Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You and Your Team.

Learn More →

Distinct roles for Ste20-like kinase SLK in muscle function and regeneration

Distinct roles for Ste20-like kinase SLK in muscle function and regeneration Background: Cell growth and terminal differentiation are controlled by complex signaling systems that regulate the tissue-specific expression of genes controlling cell fate and morphogenesis. We have previously reported that the Ste20-like kinase SLK is expressed in muscle tissue and is required for cell motility. However, the specific function of SLK in muscle tissue is still poorly understood. Methods: To gain further insights into the role of SLK in differentiated muscles, we expressed a kinase-inactive SLK from the human skeletal muscle actin promoter. Transgenic muscles were surveyed for potential defects. Standard histological procedures and cardiotoxin-induced regeneration assays we used to investigate the role of SLK in myogenesis and muscle repair. Results: High levels of kinase-inactive SLK in muscle tissue produced an overall decrease in SLK activity in muscle tissue, resulting in altered muscle organization, reduced litter sizes, and reduced breeding capacity. The transgenic mice did not show any differences in fiber-type distribution but displayed enhanced regeneration capacity in vivo and more robust differentiation in vitro. Conclusions: Our results show that SLK activity is required for optimal muscle development in the embryo and muscle physiology in the adult. However, reduced kinase activity during muscle repair enhances regeneration and differentiation. Together, these results suggest complex and distinct roles for SLK in muscle development and function. Keywords: Ste20-like Kinase, Muscle Regeneration, Transgenic Background Ste20 has also been shown to bind the small GTPase Growth and differentiation of muscle cells are regulated Cdc42, but its Cdc42-binding domain has been shown to by complex processes involving a large number of signal- be dispensable for pheromone signaling in yeast [7]. Sev- ing systems. Activation or inhibition of various pathways eral members of the Ste20 family of kinases have been results in the expression of specific subsets of genes di- identified in mammals [8], and have been shown to play a rectly involved in proliferation or terminal differentiation role in various biological processes such as stress, cell [1-5]. In yeast, the serine/threonine protein kinase Ste20 death, cytoskeletal reorganization, growth, and differenti- regulates a mitogen- activated protein kinase pathway ation [9-15]. A novel Ste20-related kinase was previously consisting of the Ste11 protein kinase (a mitogen-activated identified [16] and termed Ste20-like serine/threonine pro- protein kinase kinase; MEKK), Ste7 protein kinase (a tein kinase (SLK) [17-19]. Overexpression of SLK has been mitogen-activated protein kinase kinase; MEK), and Fus3/ shown to induce breakdown of actin stress fibers and cell Kss1 protein kinase (a mitogen-activated protein kinase; death in various systems [19-22]. A role for SLK in cell mi- MAPK) involved in the control of mating response [6]. gration and cell-cycle progression has also been shown [23-30]. * Correspondence: lsabourin@ohri.ca During murine embryogenesis, SLK is preferentially Ottawa Hospital Research Institute, 501 Smyth Rd, Box 926, Ottawa, ON expressed in muscle and neuronal lineages [31]. Despite K1H8L6, Canada a role for SLK in cell death, it is also expressed at high Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, ON, Canada © 2013 Storbeck et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 2 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Table 1 Primers for PCR amplification levels in muscle tissues and proliferating myoblasts, suggesting a functional role for this kinase in physio- Primer Primer Sequence 5′→3′ logical processes other than apoptosis [32]. Our previous SLK Forward GAGCAGGTCAGCGAGTCCAATAG data showed that SLK is expressed in the muscle mass Reverse CTCTCAGGCGGTTAGTGTGCTCTT of developing embryos and is found at myofibrillar stria- tions of specific subsets of myofibers [31,32]. Further- more, expression of dominant negative SLK in C2C12 into the belly of the tibialis anterior (TA) muscle [32]. myoblasts inhibits terminal differentiation [32]. To gain The mice were allowed to recover and the muscles were further insights into the role of SLK in myogenic devel- collected at 7 days post-injection. The tissues were em- opment, we characterized transgenic animals expressing bedded in optimal cutting temperature compound, and a kinase-inactive SLK mutant from the human skeletal cryosectioned for hematoxylin and eosin (H&E) staining actin promoter. Our results showed that muscle-specific [32]. To assess muscle damage, the cross-sectional area expression of a dominant negative SLK reduces overall (CSA) of the regenerating fibers was measured from ran- kinase activity in muscle tissue, and affects muscle devel- dom fields (ImageScope; Aperio, Vista, CA, USA). Data opment and litter size. Interestingly, transgenic animals are presented as the proportion of fibers within a spe- showed enhanced regenerative capacity in vivo and in- cific range of CSA for both transgenic lines. Embryos creased differentiation potential in vitro. These results were collected by caesarean section of timed matings suggest complex and distinct roles for SLK in differenti- and genotyped using placental DNA. For immunostain- ation and function of muscle cells. ing, embryos and TA muscles were removed and fixed in 4% paraformaldehyde (PFA), followed by perfusion in Methods 10% sucrose. The tissues were then frozen in isopentane, Transgenic animals cut into12 μm sections, and assayed by immunochemistry. Animal studies were approved by the University of Ottawa Embryos or muscle sections were stained with MyoD animal ethics board. Care and use of experimental mice (sc304; Santa Cruz Biotechnology, Santa Cruz, CA, USA), followed the guidelines established by the Canadian Coun- Myogenin (F5D) and Pax7 (1E12). The Myogenin and cil on Animal Care. Pax7 monoclonals were used as hybridoma supernatants Transgenic plasmid DNA was constructed by inserting (Developmental Studies Hybridoma Bank, Iowa City, IA). the human skeletal actin promoter (−2500 bp) [33] up- Fiber-type-specific monoclonal antibodies consisted of Hy- stream of full-length (3600 bp) kinase-inactive SLK bearing bridoma Bank clones SC-71 (type IIA), BF-F3 (type IIB), a point mutation at lysine 63 (K63R) [20]. This ATP- and A4-840 (type I) (all kind gift of Dr Robert Parry, Uni- binding site mutation inactivates kinase activity in an auto- versity of Ottawa). phosphorylation assay [20]. Injection and derivation of For western blotting and kinase assays, lower anterior transgenic mice were performed using linearized plasmid muscles or cardiac tissue were removed and ground in DNA as previously described [34]. liquid nitrogen. The tissue powder was then lysed in C57BL/6-C3H F1 (C6B3F1) mice 6 to 8 weeks old RIPA buffer as previously described [28], and lysates (Charles River Laboratories, Wilmington, MA, USA). were cleared by centrifugation at 10,000 g for 2 minutes. Hybrid C6B3F1 mice were used as donors for fertilized Protein concentrations were determined using protein one-cell embryos. DNA fragments were microinjected assay dye reagent (Bio-Rad Laboratories, Inc., Hercules, into the pronucleus of donor embryos, and pseudopreg- CA, USA). Equal amounts of protein (20 to 40 μg) were nant females were used as recipients for the modified zy- separated by electrophoresis on 8 to 15% polyacrylamide gotes. Potential founders were weaned at 3 weeks after gels, and transferred to PVDF membranes. Membranes birth, and tail biopsies were collected for genotyping by were probed with anti-hemagglutinin (HA; 12CA5) or Southern blotting as described previously [35]. Founders anti-SLK antibodies overnight at 4°C in 5% skim milk were then bred with C6B3F1 wild-type mice, and trans- powder in 1 × Tris-buffered saline with Tween (TBS-T; genic lines were backcrossed onto FVB/N wild-type mice 50 mmol/l Tris pH 7.4, 150 mmol/l NaCl, and 0.05 Tween for several generations to establish independent transgenic 20). Membranes were washed in TBS-T and the reactive lines. Positive transgenic pups were subsequently geno- proteins were detected using chemiluminescence (Perkin typed from ear punch DNA using a mouse genotyping kit Elmer, Waltham, MA, USA) and exposure to X-ray film. (Kapa Biosystems, Inc., Woburn, MA, USA) by PCR am- For immunoprecipitations, 300 μg of protein lysate plification (see Table 1 for primers). was immunoprecipitated with 2 μg of antibody and 20 μl of protein A sepharose (Pharmacia & Upjohn Inc., Tissue collection and analysis Bridgewater, NJ, USA) for 2 to 12 hours. Immune com- For muscle injury, mice aged 8 to 10 weeks old were plexes were recovered by centrifugation and washed with anesthetized, and cardiotoxin 10 μmol/l was injected NETN buffer (20 mmol/l Tris–HCl pH 8.0, 1 mmol/l Storbeck et al. Skeletal Muscle 2013, 3:16 Page 3 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 EDTA, 150 mmol/l NaCl, 0.5% Nonidet P-40), then used for SDS-polyacrylamide gel electrophoresis (PAGE) or kinase assays. In vitro kinase assays were performed fol- lowing SLK immunoprecipitation as described previously [28], transferred to PVDF membranes and used for auto- radiography, followed by western blotting with SLK anti- body [24]. Satellite-cell cultures and in vitro differentiation Hind leg muscles from mice 4 to 6 weeks old were minced in PBS, and primary myoblasts were isolated as described previously [36]. The myoblasts were grown in Ham’s F-10 medium (Sigma-Aldrich, St Louis, MO, USA) supplemented with basic fibroblast growth factor 10 ng/ml (Sigma-Aldrich). Cells were grown in 6-well collagen-coated dishes (Corning Inc., Corning, NY, USA) and induced to differentiate in DMEM containing 2% horse serum (Sigma-Aldrich) when the cultures reached 70 to 80% confluency. After 3 days, the myotubes were washed with PBS and fixed in 4% PFA for 5 minutes at room temperature. The cells were stained with DAPI and for myosin heavy chain (MF20) in conjunction with a Cy3 anti-mouse secondary antibody (Jackson Immunoresearch Laboratories Inc., West Grove, PA, USA). Visualization and image acquisition was performed using a fluorescence microscope (Axiovert; Carl Zeiss, Jena, Germany). The fusion index was calculated as the number of nuclei in myotubes over the total number of nuclei in the field: Figure 1 Generation of transgenic lines. (A) Schematic ðÞ number of MF20 nuclei=totalnumberof nucleiinfield representation of the hemagglutinin-tagged Ste20-like kinase (SLK) 100: construct. Full-length murine SLK mutated at the ATP-binding site (K63R) is driven by 2500 bp of upstream promoter sequences derived from the human skeletal actin gene. A SV40 polyadenylation Only myotubes containing three or more nuclei were signal was also cloned downstream of SLK (not shown). The 1.9 kb scored. PvuII probe fragment spanning the promoter and cDNA regions is For western blot analyses cultures were lysed as above shown. (B) Representative Southern blot analysis of a full litter from line 3405 crossed with wild-type FVB/N showing the transgene and probed with MF20, MyoD, myogenin and cyclin D1 signal on a PvuII digest of tail DNA. The corresponding PCR analysis (sc20044; Santa Cruz Biotechnology) antibodies. is shown below the autoradiogram. Results Generation of SLK transgenic mice We have previously shown that SLK is highly expressed Two transgenic lines were then derived from independent in both the neuronal and myogenic compartment in the founders for further analysis. developing embryo [31]. In addition, expression of a To verify SLK transgene expression, muscle tissue was kinase-inactive SLK in C2C12 cells inhibits myoblast fusion taken from the lower hind leg, then homogenized and [32]. Together, these data suggest a role for SLK in muscle surveyed for transgene expression using immunoprecipi- differentiation and function. To gain further insight into tation and western blot analysis. Both lines expressed the role of SLK in differentiated muscles, we generated a epitope-tagged SLK in muscle tissue (Figure 2). Interest- skeletal actin-driven transgene (Figure 1). The HA-tagged ingly, levels of HA-SLK were about two-fold to three- kinase-inactive SLK (K63R) transgene was purified and fold higher in line 654 than in line 3405. We and others injected into donor zygotes. Using Southern blot analysis have shown previously that the K63R mutation abolishes and a transgene-specific probe (Figure 1), 5 founders were autophosphorylation activity [20,37]. To test for kinase identified from 45 mice surveyed. The presence of the activity in our transgenic lines, total tissue lysates were transgene was further confirmed by PCR analysis (Figure 1). used for SLK kinase assays [25]. In vitro kinase assays Storbeck et al. Skeletal Muscle 2013, 3:16 Page 4 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Figure 2 Characterization of Ste20-like kinase (SLK) expression in transgenic lines. (A) Total lysates from anterior hind leg muscles were immunoprecipitated with anti-hemagglutinin (HA) antibodies (12CA5). Subsequent probing for SLK showed expression of HA-tagged kinase in the 654 and 3405 transgenic lines. (B) Total lysates were immunoprecipitated for total SLK and used for in vitro kinase assays. Total SLK activity was markedly reduced in both transgenic lines. (C) Total tissue lysates from cardiac and hind leg muscles were surveyed for transgene expression using immunoprecipitation and anti-HA western blot. No expression was detected in the heart muscle of transgenic mice. (D) Monitoring wild- type to transgenic crosses showed that the higher-expressing 654 transgenic line produced fewer pups (absolute numbers) compared with the 3405 line. The proportion of transgenic animals was the same. (E) Monitoring of litter numbers over 4 to 6 months showed reduced breeding capacity in the 654 line. (Figure 2B) showed that, in both transgenic lines, the over- rearrangement or inactivation that could explain the appa- all SLK kinase activity was markedly reduced, suggesting rent dominant lethality phenotype in this line. that HA-K63R is acting as a dominant-negative kinase To further investigate the embryonic phenotype, trans- [37,38]. Furthermore, quantification of the SLK western blot genic and wild-type embryos from timed matings were (Figure 2B) showed that the overall SLK levels in the trans- collected for analysis. The embryos (11.5 and 13.5 days genic lines were about two-fold and four-fold higher than post-conception (dpc)) were cryosectioned and used for in wild-type animals. As previously reported, no transgene MF20 or myogenin immunostaining. MF20-positive fi- expression was detected in cardiac tissues (Figure 2C) [39]. bers were present in both wild-type and transgenic 13.5 To investigate the effect of HA-K63R overexpression, the dpc embryos (Figure 3B-E). However, muscle fibers ap- breeding capacity and litter sizes for the two lines were peared to be significantly larger in the wild-type animals. monitored. Although both lines gave a similar proportion The wild-type muscles displayed thick parallel bundles of transgenic pups (around 50%), the higher-expressing of myofibers, whereas the high-expressing transgenic 654 line showed reduced breeding capacity and was much mice (line 654) had a more disorganized musculature more difficult to maintain (Figure 2D,E). Supporting this, (Figure 3B-E). Immunohistochemical analysis for myogenin, over a 6-month period, the average number of litters per an early myogenic marker [41,42], showed relatively smaller breeding pair (wild-type × transgenic) was found to be 1.2 pre-muscle masses in the high-expressing 654 line at 11.5 and 2.5 for the 654 and 3405 lines, respectively. In addition, dpc (Figure 3F,G). As for older embryos, MF20 analysis of the average litter size was found to be significantly smaller 11.5 dpc embryos showed smaller myofibers and reduced in the 654 line (mean ± SD 4.8 ± 2) than in the 3405 line pre-muscle masses (Figure 3H,I). (9 ± 2) or the wild-type FVB/N (9.8 ± 1.3) (Figure 3A). One These results suggest that muscle development may be possibility is that high levels of kinase-inactive SLK in delayed in high-expressing embryos. As it displayed a muscle tissues is detrimental. Alternatively, as previously more robust phenotype, only the 654 line was further described [40], the 654 line could bear a chromosomal characterized. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 5 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Figure 3 (See legend on next page.) Storbeck et al. Skeletal Muscle 2013, 3:16 Page 6 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 (See figure on previous page.) Figure 3 Overexpression of hemagglutinin (HA)-K63R affects muscle development. (A) Monitoring of litter sizes showed that the higher-expressing 654 line gave rise to 50% fewer pups than the 3405 line or wild-type FVB/N (* P<0.05for the3405or FVB/N t-test comparison). (B, C) Intercostal muscles of embryos at 13.5 days post-conception (dpc) stained for myosin heavy chain (MF20). (D, E) Forelimb muscles of the same embryos stained with MF20. Transgenic animals had smaller and more disorganized muscle fibers (arrowheads). (F, G) Immunohistochemistry for myogenin in 11.5 dpc embryos showing smaller myogenic compartments along the rostral-caudal axis in the 654 transgenic line. (H, I) Immunohistochemistry for MF20 as above in 11.5 dpc embryos. Altered regeneration in transgenic muscles stained with isotype-specific myosin heavy chain (MHC) We have previously reported that SLK is preferentially antibodies. Although no significant differences in the expressed in type I myofiber [32]. Therefore, to gain fur- proportion of each fiber type were seen (not shown), ther insights into the phenotype of the HA-K63R mice, measurements of the cross-sectional area of type I fibers we performed fiber typing analysis. The TA muscles of showed a significantly smaller proportion of large fibers transgenic and wild-type littermates were sectioned and (>6000 μ ) and an increased proportion of smaller fibers Figure 4 HA-K63R expressing mice display smaller type I fibers. TA muscles from both wild-type (WT) and transgenic (Tg) mice were cryosectioned and immunostained for (A, D) type I, (B, E) type IIA, or (C, F) type IIB. (G) The caliber of positive fibers was measured using ImageScope software (Aperio) and categorized into three groups. The proportion of the fibers falling within the groups was quantified. At least 100 fibers were measured from three independent animals. Results showed a smaller proportion of large type I fibers and more small fibers in transgenic animals (*P<0.05 for Tg versus WT Myosin Heavy Chain type I; t-test comparison). Storbeck et al. Skeletal Muscle 2013, 3:16 Page 7 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 (0 to 3000 μ ) in transgenic animals compared with showed that both lines of HA-K63R mice displayed pro- wild-type littermates (Figure 4). No differences in the portionally larger fibers at day 7 post-injury (Figure 5C). IIA or IIB fibers were seen. However, at day 14 post-injury, no significant differences Our previous results have shown that SLK kinase activ- were seen between the transgenic and wild-type animals ity is modulated during C2C12 differentiation, and that (Figure 5A insets; Figure 5C). Immunohistochemical ana- expression of a truncated dominant-negative SLK inhibits lysis of muscle regenerates at days 3 and 7 showed that the the differentiation of C2C12 cells when overexpressed in number of infiltrating myogenic precursor cells (MyoD+ myoblasts [32]. To further investigate the role of SLK in and Pax7+) was also unaffected (Figure 5D-H). These muscle differentiation, cardiotoxin-induced regeneration results suggest that mice expressing inactive SLK do not assays were performed on wildtype and HA-K63R trans- recruit more myogenic precursor cells but have an acceler- genic mice. For muscle-injury assays, mice 8 to 10 weeks ated regenerative capacity, resulting in a normal endpoint. old were injected with cardiotoxin or NaCl control. The To address this possibility further, satellite-cell cultures TA muscles were collected at various times post-injury, were derived from both HA-K63R lines and induced to and assessed by H&E staining. In contrast to wild-type lit- differentiate in vitro as the monolayers reached 70 to termates, HA-K63R mice generally displayed reduced areas 80% confluency. Differentiated myotubes were detected of damage at day 7 post-injury (Figure 5). No damage was using MHC staining, and fusion indices were calculated. seen in the NaCl control (not shown), whereas both geno- Myoblasts derived from HA-K63R mice displayed a types displayed regenerating fibers bearing centrally located more robust differentiation phenotype with a higher nuclei throughout the time course. Interestingly, quan- number of large myotubes (Figure 6). Fusion index ana- tification of fiber-size distribution in the damaged area lyses of myotubes bearing three or more nuclei had Figure 5 Expression of hemagglutinin (HA)-K63R enhances muscle regeneration. Muscle repair after cardiotoxin-induced injury was monitored at day 7 post-injection in (A) wild-type and (B) line 654 transgenic animals using hematoxylin and eosin staining. More damage was consistently seen in the wild-type animals. Insets show representative regenerates at day 14 post-injury, (C) The extent of damage was quantified by measuring the proportion of fibers with specific cross-sectional area (CSA) in the damaged area. Approximately 500 fibers were counted from 3 different animals forall genotypes. A shift towards an increased proportion of larger fibers was seen at day 7 for the transgenic groups, suggesting enhanced regeneration. No differences were seen at day 14. (D-G) Regenerating sections at day 3 from wild-type and transgenic mice were stained for MyoD and Pax7 to identify activated satellite cells (arrowheads). (H) Activated satellite cells were enumerated from at least three different animals at days 3 and 7 post-injury, and expressed as the proportion of total nuclei in the field. No differences were seen between the transgenic and wild-type animals. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 8 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Figure 6D). However, myogenin and MyoD levels did not show any appreciable differences. Surprisingly, transgenic cultures showed a marked downregulation of cyclinD1 levels as they proceeded through differentiation. Wild- type cultures had a two-fold reduction in cyclin D1 over the time course, whereas a ten-fold downregulation was seen in the transgenic cultures (Figure 6D). Together, these data suggest that the HA-K63R myoblasts have en- hanced differentiation potential in vitro. and that they can exit the cell cycle much more efficiently. Discussion Using transgenic lines expressing a kinase-inactive SLK from the human skeletal actin promoter, we have shown that high levels of dominant-negative SLK result in im- paired development and accelerated differentiation in vivo following muscle injury. Similarly, myoblast cultures de- rived from transgenic mice differentiate more efficiently in vitro. These data suggest potentially complex and dis- tinct roles for SLK in embryonic and adult muscles. Muscle-cell differentiation and myoblast fusion is reg- ulated by complex signaling networks [3,43]. Myoblast fusion is also highly dependent on cytoskeletal remodeling and on factors controlling actin dynamics and adhesion [44-53]. We have recently shown that the Ste20-like kinase SLK is required for efficient cell migration, chemo- taxis, and focal adhesion turnover [24,26,27,54]. Our pre- vious findings showed that expression of kinase-inactive Figure 6 Expression of hemagglutinin (HA)-K63R enhances SLK in myoblasts impaired fusion [32]. To further investi- muscle differentiation in vitro.(A,B) Primary myoblast cultures were gate its role in skeletal muscle in the current study, we established from mice 4 to 6 weeks old and induced to differentiate by serum withdrawal. After 3 days, the cultures were stained for myosin generated transgenic mice expressing kinase-inactive SLK heavy chain (MHC) and with DAPI to establish the fusion index. from the human skeletal actin promoter. Immunoprecipi- (C) Quantification of the fusion index from MHC-stained myotube tation and western blotting analysis showed that in trans- cultures. The fusion index was established from myotubes bearing three genic animals the overall levels of SLK were increased or more nuclei using the equation: (number of nuclei in myotubes/total two-fold to four-fold. However, the overall kinase activity number of nuclei) × 100. The fusion indices were obtained from triplicate cultures of two independent animals from all genotypes. At was markedly reduced, suggesting that HA-K63R has a least 200 nuclei were counted. (*P<0.008 Tg654 versus wild-type (WT), dominant-negative effect. SLK has recently been reported ** P<0.05 Tg3405 versus WT). (D) Differentiating cultures from both to function as a homodimer [37,55]. Furthermore, auto- transgenic (Tg) line were monitored for the levels of MyHC, MyoD, phosphorylation of the activation loop seems to be re- myogenin and CyclinD1 by western blotting analysis. The figure shows quired for maximal kinase activity. Therefore, it is likely results for the 3405 line; similar findings were seen for the 654 line. that the HA-K63R version can associate with endogenous SLK, preventing full activation as a result of lack of mean (±SD) fusion indices of 67 ± 3% and 58 ± 3% for complete autophosphorylation. This dominant-negative the HA-K63R lines compared with 46 ± 8% for wild- phenotype is therefore likely to be contributing to the de- type littermates. These results suggest that myoblasts layed development of the higher-expressing 654 line. derived from HA-K63R mice can differentiate more effi- Interestingly, mice that are deficient for both MyoD ciently, supporting our in vivo findings. and Myf5 develop until birth [56,57]. As the transgene is To further investigate the mechanism responsible for not detected in cardiac tissues (Figure 2), it is unclear enhanced differentiation in vitro, myoblast cultures from how muscle-specific K63R transgene expression induces transgenic and wild-type animals were differentiated embryonic lethality. It is possible that high expression of and assessed for the expression of differentiation mark- kinase-inactive SLK in pre-muscle masses is detrimental. ers. Supporting the in vitro fusion data, MHC levels However, a more likely explanation is that the 654 line were markedly increased in HA-K63R cultures at day 2 has undergone a chromosomal rearrangement of a crucial after onset of differentiation (four-fold versus >100-fold; gene, responsible for this apparent dominant embryonic Storbeck et al. Skeletal Muscle 2013, 3:16 Page 9 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 lethality. These anomalies have been shown to result promoter enhanced muscle regeneration after cardiotoxin- in reduced litter sizes and arrested development be- induced damage. Similarly, myoblast cultures derived from fore 7 dpc [40]. HA-K63R-expressing mice displayed increased differenti- Our previous data showed that SLK is preferentially ation potential, as evidenced by higher fusion indices and expressed in type I myofibers [32]. Interestingly, HA- increased levels of MHC protein. As SLK is required both K63R-expressing mice displayed a reduced proportion of for proliferation [28] and cytoskeletal dynamics [23], these large type I fibers, suggesting a possible role for SLK in observations raise the possibility that SLK plays different the maintenance of these fibers. Several adhesion proteins roles during myoblast differentiation. Supporting this, SLK such as focal adhesion kinase (FAK) and paxillin have kinase activity is downregulated upon serum withdrawal been implicated in muscle organization and function from C2C12 cultures, but upregulated in differentiated [58-60]. As SLK is activated downstream of FAK-mediated myotubes [32]. As myoblast proliferation and differenti- motility signaling [24,27], one possibility is that expression ation are mutually exclusive [43], one possibility is that of HA-K63R suppresses further signals, leading to matur- HA-K63R expression in differentiating myocytes facilitates ation defects and atrophy. cell-cycle exit, enhancing differentiation. Supporting this Using C2C12 cells, we previously found that expression hypothesis is the observation that differentiating trans- of a truncated kinase-inactive SLK in myoblasts inhibits genic cultures show marked downregulation of cyclin D1 fusion in a cell autonomous manner [32]. Surprisingly, ex- levels, suggesting that they exit the cell cycle much more pression of dominant-negative SLK from the skeletal actin efficiently than do wild-type cells. Surprisingly, fusion is Figure 7 Complex roles for Ste20-like kinase in muscle development and regeneration. (A) After muscle injury (left side), SLK is required for proliferation of activated satellite cells. Upon terminal differentiation, SLK activity is downregulated (down arrow), leading to cell-cycle exit and growth arrest [32]. SLK activity is then upregulated upon myoblast fusion and myofiber maturation (up arrow). Similarly, in cultured myoblasts (right side) SLK is downregulated for growth arrest and upregulated during fusion and maturation. Expression of kinase-dead SLK (K63R) as myoblasts enter the differentiation pathway enhances cell-cycle arrest and differentiation. (B) In the developing embryos, expression of kinase-dead SLK from the skeletal actin promoter delays terminal differentiation and maturation, suggesting a distinct role for SLK in embryonic myogenesis. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 10 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 enhanced in HA-K63R-derived myoblasts. It is possible Authors’ contributions CJS carried out the transgenic design and initial characterization as well as that the residual low level of kinase activity is sufficient to the experimental designs. KNA performed immunohistochemistry and tissue allow fusion to proceed. analysis of embryos. RS and SK performed myoblast isolation and western The observed enhanced regeneration and differenti- blot analysis. PO collected regenerating samples and performed H&E staining. KD and MM maintained animal colonies and performed muscle ation is in marked contrast to the developmental delay injuries. LAS conceived the study, and RK and CT coordinated some of the seen in the muscles of transgenic embryos. One possibil- experimental studies. All authors read and approved the final manuscript. ity is that SLK has different functions in embryonic myogenic cells and adult satellite cells (Figure 7). Studies Acknowledgements This work was supported by the Canadian Institute for Health Research and have shown that skeletal actin is expressed in mononu- MDAUSA. CJS is the recipient of a Canadian Heart and Stroke Foundation cleated myocytes before fusion [61-66], suggesting that Fellowship. KAZ is funded by the Canadian Breast Cancer Foundation. PO is the the transgene could be expressed as some precursor cell recipient of an OGSST studentship. The authors declare no conflict of interest. populations expand and enter the differentiation path- Received: 24 October 2012 Accepted: 2 May 2013 way. Because of its role in cell-cycle progression, high Published: 1 July 2013 levels of dominant-negative SLK may impair this expan- sion in the expressing embryos. Alternatively, expression References 1. Fuchtbauer EM: Inhibition of skeletal muscle development: less of kinase-inactive SLK in myocytes in vivo impairs their differentiation gives more muscle. Results Probl Cell Differ 2002, 38:143–161. terminal differentiation without affecting cell-cycle pro- 2. Charge SB, Rudnicki MA: Cellular and molecular regulation of muscle gression. By contrast, kinase-inactive SLK may accelerate regeneration. Physiol Rev 2004, 84(1):209–238. 3. Rudnicki MA, et al: The molecular regulation of muscle stem cell function. cell-cycle exit in satellite cells, thereby speeding up myo- Cold Spring Harb Symp Quant Biol 2008, 73:323–331. blast fusion and injury repair. Interestingly, our previous 4. Tapscott SJ: The circuitry of a master switch: Myod and the regulation of data showed that expression of a truncated kinase-inactive skeletal muscle gene transcription. Development 2005, 132(12):2685–2695. 5. Guttridge DC: Signaling pathways weigh in on decisions to make or SLK (KΔC) in C2C12 myoblasts impairs differentiation break skeletal muscle. Curr Opin Clin Nutr Metab Care 2004, 7(4):443–450. [32]. This would suggest that SLK activity is required after 6. Zhao ZS, et al: Pheromone signalling in Saccharomyces cerevisiae cell-cycle exit and before fusion. In this case, expression of requires the small GTP-binding protein Cdc42p and its activator CDC24. Mol Cell Biol 1995, 15(10):5246–5257. full-length kinase-dead SLK (K63R) in differentiating cells, 7. Leberer E, et al: Functional characterization of the Cdc42p binding from a differentiation-specific promoter, seems to enhance domain of yeast Ste20p protein kinase. EMBO J 1997, 16(1):83–97. cell-cycle exit and terminal differentiation, suggesting that 8. Dan I, Watanabe NM, Kusumi A: The Ste20 group kinases as regulators of MAP kinase cascades. Trends Cell Biol 2001, 11(5):220–230. SLK downregulation in differentiating cells enhances myo- 9. Brown JL, et al: Human Ste20 homologue hPAK1 links GTPases to the blast fusion and differentiation. Another important con- JNK MAP kinase pathway. Curr Biol 1996, 6(5):598–605. sideration is the fact that K63R encodes the full-length 10. Dan C, et al: Cytoskeletal changes regulated by the PAK4 serine/threonine kinase are mediated by LIMK1 and cofilin. JBiol Chem 2001, 18:18. kinase, suggesting that the 829 amino acids deleted from 11. Daniels RH, Hall PS, Bokoch GM: Membrane targeting of p21-activated KΔC might play an important scaffolding role that is cru- kinase 1 (PAK1) induces neurite outgrowth from PC12 cells. EMBO J 1998, cial to myoblast differentiation. 17(3):754–764. 12. Fanger GR, et al: MEKKs, GCKs, MLKs, PAKs, TAKs, and tpls: upstream regulators of the c- Jun amino-terminal kinases? Curr Opin Genet Dev 1997, 7(1):67–74. Conclusions 13. Hu MC, et al: Human HPK1, a novel human hematopoietic progenitor Together with our previous results [32], these data suggest kinase that activates the JNK/SAPK kinase cascade. Genes Dev 1996, 10(18):2251–2264. a complex mechanism by which SLK is required for cyto- 14. Kuramochi S, et al: LOK is a novel mouse STE20-like protein kinase that is skeletal dynamics before fusion, then is downregulated for expressed predominantly in lymphocytes. J Biol Chem 1997, cell-cycle exit but re-activated for muscle-specific func- 272(36):22679–22684. 15. Lee N, et al: Activation of hPAK65 by caspase cleavage induces some of tions. Identification of SLK substrates and generation of the morphological and biochemical changes of apoptosis. Proc Natl Acad SLK knockout models will further help to delineate be- Sci U S A 1997, 94(25):13642–13647. tween these possibilities. 16. Al-Zahrani KN, Baron KD, Sabourin LA: Ste20-like kinase SLK, at the crossroads: a matter of life and death. Cell Adh Migr 2013, 7(1):1–10. 17. Itoh S, et al: Molecular cloning and characterization of a novel putative Abbreviations STE20-like kinase in guinea pigs. Arch Biochem Biophys 1997, CSA: Cross-sectional area; DAPI: 4',6-diamidino-2-phenylindole; 340(2):201–207. DMEM: Dulbecco’s modified Eagle’s medium; Dpc: Days post-conception; 18. Pytowski B, et al: Identification and initial characterization of mSLK, a FAK: Focal adhesion kinase; H&E: Haematoxylin and eosin; murine member of the STE20 family of kinases. Arch Biochem Biophys HA: Hemagglutinin; MAPK: Mitogen-activated protein kinase; MHC: Myosin 1998, 359(2):310–319. heavy chain; PAGE: Polyacrylamide gel electrophoresis; PBS: Phosphate 19. Sabourin LA, Rudnicki MA: Induction of apoptosis by SLK, a Ste20-related buffered saline; PFA: Paraformaldehyde; PVDF: Polyvinylidene difluoride; kinase. Oncogene 1999, 18:7566–7575. RIPA: Radio-immunoprecipitation assay; SDS: Sodium dodecyl sulfate; 20. Sabourin LA, et al: Caspase 3 cleavage of the Ste20-related kinase SLK SLK: Ste20-like kinase; TA: Tibialis anterior; TBS-T: Tris-buffered saline with Tween. releases and activates an apoptosis-inducing kinase domain and an actin-disassembling region. Mol Cell Biol 2000, 20(2):684–696. 21. Hao W, et al: Induction of apoptosis by the Ste20-like kinase SLK, a Competing interests germinal center kinase that activates apoptosis signal-regulating kinase The authors declare no competing interests. and p38. J Biol Chem 2006, 281(6):3075–3084. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 11 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 22. Cybulsky AV, et al: Podocyte injury and albuminuria in mice with 50. Heller H, Gredinger E, Bengal E: Rac1 inhibits myogenic differentiation by podocyte-specific overexpression of the Ste20-like kinase. SLK. Am J preventing the complete withdrawal of myoblasts from the cell cycle. Pathol 2010, 177(5):2290–2299. J Biol Chem 2001, 276(40):37307–37316. 23. Wagner SM, Sabourin LA: A novel role for the Ste20 kinase SLK in 51. Laurin M, et al: The atypical Rac activator Dock180 (Dock1) regulates adhesion signaling and cell migration. Cell Adh Migr 2009, 3(2):182–184. myoblast fusion in vivo. Proc Natl Acad Sci U S A 2008, 24. Wagner S, et al: FAK/src-family dependent activation of the Ste20-like 105(40):15446–15451. kinase SLK is required for microtubule-dependent focal adhesion 52. Meriane M, et al: Critical activities of Rac1 and Cdc42Hs in skeletal turnover and cell migration. PLoS One 2008, 3(4):e1868. myogenesis: antagonistic effects of JNK and p38 pathways. Mol Biol Cell 25. Wagner S, et al: Association of the Ste20-like kinase (SLK) with the 2000, 11(8):2513–2528. microtubule. Role in Rac1-mediated regulation of actin dynamics during 53. Schwander M, et al: [beta]1 integrins regulate myoblast fusion and cell adhesion and spreading. J Biol Chem 2002, 277(40):37685–37692. sarcomere assembly. Dev Cell 2003, 4(5):673–685. 54. Quizi JL, et al: SLK-mediated phosphorylation of paxillin is required for 26. Storbeck CJ, et al: The Ldb1 and Ldb2 transcriptional co-factors interact focal adhesion turnover and cell migration. Oncogene 2012. In Press. with the Ste20-like Kinase SLK and regulate cell migration. Mol Biol Cell 55. Pike AC, et al: Activation segment dimerization: a mechanism for kinase 2009, 20(19):4174–4182. autophosphorylation of non-consensus sites. EMBO J 2008, 27(4):704–714. 27. Roovers K, et al: The Ste20-like kinase SLK is required for ErbB2-driven 56. Rudnicki MA, et al: MyoD or Myf-5 is required for the formation of breast cancer cell motility. Oncogene 2009, 28(31):2839–2848. skeletal muscle. Cell 1993, 75(7):1351–1359. 28. O’Reilly PG, et al: The Ste20-like kinase SLK is required for cell cycle 57. Buckingham ME: Muscle: the regulation of myogenesis. Curr Opin Genet progression through G2. J Biol Chem 2005, 280(51):42383–42390. Dev 1994, 4(5):745–751. 29. Ellinger-Ziegelbauer H, et al: Ste20-like kinase (SLK), a regulatory kinase 58. Quach NL, Rando TA: Focal adhesion kinase is essential for costamerogenesis for polo-like kinase (Plk) during the G2/M transition in somatic cells. in cultured skeletal muscle cells. Dev Biol 2006, 293(1):38–52. Genes Cells 2000, 5(6):491–498. 59. Fluck M, et al: Focal adhesion proteins FAK and paxillin increase in 30. Burakov AV, et al: Ste20-related protein kinase LOSK (SLK) controls hypertrophied skeletal muscle. Am J Physiol 1999, 277(1 Pt 1):C152–C162. microtubule radial array in interphase. Mol Biol Cell 2008, 19(5):1952–1961. 60. Bae GU, et al: Neogenin regulates skeletal myofiber size and focal 31. Zhang Y-H, et al: Expression of the Ste20-like kinase SLK during adhesion kinase and extracellular signal-regulated kinase activities embryonic development and in the murine adult central nervous in vivo and in vitro. Mol Biol Cell 2009, 20(23):4920–4931. system. Brain Res Dev Brain Res 2002, 139(2):205–215. 61. Lin Z, et al: Sequential appearance of muscle-specific proteins in 32. Storbeck CJ, et al: Ste20-like kinase SLK displays myofiber type specificity myoblasts as a function of time after cell division: evidence for a and is involved in C2C12 myoblast differentiation. Muscle Nerve 2004, conserved myoblast differentiation program in skeletal muscle. Cell Motil 29(4):553–564. Cytoskeleton 1994, 29(1):1–19. 33. Mankodi A, et al: Myotonic dystrophy in transgenic mice expressing an 62. Lancioni H, et al: Muscle actin isoforms are differentially expressed in expanded CUG repeat. Science 2000, 289(5485):1769–1773. human satellite cells isolated from donors of different ages. Cell Biol Int 34. Guy LG, et al: The beta-globin locus control region enhances 2007, 31(2):180–185. transcription of but does not confer position-independent expression 63. Furst DO, Osborn M, Weber K: Myogenesis in the mouse embryo: onto the lacZ gene in transgenic mice. EMBO J 1996, 15(14):3713–3721. differential onset of expression of myogenic proteins and the 35. Maniatis T, Fritsch EF, Sambrook J: Molecularcloning: alaboratory manual. involvement of titin in myofibril assembly. J Cell Biol 1989, 109(2):517–527. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1982. 64. Burattini S, et al: C2C12 murine myoblasts as a model of skeletal muscle 36. Rando TA, Blau HM: Primary mouse myoblast purification, development: morpho-functional characterization. Eur J Histochem 2004, characterization, and transplantation for cell-mediated gene therapy. 48(3):223–233. J Cell Biol 1994, 125(6):1275–1287. 65. Baroffio A, et al: Identification of self-renewing myoblasts in the progeny 37. Delarosa S, et al: Activity of the Ste20-like kinase, SLK, is enhanced by of single human muscle satellite cells. Differentiation 1996, 60(1):47–57. Homodimerization. Am J Physiol Renal Physiol 2011, 301:F554–64. 66. Springer ML, Ozawa CR, Blau HM: Transient production of alpha-smooth 38. Luhovy AY, et al: Regulation of the Ste20-like kinase, SLK: involvement of muscle actin by skeletal myoblasts during differentiation in culture and activation segment phosphorylation. J Biol Chem 2012, 287(8):5446–5458. following intramuscular implantation. Cell Motil Cytoskeleton 2002, 39. Miura S, et al: Overexpression of peroxisome proliferator-activated 51(4):177–186. receptor gamma coactivator-1alpha down-regulates GLUT4 mRNA in skeletal muscles. J Biol Chem 2003, 278(33):31385–31390. doi:10.1186/2044-5040-3-16 40. Mahon KA, Overbeek PA, Westphal H: Prenatal lethality in a transgenic Cite this article as: Storbeck et al.: Distinct roles for Ste20-like kinase SLK mouse line is the result of a chromosomal translocation. Proc Natl Acad in muscle function and regeneration. Skeletal Muscle 2013 3:16. Sci U S A 1988, 85(4):1165–1168. 41. Sassoon D, et al: Expression of two myogenic regulatory factors myogenin and MyoD1 during mouse embryogenesis. Nature 1989, 341(6240):303–307. 42. Buckingham M, et al: Expression of muscle genes in the mouse embryo. Symp Soc Exp Biol 1992, 46:203–217. 43. Sabourin LA, Rudnicki MA: The molecular regulation of myogenesis. Clin Genet 2000, 57(1):16–25. 44. Bataille L, et al: Downstream of identity genes: muscle-type-specific Submit your next manuscript to BioMed Central regulation of the fusion process. Dev Cell 2010, 19(2):317–328. 45. Alvarez B, et al: Integrin cytoplasmic domain-Associated protein-1 and take full advantage of: (ICAP-1) promotes migration of myoblasts and affects focal adhesions. J Cell Physiol 2008, 214(2):474–482. • Convenient online submission 46. Brzoska E, et al: Integrin alpha3beta1 subunit participates in myoblast • Thorough peer review adhesion and fusion in vitro. Differentiation 2006, 74(2–3):105–118. 47. Crawley S, et al: The alpha7beta1 integrin mediates adhesion and migration • No space constraints or color figure charges of skeletal myoblasts on laminin. Exp Cell Res 1997, 235(1):274–286. • Immediate publication on acceptance 48. de Oliveira MV, et al: SHP-2 regulates myogenesis by coupling to FAK • Inclusion in PubMed, CAS, Scopus and Google Scholar signaling pathway. FEBS Lett 2009, 583(18):2975–2981. 49. Fortier M, et al: RhoE controls myoblast alignment prior fusion through • Research which is freely available for redistribution RhoA and ROCK. Cell Death Differ 2008, 15(8):1221–1231. Submit your manuscript at www.biomedcentral.com/submit http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Skeletal Muscle Springer Journals

Distinct roles for Ste20-like kinase SLK in muscle function and regeneration

Loading next page...
 
/lp/springer-journals/distinct-roles-for-ste20-like-kinase-slk-in-muscle-function-and-8ls1sWmwEX
Publisher
Springer Journals
Copyright
Copyright © 2013 by Storbeck et al.; licensee BioMed Central Ltd.
Subject
Life Sciences; Cell Biology; Developmental Biology; Biochemistry, general; Systems Biology; Biotechnology
eISSN
2044-5040
DOI
10.1186/2044-5040-3-16
pmid
23815977
Publisher site
See Article on Publisher Site

Abstract

Background: Cell growth and terminal differentiation are controlled by complex signaling systems that regulate the tissue-specific expression of genes controlling cell fate and morphogenesis. We have previously reported that the Ste20-like kinase SLK is expressed in muscle tissue and is required for cell motility. However, the specific function of SLK in muscle tissue is still poorly understood. Methods: To gain further insights into the role of SLK in differentiated muscles, we expressed a kinase-inactive SLK from the human skeletal muscle actin promoter. Transgenic muscles were surveyed for potential defects. Standard histological procedures and cardiotoxin-induced regeneration assays we used to investigate the role of SLK in myogenesis and muscle repair. Results: High levels of kinase-inactive SLK in muscle tissue produced an overall decrease in SLK activity in muscle tissue, resulting in altered muscle organization, reduced litter sizes, and reduced breeding capacity. The transgenic mice did not show any differences in fiber-type distribution but displayed enhanced regeneration capacity in vivo and more robust differentiation in vitro. Conclusions: Our results show that SLK activity is required for optimal muscle development in the embryo and muscle physiology in the adult. However, reduced kinase activity during muscle repair enhances regeneration and differentiation. Together, these results suggest complex and distinct roles for SLK in muscle development and function. Keywords: Ste20-like Kinase, Muscle Regeneration, Transgenic Background Ste20 has also been shown to bind the small GTPase Growth and differentiation of muscle cells are regulated Cdc42, but its Cdc42-binding domain has been shown to by complex processes involving a large number of signal- be dispensable for pheromone signaling in yeast [7]. Sev- ing systems. Activation or inhibition of various pathways eral members of the Ste20 family of kinases have been results in the expression of specific subsets of genes di- identified in mammals [8], and have been shown to play a rectly involved in proliferation or terminal differentiation role in various biological processes such as stress, cell [1-5]. In yeast, the serine/threonine protein kinase Ste20 death, cytoskeletal reorganization, growth, and differenti- regulates a mitogen- activated protein kinase pathway ation [9-15]. A novel Ste20-related kinase was previously consisting of the Ste11 protein kinase (a mitogen-activated identified [16] and termed Ste20-like serine/threonine pro- protein kinase kinase; MEKK), Ste7 protein kinase (a tein kinase (SLK) [17-19]. Overexpression of SLK has been mitogen-activated protein kinase kinase; MEK), and Fus3/ shown to induce breakdown of actin stress fibers and cell Kss1 protein kinase (a mitogen-activated protein kinase; death in various systems [19-22]. A role for SLK in cell mi- MAPK) involved in the control of mating response [6]. gration and cell-cycle progression has also been shown [23-30]. * Correspondence: lsabourin@ohri.ca During murine embryogenesis, SLK is preferentially Ottawa Hospital Research Institute, 501 Smyth Rd, Box 926, Ottawa, ON expressed in muscle and neuronal lineages [31]. Despite K1H8L6, Canada a role for SLK in cell death, it is also expressed at high Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, ON, Canada © 2013 Storbeck et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 2 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Table 1 Primers for PCR amplification levels in muscle tissues and proliferating myoblasts, suggesting a functional role for this kinase in physio- Primer Primer Sequence 5′→3′ logical processes other than apoptosis [32]. Our previous SLK Forward GAGCAGGTCAGCGAGTCCAATAG data showed that SLK is expressed in the muscle mass Reverse CTCTCAGGCGGTTAGTGTGCTCTT of developing embryos and is found at myofibrillar stria- tions of specific subsets of myofibers [31,32]. Further- more, expression of dominant negative SLK in C2C12 into the belly of the tibialis anterior (TA) muscle [32]. myoblasts inhibits terminal differentiation [32]. To gain The mice were allowed to recover and the muscles were further insights into the role of SLK in myogenic devel- collected at 7 days post-injection. The tissues were em- opment, we characterized transgenic animals expressing bedded in optimal cutting temperature compound, and a kinase-inactive SLK mutant from the human skeletal cryosectioned for hematoxylin and eosin (H&E) staining actin promoter. Our results showed that muscle-specific [32]. To assess muscle damage, the cross-sectional area expression of a dominant negative SLK reduces overall (CSA) of the regenerating fibers was measured from ran- kinase activity in muscle tissue, and affects muscle devel- dom fields (ImageScope; Aperio, Vista, CA, USA). Data opment and litter size. Interestingly, transgenic animals are presented as the proportion of fibers within a spe- showed enhanced regenerative capacity in vivo and in- cific range of CSA for both transgenic lines. Embryos creased differentiation potential in vitro. These results were collected by caesarean section of timed matings suggest complex and distinct roles for SLK in differenti- and genotyped using placental DNA. For immunostain- ation and function of muscle cells. ing, embryos and TA muscles were removed and fixed in 4% paraformaldehyde (PFA), followed by perfusion in Methods 10% sucrose. The tissues were then frozen in isopentane, Transgenic animals cut into12 μm sections, and assayed by immunochemistry. Animal studies were approved by the University of Ottawa Embryos or muscle sections were stained with MyoD animal ethics board. Care and use of experimental mice (sc304; Santa Cruz Biotechnology, Santa Cruz, CA, USA), followed the guidelines established by the Canadian Coun- Myogenin (F5D) and Pax7 (1E12). The Myogenin and cil on Animal Care. Pax7 monoclonals were used as hybridoma supernatants Transgenic plasmid DNA was constructed by inserting (Developmental Studies Hybridoma Bank, Iowa City, IA). the human skeletal actin promoter (−2500 bp) [33] up- Fiber-type-specific monoclonal antibodies consisted of Hy- stream of full-length (3600 bp) kinase-inactive SLK bearing bridoma Bank clones SC-71 (type IIA), BF-F3 (type IIB), a point mutation at lysine 63 (K63R) [20]. This ATP- and A4-840 (type I) (all kind gift of Dr Robert Parry, Uni- binding site mutation inactivates kinase activity in an auto- versity of Ottawa). phosphorylation assay [20]. Injection and derivation of For western blotting and kinase assays, lower anterior transgenic mice were performed using linearized plasmid muscles or cardiac tissue were removed and ground in DNA as previously described [34]. liquid nitrogen. The tissue powder was then lysed in C57BL/6-C3H F1 (C6B3F1) mice 6 to 8 weeks old RIPA buffer as previously described [28], and lysates (Charles River Laboratories, Wilmington, MA, USA). were cleared by centrifugation at 10,000 g for 2 minutes. Hybrid C6B3F1 mice were used as donors for fertilized Protein concentrations were determined using protein one-cell embryos. DNA fragments were microinjected assay dye reagent (Bio-Rad Laboratories, Inc., Hercules, into the pronucleus of donor embryos, and pseudopreg- CA, USA). Equal amounts of protein (20 to 40 μg) were nant females were used as recipients for the modified zy- separated by electrophoresis on 8 to 15% polyacrylamide gotes. Potential founders were weaned at 3 weeks after gels, and transferred to PVDF membranes. Membranes birth, and tail biopsies were collected for genotyping by were probed with anti-hemagglutinin (HA; 12CA5) or Southern blotting as described previously [35]. Founders anti-SLK antibodies overnight at 4°C in 5% skim milk were then bred with C6B3F1 wild-type mice, and trans- powder in 1 × Tris-buffered saline with Tween (TBS-T; genic lines were backcrossed onto FVB/N wild-type mice 50 mmol/l Tris pH 7.4, 150 mmol/l NaCl, and 0.05 Tween for several generations to establish independent transgenic 20). Membranes were washed in TBS-T and the reactive lines. Positive transgenic pups were subsequently geno- proteins were detected using chemiluminescence (Perkin typed from ear punch DNA using a mouse genotyping kit Elmer, Waltham, MA, USA) and exposure to X-ray film. (Kapa Biosystems, Inc., Woburn, MA, USA) by PCR am- For immunoprecipitations, 300 μg of protein lysate plification (see Table 1 for primers). was immunoprecipitated with 2 μg of antibody and 20 μl of protein A sepharose (Pharmacia & Upjohn Inc., Tissue collection and analysis Bridgewater, NJ, USA) for 2 to 12 hours. Immune com- For muscle injury, mice aged 8 to 10 weeks old were plexes were recovered by centrifugation and washed with anesthetized, and cardiotoxin 10 μmol/l was injected NETN buffer (20 mmol/l Tris–HCl pH 8.0, 1 mmol/l Storbeck et al. Skeletal Muscle 2013, 3:16 Page 3 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 EDTA, 150 mmol/l NaCl, 0.5% Nonidet P-40), then used for SDS-polyacrylamide gel electrophoresis (PAGE) or kinase assays. In vitro kinase assays were performed fol- lowing SLK immunoprecipitation as described previously [28], transferred to PVDF membranes and used for auto- radiography, followed by western blotting with SLK anti- body [24]. Satellite-cell cultures and in vitro differentiation Hind leg muscles from mice 4 to 6 weeks old were minced in PBS, and primary myoblasts were isolated as described previously [36]. The myoblasts were grown in Ham’s F-10 medium (Sigma-Aldrich, St Louis, MO, USA) supplemented with basic fibroblast growth factor 10 ng/ml (Sigma-Aldrich). Cells were grown in 6-well collagen-coated dishes (Corning Inc., Corning, NY, USA) and induced to differentiate in DMEM containing 2% horse serum (Sigma-Aldrich) when the cultures reached 70 to 80% confluency. After 3 days, the myotubes were washed with PBS and fixed in 4% PFA for 5 minutes at room temperature. The cells were stained with DAPI and for myosin heavy chain (MF20) in conjunction with a Cy3 anti-mouse secondary antibody (Jackson Immunoresearch Laboratories Inc., West Grove, PA, USA). Visualization and image acquisition was performed using a fluorescence microscope (Axiovert; Carl Zeiss, Jena, Germany). The fusion index was calculated as the number of nuclei in myotubes over the total number of nuclei in the field: Figure 1 Generation of transgenic lines. (A) Schematic ðÞ number of MF20 nuclei=totalnumberof nucleiinfield representation of the hemagglutinin-tagged Ste20-like kinase (SLK) 100: construct. Full-length murine SLK mutated at the ATP-binding site (K63R) is driven by 2500 bp of upstream promoter sequences derived from the human skeletal actin gene. A SV40 polyadenylation Only myotubes containing three or more nuclei were signal was also cloned downstream of SLK (not shown). The 1.9 kb scored. PvuII probe fragment spanning the promoter and cDNA regions is For western blot analyses cultures were lysed as above shown. (B) Representative Southern blot analysis of a full litter from line 3405 crossed with wild-type FVB/N showing the transgene and probed with MF20, MyoD, myogenin and cyclin D1 signal on a PvuII digest of tail DNA. The corresponding PCR analysis (sc20044; Santa Cruz Biotechnology) antibodies. is shown below the autoradiogram. Results Generation of SLK transgenic mice We have previously shown that SLK is highly expressed Two transgenic lines were then derived from independent in both the neuronal and myogenic compartment in the founders for further analysis. developing embryo [31]. In addition, expression of a To verify SLK transgene expression, muscle tissue was kinase-inactive SLK in C2C12 cells inhibits myoblast fusion taken from the lower hind leg, then homogenized and [32]. Together, these data suggest a role for SLK in muscle surveyed for transgene expression using immunoprecipi- differentiation and function. To gain further insight into tation and western blot analysis. Both lines expressed the role of SLK in differentiated muscles, we generated a epitope-tagged SLK in muscle tissue (Figure 2). Interest- skeletal actin-driven transgene (Figure 1). The HA-tagged ingly, levels of HA-SLK were about two-fold to three- kinase-inactive SLK (K63R) transgene was purified and fold higher in line 654 than in line 3405. We and others injected into donor zygotes. Using Southern blot analysis have shown previously that the K63R mutation abolishes and a transgene-specific probe (Figure 1), 5 founders were autophosphorylation activity [20,37]. To test for kinase identified from 45 mice surveyed. The presence of the activity in our transgenic lines, total tissue lysates were transgene was further confirmed by PCR analysis (Figure 1). used for SLK kinase assays [25]. In vitro kinase assays Storbeck et al. Skeletal Muscle 2013, 3:16 Page 4 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Figure 2 Characterization of Ste20-like kinase (SLK) expression in transgenic lines. (A) Total lysates from anterior hind leg muscles were immunoprecipitated with anti-hemagglutinin (HA) antibodies (12CA5). Subsequent probing for SLK showed expression of HA-tagged kinase in the 654 and 3405 transgenic lines. (B) Total lysates were immunoprecipitated for total SLK and used for in vitro kinase assays. Total SLK activity was markedly reduced in both transgenic lines. (C) Total tissue lysates from cardiac and hind leg muscles were surveyed for transgene expression using immunoprecipitation and anti-HA western blot. No expression was detected in the heart muscle of transgenic mice. (D) Monitoring wild- type to transgenic crosses showed that the higher-expressing 654 transgenic line produced fewer pups (absolute numbers) compared with the 3405 line. The proportion of transgenic animals was the same. (E) Monitoring of litter numbers over 4 to 6 months showed reduced breeding capacity in the 654 line. (Figure 2B) showed that, in both transgenic lines, the over- rearrangement or inactivation that could explain the appa- all SLK kinase activity was markedly reduced, suggesting rent dominant lethality phenotype in this line. that HA-K63R is acting as a dominant-negative kinase To further investigate the embryonic phenotype, trans- [37,38]. Furthermore, quantification of the SLK western blot genic and wild-type embryos from timed matings were (Figure 2B) showed that the overall SLK levels in the trans- collected for analysis. The embryos (11.5 and 13.5 days genic lines were about two-fold and four-fold higher than post-conception (dpc)) were cryosectioned and used for in wild-type animals. As previously reported, no transgene MF20 or myogenin immunostaining. MF20-positive fi- expression was detected in cardiac tissues (Figure 2C) [39]. bers were present in both wild-type and transgenic 13.5 To investigate the effect of HA-K63R overexpression, the dpc embryos (Figure 3B-E). However, muscle fibers ap- breeding capacity and litter sizes for the two lines were peared to be significantly larger in the wild-type animals. monitored. Although both lines gave a similar proportion The wild-type muscles displayed thick parallel bundles of transgenic pups (around 50%), the higher-expressing of myofibers, whereas the high-expressing transgenic 654 line showed reduced breeding capacity and was much mice (line 654) had a more disorganized musculature more difficult to maintain (Figure 2D,E). Supporting this, (Figure 3B-E). Immunohistochemical analysis for myogenin, over a 6-month period, the average number of litters per an early myogenic marker [41,42], showed relatively smaller breeding pair (wild-type × transgenic) was found to be 1.2 pre-muscle masses in the high-expressing 654 line at 11.5 and 2.5 for the 654 and 3405 lines, respectively. In addition, dpc (Figure 3F,G). As for older embryos, MF20 analysis of the average litter size was found to be significantly smaller 11.5 dpc embryos showed smaller myofibers and reduced in the 654 line (mean ± SD 4.8 ± 2) than in the 3405 line pre-muscle masses (Figure 3H,I). (9 ± 2) or the wild-type FVB/N (9.8 ± 1.3) (Figure 3A). One These results suggest that muscle development may be possibility is that high levels of kinase-inactive SLK in delayed in high-expressing embryos. As it displayed a muscle tissues is detrimental. Alternatively, as previously more robust phenotype, only the 654 line was further described [40], the 654 line could bear a chromosomal characterized. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 5 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Figure 3 (See legend on next page.) Storbeck et al. Skeletal Muscle 2013, 3:16 Page 6 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 (See figure on previous page.) Figure 3 Overexpression of hemagglutinin (HA)-K63R affects muscle development. (A) Monitoring of litter sizes showed that the higher-expressing 654 line gave rise to 50% fewer pups than the 3405 line or wild-type FVB/N (* P<0.05for the3405or FVB/N t-test comparison). (B, C) Intercostal muscles of embryos at 13.5 days post-conception (dpc) stained for myosin heavy chain (MF20). (D, E) Forelimb muscles of the same embryos stained with MF20. Transgenic animals had smaller and more disorganized muscle fibers (arrowheads). (F, G) Immunohistochemistry for myogenin in 11.5 dpc embryos showing smaller myogenic compartments along the rostral-caudal axis in the 654 transgenic line. (H, I) Immunohistochemistry for MF20 as above in 11.5 dpc embryos. Altered regeneration in transgenic muscles stained with isotype-specific myosin heavy chain (MHC) We have previously reported that SLK is preferentially antibodies. Although no significant differences in the expressed in type I myofiber [32]. Therefore, to gain fur- proportion of each fiber type were seen (not shown), ther insights into the phenotype of the HA-K63R mice, measurements of the cross-sectional area of type I fibers we performed fiber typing analysis. The TA muscles of showed a significantly smaller proportion of large fibers transgenic and wild-type littermates were sectioned and (>6000 μ ) and an increased proportion of smaller fibers Figure 4 HA-K63R expressing mice display smaller type I fibers. TA muscles from both wild-type (WT) and transgenic (Tg) mice were cryosectioned and immunostained for (A, D) type I, (B, E) type IIA, or (C, F) type IIB. (G) The caliber of positive fibers was measured using ImageScope software (Aperio) and categorized into three groups. The proportion of the fibers falling within the groups was quantified. At least 100 fibers were measured from three independent animals. Results showed a smaller proportion of large type I fibers and more small fibers in transgenic animals (*P<0.05 for Tg versus WT Myosin Heavy Chain type I; t-test comparison). Storbeck et al. Skeletal Muscle 2013, 3:16 Page 7 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 (0 to 3000 μ ) in transgenic animals compared with showed that both lines of HA-K63R mice displayed pro- wild-type littermates (Figure 4). No differences in the portionally larger fibers at day 7 post-injury (Figure 5C). IIA or IIB fibers were seen. However, at day 14 post-injury, no significant differences Our previous results have shown that SLK kinase activ- were seen between the transgenic and wild-type animals ity is modulated during C2C12 differentiation, and that (Figure 5A insets; Figure 5C). Immunohistochemical ana- expression of a truncated dominant-negative SLK inhibits lysis of muscle regenerates at days 3 and 7 showed that the the differentiation of C2C12 cells when overexpressed in number of infiltrating myogenic precursor cells (MyoD+ myoblasts [32]. To further investigate the role of SLK in and Pax7+) was also unaffected (Figure 5D-H). These muscle differentiation, cardiotoxin-induced regeneration results suggest that mice expressing inactive SLK do not assays were performed on wildtype and HA-K63R trans- recruit more myogenic precursor cells but have an acceler- genic mice. For muscle-injury assays, mice 8 to 10 weeks ated regenerative capacity, resulting in a normal endpoint. old were injected with cardiotoxin or NaCl control. The To address this possibility further, satellite-cell cultures TA muscles were collected at various times post-injury, were derived from both HA-K63R lines and induced to and assessed by H&E staining. In contrast to wild-type lit- differentiate in vitro as the monolayers reached 70 to termates, HA-K63R mice generally displayed reduced areas 80% confluency. Differentiated myotubes were detected of damage at day 7 post-injury (Figure 5). No damage was using MHC staining, and fusion indices were calculated. seen in the NaCl control (not shown), whereas both geno- Myoblasts derived from HA-K63R mice displayed a types displayed regenerating fibers bearing centrally located more robust differentiation phenotype with a higher nuclei throughout the time course. Interestingly, quan- number of large myotubes (Figure 6). Fusion index ana- tification of fiber-size distribution in the damaged area lyses of myotubes bearing three or more nuclei had Figure 5 Expression of hemagglutinin (HA)-K63R enhances muscle regeneration. Muscle repair after cardiotoxin-induced injury was monitored at day 7 post-injection in (A) wild-type and (B) line 654 transgenic animals using hematoxylin and eosin staining. More damage was consistently seen in the wild-type animals. Insets show representative regenerates at day 14 post-injury, (C) The extent of damage was quantified by measuring the proportion of fibers with specific cross-sectional area (CSA) in the damaged area. Approximately 500 fibers were counted from 3 different animals forall genotypes. A shift towards an increased proportion of larger fibers was seen at day 7 for the transgenic groups, suggesting enhanced regeneration. No differences were seen at day 14. (D-G) Regenerating sections at day 3 from wild-type and transgenic mice were stained for MyoD and Pax7 to identify activated satellite cells (arrowheads). (H) Activated satellite cells were enumerated from at least three different animals at days 3 and 7 post-injury, and expressed as the proportion of total nuclei in the field. No differences were seen between the transgenic and wild-type animals. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 8 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 Figure 6D). However, myogenin and MyoD levels did not show any appreciable differences. Surprisingly, transgenic cultures showed a marked downregulation of cyclinD1 levels as they proceeded through differentiation. Wild- type cultures had a two-fold reduction in cyclin D1 over the time course, whereas a ten-fold downregulation was seen in the transgenic cultures (Figure 6D). Together, these data suggest that the HA-K63R myoblasts have en- hanced differentiation potential in vitro. and that they can exit the cell cycle much more efficiently. Discussion Using transgenic lines expressing a kinase-inactive SLK from the human skeletal actin promoter, we have shown that high levels of dominant-negative SLK result in im- paired development and accelerated differentiation in vivo following muscle injury. Similarly, myoblast cultures de- rived from transgenic mice differentiate more efficiently in vitro. These data suggest potentially complex and dis- tinct roles for SLK in embryonic and adult muscles. Muscle-cell differentiation and myoblast fusion is reg- ulated by complex signaling networks [3,43]. Myoblast fusion is also highly dependent on cytoskeletal remodeling and on factors controlling actin dynamics and adhesion [44-53]. We have recently shown that the Ste20-like kinase SLK is required for efficient cell migration, chemo- taxis, and focal adhesion turnover [24,26,27,54]. Our pre- vious findings showed that expression of kinase-inactive Figure 6 Expression of hemagglutinin (HA)-K63R enhances SLK in myoblasts impaired fusion [32]. To further investi- muscle differentiation in vitro.(A,B) Primary myoblast cultures were gate its role in skeletal muscle in the current study, we established from mice 4 to 6 weeks old and induced to differentiate by serum withdrawal. After 3 days, the cultures were stained for myosin generated transgenic mice expressing kinase-inactive SLK heavy chain (MHC) and with DAPI to establish the fusion index. from the human skeletal actin promoter. Immunoprecipi- (C) Quantification of the fusion index from MHC-stained myotube tation and western blotting analysis showed that in trans- cultures. The fusion index was established from myotubes bearing three genic animals the overall levels of SLK were increased or more nuclei using the equation: (number of nuclei in myotubes/total two-fold to four-fold. However, the overall kinase activity number of nuclei) × 100. The fusion indices were obtained from triplicate cultures of two independent animals from all genotypes. At was markedly reduced, suggesting that HA-K63R has a least 200 nuclei were counted. (*P<0.008 Tg654 versus wild-type (WT), dominant-negative effect. SLK has recently been reported ** P<0.05 Tg3405 versus WT). (D) Differentiating cultures from both to function as a homodimer [37,55]. Furthermore, auto- transgenic (Tg) line were monitored for the levels of MyHC, MyoD, phosphorylation of the activation loop seems to be re- myogenin and CyclinD1 by western blotting analysis. The figure shows quired for maximal kinase activity. Therefore, it is likely results for the 3405 line; similar findings were seen for the 654 line. that the HA-K63R version can associate with endogenous SLK, preventing full activation as a result of lack of mean (±SD) fusion indices of 67 ± 3% and 58 ± 3% for complete autophosphorylation. This dominant-negative the HA-K63R lines compared with 46 ± 8% for wild- phenotype is therefore likely to be contributing to the de- type littermates. These results suggest that myoblasts layed development of the higher-expressing 654 line. derived from HA-K63R mice can differentiate more effi- Interestingly, mice that are deficient for both MyoD ciently, supporting our in vivo findings. and Myf5 develop until birth [56,57]. As the transgene is To further investigate the mechanism responsible for not detected in cardiac tissues (Figure 2), it is unclear enhanced differentiation in vitro, myoblast cultures from how muscle-specific K63R transgene expression induces transgenic and wild-type animals were differentiated embryonic lethality. It is possible that high expression of and assessed for the expression of differentiation mark- kinase-inactive SLK in pre-muscle masses is detrimental. ers. Supporting the in vitro fusion data, MHC levels However, a more likely explanation is that the 654 line were markedly increased in HA-K63R cultures at day 2 has undergone a chromosomal rearrangement of a crucial after onset of differentiation (four-fold versus >100-fold; gene, responsible for this apparent dominant embryonic Storbeck et al. Skeletal Muscle 2013, 3:16 Page 9 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 lethality. These anomalies have been shown to result promoter enhanced muscle regeneration after cardiotoxin- in reduced litter sizes and arrested development be- induced damage. Similarly, myoblast cultures derived from fore 7 dpc [40]. HA-K63R-expressing mice displayed increased differenti- Our previous data showed that SLK is preferentially ation potential, as evidenced by higher fusion indices and expressed in type I myofibers [32]. Interestingly, HA- increased levels of MHC protein. As SLK is required both K63R-expressing mice displayed a reduced proportion of for proliferation [28] and cytoskeletal dynamics [23], these large type I fibers, suggesting a possible role for SLK in observations raise the possibility that SLK plays different the maintenance of these fibers. Several adhesion proteins roles during myoblast differentiation. Supporting this, SLK such as focal adhesion kinase (FAK) and paxillin have kinase activity is downregulated upon serum withdrawal been implicated in muscle organization and function from C2C12 cultures, but upregulated in differentiated [58-60]. As SLK is activated downstream of FAK-mediated myotubes [32]. As myoblast proliferation and differenti- motility signaling [24,27], one possibility is that expression ation are mutually exclusive [43], one possibility is that of HA-K63R suppresses further signals, leading to matur- HA-K63R expression in differentiating myocytes facilitates ation defects and atrophy. cell-cycle exit, enhancing differentiation. Supporting this Using C2C12 cells, we previously found that expression hypothesis is the observation that differentiating trans- of a truncated kinase-inactive SLK in myoblasts inhibits genic cultures show marked downregulation of cyclin D1 fusion in a cell autonomous manner [32]. Surprisingly, ex- levels, suggesting that they exit the cell cycle much more pression of dominant-negative SLK from the skeletal actin efficiently than do wild-type cells. Surprisingly, fusion is Figure 7 Complex roles for Ste20-like kinase in muscle development and regeneration. (A) After muscle injury (left side), SLK is required for proliferation of activated satellite cells. Upon terminal differentiation, SLK activity is downregulated (down arrow), leading to cell-cycle exit and growth arrest [32]. SLK activity is then upregulated upon myoblast fusion and myofiber maturation (up arrow). Similarly, in cultured myoblasts (right side) SLK is downregulated for growth arrest and upregulated during fusion and maturation. Expression of kinase-dead SLK (K63R) as myoblasts enter the differentiation pathway enhances cell-cycle arrest and differentiation. (B) In the developing embryos, expression of kinase-dead SLK from the skeletal actin promoter delays terminal differentiation and maturation, suggesting a distinct role for SLK in embryonic myogenesis. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 10 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 enhanced in HA-K63R-derived myoblasts. It is possible Authors’ contributions CJS carried out the transgenic design and initial characterization as well as that the residual low level of kinase activity is sufficient to the experimental designs. KNA performed immunohistochemistry and tissue allow fusion to proceed. analysis of embryos. RS and SK performed myoblast isolation and western The observed enhanced regeneration and differenti- blot analysis. PO collected regenerating samples and performed H&E staining. KD and MM maintained animal colonies and performed muscle ation is in marked contrast to the developmental delay injuries. LAS conceived the study, and RK and CT coordinated some of the seen in the muscles of transgenic embryos. One possibil- experimental studies. All authors read and approved the final manuscript. ity is that SLK has different functions in embryonic myogenic cells and adult satellite cells (Figure 7). Studies Acknowledgements This work was supported by the Canadian Institute for Health Research and have shown that skeletal actin is expressed in mononu- MDAUSA. CJS is the recipient of a Canadian Heart and Stroke Foundation cleated myocytes before fusion [61-66], suggesting that Fellowship. KAZ is funded by the Canadian Breast Cancer Foundation. PO is the the transgene could be expressed as some precursor cell recipient of an OGSST studentship. The authors declare no conflict of interest. populations expand and enter the differentiation path- Received: 24 October 2012 Accepted: 2 May 2013 way. Because of its role in cell-cycle progression, high Published: 1 July 2013 levels of dominant-negative SLK may impair this expan- sion in the expressing embryos. Alternatively, expression References 1. Fuchtbauer EM: Inhibition of skeletal muscle development: less of kinase-inactive SLK in myocytes in vivo impairs their differentiation gives more muscle. Results Probl Cell Differ 2002, 38:143–161. terminal differentiation without affecting cell-cycle pro- 2. Charge SB, Rudnicki MA: Cellular and molecular regulation of muscle gression. By contrast, kinase-inactive SLK may accelerate regeneration. Physiol Rev 2004, 84(1):209–238. 3. Rudnicki MA, et al: The molecular regulation of muscle stem cell function. cell-cycle exit in satellite cells, thereby speeding up myo- Cold Spring Harb Symp Quant Biol 2008, 73:323–331. blast fusion and injury repair. Interestingly, our previous 4. Tapscott SJ: The circuitry of a master switch: Myod and the regulation of data showed that expression of a truncated kinase-inactive skeletal muscle gene transcription. Development 2005, 132(12):2685–2695. 5. Guttridge DC: Signaling pathways weigh in on decisions to make or SLK (KΔC) in C2C12 myoblasts impairs differentiation break skeletal muscle. Curr Opin Clin Nutr Metab Care 2004, 7(4):443–450. [32]. This would suggest that SLK activity is required after 6. Zhao ZS, et al: Pheromone signalling in Saccharomyces cerevisiae cell-cycle exit and before fusion. In this case, expression of requires the small GTP-binding protein Cdc42p and its activator CDC24. Mol Cell Biol 1995, 15(10):5246–5257. full-length kinase-dead SLK (K63R) in differentiating cells, 7. Leberer E, et al: Functional characterization of the Cdc42p binding from a differentiation-specific promoter, seems to enhance domain of yeast Ste20p protein kinase. EMBO J 1997, 16(1):83–97. cell-cycle exit and terminal differentiation, suggesting that 8. Dan I, Watanabe NM, Kusumi A: The Ste20 group kinases as regulators of MAP kinase cascades. Trends Cell Biol 2001, 11(5):220–230. SLK downregulation in differentiating cells enhances myo- 9. Brown JL, et al: Human Ste20 homologue hPAK1 links GTPases to the blast fusion and differentiation. Another important con- JNK MAP kinase pathway. Curr Biol 1996, 6(5):598–605. sideration is the fact that K63R encodes the full-length 10. Dan C, et al: Cytoskeletal changes regulated by the PAK4 serine/threonine kinase are mediated by LIMK1 and cofilin. JBiol Chem 2001, 18:18. kinase, suggesting that the 829 amino acids deleted from 11. Daniels RH, Hall PS, Bokoch GM: Membrane targeting of p21-activated KΔC might play an important scaffolding role that is cru- kinase 1 (PAK1) induces neurite outgrowth from PC12 cells. EMBO J 1998, cial to myoblast differentiation. 17(3):754–764. 12. Fanger GR, et al: MEKKs, GCKs, MLKs, PAKs, TAKs, and tpls: upstream regulators of the c- Jun amino-terminal kinases? Curr Opin Genet Dev 1997, 7(1):67–74. Conclusions 13. Hu MC, et al: Human HPK1, a novel human hematopoietic progenitor Together with our previous results [32], these data suggest kinase that activates the JNK/SAPK kinase cascade. Genes Dev 1996, 10(18):2251–2264. a complex mechanism by which SLK is required for cyto- 14. Kuramochi S, et al: LOK is a novel mouse STE20-like protein kinase that is skeletal dynamics before fusion, then is downregulated for expressed predominantly in lymphocytes. J Biol Chem 1997, cell-cycle exit but re-activated for muscle-specific func- 272(36):22679–22684. 15. Lee N, et al: Activation of hPAK65 by caspase cleavage induces some of tions. Identification of SLK substrates and generation of the morphological and biochemical changes of apoptosis. Proc Natl Acad SLK knockout models will further help to delineate be- Sci U S A 1997, 94(25):13642–13647. tween these possibilities. 16. Al-Zahrani KN, Baron KD, Sabourin LA: Ste20-like kinase SLK, at the crossroads: a matter of life and death. Cell Adh Migr 2013, 7(1):1–10. 17. Itoh S, et al: Molecular cloning and characterization of a novel putative Abbreviations STE20-like kinase in guinea pigs. Arch Biochem Biophys 1997, CSA: Cross-sectional area; DAPI: 4',6-diamidino-2-phenylindole; 340(2):201–207. DMEM: Dulbecco’s modified Eagle’s medium; Dpc: Days post-conception; 18. Pytowski B, et al: Identification and initial characterization of mSLK, a FAK: Focal adhesion kinase; H&E: Haematoxylin and eosin; murine member of the STE20 family of kinases. Arch Biochem Biophys HA: Hemagglutinin; MAPK: Mitogen-activated protein kinase; MHC: Myosin 1998, 359(2):310–319. heavy chain; PAGE: Polyacrylamide gel electrophoresis; PBS: Phosphate 19. Sabourin LA, Rudnicki MA: Induction of apoptosis by SLK, a Ste20-related buffered saline; PFA: Paraformaldehyde; PVDF: Polyvinylidene difluoride; kinase. Oncogene 1999, 18:7566–7575. RIPA: Radio-immunoprecipitation assay; SDS: Sodium dodecyl sulfate; 20. Sabourin LA, et al: Caspase 3 cleavage of the Ste20-related kinase SLK SLK: Ste20-like kinase; TA: Tibialis anterior; TBS-T: Tris-buffered saline with Tween. releases and activates an apoptosis-inducing kinase domain and an actin-disassembling region. Mol Cell Biol 2000, 20(2):684–696. 21. Hao W, et al: Induction of apoptosis by the Ste20-like kinase SLK, a Competing interests germinal center kinase that activates apoptosis signal-regulating kinase The authors declare no competing interests. and p38. J Biol Chem 2006, 281(6):3075–3084. Storbeck et al. Skeletal Muscle 2013, 3:16 Page 11 of 11 http://www.skeletalmusclejournal.com/content/3/1/16 22. Cybulsky AV, et al: Podocyte injury and albuminuria in mice with 50. Heller H, Gredinger E, Bengal E: Rac1 inhibits myogenic differentiation by podocyte-specific overexpression of the Ste20-like kinase. SLK. Am J preventing the complete withdrawal of myoblasts from the cell cycle. Pathol 2010, 177(5):2290–2299. J Biol Chem 2001, 276(40):37307–37316. 23. Wagner SM, Sabourin LA: A novel role for the Ste20 kinase SLK in 51. Laurin M, et al: The atypical Rac activator Dock180 (Dock1) regulates adhesion signaling and cell migration. Cell Adh Migr 2009, 3(2):182–184. myoblast fusion in vivo. Proc Natl Acad Sci U S A 2008, 24. Wagner S, et al: FAK/src-family dependent activation of the Ste20-like 105(40):15446–15451. kinase SLK is required for microtubule-dependent focal adhesion 52. Meriane M, et al: Critical activities of Rac1 and Cdc42Hs in skeletal turnover and cell migration. PLoS One 2008, 3(4):e1868. myogenesis: antagonistic effects of JNK and p38 pathways. Mol Biol Cell 25. Wagner S, et al: Association of the Ste20-like kinase (SLK) with the 2000, 11(8):2513–2528. microtubule. Role in Rac1-mediated regulation of actin dynamics during 53. Schwander M, et al: [beta]1 integrins regulate myoblast fusion and cell adhesion and spreading. J Biol Chem 2002, 277(40):37685–37692. sarcomere assembly. Dev Cell 2003, 4(5):673–685. 54. Quizi JL, et al: SLK-mediated phosphorylation of paxillin is required for 26. Storbeck CJ, et al: The Ldb1 and Ldb2 transcriptional co-factors interact focal adhesion turnover and cell migration. Oncogene 2012. In Press. with the Ste20-like Kinase SLK and regulate cell migration. Mol Biol Cell 55. Pike AC, et al: Activation segment dimerization: a mechanism for kinase 2009, 20(19):4174–4182. autophosphorylation of non-consensus sites. EMBO J 2008, 27(4):704–714. 27. Roovers K, et al: The Ste20-like kinase SLK is required for ErbB2-driven 56. Rudnicki MA, et al: MyoD or Myf-5 is required for the formation of breast cancer cell motility. Oncogene 2009, 28(31):2839–2848. skeletal muscle. Cell 1993, 75(7):1351–1359. 28. O’Reilly PG, et al: The Ste20-like kinase SLK is required for cell cycle 57. Buckingham ME: Muscle: the regulation of myogenesis. Curr Opin Genet progression through G2. J Biol Chem 2005, 280(51):42383–42390. Dev 1994, 4(5):745–751. 29. Ellinger-Ziegelbauer H, et al: Ste20-like kinase (SLK), a regulatory kinase 58. Quach NL, Rando TA: Focal adhesion kinase is essential for costamerogenesis for polo-like kinase (Plk) during the G2/M transition in somatic cells. in cultured skeletal muscle cells. Dev Biol 2006, 293(1):38–52. Genes Cells 2000, 5(6):491–498. 59. Fluck M, et al: Focal adhesion proteins FAK and paxillin increase in 30. Burakov AV, et al: Ste20-related protein kinase LOSK (SLK) controls hypertrophied skeletal muscle. Am J Physiol 1999, 277(1 Pt 1):C152–C162. microtubule radial array in interphase. Mol Biol Cell 2008, 19(5):1952–1961. 60. Bae GU, et al: Neogenin regulates skeletal myofiber size and focal 31. Zhang Y-H, et al: Expression of the Ste20-like kinase SLK during adhesion kinase and extracellular signal-regulated kinase activities embryonic development and in the murine adult central nervous in vivo and in vitro. Mol Biol Cell 2009, 20(23):4920–4931. system. Brain Res Dev Brain Res 2002, 139(2):205–215. 61. Lin Z, et al: Sequential appearance of muscle-specific proteins in 32. Storbeck CJ, et al: Ste20-like kinase SLK displays myofiber type specificity myoblasts as a function of time after cell division: evidence for a and is involved in C2C12 myoblast differentiation. Muscle Nerve 2004, conserved myoblast differentiation program in skeletal muscle. Cell Motil 29(4):553–564. Cytoskeleton 1994, 29(1):1–19. 33. Mankodi A, et al: Myotonic dystrophy in transgenic mice expressing an 62. Lancioni H, et al: Muscle actin isoforms are differentially expressed in expanded CUG repeat. Science 2000, 289(5485):1769–1773. human satellite cells isolated from donors of different ages. Cell Biol Int 34. Guy LG, et al: The beta-globin locus control region enhances 2007, 31(2):180–185. transcription of but does not confer position-independent expression 63. Furst DO, Osborn M, Weber K: Myogenesis in the mouse embryo: onto the lacZ gene in transgenic mice. EMBO J 1996, 15(14):3713–3721. differential onset of expression of myogenic proteins and the 35. Maniatis T, Fritsch EF, Sambrook J: Molecularcloning: alaboratory manual. involvement of titin in myofibril assembly. J Cell Biol 1989, 109(2):517–527. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1982. 64. Burattini S, et al: C2C12 murine myoblasts as a model of skeletal muscle 36. Rando TA, Blau HM: Primary mouse myoblast purification, development: morpho-functional characterization. Eur J Histochem 2004, characterization, and transplantation for cell-mediated gene therapy. 48(3):223–233. J Cell Biol 1994, 125(6):1275–1287. 65. Baroffio A, et al: Identification of self-renewing myoblasts in the progeny 37. Delarosa S, et al: Activity of the Ste20-like kinase, SLK, is enhanced by of single human muscle satellite cells. Differentiation 1996, 60(1):47–57. Homodimerization. Am J Physiol Renal Physiol 2011, 301:F554–64. 66. Springer ML, Ozawa CR, Blau HM: Transient production of alpha-smooth 38. Luhovy AY, et al: Regulation of the Ste20-like kinase, SLK: involvement of muscle actin by skeletal myoblasts during differentiation in culture and activation segment phosphorylation. J Biol Chem 2012, 287(8):5446–5458. following intramuscular implantation. Cell Motil Cytoskeleton 2002, 39. Miura S, et al: Overexpression of peroxisome proliferator-activated 51(4):177–186. receptor gamma coactivator-1alpha down-regulates GLUT4 mRNA in skeletal muscles. J Biol Chem 2003, 278(33):31385–31390. doi:10.1186/2044-5040-3-16 40. Mahon KA, Overbeek PA, Westphal H: Prenatal lethality in a transgenic Cite this article as: Storbeck et al.: Distinct roles for Ste20-like kinase SLK mouse line is the result of a chromosomal translocation. Proc Natl Acad in muscle function and regeneration. Skeletal Muscle 2013 3:16. Sci U S A 1988, 85(4):1165–1168. 41. Sassoon D, et al: Expression of two myogenic regulatory factors myogenin and MyoD1 during mouse embryogenesis. Nature 1989, 341(6240):303–307. 42. Buckingham M, et al: Expression of muscle genes in the mouse embryo. Symp Soc Exp Biol 1992, 46:203–217. 43. Sabourin LA, Rudnicki MA: The molecular regulation of myogenesis. Clin Genet 2000, 57(1):16–25. 44. Bataille L, et al: Downstream of identity genes: muscle-type-specific Submit your next manuscript to BioMed Central regulation of the fusion process. Dev Cell 2010, 19(2):317–328. 45. Alvarez B, et al: Integrin cytoplasmic domain-Associated protein-1 and take full advantage of: (ICAP-1) promotes migration of myoblasts and affects focal adhesions. J Cell Physiol 2008, 214(2):474–482. • Convenient online submission 46. Brzoska E, et al: Integrin alpha3beta1 subunit participates in myoblast • Thorough peer review adhesion and fusion in vitro. Differentiation 2006, 74(2–3):105–118. 47. Crawley S, et al: The alpha7beta1 integrin mediates adhesion and migration • No space constraints or color figure charges of skeletal myoblasts on laminin. Exp Cell Res 1997, 235(1):274–286. • Immediate publication on acceptance 48. de Oliveira MV, et al: SHP-2 regulates myogenesis by coupling to FAK • Inclusion in PubMed, CAS, Scopus and Google Scholar signaling pathway. FEBS Lett 2009, 583(18):2975–2981. 49. Fortier M, et al: RhoE controls myoblast alignment prior fusion through • Research which is freely available for redistribution RhoA and ROCK. Cell Death Differ 2008, 15(8):1221–1231. Submit your manuscript at www.biomedcentral.com/submit

Journal

Skeletal MuscleSpringer Journals

Published: Jul 1, 2013

References