Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Etiology of diarrheal disease among children under 5 years in Egypt: a high incidence of human bocavirus

Etiology of diarrheal disease among children under 5 years in Egypt: a high incidence of human... Background: Human bocavirus (HBoV) is globally distributed and associated with respiratory and enteric infections. Limited data are available about the incidence of HBoV in Egyptian children. We aimed to investigate the association of HBoV genotypes in children with diarrheal disease and also to determine the possibility of HBoV co-infections with other human enteric pathogens. Methods: A total of 102 stool samples were collected from children under five years old with diarrhea. Samples were analyzed for the presence of HBoV by real-time PCR. HBoV positive samples were tested for adenovirus (AdV), rotavirus (RoV), parasitic helminths, and enteric protozoa. Results: HBoV was detected in 58% of examined cases. HBoV-3 was the most prevalent genotype observed (44%; 45 of 102), followed by HBoV-2/4 (33%; 34 of 102) and HBoV-1 (30%; 31 of 102). Although the incidence of HBoV was higher in males (66.6%; 34 of 51) than females (49%; 25 of 51), the analysis showed no significant difference for HBoV 4 5 between genders. The average HBoV concentrations were 5.3 × 10 GC/g in males and 1.03 × 10 GC/g in females. Among the HBoV-positive samples, the single infection of HBoV was 52.5% (31/59), while the co-infections with multiple viruses were found in 1.7% (1/59) for HBoV and AdV, 33.9% (20/59) for HBoV and RoV, and 11.9% (7/59) for HBoV, and RoV and AdV. No co-infection with parasitic helminths or enteric protozoa was found. Conclusions: The single infection of HBoV in some children suffering from acute gastroenteritis indicated that HBoV could be the main etiologic agent of the disease. The study highlights the high incidence of HBoVs genotypes with remarkable multiple co-infections in the pre-school children in Egypt. Keywords: Human bocaviruses, Adenovirus, Rotavirus, Co-infections, diarrhea, qPCR 1 Introduction uncommon in high-income countries, but diarrhea is Diarrheal disease is the second most common cause of often associated with substantial medical and healthcare mortality worldwide in children less than 5 years and it costs. Viral diarrhea is a prevalent type of diarrhea in is estimated that 600,000–700,000 infants and young the world affecting patients of all ages, especially chil- children die from diarrhea each year. Most of the deaths dren [1]. Enteric viruses are the most frequent common occur in Sub-Saharan Africa and South Asia and mortal- pathogens causing diarrhea in high-income as well as ity is high in children less than 5 years [1]. Mortality is low-income countries [2]. The most common agents are rotavirus (RoV), adenovirus (AdV), norovirus (NoV), * Correspondence: ibrahimnrc@gmail.com sapovirus (SaV), and astrovirus (AstV). Additionally, Neveen M. Rizk and Sherif Abd-Elmaksoud contributed equally to this work. bocaviruses (HBoVs) are increasingly being identified as Water Pollution Research Department, National Research Centre, 33 El causative agents of diarrhea [3]. However, little attention Buhouth St., Dokki, Giza 12622, Egypt Full list of author information is available at the end of the article for HBoVs as a causative agent of diarrhea has been © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 2 of 7 received so far, particularly the co-infections pattern of association of HBoV genotypes in children with AGE up different HBoVs genotypes in pre-school children. to 5 years. Also, we screened the positive HBoV samples Human bocavirus (HBoV) was discovered in 2005 [4]. for AdV, RoV, parasitic helminths, and enteric protozoa HBoV is a member of the family Parvoviridae, subfamily to determine whether the causative agent of diarrhea in Parvovirinae, genus Bocaparvovirus. Four HBoV geno- the collected samples is HBoV or co-infection with other types (HBoV-1-HBoV-4) have been identified and char- pathogens. acterized by a 5.3 kb single-stranded DNA genome, encapsulated in a non-enveloped icosahedral capsid pro- 2 Methods tein coat [5]. The genome of HBoV has three open read- 2.1 Sample collection ing frames (ORFs), encoding two nonstructural proteins A total of 102 stool samples were collected anonymously NS1 and NP1 and two viral capsid proteins VP1 and from preschool children (51 samples from males and 51 VP2 [6]. samples from females) from private clinics in Giza, Egypt. A plethora of studies detected HBoVs in Europe [7], The samples were collected from children under 5 years North America [8], South America [9], the Middle East of age suffering from acute watery diarrhea. Stool samples [10], Asia [11], and Australia [12]. In African countries, were examined immediately at the same day for parasites HBoVs have been reported in Egypt 2% (2/100 children identification. In order to avoid repeated freezing and of age from 1 month to 2 years) [13], Kenya 1.8% (7/384 thawing, stool samples were aliquoted, stored at − 20 °C, children/adults) [14], and South Africa 22.8% (174/1460 and tested within a month from collection for HBoV. children < 2 years) [15]. As yet, little is still known about the prevalence of HBoV and its genotypes in Egypt, par- 2.2 Sample concentration and processing ticularly in children. About 100 mg of fecal diarrhea samples were weighed HBoVs cause a variety of clinical manifestation and and diluted in phosphate buffer saline (1:10). The sam- could be isolated from several types of clinical samples ples were vortexed for 30 s followed by centrifugation at including nasopharyngeal aspirates [12, 16] and stool 5000 rpm for 10 min at room temperature. The superna- [17]. Furthermore, HBoVs was also found in environ- tants were kept at − 80 °C until further use. mental waters [18, 19]. HBoV-1 is commonly associated with respiratory tract infections in pediatric patients, as 2.3 Nucleic acid extraction well as in those with gastrointestinal symptoms [20]. In Viral nucleic acids were extracted from 200 μl of the contrast, the other three genotypes (HBoV2-4) are found concentrated sample using GeneJET Viral DNA and mainly in stool samples from patients suffering from RNA Purification kit (Thermo Scientific-USA) according gastroenteritis [21]. to the manufacturer’s instructions. The obtained nucleic The association of HBoV with respiratory disease and acid was dissolved in 60 μl of eluent and kept at – 80 °C acute gastroenteritis remains unclear due to the high until use. rate of co-infection with other pathogenic viruses in symptomatic patients, as well as its frequent detection in 2.4 Detection and quantification of HBoV by qPCR asymptomatic individuals [6, 21]. However, HBoV was All primers used in the current study were listed in isolated from hospitalized infants suffering from respira- Table 1. The quantification protocol targeting the NP1 tory infections, without other respiratory viruses (i.e., gene for HBoV-1 was used according to Hamza et al. adenovirus, respiratory syncytial virus, parainfluenza [18]. A single sense primer was shared in HBoV-2, 3, virus 1, 2, and 3, human metapneumovirus, influenza and 4 quantifications and the qPCR of HBoV-2 and 4 virus A and B) [22]. Moreover, some reports found sin- used the same antisense primer [29]. SYBR green qPCR gle infection of HBoV in the stool of infected patients assay was conducted for HBoVs quantification using a with acute gastroenteritis (AGE), particularly among Maxima SYBR Green qPCR Master Mix Kit (Thermo children under 5 years of age [3, 23]. However, all chil- Scientifc). The PCR conditions were 10 min initial de- dren of different ages are at risk of HBoV infection as a naturation step at 95 °C, 40 cycles of denaturation at 95 result of poor hygiene practices and sanitation [23]. It is °C for 15 s and annealing-extension at 60 °C for 1 min. suspected that HBoV enters the bloodstream after a long Amplification was followed by one cycle of melting period of persistence in the mucosa of the respiratory curve analysis. Dissociation was carried out from 60 °C tract and migrates to the gastrointestinal tract, where it to 95 °C with a temperature ramp of 0.05 °C/s. Analysis may either produce new infection or be excreted asymp- indicated a melting peak (Tm) at 83 °C ± 0.2 °C for tomatically [24]. HBoVs can infect all human age groups, HBoV-1, 81.5 °C ± 0.3 °C for HBoV 2/4, and 80 °C ± although severe infections were noticed in children [25] 0.2 °C for HBoV-3. PCR amplification and data analysis and patients with underlying diseases like cancer [26]. In were performed by CFX 96 Realtime PCR machine (Bio- this study, we specifically aimed to investigate the Rad). The genome copy numbers of bocavirus genotypes Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 3 of 7 Table 1 Primer sequences of HBoVs, AdV, and RoV Virus Target gene Primer name Sequence (5′–3′) Fragment length (bp) References HBoV-1 NP1 NP1-F2421 TGGCAGACAACTCATCACAG 123 [22] NP1- R2544 TCTTCGAAGCAGTGCAAGAC HBoV-2/4 NS1 HBoV234F GCACTTCCGCATYTCGTCAG 100 [29] HBoV24R AGCAGAAAAGGCCATAGTGTCA HBoV-3 NS1 HBoV234F GCACTTCCGCATYTCGTCAG 100 HBoV3R GTGGATTGAAAGCCATAATTTGA RoV VP6 VP6-F GACGGVGCRACTACATGGT 382 [40] VP6-R GTCCAATTCATNCCTGGTG VP6-NF GCTAGAAATTTTGATACA 147 VP6-NR TCTGCAGTTTGTGAATC AdV Hexon HexAA1885 GCCGCAGTGGTCTTACATGCACATC 300 [31] Hex1913 CAGCACGCCGCGGATGTCAAAGT (HBoV-1, HBoV-2/4, and HBoV-3) were determined by examination (direct wet-mount preparation) [32] to dif- comparison with a standard curve generated with serial ferentiate whether AGE originated from HBoV or other dilutions of positive control of the PCR product from causative agents. each genotype. The PCR product was purified using Wizard® SV Gel and the PCR Clean-Up System (Pro- 2.7 Statistical analyses mega, USA). Nucleic acid concentrations of the purified Statistical analyses were performed using GraphPad PCR products were determined by NanoDrop Prism version 8.3.0 software (USA). The critical P value Fluorospectrometer (Thermo-Scientific, USA). The for the test was set at < 0.05. One-way ANOVA shows DNA concentration was converted to genomic copies the significant difference between the relative distribu- using the following formula: number of DNA copies = tion of different bocavirus genotypes in total, male and (DNA amount (ng) × 6.022 × 10 )/(length (bp) × 1 × female stool samples. The unpaired t test was used to 10 × 650). compare each HBoV genotype in male versus female The standard curve of each bocavirus was separately stool samples. prepared by tenfold serial dilution of the nucleic acid 1 7 standard ranging from 5 × 10 to 5 × 10 copies/reac- 3 Results tion. For HBoV-1 and HBoV-3, the slop was − 3.69; the 2 3.1 Detection and quantification of human bocaviruses coefficient of determination (R ) was 0.99. In the case of In the present study, human bocavirus genotypes were HBoV-2/4, the mean value of the slope was − 3.45; the 2 detected in 58% (59 of 102, P< 0.05) of the children mean of R was 0.99. Virus concentration per gram (g) stool samples using qPCR, which targets NP-1 and NS-1 GC/g was calculated according to the following equa- genes. Statistically, the viral type showed a significant ef- tion: GC/g = GCxDF× 10, where GC is genome copy fect on the prevalence of HBoV in males (P = < 0.0001), number per reaction, DF is the dilution factor for the although no significant influence on the prevalence of volume reductions that occur during the concentration, the virus in females (P = 0.27). The detection rates of DNA extraction, and qPCR steps, and the obtained GC different HBoV genotypes are presented in Table 2. was expressed per gram of stool sample. 2.5 Detection of rotavirus and adenovirus 3.2 HBoV-1 The positive samples for HBoV were tested for RoV and HBoV-1 was detected in 31 out of 102 stool samples. AdV to determine the pathogen co-infections. RoV was The positive samples were 37% from males and 23% detected by using nested RT-PCR for the detection of from females, in accordance with the number of samples the VP6 segment [30]. AdV was detected according to collected from each gender (Table 2). Statistically, there Puig et al. [31] using primers based on the hexon gene was no significant difference between male and female (Table 1). patients who were infected with HBoV-1 (P = 0.22). In other words, gender had no significant effect on the 2.6 Detection of enteric protozoa and helminth parasites prevalence of HBoV-1. The average viral concentration 4 4 The positive samples for HBoV were tested for enteric was 1.0 × 10 GC/g in males and 1.3 × 10 GC/g in fe- protozoa and helminth parasites by microscopic males (Fig. 1). Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 4 of 7 Table 2 Detection rates of bocaviruses genotypes in stool samples of under five children, Giza, Egypt Prevalence n/N (%) Male Female Total Bocavirus infection HBoV-1 19/51 (37.3%) 12/51 (23.5%) 31/102 (30.4%) HBoV-2/4 20/51 (39.2 %) 14/51 (27.5%) 34/102 (33.3%) HBoV-3 25/51 (49 %) 20/51(39.2%) 45/102 (44.1%) One genotype (n = 20/59, 34%) HBoV-1 2/34 (5.9%) 1/25 (4%) 3/59 (5%) HBoV-2/4 4/34 (11.8%) 3/25(12%) 7/59 (12%) HBoV-3 5/34 (14.7%) 5/25(20%) 10/59 (17%) Two genotypes (n = 27/59, 46%) HBoV-1 + HBoV-2/4 3/34 (8.8%) 1/25 (4%) 4/59 (6.7%) HBoV-1 + HBoV-3 7/34 (20.6%) 5/25 (20%) 12/59 (20.3%) HBoV-2/4 + HBoV-3 6/34 (17.6%) 5/25 (20%) 11/59 (18.6%) Three genotypes (n = 12/59, 20%) HBoV-1 + HBoV-2/4+ HBoV-3 7/34 (20.6%) 5/25 (20%) 12/59 (20%) n number of bocavirus positive cases, N total number of cases 3.3 HBoV-2/4 HBoV-1 as well as HBoV-2/4 in males versus females. HBoV-2/4 virus was detected in 34 out of 102 samples. The mean virus concentration in male and female sam- 4 4 The prevalence of HBoV-2/4 was higher in males (39.2 ples reached 1.9 × 10 and 3.6 × 10 GC/g, respectively %) than females (27.5%) (Table 2). Similar to HBoV-1, (Fig. 1). no critical role played by the gender on the prevalence of HBoV-2/4 (P = 0.4254). The average viral concentra- 3.5 HBoV genotype co-infections 5 5 tions were 1.3 × 10 GC/g and 2.6 × 10 GC/g in males Among the positive samples, single genotypes detected and females, respectively (Fig. 1). in 34% (20/59) of HBoV positive cases and two or more genotypes detected in 66% (39/59) of HBoV positive 3.4 HBoV-3 cases. The most common mixed genotype cases were HBoV-3 showed a high prevalence (44.1%) in total sam- HBoV-1 and HBoV-3 (20.3%), followed by HBoV-2/4 ples compared to other HBoV types. The prevalence of and HBoV-3 (18.6%) and HBoV-1 andHBoV-2/4 (6.7%) HBoV-3 was higher in males (49 %) than females (Table 2). (39.2%) (Table 2). HBoV-3 had the same pattern as 3.6 HBoV and other enteric pathogen co-infections The positive samples for HBoV (n = 59) were screened for other viruses (i.e., AdV and RoV), protozoa, and parasitic helminths to explore whether AGE originated from bocavirus or other causative agents. The single in- fections of HBoV in males and females were 61.8% (21/ 34) and 40% (10/25), respectively, while the co- infections ratios of HBoV/AdV, HBoV/RoV, and HBoV/ RoV/AdV in males were 2.9 % (1/34), 26.5% (9/34), and 8.8% (3/34), respectively. In females, multiple infections of HBoV/RoV and HBoV/RoV/AdV account for 44% (11/25) and 16% (4/25), respectively (Fig. 2). Protozoa and parasitic helminths could not be detected in fecal samples of the children suffering from viral infections. 4 Discussion Fig. 1 Concentration of bocaviruses in male and female stool samples Different viruses including RoV, AdV, NoV, and AstV of under five children are the major cause of gastrointestinal disease Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 5 of 7 Fig. 2 Different infection types in HBoV-positive samples. A Total positive samples for HBoV (n = 59). B Males positive samples. C females positive samples worldwide, particularly in developing countries. Globally, infection with AdV and RoV, indicating the possible HBoV has been associated with about 5.9% of gastro- contribution of the virus in the pathogenicity. In con- intestinal illnesses and 6.3% of respiratory tract infec- trast, infection with HBoV in Pakistani children was not tions [6, 12] and has been reported in various studies as significantly associated with gastroenteritis alone where a potential cause of diarrhea outbreaks [33]. It was esti- 98% of HBoV reported cases had co-infection with RoV mated that 13% of African individuals suffering from [34]. The co-infection of HBoV and RoV (46%) in pa- gastroenteritis principally caused by HBoVs between tients with gastrointestinal infections has been recorded 2005 and 2016 [23]. To our knowledge, limited data are elsewhere [6]. In this study, mixed infections with the available about the incidence of HBoV in Egyptian chil- three viruses (HBoV, AdV and RoV) were detected in dren. Only two clinical studies were reported in Egypt; 11.9% of HBoV-positive samples. Likewise, the mixed in- the first study found HBoV in Children with AGE [13]. fections with (Aichivirus, sapovirus, human parecho- The second study observed HBoV-1 in children suffering viruses, bocavirus, and rotaviruses) were detected in from lower respiratory tract infections without providing 45.4% of the stool samples from Indian children < 5 years any data about different genotypes in the given cases of age hospitalized for acute gastroenteritis [28]. [27]. However, HBoV-1, HBoV-2, and HBoV-3 were de- In the present study, the prevalence of HBoV in chil- tected in environmental samples from Egypt [19]. There- dren suffering from AGE was 58% which is higher than fore, it is crucial to determine the prevalence of HBoV the previous reports of AGE associated with HBoV in genotypes in children < 5 years of age, who are most vul- Egypt (2%) [13], Brazil (24 and 42%) [35], and Taiwan nerable to HBoV infections. (8.5%) [36]. This difference in detection rate could be at- Our results showed that the proportion of the single tributed to the difference of sensitivity of the detection infection of HBoV (52.5%, 31/59) was higher than co- method, geographical region, hygiene and sanitary Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 6 of 7 conditions, and/or the sample size of the study. HBoV the viral loads were higher in females than in males. has been detected in stool samples of both children and HBoV-3 was the most abundant among HBoV geno- adults; however, children ≤ 2 years of age were found to types. Higher proportions of multiple co-infection of be most susceptible to HBoV infection [23]. In our HBoV genotypes were recorded compared to single in- study, we detected HBoV-1, HBoV2/4, and HBoV-3. fections. The viral type had a strong significant effect on Likewise, all genotypes have been detected in USA (chil- the prevalence of HBoV rather than human gender. dren), Finland (children/adults), Japan (children), Kenya Moreover, the concentration of HBoV-2/4 was higher (children/adults), and Turkey (children) [23]. The most than HBoV-1 as well as HBoV-3. Taken together, the abundant HBoV type in the current study was HBoV3. data obtained in our study raise a concern on the role of In contrast, HBoV1 was the most prevalent in urban and HBoV in gastrointestinal illness. rural settings followed by HBoV-2 [12, 23, 34]. The dif- Abbreviations ferences in HBoV genotypes abundance may be due to ANOVA: Analysis of variance; HBoV: Human bocavirus; AGE: Acute regional differences in viral epidemiology or because not gastroenteritis; AdV: Adenovirus; RoV: Rotavirus; NoV: Norovirus; SaV: Sapovirus; AstV: Astrovirus; GC/g: Gene copy per gram; RPM: Revolutions all the studies tested all HBoV genotypes or the lately per minute; n: Number; P: P value; RT-PCR: Reverse transcription polymerase discovered genotypes (i.e., HBoV-2/4 and HBoV-3) com- chain reaction; DF: Dilution factor; ORFs: Open reading frames; qPCR: Real- pared to HBoV-1. HBoV was found in 9% of nasopha- time PCR; R : The coefficient of determination; UK: United Kingdom; USA: United States of America ryngeal swabs obtained from children with acute respiratory tract infection in Alexandria, Egypt [37]. The Acknowledgements HBoV-1 was the only genotype detected, suggesting that Not applicable. a single genetic lineage of HBoV is circulating in Egypt Authors’ contributions [37]. However, in the present study, HBoV-3 was the NR: conceptualization, formal analysis, writing—original draft, visualization, most abundant genotype which could be due to the dif- funding acquisition. SA: validation, writing—review and editing, study concept and design. TF: investigation, writing-review, interpretation of the ference in samples types. Furthermore, the relative abun- data. MA: investigation, visualization, writing-review. AA: methodology, para- dance of HBoV-2 and HBoV-3 compared to HBoV-1 sitology analysis and review. IH: conceptualization, methodology, supervision may be due to differences in tissue tropism or pathogen- and writing the manuscript. All authors have read and approved the manuscript. esis among HBoV genotypes, which may affect transmis- sion and persistence. Funding In the present study, the viral incidence was higher in This study was funded by National Research Centre, Cairo, Egypt, project males 66.6% than females 49% and the difference was number 12030103. statistically non-significant (p > 0.05). The current re- Availability of data and materials sults agree with the study of Nawaz et al. [38] from the The datasets used and analyzed during the current study are available from UK, who reported that the distribution of HBoV among the corresponding author upon reasonable request. females and males was not significantly different, which Declarations recorded 53% and 47% in females and males, respect- ively. Similarly in Brazil, the researchers found that 57% Ethical approval and consent to participate Ethical approval and consent to participate: The study was conducted with of HBoV positive cases were detected in boys and 43% the approval of The Medical Research Ethics Committee (MREC), National were detected in girls [39]. In another study in Pakistan, Research Centre, Egypt (approval no. 20-165). A written informed consent the researchers found HBoV infection rates were higher was obtained from all participants’ parents after explaining the aim of the study. in males (68%) as compared to females (32%) [34]. Consent for publication 4.1 Limitations of the study Not applicable. Our study had some limitations such as the lack of a Competing interests healthy control group and screening of other enteric The authors declared that there was no conflict of interest. pathogens (e.g., bacteria, sapovirus, norovirus, or Author details astrovirus). Water Pollution Research Department, National Research Centre, 33 El Buhouth St., Dokki, Giza 12622, Egypt. Pediatric Department, National 5 Conclusions Research Centre, 33 El Buhouth St., Dokki, Giza 12622, Egypt. The presence of HBoV in some children suffering from Received: 11 December 2020 Accepted: 22 June 2021 AGE without the association of any other etiological agents (i.e., AdV, RoV, protozoa and parasitic helminths) indicates the ability of the virus to cause the disease. References 1. Liu L, Oza S, Hogan D, Chu Y, Perin J, Zhu J, et al. Global, regional, and HBoV was abundant in stool samples from children with national causes of under-5 mortality in 2000-15: an updated systematic gastrointestinal disease in Egypt. Higher infection rates analysis with implications for the Sustainable Development Goals. Lancet. were detected in males rather than females. However, 2016;388(10063):3027–35. Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 7 of 7 2. Green RJ. Viral infections in children, volume II. Publishing SI, editor. Viral 25. Heydari H, Mamishi S, Khotaei G-T, Moradi S. Fatal type 7 adenovirus Infections in Children, Volume II. 2017. 1–224 p. associated with human bocavirus infection in a healthy child. J Med Virol. 3. De R, Liu L, Qian Y, Zhu R, Deng J, Wang F, et al. Risk of acute 2011;83(10):1762–3. gastroenteritis associated with human bocavirus infection in children: a 26. Kupfer B, Vehreschild J, Cornely O, Kaiser R, Plum G, Viazov S, et al. Severe systematic review and meta-analysis. PLoS One. 2017;12(9):e0184833. pneumonia and human bocavirus in adult. Emerg Infect Dis. 2006;12(10): 1614–6. 4. Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson 27. Abdel-Moneim AS, Kamel MM, Hamed DH, Hassan SS, Soliman MS, Al- B. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA. 2005;102(36):12891–6. Quraishy SA, et al. A novel primer set for improved direct gene sequencing of human bocavirus genotype-1 from clinical samples. J Virol Methods. 5. Schildgen O, Qiu J, Sderlund-Venermo M. Genomic features of the human 2016;228:108–13. bocaviruses. Future Virol. 2012;7(1):31–9. 28. Tatte VS, Gopalkrishna V. Detection of different enteric viruses in children 6. Guido M, Tumolo MR, Verri T, Romano A, Serio F, De Giorgi M, et al. Human with diarrheal disease: evidence of the high frequency of mixed infections. bocavirus: current knowledge and future challenges. World J Gastroenterol. Access Microbiol. 2019;1(2):e000010. 2016;22(39):8684–97. 29. Kantola K, Sadeghi M, Antikainen J, Kirveskari J, Delwart E, Hedman K, et al. 7. Bonzel L, Tenenbaum T, Schroten H, Schildgen O, Schweitzer-Krantz S, Real-time quantitative PCR detection of four human bocaviruses. J Clin Adams O. Frequent detection of viral coinfection in children hospitalized Microbiol. 2010;48(11):4044–50. with acute respiratory tract infection using a real-time polymerase chain 30. Iturriza-Gómara M, Dallman T, Bányai K, Böttiger B, Buesa J, Diedrich S, et al. reaction. Pediatr Infect Dis J. 2008;27(7):589–94. Rotavirus genotypes co-circulating in Europe between 2006 and 2009 as 8. Albuquerque MCM, Pena GPA, Varella RB, Gallucci G, Erdman D, Santos N. determined by EuroRotaNet, a pan-European collaborative strain Novel respiratory virus infections in children. Brazil. Emerg Infect Dis. 2009; surveillance network. Epidemiol Infect. 2011;139(6):895–909. 15(5):806–8. 31. Puig M, Jofre J, Lucena F, Allard A, Wadell G, Girones R. Detection of 9. Ghietto LM, Cámara A, Cámara J, Adamo MP. High frequency of human adenoviruses and enteroviruses in polluted waters by nested PCR bocavirus 1 DNA in infants and adults with lower acute respiratory amplification. Appl Environ Microbiol. 1994;60(8):2963–70. infection. J Med Microbiol. 2012;61(4):548–51. 32. Garcia LS, Arrowood M, Kokoskin E, Paltridge GP, Pillai DR, Procop GW, et al. 10. Kaplan NM, Dove W, Abu-Zeid AF, Shamoon HE, Abd-Eldayem SA, Hart CA. Laboratory diagnosis of parasites from the gastrointestinal tract. Clin Human bocavirus infection among children. Jordan Emerg Infect Dis. 2006; Microbiol Rev. 2018;31(1):1–81. 12(9):1418–20. 33. Bastien N, Brandt K, Dust K, Ward D, Li Y. Human Bocavirus infection, 11. Pham NTK, Trinh QD, Chan-It W, Khamrin P, Nishimura S, Sugita K, et al. Canada. Emerg Infect Dis. 2006;12(5):848–50. Human bocavirus infection in children with acute gastroenteritis in Japan 34. Alam MM, Khurshid A, Shaukat S, Sharif S, Suleman RM, Angez M, et al. and Thailand. J Med Virol. 2011;83(2):286–90. Human bocavirus in Pakistani children with gastroenteritis. J Med Virol. 12. Arthur JL, Higgins GD, Davidson GP, Givney RC, Ratcliff RM. A novel 2015;87(4):656–63. bocavirus associated with acute gastroenteritis in Australian children. PLoS 35. Soares LS, Lima ABF, Pantoja KC, Lobo PS, Cruz JF, Guerra SFS, et al. Pathog. 2009;5(4):e1000391. Molecular epidemiology of human bocavirus in children with acute 13. El-Mosallamy WA, Awadallah MG, Abd El-Fattah MD. Human bocavirus gastroenteritis from north region of Brazil. J Med Microbiol. 2019;68(8): among viral causes of infantile gastroenteritis. Egypt J Med Microbiol. 2015; 1233–9. 24(3):53–9. 36. Lin MYC, Chan HC, Chi H, Chiu SC, Nora-Krukle Z, Rasa-Dzelzkaleja S, et al. 14. Misigo D, Mwaengo D, Mburu D. Molecular detection and phylogenetic Genetic diversity and phylogenetic analysis of human bocavirus 2 in analysis of Kenyan human bocavirus isolates. J Infect Dev Ctries. 2014; 8(2): pediatric patients with acute gastroenteritis in Taiwan. Int J Environ Res 221–7. Public Health. 2020;17(3):1–9. 15. Nunes MC, Kuschner Z, Rabede Z, Madimabe R, Van Niekerk N, Moloi J, 37. Abozahra R, Abdelhamid SM, Khairy K, Baraka K. Detection and phylogenetic et al. Clinical epidemiology of bocavirus, rhinovirus, two polyomaviruses analysis of human bocavirus in children diagnosed with acute respiratory and four coronaviruses in HIV-infected and HIV-uninfected South African tract infection. J Med Microbiol. 2020;69(9):1197–202. children. PLoS One. 2014;9(2):e86448. 38. Nawaz S, Allen DJ, Aladin F, Gallimore C, Iturriza-Gómara M. Human 16. Koseki N, Teramoto S, Kaiho M, Gomi-Endo R, Yoshioka M, Takahashi Y, et al. bocaviruses are not significantly associated with gastroenteritis: Results of Detection of human bocaviruses 1 to 4 from nasopharyngeal swab samples retesting archive DNA from a case control study in the UK. PLoS One. 2012; collected from patients with respiratory tract infections. J Clin Microbiol. 7(7):e41346. 2012;50(6):2118–21. 39. Albuquerque MCM, Rocha LN, Benati F, Soares CC, Maranhão AG, Ramirez 17. Okitsu S, Khamrin P, Takanashi S, Thongprachum A, Hoque SA, Takeuchi H, ML, et al. Human bocavirus infection in children with gastroenteritis, Brazil. et al. Molecular detection of enteric viruses in the stool samples of children Emerg Infect Dis. 2007;13(11):1756–8. without diarrhea in Bangladesh. Infect Genet Evol. 2020;77:104055. 40. Gray J, Iturriza-Gómara M. Rotaviruses. Methods Mol Biol. 2011;665:325–55. 18. Hamza IA, Jurzik L, Stang A, Sure K, Überla K, Wilhelm M. Detection of human viruses in rivers of a densly-populated area in Germany using a virus adsorption elution method optimized for PCR analyses. Water Res. 2009; Publisher’sNote 43(10):2657–68. Springer Nature remains neutral with regard to jurisdictional claims in 19. Hamza H, Leifels M, Wilhelm M, Hamza IA. Relative abundance of human published maps and institutional affiliations. bocaviruses in urban sewage in Greater Cairo. Egypt. Food Environ Virol. 2017;9(3):304–13. 20. Netshikweta R, Chidamba L, Nadan S, Taylor MB, Page NA. Molecular epidemiology of human bocavirus infection in hospitalized children with acute gastroenteritis in South Africa, 2009-2015. J Med Virol. 2020;92(8): 1124–32. 21. Ong DSY, Schuurman R, Heikens E. Human bocavirus in stool: a true pathogen or an innocent bystander? J Clin Virol. 2016;74:45–9. 22. Durigon GS, Oliveira DBL, Vollet SB, Storni JG, Felício MCC, Finelli C, et al. Hospital-acquired human bocavirus in infants. J Hosp Infect. 2010;76(2): 171–3. 23. Rikhotso MC, Kabue JP, Ledwaba SE, Traoré AN, Potgieter N. Prevalence of human bocavirus in Africa and other developing countries between 2005 and 2016: a potential emerging viral pathogen for diarrhea. J Trop Med. 2018;2018:7875482. 24. Schildgen O. Human bocavirus: lessons learned to date. Pathogens. 2013; 2(1):1–12. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of the Egyptian Public Health Association Springer Journals

Etiology of diarrheal disease among children under 5 years in Egypt: a high incidence of human bocavirus

Loading next page...
 
/lp/springer-journals/etiology-of-diarrheal-disease-among-children-under-5-years-in-egypt-a-NuCVmROkqE
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2021
eISSN
2090-262X
DOI
10.1186/s42506-021-00084-z
Publisher site
See Article on Publisher Site

Abstract

Background: Human bocavirus (HBoV) is globally distributed and associated with respiratory and enteric infections. Limited data are available about the incidence of HBoV in Egyptian children. We aimed to investigate the association of HBoV genotypes in children with diarrheal disease and also to determine the possibility of HBoV co-infections with other human enteric pathogens. Methods: A total of 102 stool samples were collected from children under five years old with diarrhea. Samples were analyzed for the presence of HBoV by real-time PCR. HBoV positive samples were tested for adenovirus (AdV), rotavirus (RoV), parasitic helminths, and enteric protozoa. Results: HBoV was detected in 58% of examined cases. HBoV-3 was the most prevalent genotype observed (44%; 45 of 102), followed by HBoV-2/4 (33%; 34 of 102) and HBoV-1 (30%; 31 of 102). Although the incidence of HBoV was higher in males (66.6%; 34 of 51) than females (49%; 25 of 51), the analysis showed no significant difference for HBoV 4 5 between genders. The average HBoV concentrations were 5.3 × 10 GC/g in males and 1.03 × 10 GC/g in females. Among the HBoV-positive samples, the single infection of HBoV was 52.5% (31/59), while the co-infections with multiple viruses were found in 1.7% (1/59) for HBoV and AdV, 33.9% (20/59) for HBoV and RoV, and 11.9% (7/59) for HBoV, and RoV and AdV. No co-infection with parasitic helminths or enteric protozoa was found. Conclusions: The single infection of HBoV in some children suffering from acute gastroenteritis indicated that HBoV could be the main etiologic agent of the disease. The study highlights the high incidence of HBoVs genotypes with remarkable multiple co-infections in the pre-school children in Egypt. Keywords: Human bocaviruses, Adenovirus, Rotavirus, Co-infections, diarrhea, qPCR 1 Introduction uncommon in high-income countries, but diarrhea is Diarrheal disease is the second most common cause of often associated with substantial medical and healthcare mortality worldwide in children less than 5 years and it costs. Viral diarrhea is a prevalent type of diarrhea in is estimated that 600,000–700,000 infants and young the world affecting patients of all ages, especially chil- children die from diarrhea each year. Most of the deaths dren [1]. Enteric viruses are the most frequent common occur in Sub-Saharan Africa and South Asia and mortal- pathogens causing diarrhea in high-income as well as ity is high in children less than 5 years [1]. Mortality is low-income countries [2]. The most common agents are rotavirus (RoV), adenovirus (AdV), norovirus (NoV), * Correspondence: ibrahimnrc@gmail.com sapovirus (SaV), and astrovirus (AstV). Additionally, Neveen M. Rizk and Sherif Abd-Elmaksoud contributed equally to this work. bocaviruses (HBoVs) are increasingly being identified as Water Pollution Research Department, National Research Centre, 33 El causative agents of diarrhea [3]. However, little attention Buhouth St., Dokki, Giza 12622, Egypt Full list of author information is available at the end of the article for HBoVs as a causative agent of diarrhea has been © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 2 of 7 received so far, particularly the co-infections pattern of association of HBoV genotypes in children with AGE up different HBoVs genotypes in pre-school children. to 5 years. Also, we screened the positive HBoV samples Human bocavirus (HBoV) was discovered in 2005 [4]. for AdV, RoV, parasitic helminths, and enteric protozoa HBoV is a member of the family Parvoviridae, subfamily to determine whether the causative agent of diarrhea in Parvovirinae, genus Bocaparvovirus. Four HBoV geno- the collected samples is HBoV or co-infection with other types (HBoV-1-HBoV-4) have been identified and char- pathogens. acterized by a 5.3 kb single-stranded DNA genome, encapsulated in a non-enveloped icosahedral capsid pro- 2 Methods tein coat [5]. The genome of HBoV has three open read- 2.1 Sample collection ing frames (ORFs), encoding two nonstructural proteins A total of 102 stool samples were collected anonymously NS1 and NP1 and two viral capsid proteins VP1 and from preschool children (51 samples from males and 51 VP2 [6]. samples from females) from private clinics in Giza, Egypt. A plethora of studies detected HBoVs in Europe [7], The samples were collected from children under 5 years North America [8], South America [9], the Middle East of age suffering from acute watery diarrhea. Stool samples [10], Asia [11], and Australia [12]. In African countries, were examined immediately at the same day for parasites HBoVs have been reported in Egypt 2% (2/100 children identification. In order to avoid repeated freezing and of age from 1 month to 2 years) [13], Kenya 1.8% (7/384 thawing, stool samples were aliquoted, stored at − 20 °C, children/adults) [14], and South Africa 22.8% (174/1460 and tested within a month from collection for HBoV. children < 2 years) [15]. As yet, little is still known about the prevalence of HBoV and its genotypes in Egypt, par- 2.2 Sample concentration and processing ticularly in children. About 100 mg of fecal diarrhea samples were weighed HBoVs cause a variety of clinical manifestation and and diluted in phosphate buffer saline (1:10). The sam- could be isolated from several types of clinical samples ples were vortexed for 30 s followed by centrifugation at including nasopharyngeal aspirates [12, 16] and stool 5000 rpm for 10 min at room temperature. The superna- [17]. Furthermore, HBoVs was also found in environ- tants were kept at − 80 °C until further use. mental waters [18, 19]. HBoV-1 is commonly associated with respiratory tract infections in pediatric patients, as 2.3 Nucleic acid extraction well as in those with gastrointestinal symptoms [20]. In Viral nucleic acids were extracted from 200 μl of the contrast, the other three genotypes (HBoV2-4) are found concentrated sample using GeneJET Viral DNA and mainly in stool samples from patients suffering from RNA Purification kit (Thermo Scientific-USA) according gastroenteritis [21]. to the manufacturer’s instructions. The obtained nucleic The association of HBoV with respiratory disease and acid was dissolved in 60 μl of eluent and kept at – 80 °C acute gastroenteritis remains unclear due to the high until use. rate of co-infection with other pathogenic viruses in symptomatic patients, as well as its frequent detection in 2.4 Detection and quantification of HBoV by qPCR asymptomatic individuals [6, 21]. However, HBoV was All primers used in the current study were listed in isolated from hospitalized infants suffering from respira- Table 1. The quantification protocol targeting the NP1 tory infections, without other respiratory viruses (i.e., gene for HBoV-1 was used according to Hamza et al. adenovirus, respiratory syncytial virus, parainfluenza [18]. A single sense primer was shared in HBoV-2, 3, virus 1, 2, and 3, human metapneumovirus, influenza and 4 quantifications and the qPCR of HBoV-2 and 4 virus A and B) [22]. Moreover, some reports found sin- used the same antisense primer [29]. SYBR green qPCR gle infection of HBoV in the stool of infected patients assay was conducted for HBoVs quantification using a with acute gastroenteritis (AGE), particularly among Maxima SYBR Green qPCR Master Mix Kit (Thermo children under 5 years of age [3, 23]. However, all chil- Scientifc). The PCR conditions were 10 min initial de- dren of different ages are at risk of HBoV infection as a naturation step at 95 °C, 40 cycles of denaturation at 95 result of poor hygiene practices and sanitation [23]. It is °C for 15 s and annealing-extension at 60 °C for 1 min. suspected that HBoV enters the bloodstream after a long Amplification was followed by one cycle of melting period of persistence in the mucosa of the respiratory curve analysis. Dissociation was carried out from 60 °C tract and migrates to the gastrointestinal tract, where it to 95 °C with a temperature ramp of 0.05 °C/s. Analysis may either produce new infection or be excreted asymp- indicated a melting peak (Tm) at 83 °C ± 0.2 °C for tomatically [24]. HBoVs can infect all human age groups, HBoV-1, 81.5 °C ± 0.3 °C for HBoV 2/4, and 80 °C ± although severe infections were noticed in children [25] 0.2 °C for HBoV-3. PCR amplification and data analysis and patients with underlying diseases like cancer [26]. In were performed by CFX 96 Realtime PCR machine (Bio- this study, we specifically aimed to investigate the Rad). The genome copy numbers of bocavirus genotypes Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 3 of 7 Table 1 Primer sequences of HBoVs, AdV, and RoV Virus Target gene Primer name Sequence (5′–3′) Fragment length (bp) References HBoV-1 NP1 NP1-F2421 TGGCAGACAACTCATCACAG 123 [22] NP1- R2544 TCTTCGAAGCAGTGCAAGAC HBoV-2/4 NS1 HBoV234F GCACTTCCGCATYTCGTCAG 100 [29] HBoV24R AGCAGAAAAGGCCATAGTGTCA HBoV-3 NS1 HBoV234F GCACTTCCGCATYTCGTCAG 100 HBoV3R GTGGATTGAAAGCCATAATTTGA RoV VP6 VP6-F GACGGVGCRACTACATGGT 382 [40] VP6-R GTCCAATTCATNCCTGGTG VP6-NF GCTAGAAATTTTGATACA 147 VP6-NR TCTGCAGTTTGTGAATC AdV Hexon HexAA1885 GCCGCAGTGGTCTTACATGCACATC 300 [31] Hex1913 CAGCACGCCGCGGATGTCAAAGT (HBoV-1, HBoV-2/4, and HBoV-3) were determined by examination (direct wet-mount preparation) [32] to dif- comparison with a standard curve generated with serial ferentiate whether AGE originated from HBoV or other dilutions of positive control of the PCR product from causative agents. each genotype. The PCR product was purified using Wizard® SV Gel and the PCR Clean-Up System (Pro- 2.7 Statistical analyses mega, USA). Nucleic acid concentrations of the purified Statistical analyses were performed using GraphPad PCR products were determined by NanoDrop Prism version 8.3.0 software (USA). The critical P value Fluorospectrometer (Thermo-Scientific, USA). The for the test was set at < 0.05. One-way ANOVA shows DNA concentration was converted to genomic copies the significant difference between the relative distribu- using the following formula: number of DNA copies = tion of different bocavirus genotypes in total, male and (DNA amount (ng) × 6.022 × 10 )/(length (bp) × 1 × female stool samples. The unpaired t test was used to 10 × 650). compare each HBoV genotype in male versus female The standard curve of each bocavirus was separately stool samples. prepared by tenfold serial dilution of the nucleic acid 1 7 standard ranging from 5 × 10 to 5 × 10 copies/reac- 3 Results tion. For HBoV-1 and HBoV-3, the slop was − 3.69; the 2 3.1 Detection and quantification of human bocaviruses coefficient of determination (R ) was 0.99. In the case of In the present study, human bocavirus genotypes were HBoV-2/4, the mean value of the slope was − 3.45; the 2 detected in 58% (59 of 102, P< 0.05) of the children mean of R was 0.99. Virus concentration per gram (g) stool samples using qPCR, which targets NP-1 and NS-1 GC/g was calculated according to the following equa- genes. Statistically, the viral type showed a significant ef- tion: GC/g = GCxDF× 10, where GC is genome copy fect on the prevalence of HBoV in males (P = < 0.0001), number per reaction, DF is the dilution factor for the although no significant influence on the prevalence of volume reductions that occur during the concentration, the virus in females (P = 0.27). The detection rates of DNA extraction, and qPCR steps, and the obtained GC different HBoV genotypes are presented in Table 2. was expressed per gram of stool sample. 2.5 Detection of rotavirus and adenovirus 3.2 HBoV-1 The positive samples for HBoV were tested for RoV and HBoV-1 was detected in 31 out of 102 stool samples. AdV to determine the pathogen co-infections. RoV was The positive samples were 37% from males and 23% detected by using nested RT-PCR for the detection of from females, in accordance with the number of samples the VP6 segment [30]. AdV was detected according to collected from each gender (Table 2). Statistically, there Puig et al. [31] using primers based on the hexon gene was no significant difference between male and female (Table 1). patients who were infected with HBoV-1 (P = 0.22). In other words, gender had no significant effect on the 2.6 Detection of enteric protozoa and helminth parasites prevalence of HBoV-1. The average viral concentration 4 4 The positive samples for HBoV were tested for enteric was 1.0 × 10 GC/g in males and 1.3 × 10 GC/g in fe- protozoa and helminth parasites by microscopic males (Fig. 1). Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 4 of 7 Table 2 Detection rates of bocaviruses genotypes in stool samples of under five children, Giza, Egypt Prevalence n/N (%) Male Female Total Bocavirus infection HBoV-1 19/51 (37.3%) 12/51 (23.5%) 31/102 (30.4%) HBoV-2/4 20/51 (39.2 %) 14/51 (27.5%) 34/102 (33.3%) HBoV-3 25/51 (49 %) 20/51(39.2%) 45/102 (44.1%) One genotype (n = 20/59, 34%) HBoV-1 2/34 (5.9%) 1/25 (4%) 3/59 (5%) HBoV-2/4 4/34 (11.8%) 3/25(12%) 7/59 (12%) HBoV-3 5/34 (14.7%) 5/25(20%) 10/59 (17%) Two genotypes (n = 27/59, 46%) HBoV-1 + HBoV-2/4 3/34 (8.8%) 1/25 (4%) 4/59 (6.7%) HBoV-1 + HBoV-3 7/34 (20.6%) 5/25 (20%) 12/59 (20.3%) HBoV-2/4 + HBoV-3 6/34 (17.6%) 5/25 (20%) 11/59 (18.6%) Three genotypes (n = 12/59, 20%) HBoV-1 + HBoV-2/4+ HBoV-3 7/34 (20.6%) 5/25 (20%) 12/59 (20%) n number of bocavirus positive cases, N total number of cases 3.3 HBoV-2/4 HBoV-1 as well as HBoV-2/4 in males versus females. HBoV-2/4 virus was detected in 34 out of 102 samples. The mean virus concentration in male and female sam- 4 4 The prevalence of HBoV-2/4 was higher in males (39.2 ples reached 1.9 × 10 and 3.6 × 10 GC/g, respectively %) than females (27.5%) (Table 2). Similar to HBoV-1, (Fig. 1). no critical role played by the gender on the prevalence of HBoV-2/4 (P = 0.4254). The average viral concentra- 3.5 HBoV genotype co-infections 5 5 tions were 1.3 × 10 GC/g and 2.6 × 10 GC/g in males Among the positive samples, single genotypes detected and females, respectively (Fig. 1). in 34% (20/59) of HBoV positive cases and two or more genotypes detected in 66% (39/59) of HBoV positive 3.4 HBoV-3 cases. The most common mixed genotype cases were HBoV-3 showed a high prevalence (44.1%) in total sam- HBoV-1 and HBoV-3 (20.3%), followed by HBoV-2/4 ples compared to other HBoV types. The prevalence of and HBoV-3 (18.6%) and HBoV-1 andHBoV-2/4 (6.7%) HBoV-3 was higher in males (49 %) than females (Table 2). (39.2%) (Table 2). HBoV-3 had the same pattern as 3.6 HBoV and other enteric pathogen co-infections The positive samples for HBoV (n = 59) were screened for other viruses (i.e., AdV and RoV), protozoa, and parasitic helminths to explore whether AGE originated from bocavirus or other causative agents. The single in- fections of HBoV in males and females were 61.8% (21/ 34) and 40% (10/25), respectively, while the co- infections ratios of HBoV/AdV, HBoV/RoV, and HBoV/ RoV/AdV in males were 2.9 % (1/34), 26.5% (9/34), and 8.8% (3/34), respectively. In females, multiple infections of HBoV/RoV and HBoV/RoV/AdV account for 44% (11/25) and 16% (4/25), respectively (Fig. 2). Protozoa and parasitic helminths could not be detected in fecal samples of the children suffering from viral infections. 4 Discussion Fig. 1 Concentration of bocaviruses in male and female stool samples Different viruses including RoV, AdV, NoV, and AstV of under five children are the major cause of gastrointestinal disease Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 5 of 7 Fig. 2 Different infection types in HBoV-positive samples. A Total positive samples for HBoV (n = 59). B Males positive samples. C females positive samples worldwide, particularly in developing countries. Globally, infection with AdV and RoV, indicating the possible HBoV has been associated with about 5.9% of gastro- contribution of the virus in the pathogenicity. In con- intestinal illnesses and 6.3% of respiratory tract infec- trast, infection with HBoV in Pakistani children was not tions [6, 12] and has been reported in various studies as significantly associated with gastroenteritis alone where a potential cause of diarrhea outbreaks [33]. It was esti- 98% of HBoV reported cases had co-infection with RoV mated that 13% of African individuals suffering from [34]. The co-infection of HBoV and RoV (46%) in pa- gastroenteritis principally caused by HBoVs between tients with gastrointestinal infections has been recorded 2005 and 2016 [23]. To our knowledge, limited data are elsewhere [6]. In this study, mixed infections with the available about the incidence of HBoV in Egyptian chil- three viruses (HBoV, AdV and RoV) were detected in dren. Only two clinical studies were reported in Egypt; 11.9% of HBoV-positive samples. Likewise, the mixed in- the first study found HBoV in Children with AGE [13]. fections with (Aichivirus, sapovirus, human parecho- The second study observed HBoV-1 in children suffering viruses, bocavirus, and rotaviruses) were detected in from lower respiratory tract infections without providing 45.4% of the stool samples from Indian children < 5 years any data about different genotypes in the given cases of age hospitalized for acute gastroenteritis [28]. [27]. However, HBoV-1, HBoV-2, and HBoV-3 were de- In the present study, the prevalence of HBoV in chil- tected in environmental samples from Egypt [19]. There- dren suffering from AGE was 58% which is higher than fore, it is crucial to determine the prevalence of HBoV the previous reports of AGE associated with HBoV in genotypes in children < 5 years of age, who are most vul- Egypt (2%) [13], Brazil (24 and 42%) [35], and Taiwan nerable to HBoV infections. (8.5%) [36]. This difference in detection rate could be at- Our results showed that the proportion of the single tributed to the difference of sensitivity of the detection infection of HBoV (52.5%, 31/59) was higher than co- method, geographical region, hygiene and sanitary Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 6 of 7 conditions, and/or the sample size of the study. HBoV the viral loads were higher in females than in males. has been detected in stool samples of both children and HBoV-3 was the most abundant among HBoV geno- adults; however, children ≤ 2 years of age were found to types. Higher proportions of multiple co-infection of be most susceptible to HBoV infection [23]. In our HBoV genotypes were recorded compared to single in- study, we detected HBoV-1, HBoV2/4, and HBoV-3. fections. The viral type had a strong significant effect on Likewise, all genotypes have been detected in USA (chil- the prevalence of HBoV rather than human gender. dren), Finland (children/adults), Japan (children), Kenya Moreover, the concentration of HBoV-2/4 was higher (children/adults), and Turkey (children) [23]. The most than HBoV-1 as well as HBoV-3. Taken together, the abundant HBoV type in the current study was HBoV3. data obtained in our study raise a concern on the role of In contrast, HBoV1 was the most prevalent in urban and HBoV in gastrointestinal illness. rural settings followed by HBoV-2 [12, 23, 34]. The dif- Abbreviations ferences in HBoV genotypes abundance may be due to ANOVA: Analysis of variance; HBoV: Human bocavirus; AGE: Acute regional differences in viral epidemiology or because not gastroenteritis; AdV: Adenovirus; RoV: Rotavirus; NoV: Norovirus; SaV: Sapovirus; AstV: Astrovirus; GC/g: Gene copy per gram; RPM: Revolutions all the studies tested all HBoV genotypes or the lately per minute; n: Number; P: P value; RT-PCR: Reverse transcription polymerase discovered genotypes (i.e., HBoV-2/4 and HBoV-3) com- chain reaction; DF: Dilution factor; ORFs: Open reading frames; qPCR: Real- pared to HBoV-1. HBoV was found in 9% of nasopha- time PCR; R : The coefficient of determination; UK: United Kingdom; USA: United States of America ryngeal swabs obtained from children with acute respiratory tract infection in Alexandria, Egypt [37]. The Acknowledgements HBoV-1 was the only genotype detected, suggesting that Not applicable. a single genetic lineage of HBoV is circulating in Egypt Authors’ contributions [37]. However, in the present study, HBoV-3 was the NR: conceptualization, formal analysis, writing—original draft, visualization, most abundant genotype which could be due to the dif- funding acquisition. SA: validation, writing—review and editing, study concept and design. TF: investigation, writing-review, interpretation of the ference in samples types. Furthermore, the relative abun- data. MA: investigation, visualization, writing-review. AA: methodology, para- dance of HBoV-2 and HBoV-3 compared to HBoV-1 sitology analysis and review. IH: conceptualization, methodology, supervision may be due to differences in tissue tropism or pathogen- and writing the manuscript. All authors have read and approved the manuscript. esis among HBoV genotypes, which may affect transmis- sion and persistence. Funding In the present study, the viral incidence was higher in This study was funded by National Research Centre, Cairo, Egypt, project males 66.6% than females 49% and the difference was number 12030103. statistically non-significant (p > 0.05). The current re- Availability of data and materials sults agree with the study of Nawaz et al. [38] from the The datasets used and analyzed during the current study are available from UK, who reported that the distribution of HBoV among the corresponding author upon reasonable request. females and males was not significantly different, which Declarations recorded 53% and 47% in females and males, respect- ively. Similarly in Brazil, the researchers found that 57% Ethical approval and consent to participate Ethical approval and consent to participate: The study was conducted with of HBoV positive cases were detected in boys and 43% the approval of The Medical Research Ethics Committee (MREC), National were detected in girls [39]. In another study in Pakistan, Research Centre, Egypt (approval no. 20-165). A written informed consent the researchers found HBoV infection rates were higher was obtained from all participants’ parents after explaining the aim of the study. in males (68%) as compared to females (32%) [34]. Consent for publication 4.1 Limitations of the study Not applicable. Our study had some limitations such as the lack of a Competing interests healthy control group and screening of other enteric The authors declared that there was no conflict of interest. pathogens (e.g., bacteria, sapovirus, norovirus, or Author details astrovirus). Water Pollution Research Department, National Research Centre, 33 El Buhouth St., Dokki, Giza 12622, Egypt. Pediatric Department, National 5 Conclusions Research Centre, 33 El Buhouth St., Dokki, Giza 12622, Egypt. The presence of HBoV in some children suffering from Received: 11 December 2020 Accepted: 22 June 2021 AGE without the association of any other etiological agents (i.e., AdV, RoV, protozoa and parasitic helminths) indicates the ability of the virus to cause the disease. References 1. Liu L, Oza S, Hogan D, Chu Y, Perin J, Zhu J, et al. Global, regional, and HBoV was abundant in stool samples from children with national causes of under-5 mortality in 2000-15: an updated systematic gastrointestinal disease in Egypt. Higher infection rates analysis with implications for the Sustainable Development Goals. Lancet. were detected in males rather than females. However, 2016;388(10063):3027–35. Rizk et al. Journal of the Egyptian Public Health Association (2021) 96:24 Page 7 of 7 2. Green RJ. Viral infections in children, volume II. Publishing SI, editor. Viral 25. Heydari H, Mamishi S, Khotaei G-T, Moradi S. Fatal type 7 adenovirus Infections in Children, Volume II. 2017. 1–224 p. associated with human bocavirus infection in a healthy child. J Med Virol. 3. De R, Liu L, Qian Y, Zhu R, Deng J, Wang F, et al. Risk of acute 2011;83(10):1762–3. gastroenteritis associated with human bocavirus infection in children: a 26. Kupfer B, Vehreschild J, Cornely O, Kaiser R, Plum G, Viazov S, et al. Severe systematic review and meta-analysis. PLoS One. 2017;12(9):e0184833. pneumonia and human bocavirus in adult. Emerg Infect Dis. 2006;12(10): 1614–6. 4. Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson 27. Abdel-Moneim AS, Kamel MM, Hamed DH, Hassan SS, Soliman MS, Al- B. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA. 2005;102(36):12891–6. Quraishy SA, et al. A novel primer set for improved direct gene sequencing of human bocavirus genotype-1 from clinical samples. J Virol Methods. 5. Schildgen O, Qiu J, Sderlund-Venermo M. Genomic features of the human 2016;228:108–13. bocaviruses. Future Virol. 2012;7(1):31–9. 28. Tatte VS, Gopalkrishna V. Detection of different enteric viruses in children 6. Guido M, Tumolo MR, Verri T, Romano A, Serio F, De Giorgi M, et al. Human with diarrheal disease: evidence of the high frequency of mixed infections. bocavirus: current knowledge and future challenges. World J Gastroenterol. Access Microbiol. 2019;1(2):e000010. 2016;22(39):8684–97. 29. Kantola K, Sadeghi M, Antikainen J, Kirveskari J, Delwart E, Hedman K, et al. 7. Bonzel L, Tenenbaum T, Schroten H, Schildgen O, Schweitzer-Krantz S, Real-time quantitative PCR detection of four human bocaviruses. J Clin Adams O. Frequent detection of viral coinfection in children hospitalized Microbiol. 2010;48(11):4044–50. with acute respiratory tract infection using a real-time polymerase chain 30. Iturriza-Gómara M, Dallman T, Bányai K, Böttiger B, Buesa J, Diedrich S, et al. reaction. Pediatr Infect Dis J. 2008;27(7):589–94. Rotavirus genotypes co-circulating in Europe between 2006 and 2009 as 8. Albuquerque MCM, Pena GPA, Varella RB, Gallucci G, Erdman D, Santos N. determined by EuroRotaNet, a pan-European collaborative strain Novel respiratory virus infections in children. Brazil. Emerg Infect Dis. 2009; surveillance network. Epidemiol Infect. 2011;139(6):895–909. 15(5):806–8. 31. Puig M, Jofre J, Lucena F, Allard A, Wadell G, Girones R. Detection of 9. Ghietto LM, Cámara A, Cámara J, Adamo MP. High frequency of human adenoviruses and enteroviruses in polluted waters by nested PCR bocavirus 1 DNA in infants and adults with lower acute respiratory amplification. Appl Environ Microbiol. 1994;60(8):2963–70. infection. J Med Microbiol. 2012;61(4):548–51. 32. Garcia LS, Arrowood M, Kokoskin E, Paltridge GP, Pillai DR, Procop GW, et al. 10. Kaplan NM, Dove W, Abu-Zeid AF, Shamoon HE, Abd-Eldayem SA, Hart CA. Laboratory diagnosis of parasites from the gastrointestinal tract. Clin Human bocavirus infection among children. Jordan Emerg Infect Dis. 2006; Microbiol Rev. 2018;31(1):1–81. 12(9):1418–20. 33. Bastien N, Brandt K, Dust K, Ward D, Li Y. Human Bocavirus infection, 11. Pham NTK, Trinh QD, Chan-It W, Khamrin P, Nishimura S, Sugita K, et al. Canada. Emerg Infect Dis. 2006;12(5):848–50. Human bocavirus infection in children with acute gastroenteritis in Japan 34. Alam MM, Khurshid A, Shaukat S, Sharif S, Suleman RM, Angez M, et al. and Thailand. J Med Virol. 2011;83(2):286–90. Human bocavirus in Pakistani children with gastroenteritis. J Med Virol. 12. Arthur JL, Higgins GD, Davidson GP, Givney RC, Ratcliff RM. A novel 2015;87(4):656–63. bocavirus associated with acute gastroenteritis in Australian children. PLoS 35. Soares LS, Lima ABF, Pantoja KC, Lobo PS, Cruz JF, Guerra SFS, et al. Pathog. 2009;5(4):e1000391. Molecular epidemiology of human bocavirus in children with acute 13. El-Mosallamy WA, Awadallah MG, Abd El-Fattah MD. Human bocavirus gastroenteritis from north region of Brazil. J Med Microbiol. 2019;68(8): among viral causes of infantile gastroenteritis. Egypt J Med Microbiol. 2015; 1233–9. 24(3):53–9. 36. Lin MYC, Chan HC, Chi H, Chiu SC, Nora-Krukle Z, Rasa-Dzelzkaleja S, et al. 14. Misigo D, Mwaengo D, Mburu D. Molecular detection and phylogenetic Genetic diversity and phylogenetic analysis of human bocavirus 2 in analysis of Kenyan human bocavirus isolates. J Infect Dev Ctries. 2014; 8(2): pediatric patients with acute gastroenteritis in Taiwan. Int J Environ Res 221–7. Public Health. 2020;17(3):1–9. 15. Nunes MC, Kuschner Z, Rabede Z, Madimabe R, Van Niekerk N, Moloi J, 37. Abozahra R, Abdelhamid SM, Khairy K, Baraka K. Detection and phylogenetic et al. Clinical epidemiology of bocavirus, rhinovirus, two polyomaviruses analysis of human bocavirus in children diagnosed with acute respiratory and four coronaviruses in HIV-infected and HIV-uninfected South African tract infection. J Med Microbiol. 2020;69(9):1197–202. children. PLoS One. 2014;9(2):e86448. 38. Nawaz S, Allen DJ, Aladin F, Gallimore C, Iturriza-Gómara M. Human 16. Koseki N, Teramoto S, Kaiho M, Gomi-Endo R, Yoshioka M, Takahashi Y, et al. bocaviruses are not significantly associated with gastroenteritis: Results of Detection of human bocaviruses 1 to 4 from nasopharyngeal swab samples retesting archive DNA from a case control study in the UK. PLoS One. 2012; collected from patients with respiratory tract infections. J Clin Microbiol. 7(7):e41346. 2012;50(6):2118–21. 39. Albuquerque MCM, Rocha LN, Benati F, Soares CC, Maranhão AG, Ramirez 17. Okitsu S, Khamrin P, Takanashi S, Thongprachum A, Hoque SA, Takeuchi H, ML, et al. Human bocavirus infection in children with gastroenteritis, Brazil. et al. Molecular detection of enteric viruses in the stool samples of children Emerg Infect Dis. 2007;13(11):1756–8. without diarrhea in Bangladesh. Infect Genet Evol. 2020;77:104055. 40. Gray J, Iturriza-Gómara M. Rotaviruses. Methods Mol Biol. 2011;665:325–55. 18. Hamza IA, Jurzik L, Stang A, Sure K, Überla K, Wilhelm M. Detection of human viruses in rivers of a densly-populated area in Germany using a virus adsorption elution method optimized for PCR analyses. Water Res. 2009; Publisher’sNote 43(10):2657–68. Springer Nature remains neutral with regard to jurisdictional claims in 19. Hamza H, Leifels M, Wilhelm M, Hamza IA. Relative abundance of human published maps and institutional affiliations. bocaviruses in urban sewage in Greater Cairo. Egypt. Food Environ Virol. 2017;9(3):304–13. 20. Netshikweta R, Chidamba L, Nadan S, Taylor MB, Page NA. Molecular epidemiology of human bocavirus infection in hospitalized children with acute gastroenteritis in South Africa, 2009-2015. J Med Virol. 2020;92(8): 1124–32. 21. Ong DSY, Schuurman R, Heikens E. Human bocavirus in stool: a true pathogen or an innocent bystander? J Clin Virol. 2016;74:45–9. 22. Durigon GS, Oliveira DBL, Vollet SB, Storni JG, Felício MCC, Finelli C, et al. Hospital-acquired human bocavirus in infants. J Hosp Infect. 2010;76(2): 171–3. 23. Rikhotso MC, Kabue JP, Ledwaba SE, Traoré AN, Potgieter N. Prevalence of human bocavirus in Africa and other developing countries between 2005 and 2016: a potential emerging viral pathogen for diarrhea. J Trop Med. 2018;2018:7875482. 24. Schildgen O. Human bocavirus: lessons learned to date. Pathogens. 2013; 2(1):1–12.

Journal

Journal of the Egyptian Public Health AssociationSpringer Journals

Published: Aug 5, 2021

Keywords: Human bocaviruses; Adenovirus; Rotavirus; Co-infections; diarrhea; qPCR

References