences were as follows (forward se- throughout the genome, in an overlapping but non- quences only listed, reverse complement sequences not identical pattern to MyoD, reflecting an overlapping but shown): MSC-specific: cggccgaccagctggagatcct; -1 pos- not identical E-box sequence specificity. The substantial ition mutation (mut): cggccgagcagctggagatcct; -1/+1 pos- direct overlap of MSC and MyoD sites together with the ition mut: cggccgagcagctgcagatcct; MSC-specific T mut: close proximity of many MSC- and MyoD-specific sites cggccgtccagctggagatcct; -1/+1 T mut: cggccgtgcagctgca- suggests that MSC has the potential for broadly modu- gatcct; CG E-box: cggccgaccacgtggagatcct; B1: lating MyoD activity in normal development and in gatccccccaacacctgctgcctga. rhabdomyosarcomas. Peak calling Sequences were extracted by GApipeline-0.3.0. Reads Methods mapping to the X and Y-chromosomes were excluded Cell culture and construct preparation from our analysis. Reads were aligned using BWA to the RD cells were obtained from the American Type Culture human genome (hg19). Duplicate sequences were dis- Collection (ATCC), and all analyses were performed on carded to minimize the effects of PCR amplification. cells that originated from low passage number frozen ali- Each read was extended in the sequencing orientation to quots. RD cells were maintained in DMEM with 10% a total of 200 bases to infer the coverage at each gen- bovine calf serum and 1% Pen-Strep (Gibco). MSC with omic position. Peak calling was performed by an in- a tandem affinity purification (TAP) tag was constructed house developed R package, which models background by cloning the coding sequence for MSC in-frame with a reads by a negative binomial distribution as previously TAP-tagged pBabe plasmid so that the TAP tag is N- described [24]. Peaks in the MyoD and MSC samples terminal to MSC. that overlapped with peaks in the RD no antibody cell- MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 3 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 -5 type specific control sample at a P value cutoff of 10 in intergenic regions. A number of sites identified as be- were removed from the analysis. ing specifically and strongly enriched for either MyoD or MSC by ChIP-seq were tested with biologically inde- Motif analysis pendent site-specific ChIP, and factor-specific enrich- We applied an in-house developed Bioconductor pack- ment in agreement with the ChIP-seq data found at all age motifRG for discriminative de novo motif discovery sites (Additional file 1: Figure S1). as previously described [3,25]. To find discriminative MSC heterodimerizes with E-proteins to bind to E- motifs for MSC-specific peaks, we selected MSC-specific boxes [10], and we have previously shown by LC-MS/ and MSC- and MyoD-shared peaks. Specific peaks were MS that the E-protein E12 associates with MSC in RD defined as peaks present for one transcription factor cells, while MyoD does not associate with MSC [18]. To -10 with a P value cutoff of 10 and absent for the other further confirm that the ChIP-seq data represent distinct -4 with a P value cutoff of 10 . Shared peaks were present MyoD or MSC bHLH dimers, a TAP-tagged MSC was -10 for both factors with a P value cutoff of 10 . created. This was shown to maintain biological activity as measured by its ability to repress myogenic reporters P value peak overlap analysis and bind E-boxes in electrophoretic mobility shift assays We adopted a nonparametric rank-based paradigm to (EMSAs) (data not shown). The tagged MSC was then compare two ChIP-seq samples as previously described introduced stably into RD cells through retroviral trans- [24]. We ranked all peaks by their P values and grouped duction and MSC-associated complexes pulled down ranks into bins of 3,000 (that is, the top 3,000 peaks, and subjected to LC-MS/MS. As expected, all E-proteins then the top 6,000 peaks, and so on). Then we computed were found to associate with MSC, while there was no the fraction of top x peaks in a sample that overlap with indication of a MSC: MyoD interaction (Additional file the top y peaks in another sample, where x and y vary 2: Table S1). from 3,000 to 30,000, and y is equal to or greater than x. A motif analysis of the binding site preferred by MSC found strong enrichment for binding at a GC core Results E-box (Figure 1A, top), one of the two E-box cores we Musculin and MyoD have overlapping, but non-identical, previously identified as being preferred by MyoD genome-wide binding patterns (Figure 1A, bottom). In contrast to MyoD, MSC exhibits To compare the binding pattern of the bHLH myogenic a strong nucleotide preference for a ‘G’ at the first inhibitor MSC to that of the myogenic activator MyoD, nucleotide after the E-box (CAGCTGG), designated ChIP-seq for endogenous MSC was performed in RD position +1 relative to the E-box. Also notable was a dif- cells under growth conditions. MSC binds at a compar- ference in the sequences enriched at the two positions able number of sites as MyoD and with a similar gen- immediately before the E-box, designated positions −1 omic distribution, although there was a slightly greater and −2relativetothe E-box.We havepreviouslyshown enrichment of MSC binding in the region surrounding that MyoD:E and NeuroD2:E heterodimers show a the transcription start site (TSS) compared to MyoD flanking preference for G or A in the −1and −2posi- (Table 1), possibly reflecting the GC-rich nature of pro- tions [3,24], whereas the MSC motif does not demon- moters and the preferred MSC E-box (see below). As strate a similarly strong preference at these positions with MyoD, MSC was found to bind widely at regions (Figure 1A, positions 2 and 3). outside of those generally thought of as gene related, As anticipated from the motif analysis, MyoD and binding to a high degree (approximately 40% of all sites) MSC showed overlapping but not identical binding Table 1 Number and genomic location of musculin and MyoD ChIP-seq peaks in RD cells Factor Number of peaks Genomic location (fraction of peaks) b c d e f g h P value cutoff Promoter Proximal promoter 3 Prime Exon Intron Upstream Downstream Intergenic -5 -7 -10 10 10 10 Musculin 54901 39036 25688 0.165 0.231 0.029 0.204 0.563 0.209 0.170 0.423 MyoD [21] 50320 35203 24501 0.110 0.175 0.027 0.154 0.560 0.187 0.164 0.405 The fraction of MyoD and musculin peaks found in each listed type of genomic region are given. Note that categories are not mutually exclusive, and a single peak may be included in multiple categories. Three P value cutoffs were used to evaluate whether ChIP-seq reads are considered a ‘peak’ and included in the count of the total number of peaks. +/−500 bp from the transcription start site (TSS). +/−2 kb from the TSS. +/−500 nucleotides from the end of the transcript. –2kbto −10 kb upstream of the TSS. +2 kb to +10 kb from the end of the transcript. >10 kb from any annotated gene. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 4 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 Figure 1 MSC has similar, but non-identical, DNA binding characteristics to MyoD and binds at many of the same genomic locations. (A) E-box motif enrichment of MSC and MyoD bound sites in RDs identifies a similar preference for central dinucleotide identity (GC and GG), but differing preferences in the E-box flanking nucleotides. (B) Comparison of the top 30,000 MyoD and MSC peaks in RDs demonstrates substantial overlap in the sites bound by each factor. Peaks were ranked by P value, and grouped into bins that increase by 3,000 peaks each time (that is, first the 3,000 most significant peaks are considered, than the 6,000 most significant, and so on). The fraction of the overlap is indicated by color, as depicted in the legend. (C) De novo motif analysis of peaks specific to MSC identifies an 8 bp motif (row 2) enriched at MSC-specific binding sites. The motif analysis compared MSC-specific binding sites to those sites that bound both MyoD and MSC. bp, base pair; fg.frac, bg.frac: fraction of foreground/background sequences that contain at least one motif occurrence; MSC, musculin; ratio, enriched/depleted ratio of motifs. locations in the genome. MyoD and MSC peaks were motif of CCAGCTGG (Figure 1C). Examination of the assigned to sequential cumulative bins of 3,000 peaks ChIP-seq data at specific loci identified sites bound only based on rank by P value and the percentage overlap by one of the factors, sites bound by both factors in an ranged from approximately 40% to 80% (Figure 1B). A apparently identical pattern, and sites bound by each motif analysis of sites that were found to bind only MSC factor in closely overlapping but non-identical binding (MSC-specific) in comparison to sites bound either patterns (Figure 2). The closely overlapping but distinct solely by MyoD (MyoD-specific) or by both MyoD and patterns suggests each factor is binding to a distinct E- MSC (shared) identified a strong enrichment for C at box in the region; however, this is identified as an ‘over- the −1 position and G at the +1 position, giving an 8-bp lap’ in the analysis shown in Figure 1B. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 5 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 Figure 2 MyoD and MSC bind at unique identical and overlapping but non-identical sites in the genome. MSC and MyoD have both unique and overlapping binding patterns at various sites in the genome. Screenshots are shown from the UCSC Genome browser for MyoD and MSC ChIP-seq results at four distinct genomic locations (indicated below each panel, representing positions in hg19). The identity of the bHLH factor is indicated along the left, and E-boxes are represented as black marks along the bottom of each panel. Note that the number of MyoD reads in the ‘MSC only’ panel is five, in contrast to 298 reads for MSC, and are not centered on an E-box, and thus do not likely represent true MyoD binding. bHLH, basic helix-loop-helix; ChIP-seq, chromatin immunoprecipitation coupled to high-throughput sequencing; MSC, musculin. Musculin binding is enriched at DNase hypersensitive to a TSS (<2 kb from the nearest TSS) (P value of the genomic regions and regions with higher levels of difference between MSC-specific and MyoD-specific -45 histone acetylation peaks: 1 × 10 , P value for MSC-specific versus shared -7 We have previously shown that MyoD binding induces peaks: 1 × 10 ) (Figure 3B). MSC binding did not cor- histone acetylation at binding sites throughout the gen- relate, either positively or negatively, with genes that we ome [3]. To test the hypothesis that the genome-wide have previously identified as being differentially regu- binding of MSC might inhibit acetylation in either a glo- lated in RD cells compared to normal myogenic cells bal manner or at some subset of MyoD-bound locations, [21] (data not shown). we performed ChIP-seq for acetylated histone H4 Given the lack of a global effect on gene expres- (AcH4) from RD cells under conditions similar to the sion, we hypothesized that the association with AcH4 MyoD and MSC ChIP-seq data. AcH4 enrichment was might simply reflect binding of MSC at regions of examined at peaks identified as MSC-specific, MyoD- open chromatin. The MyoD-specific, MSC-specific specific and shared. Surprisingly, the highest levels of and shared peaks in the RD cells were compared to AcH4 enrichment showed a stronger association with publicly available DNase hypersensitivity data from MSC peaks, both MSC specific and shared (Figure 3A). human myoblasts. Shared peaks had the highest This trend became even more evident when peaks were proportion of peaks that overlapped with DNase grouped based on distance from the nearest gene TSS. hypersensitive sites (shared: approximately 80%, While MyoD-specific peaks showed essentially identical MSC-specific: approximately 70%, MyoD-specific: ap- AcH4 enrichment regardless of their location relative to proximately 50%) (Figure 3C), and this relation held a TSS, MSC-specific and shared peaks showed a strong across the entire range of hypersensitive values shift to higher AcH4 enrichment at peaks located closer (Additional file 3: Figure S2A). MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 6 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 Figure 3 MSC binding is associated with open chromatin. (A) Sites bound by MyoD and MSC are associated with acetylated histones. ChIP-seq for acetylated histone H4 (AcH4) was performed in RD cells and density plots constructed to compare the square root of the AcH4 value at all sites bound by MSC, MyoD or both factors. (B) MSC-specific and MyoD/MSC shared peaks are associated with higher levels of AcH4 near the transcription start site (TSS) of genes compared to MyoD-specific peaks. Density plots were constructed as in (A) for categories of peaks first split by peak identity (MyoD, MSC, shared), then subcategorized on distance from the nearest TSS. (C) Sites bound by MSC in RD cells overlap with DNase hypersensitive (HSS) sites in normal human myoblasts. Publicly available DNase HSS data from human myotubes were compared to the sites bound by MyoD and MSC in RD cells. Data for each factor category (for example, MSC-specific) are plotted as the fraction of peaks that overlap with locations that have a signal in the HSS data (that is, the graphed fraction = 1 – fraction of peaks at HSS score of ‘0’). AcH4, acetylated histone H4; bHLH, basic helix-loop-helix; ChIP, chromatin immunoprecipitation; ChIP-seq, chromatin immunoprecipitation coupled to high- throughput sequencing; HSS, hypersensitive; K, thousands of bp; MSC, musculin; TSS, transcription start site. MyoD-specific peaks seemed to have a surprisingly lying in HSS regions in the primary muscle cell dataset. low level of association with hypersensitive sites, but Taken as a whole, the above data identify MSC binding subcategorizing the MyoD-specific peaks based on as largely occurring in the context of areas of open and whether they were unique to RD cells, or common to accessible chromatin. RDs and human myotubes [21] revealed that common peaks were generally associated with hypersensitive sites, Musculin dimers have less restrictive binding site and peaks unique to RDs were not (Additional file 3: preferences at flanking nucleotides than MyoD dimers Figure S2B). We have previously shown that differences Electrophoretic mobility shift assays with in vitro trans- in MyoD binding between myotubes and RD cells can lated proteins were performed to further investigate the be correlated with differences in E-box accessibility be- sequence preference of MyoD and MSC dimers using tween the cell types [21]. This suggests that the MyoD the sequence from a MSC-specific peak at the SKI gene peaks specific to RMS, that is, not present in primary that contained the MSC-specific consensus 8-bp motif skeletal muscle cells, represent binding by MyoD to E- (CCAGCTGG). Shifts comparing binding of MyoD:E boxes that are normally inaccessible to bHLH binding in and MSC:E heterodimers demonstrated that MSC het- primary muscle cells and were therefore not identified as erodimers could bind to the 8-bp motif or a probe in MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 7 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 which the −1 position was changed from a ‘C’ to a ‘G’ and +1 (‘G’ to ‘C’) had been changed (−1/+1 mut) still (−1 mut), making it more reflective of the core MSC occurred, but at reduced levels (Figure 4A, compare motif from Figure 1A (Figure 4A, compare lane 4 to 5). lanes 4 and 5 to 6). In contrast, the ability of MyoD:E Binding of MSC to a probe in which both −1(‘C’ to ‘G’) heterodimers to form complexes improved as the probe Figure 4 MSC dimers have relaxed requirements for flanking sequence compared to MyoD dimers. (A) MyoD homodimers and MyoD:E- protein heterodimers do not bind well to MSC-specific sequences, but bind after a small number of sequence changes. Electrophoretic mobility shift assays (EMSAs) were performed using in vitro translated proteins and probes as indicated. The asterisks indicate the location of what are, judging by their relative mobility, small amounts of E-protein homodimers. (B) MSC heterodimers can be competed off a preferred binding site equally well by competitors with variations in their flanking sequence, while MyoD heterodimers cannot. MyoD:E and MSC:E heterodimers were subjected to competition by excesses of cold probes as indicated. 25× and 50× refer to the excess mass of cold probe relative to hot probe. Variations in competitor sequences are indicated, and ‘CG Ebox’ refers to a probe with an inverted central dinucleotide sequence that abolishes all binding of MyoD and MSC. (C) Single nucleotide changes in flanking sequence can completely abrogate MyoD dimer binding, but still be per- missive of MSC dimer binding. Shift assays were performed using proteins and probes as indicated. Each type of dimer combination was run in two lanes, with one lane having a probe with ‘A’ in the −2 position relative to the E-box, and the other lane having a probe with ‘T’ in that position, as indicated in red. All shifts were performed using a sufficient excess of probe so that visible free probe was present for all lanes (not shown in 4A and 4B). All probe counts were quantitated before addition to ensure there were roughly equivalent amounts in all compared lanes. Negative control lanes indicate lanes where probes were tested with an in vitro translated empty CS2 vector to identify any non-specific binding. EMSA, electrophoretic mobility shift assay; MSC, musculin. MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 8 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 was shifted away from the 8-bp MSC motif (Figure 4A, translated proteins, and thus would not reflect the effect compare lane 10 to 12). Taken together with the motif of any post-translational modifications that may occur analysis identifying the differences at positions −1 and in vivo. However, the in vitro binding preferences reflect −2, this suggests that the sequence preference for dimer those preferences seen in the in vivo ChIP-seq results. binding is more stringent for dimers containing MyoD Additionally, work with other bHLH factors has demon- than those containing MSC, even with a common dimer strated excellent correlation between binding sites iden- partner. Similar results were observed with homodimers tified by ChIP-seq and binding seen with EMSA [24]. of both MSC and MyoD, though both types of homodi- Overall, the broad overlap of MyoD and MSC binding mers formed more weakly compared to their heterodi- indicates a potential for MSC to buffer the binding and mer counterparts (Figure 4A, compare lane 1 to 3 and 7 activity of MyoD broadly, as well as other E-box binding to 9, data not shown). factors. To further test this hypothesis, competition assays We have previously shown that MSC can inhibit were performed on MSC and MyoD heterodimers. As MyoD-mediated activation of myogenic targets by oc- expected, MSC was competed off the MSC-specific 8-bp cluding specific E-boxes [19], in addition to competing motif equally well by cold competitors with the consen- for a limiting pool of E-proteins [18]. We have proposed sus 8-bp motif, –1 mut, or −1/+1 mut (Figure 4B, left that this activity controls the growth-versus- panel, compare lanes 3 and 4 to 5 and 6, and to 7 and differentiation decision point in myogenic cells, serving 8), suggesting relatively similar affinity. MSC was not as a component of interlocking oscillating regulatory cir- competed with a sequence in which the core nucleotides cuits that keep myogenic cells balanced between prolif- of the E-box were inverted to a ‘CG’ from ‘GC’ eration and terminal differentiation [19]. (Figure 4B, left panel, compare lanes 9 and 10 to 2), dem- This model suggests that the relationship between onstrating sequence specificity of the competition assays. bHLH proteins and target sites is highly dynamic, in In contrast, MyoD heterodimers were only effectively which dimers form and dissociate, from both their pro- competed by sequences at which it had formed visible tein partners and DNA binding sites, resulting in a fluc- complexes (Figure 4B, right panel, compare lanes 16 and tuating expression of gene targets. In turn, some subset 17 to 12 and 13, and to 14 and 15), and even a single of such targets feed back on the process to regulate nucleotide change had a notable impact on competition growth and differentiation appropriately. MSC has a very (compare −1/+1 mut to −1 mut). As with MSC, MyoD:E similar core binding motif as MyoD dimers but a greater heterodimers failed to form on the CG core E-box (data degree of flexibility for flanking nucleotides, which could not shown). reflect a lower need for tight regulation of the specific E- In addition to the relaxed preference at the positions boxes MSC can bind to compared to MyoD and be the immediately flanking the E-box, relative to MyoD, MSC mechanism by which MSC acts to broadly sequester E- also exhibited a sharp difference in response to sequence proteins and occupy potential MyoD binding sites. changes at the −2 position. The inclusion of a ‘T’ at the −2 Other factors have also been suggested as having an in- position is permissive for MSC heterodimer binding hibitory function during myogenesis by binding at E- (Figure 4C, compare lane 3 to 4), but absolutely abolishes boxes [26,27], further potentially increasing the complex binding of MyoD heterodimers (Figure 4C, compare lane nature of the interplay occurring at bHLH binding sites. 7 to 8), with similar results seen with the homodimers The similar core motif requirements for MyoD and (Figure 4C, compare lane 1 to 2 and 5 to 6). MSC ensure that MSC binds at many sites regulated by MyoD, and the +1 ‘G’ preference of the MSC motif in- Discussion creases the likelihood of it targeting E-boxes located in Our genome-wide comparison of the DNA binding GC-rich gene promoter regions. While the gene regula- characteristics of MyoD and MSC reveals that, even tion analysis did not identify a global role in gene sup- though MSC is one of multiple myogenic inhibitors and pression, MSC does modulate MyoD activity at the might be expected to bind at only a subset of all MyoD myogenic microRNA miR-206 [19], and it may have a binding locations, it binds at a comparable number of similar role at many other MyoD regulated genes, an ef- sites as MyoD, with a similar, but non-identical binding fect that would not be discernible with our current site preference. Even though MSC heterodimerizes with analysis. This model also offers possible insight into the ability the same E-proteins as MyoD and shares the same se- quence preference at the central dinucleotide of E- of MSC to serve apparently as either a positive or nega- boxes, it has less sequence preference for the positions tive regulator of transcription. With a component of MSC’s repressive activity appearing to be through inter- that flank E-boxes than other bHLH dimers we have re- ported [3,24]. It should be noted that the electrophoretic ference with DNA binding by other bHLH factors, MSC mobility shift assays were performed using in vitro activity could be substantially different depending on the MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 9 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 individual cellular context, potentially interfering with Screenshots are from the UCSC genome browser, and the identity of the the binding of inhibitory complexes. It is not known factor used in the ChIP, and the number of reads at the peak of occu- pancy are indicated along the side. ChIP, chromatin immunoprecipitation; what histone modification enzymes MSC might recruit, ChIP-seq, chromatin immunoprecipitation coupled to high-throughput nor is it clear how MSC activity would differ depending sequencing; MSC, musculin. on the extent of competition by other bHLH proteins Additional file 2: Table S1. LC-MS/MS identification of MSC-associated for binding partners and sites, and these additional pa- transcription factors in RD cells. rameters might contribute to a context-specific ability to Additional file 3: Figure S2. MSC binds sites associated with DNase hypersensitivity, and MyoD peaks found only in RD cells, not in normal serve as a positive or negative regulator. myotubes, are associated with areas identified in myotubes as DNase- Both the finding that MSC is associated with regions resistant. (A) Shared MyoD and MSC binding peaks are associated enriched for acetylated histone H4 in RD cells and strongly with DNase hypersensitive (HSS) sites in human myoblasts. The overlap between ChIP-seq peaks and HSS data is graphed for the entirety DNase hypersensitive sites in normal myotubes suggests of the range of HSS values. Values for a DNase signal of ‘0’ are equal to 1 MSC generally binds at areas of open chromatin. It is – the fraction graphed in Figure 3C. The data are plotted as a cumulative unclear at this point why the notable enrichment is seen distribution function, where a value on the y-axis represents the fraction of data that has a value equal to or less than the corresponding x-axis at sites closest to transcription start sites (<2 kb), though DNase HSS value. (B) MyoD-specific sites bound by MyoD only in RD cells, it is possible that part of this enrichment is due to the and not in human myotubes, overlap poorly with HSS sites in human GC-rich nature of promoters and the binding site prefer- myotubes. The MyoD-specific peaks from Figure 3C and (A) were further grouped into those peaks that were found both in RD cells and normal ence of MSC for an additional flanking ‘G’ compared to human myotubes (RD/myotube shared), and those found only in RD cells MyoD (Figure 1). While an effect by MSC on histone (RD-specific). As in Figure 3C, the data for each category (for example, acetylation cannot be formally ruled out, mass spectrom- RD-specific) are plotted as the fraction of peaks that overlap with sites that have some signal in the HSS data (that is, the graphed fraction = 1 – etry data did not identify any association with histone fraction of peaks at HSS score of ‘0’). ChIP-seq, chromatin immunoprecipi- acetyltransferases (KLM, unpublished observations), sug- tation coupled to high-throughput sequencing; HSS, hypersensitive; MSC, gesting that, in skeletal muscle cells, MSC is opportunis- musculin. tic in binding to areas of open chromatin, rather than Abbreviations instructing changes in chromatin structure. This would AcH4: acetylated histone H4; bHLH: basic helix-loop-helix; bp: base pair; be consistent with the model proposed above, serving to ChIP: chromatin immunoprecipitation; ChIP-seq: chromatin assist MSC acting in a role as a dynamic competitor of immunoprecipitation coupled to high-throughput sequencing; EMSA: electrophoretic mobility shift assay; HSS: hypersensitivity; kb: kilobase; MyoD function in the differentiation of skeletal muscle. LC-MS/MS: liquid chromatography coupled to tandem mass spectrometry; MRF: myogenic regulatory factor; MSC: musculin; mut: mutation; qPCR: quantitative PCR; RMS: rhabdomyosarcoma; TAP: tandem affinity Conclusions purification; TEV: tobacco etch virus; TSS: transcription start site. The myogenic bHLH inhibitor musculin binds widely throughout the genome in RD rhabdomyosarcoma cells Competing interests The authors declare they have no potential competing interests. and has a broadly overlapping, but non-identical, set of binding sites and peaks as MyoD. Compared to the pre- Authors’ contributions ferred MyoD E-box sequence, MSC has slightly less KLM contributed to all experimental designs, performed all non- computational experiments and drafted the manuscript. ZY performed the stringency for flanking sequence preference, permitting ChIP-seq and all other computational analyses and contributed to both ex- binding to a slightly broader set of E-boxes and poten- perimental design and data interpretation. APF performed the RD cell-type tially overlapping with other bHLH factors. Together control ChIP-seq. SJT conceived the project, contributed to all experimental designs and edited the manuscript. All authors read and approved the final with prior studies showing the ability of MSC to modu- manuscript. late MyoD activity at overlapping sites at specific pro- moters, these results suggest a broad potential for MSC Acknowledgements KLM was supported by a Developmental Biology Predoctoral Training Grant to modulate the activity of MyoD, and perhaps other (T32HD007183). ZY was supported by the NIH Interdisciplinary Training Grant bHLH proteins, during normal development and in in Cancer Research (T32CA080416). APF was supported by a grant from the cancers. University of Washington Child Health Research Center (NIH U5K12HD043376-10) and Hyundai Hope on Wheels. SJT was supported by NIH NIAMS (R01AR045113). Additional files Author details Human Biology Division, Fred Hutchinson Cancer Research Center, 1100 Additional file 1: Figure S1. MyoD and MSC site-specific ChIP confirms Fairview Ave N C3-168, Seattle WA 98109, USA. Molecular and Cellular the ChIP-seq results. Biologically independent site-specific ChIP was per- Biology Program, University of Washington, Seattle WA 98105, USA. Clinical formed at three sites indicated by the ChIP-seq to be MyoD-specific bind- Research Division, Fred Hutchinson Cancer Research Center, Seattle WA ing sites, three sites indicated as MSC-specific, and one control location 98109, USA. Department of Pediatrics, University of Washington School of with no significant binding of either factor, as indicated by both the chart Medicine, Seattle WA 98105, USA. Department of Neurology, University of and the screenshots. The enrichment was calculated for each location as Washington, Seattle WA 98105, USA. the percentage of input amplified in qPCR with antibody divided by the percentage of input amplified with no antibody, and the value is indi- Received: 17 March 2013 Accepted: 10 October 2013 cated at the top of each bar. Note that the y-axis is non-linear. Published: 1 November 2013 MacQuarrie et al. Skeletal Muscle 2013, 3:26 Page 10 of 10 http://www.skeletalmusclejournal.com/content/3/1/26 References 22. Tapscott SJ, Davis RL, Thayer MJ, Cheng PF, Weintraub H, Lassar AB: MyoD1: 1. MacQuarrie KL, Fong AP, Morse RH, Tapscott SJ: Genome-wide a nuclear phosphoprotein requiring a Myc homology region to convert transcription factor binding: beyond direct target regulation. Trends fibroblasts to myoblasts. Science 1988, 242:405–411. Genet 2011, 27:141–148. 23. Davis RL, Cheng PF, Lassar AB, Weintraub H: The MyoD DNA binding 2. Davis RL, Weintraub H, Lassar AB: Expression of a single transfected cDNA domain contains a recognition code for muscle-specific gene activation. converts fibroblasts to myoblasts. Cell 1987, 51:987–1000. Cell 1990, 60:733–746. 3. Cao Y, Yao Z, Sarkar D, Lawrence M, Sanchez GJ, Parker MH, MacQuarrie KL, 24. Fong AP, Yao Z, Zhong JW, Cao Y, Ruzzo WL, Gentleman RC, Tapscott SJ: Davison J, Morgan MT, Ruzzo WL, Gentleman RC, Tapscott SJ: Genome- Genetic and epigenetic determinants of neurogenesis and myogenesis. wide MyoD binding in skeletal muscle cells: a potential for broad cellular Dev Cell 2012, 22:721–735. reprogramming. Dev Cell 2010, 18:662–674. 25. Palii CG, Perez-Iratxeta C, Yao Z, Cao Y, Dai F, Davison J, Atkins H, Allan D, Dilworth FJ, Gentleman R, Tapscott SJ, Brand M: Differential genomic tar- 4. Berkes CA, Tapscott SJ: MyoD and the transcriptional control of geting of the transcription factor TAL1 in alternate haematopoietic line- myogenesis. Semin Cell Dev Biol 2005, 16:585–595. ages. EMBO J 2011, 30:494–509. 5. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H: The protein Id: a 26. Genetta T, Ruezinsky D, Kadesch T: Displacement of an E-box-binding re- negative regulator of helix-loop-helix DNA binding proteins. Cell 1990, pressor by basic helix-loop-helix proteins: implications for B-cell specifi- 61:49–59. city of the immunoglobulin heavy-chain enhancer. Mol Cell Biol 1994, 6. Spicer DB, Rhee J, Cheung WL, Lassar AB: Inhibition of myogenic bHLH 14:6153–6163. and MEF2 transcription factors by the bHLH protein Twist. Science 1996, 27. Soleimani VD, Yin H, Jahani-Asl A, Ming H, Kockx CE, van Ijcken WF, Grosveld 272:1476–1480. F, Rudnicki MA: Snail regulates MyoD binding-site occupancy to direct 7. St-Pierre B, Flock G, Zacksenhaus E, Egan SE: Stra13 homodimers repress enhancer switching and differentiation-specific transcription in myogen- transcription through class B E-box elements. J biol chem 2002, esis. Mol Cell 2012, 47:457–468. 277:46544–46551. 8. Lemercier C, To RQ, Carrasco RA, Konieczny SF: The basic helix-loop-helix doi:10.1186/2044-5040-3-26 transcription factor Mist1 functions as a transcriptional repressor of Cite this article as: MacQuarrie et al.: Genome-wide binding of the basic myoD. EMBO J 1998, 17:1412–1422. helix-loop-helix myogenic inhibitor musculin has substantial overlap 9. Hamamori Y, Wu HY, Sartorelli V, Kedes L: The basic domain of myogenic with MyoD: implications for buffering activity. Skeletal Muscle 2013 3:26. basic helix-loop-helix (bHLH) proteins is the novel target for direct inhib- ition by another bHLH protein, Twist. Mol Cell Biol 1997, 17:6563–6573. 10. Lu J, Webb R, Richardson JA, Olson EN: MyoR: a muscle-restricted basic helix-loop-helix transcription factor that antagonizes the actions of MyoD. Proc Natl Acad Sci USA 1999, 96:552–557. 11. Lu J-R, Bassel-Duby R, Hawkins A, Chang P, Valdez R, Wu H, Gan L, Shelton JM, Richardson JA, Olson EN: Control of facial muscle development by MyoR and capsulin. Science 2002, 298:2378–2381. 12. Moncaut N, Cross JW, Siligan C, Keith A, Taylor K, Rigby PW, Carvajal JJ: Musculin and TCF21 coordinate the maintenance of myogenic regulatory factor expression levels during mouse craniofacial development. Development 2012, 139:958–967. 13. Lee GH, Chang MY, Hsu CH, Chen YH: Essential roles of basic helix-loop- helix transcription factors, capsulin and musculin, during craniofacial myogenesis of zebrafish. Cell Mol Life Sci 2011, 68:4065–4078. 14. Ismat A, Schaub C, Reim I, Kirchner K, Schultheis D, Frasch M: HLH54F is required for the specification and migration of longitudinal gut muscle founders from the caudal mesoderm of Drosophila. Development 2010, 137:3107–3117. 15. Hishikawa K, Marumo T, Miura S, Nakanishi A, Matsuzaki Y, Shibata K, Ichiyanagi T, Kohike H, Komori T, Takahashi I, Takase O, Imai N, Yoshikawa M, Inowa T, Hayashi M, Nakaki T, Nakauchi H, Okano H, Fujita T: Musculin/ MyoR is expressed in kidney side population cells and can regulate their function. J Cell Biol 2005, 169:921–928. 16. Yu L, Sangster N, Perez A, McCormick PJ: The bHLH protein MyoR inhibits the differentiation of early embryonic endoderm. Differentiation 2004, 72:341–347. 17. Yu L, Mikloucich J, Sangster N, Perez A, McCormick PJ: MyoR is expressed in nonmyogenic cells and can inhibit their differentiation. Exp Cell Res 2003, 289:162–173. 18. Yang Z, MacQuarrie KL, Analau E, Tyler AE, Dilworth FJ, Cao Y, Diede SJ, Tapscott SJ: MyoD and E-protein heterodimers switch rhabdomyosar- coma cells from an arrested myoblast phase to a differentiated state. Submit your next manuscript to BioMed Central Genes Dev 2009, 23:694–707. and take full advantage of: 19. MacQuarrie KL, Yao Z, Young JM, Cao Y, Tapscott SJ: miR-206 integrates multiple components of differentiation pathways to control the • Convenient online submission transition from growth to differentiation in rhabdomyosarcoma cells. • Thorough peer review Skeletal Muscle 2012, 2:7. 20. Saab R, Spunt SL, Skapek SX: Chapter 7 – myogenesis and • No space constraints or color figure charges rhabdomyosarcoma: the Jekyll and Hyde of skeletal muscle. Current Top • Immediate publication on acceptance Dev Biol Cancer Dev 2010, 94:197–234. • Inclusion in PubMed, CAS, Scopus and Google Scholar 21. MacQuarrie KL, Yao Z, Fong AP, Diede SJ, Rudzinski ER, Hawkins DS, Tapscott SJ: Comparison of genome-wide binding of MyoD in normal hu- • Research which is freely available for redistribution man myogenic cells and rhabdomyosarcomas identifies regional and local suppression of pro-myogenic transcription factors. Mol Cell Biol Submit your manuscript at 2013, 33:773–784. www.biomedcentral.com/submit

Journal

Skeletal MuscleSpringer Journals

Published: Nov 1, 2013

References