Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You and Your Team.

Learn More →

A novel approach for the isolation and long-term expansion of pure satellite cells based on ice-cold treatment

A novel approach for the isolation and long-term expansion of pure satellite cells based on... Satellite cells (SCs) are muscle stem cells capable of regenerating injured muscle. The study of their functional potential depends on the availability of methods for the isolation and expansion of pure SCs with preserved myogenic properties after serial passages in vitro. Here, we describe the ice-cold treatment (ICT) method, which is a simple, economical, and efficient method for the isolation and in vitro expansion of highly pure mouse and human SCs. It involves a brief (15–30 min) incubation on ice (0 °C) of a dish containing a heterogeneous mix of adherent muscle mononuclear cells, which leads to the detachment of only the SCs, and gives rise to cultures of superior purity compared to other commonly used isolation methods. The ICT method doubles up as a gentle passaging technique, allowing SC expansion over extended periods of time without compromising their proliferation and differentiation potential. Moreover, SCs isolated and expanded using the ICT method are capable of regenerating injured muscle in vivo. The ICT method involves minimal cell manipulation, does not require any expertise or expensive reagents, it is fast, and highly reproducible, and greatly reduces the number of animals or human biopsies required in order to obtain sufficient number of SCs. The cost-effectiveness, accessibility, and technical simplicity of this method, as well as its remarkable efficiency, will no doubt accelerate SC basic and translational research bringing their therapeutic use closer to the clinic. Keywords: Satellite cell isolation, Satellite cells in vitro expansion, Skeletal muscle regeneration Background 5]. As SCs become activated, a proportion of them iden- + - The muscle is endowed with an exceptional regenerative tified as Pax7 MyoD replenish the stem cell pool, while + + ability primarily due to a resident population of stem others acquire the expression of MyoD (Pax7 MyoD ), cells called satellite cells (SCs) [1–3]. Ensconced between differentiate into myoblasts and enter the myogenic pro- the basal lamina and the plasma membrane of muscle fi- gram. After several rounds of division myoblasts give bers, SCs respond to injury or various stress stimuli by rise to Myogenin myocytes, which fuse together to form becoming activated, and undergoing proliferation, self- new myofibers [1, 4, 6–9]. renewal, and differentiation to form new myofibers [4, A major stumbling block in the study of the functional potential of SCs has been the lack of isolation methods involving minimal cell manipulation and allowing the * Correspondence: biliana.lozanoska-ochser@uniroma1.it isolation and expansion of highly pure SCs with pre- Bouche Marina Lozanoska-Ochser Biliana are co-senior authors. served myogenic properties after serial passages in vitro Department of Anatomical, Histological, Forensic and Orthopedic Sciences, Section of Histology and Embryology, Sapienza University of Rome, Rome, [10–12]. Moreover, the success of SC transplantation Italy therapy depends on having an efficient method to isolate Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Benedetti et al. Skeletal Muscle (2021) 11:7 Page 2 of 12 and expand these cells in vitro in undifferentiated state There is therefore a need for new and improved and in sufficient numbers [13]. methods for the isolation, expansion and culture of SCs. Presently, there are three main methods commonly Here, we describe a simple, inexpensive, and efficient used for the isolation of SCs: the pre-plating method, method for the isolation of highly pure mouse and hu- fluorescence activated cell sorting (FACS), and magnetic man SCs that can be serially expanded in vitro to obtain bead isolation method. sufficient number of SCs with preserved proliferation The pre-plating method is based on the differing potential, capable of regenerating injured muscle in vivo. adhesive properties of muscle cells, with SCs being the least adherent. Following enzymatic digestion, a Methods heterogeneous mix of skeletal muscle cells is plated Mice mdx onto uncoated culture dishes and after a 1–24-h incu- C57BL/10ScSn-Dmd , C57BL/10ScSn, and C57BL/6J bation at 37 C, the non-adherent cells are collected mice were purchased from the Jackson laboratory (Bar and plated onto new collagen coated dishes [10–12, Harbor, ME, USA). Both male and female mice were 14]. The resulting cell culture contains both SCs and used. The mice were housed in the Histology Depart- fibroblasts in variable proportion. To improve SC ment–accredited animal facility at the University of purity, the pre-plating step can be repeated every 24 Sapienza. All the procedures were approved by the Ital- h over 6 days [10]. Although cheap and straightfor- ian Ministry for Health and were conducted according ward to perform, this method’s main disadvantage is to the EU regulations and the Italian Law on Animal that it is time consuming and gives rise to cultures of Research. variable purity, with fibroblast contamination and overgrowth by day 7 of culture, leading to early sen- Human muscle sourcing escence and detachment of myotubes [10]. A recently Muscle biopsies (gluteus maximus) were obtained from described version of the pre-plating method intro- patients (8 males and 7 females, age range 50–90 years) duces a re-plating step whereby after a 2-day expan- undergoing surgery at the Department of Orthopaedics sion, the adhered cells are detached with trypsin and and Traumatology, Umberto I Hospital in Rome, Italy. replated onto Matrigel coated dishes, giving rise to According to the Italian law, the authors are not re- SC cultures of much improved purity [15]. quired to ask for approval from an institutional review The FACS sorting method sorts muscle mononuclear board or ethical committee for this type of study. In any cells pre-labelled with SC specific antibodies. Following case, all patients gave their approval to undergo intraop- digestion of muscle with various enzymes the resulting erative muscle biopsy and to publish the clinical and la- mixture of cells is labelled with specific antibodies to fa- boratory data obtained. cilitate the identification of SCs, which are then sorted using a FACS sorter instrument [16–21]. At present, the Satellite cell isolation with the ice-cold treatment method FACS sorting method represents the gold standard for SCs were isolated from hind-limb muscles of 4–8-week- the isolation and study of SCs. Nevertheless, there are old mice or from human biopsies. Muscles were dis- several disadvantages to this method including high cost sected with scissors and finely diced with a scalpel in a and the requirement for a FACS sorter instrument. dish containing DMEM (Sigma-Aldrich, St. Louis, MO, Moreover, this method is time consuming, requires ex- USA, D5671). This was followed by enzymatic digestion pertise to perform and cell purity can be variable. The with 10 ml/g of muscle of Collagenase type II (Sigma-Al- cell labelling step followed by the sorting procedure can drich, SCR103) at a concentration of 0.4 mg/ml in PBS potentially stress or damage the cells, decrease their via- (Sigma-Aldrich), for 45 min in a water bath at 37 °C bility, or alter their functional properties in vitro [12]. with agitation. Digestion was blocked with DMEM 10% The third method is based on magnetic cell separation FBS and after centrifuging the muscle preparation and (MACS) and uses magnetic columns and SC specific removing the supernatant, a second digestion was per- magnetic bead kits [22]. It is based on negative selec- formed with 10 ml/g of muscle of Collagenase/Dispase tion of SCs by magnetically labelling and removing at a concentration of 1 mg/ml (Roche, Basel, CH, other cell lineages. Because this method assumes that 11097113001) in PBS Calcium-Magnesium free (Sigma- all the other cell types are successfully removed from Aldrich), for 30 min at 37 °C in a water bath with agita- the muscle cell preparation, it is less precise than the tion. The digested muscle was then passed first through FACS sorting method. This method is expensive to a 70-μm cell strainer followed by 40-μm cell strainer to perform, time consuming, and stressful for the cells. obtain single cell suspension. Next, the cells were centri- As for the other two methods, cell purity is variable fuged, resuspended in DMEM 10% FBS (Sigma-Aldrich, and often the SC cultures become overgrown by fi- F2442), counted and plated at 2 × 10 cells/100 mm dish broblasts by day 7 [10, 12]. (uncoated) (Corning, NY, USA, 430167), and incubated Benedetti et al. Skeletal Muscle (2021) 11:7 Page 3 of 12 at 37 °C for 1 h. Non-adherent cells were collected, cen- SC transplantation trifuged, and the cell pellet was resuspended in DMEM Acute muscle injury was induced the day before SC 10% FBS, plated again, and incubated for another 1 h at transplantation. To induce muscle injury tibialis muscles 37 °C. After the second pre-plating, non-adherent cells were injected with 0.01 ml of Cardiotoxin from Naja Pal- were collected, centrifuged, counted, resuspended in SC lida (10 μM) (Latoxan ZA, Les Auréats, Fr), using a 30 Growth Medium (GM) DMEM, 20% Horse Serum Gauge micro-syringe [23–26]. (Thermo Fisher Scientific, Waltham, MA, USA, For cell transplantation, 15,000 SCs were resuspended 26050088), 3% Chicken Embryo Extract (Seralab, CE- in 20 μl of DMEM 2% FBS (Sigma-Aldrich) and injected 650-J), and plated into 100 mm dishes coated with 0.1% into the TA muscle of one leg with a single injection by gelatin (Stem Cell Technologies, Vancouver, BC, CAN, using a 30 Gauge micro-syringe. Contralateral TA 07903), at 10 cells/dish. The next day, the dishes con- muscle was injected with only PBS and used as control. taining a heterogeneous mix of adhered muscle cells were washed 3 times with PBS, and 10 ml of ice-cold Immunofluorescence and microscopy PBS was added into each dish. The dishes were then For immunofluorescence analysis cultured SCs were placed on ice (0 °C) for 15–30 min with occasional gen- fixed in PFA 4% for 10 min RT, permeabilized in cold tle manual shaking (swirling motion). The detached cells methanol at – 20 °C for 6 min, blocked in 5% Goat were collected, centrifuged, resuspended in GM, and Serum in PBS for 30 min RT, and incubated overnight plated into 0.1% gelatin-coated 35-mm dishes (Corning, at 4 °C in 4% BSA in PBS with the following primary 353001) at a density of 10 cells/dish. To induce differ- antibodies: mouse anti-Pax7-c (1:10 DSHB, Iowa City, entiation, proliferating cells (day 3 after adding GM) IA, USA), rabbit anti-MyoD (1:50 Santa Cruz C20: sc- were cultured in differentiating medium (DM) contain- 304, Dallas, TX, USA), mouse anti-myogenin (1:20, ing DMEM 5% Horse Serum, 1% Chicken Embryo DSHB), mouse anti-Myosin Heavy Chain (1:20 DSHB), Extract. and mouse anti-desmin (1:20, DSHB). The next day, SCs were washed 3 times in PBS for 15 min, and then incu- bated with secondary antibodies goat anti-rabbit Alexa Fluor 488 (1:1000, Abcam) and goat anti-mouse Alexa Satellite cell isolation with magnetic bead labelling Fluor 555 (1:1000, Thermo Fisher Scientific) diluted in Mouse SC isolation by magnetic bead labelling was per- 1% BSA in PBS, for 1 h RT. Nuclei were counterstained formed by using a SC Isolation Kit (Miltenyi Biotech, with Hoechst. Bergisch Gladbach, DE, REF: 130-104-268) as previously For immunofluorescence analysis of mdx TA muscle described [23]. Briefly, minced muscle was digested as transplanted with WT SCs, 8-μm-thick muscle cryosec- described above. The digested muscle was passed tions were fixed in 4% PFA for 10 min at room through 70 μm and 40 μm cell strainers, and the result- temperature (RT), and then permeabilized in cold ing single cell suspension was centrifuged, resuspended methanol for 6 min at – 20 °C. Sections were then in 80 μl buffer (PBS pH 7.2, 0.5% FBS, 2 mM EDTA), blocked in 5% Goat Serum (Sigma-Aldrich) in PBS for and incubated with 20 μl of Satellite Cell Isolation Kit 30 min at RT. Next, sections were incubated with pri- per gram of muscle, for 15 min at 4 °C. Next, the cell mary rabbit anti-dystrophin antibody (1:200, Abcam, suspension was passed through a LS column (Miltenyi Cambridge, UK) overnight at 4 °C. The next day, sec- Biotech, 130-042-401) placed in a magnetic field of a tions were washed and incubated with a secondary anti- MACS Separator (Miltenyi Biotech). Unlabeled SCs were body goat anti rabbit Alexa Fluor 488 (1:1000 Abcam). collected in the flow-through, counted, washed, resus- Nuclei were counterstained with Hoechst. pended in growth medium (GM), and plated into 35- Samples were analyzed under an epifluorescence Zeiss mm dishes at a density of 10 cells/dish. Axioskop 2 Plus microscope (Carl Zeiss, Oberkochen, Mouse and human SCs were cultured either in GM DE). containing DMEM, 20% Horse Serum (Sigma-Aldrich), Bright field images were acquired with an inverted 3% Chicken Embryo Extract, or in DM containing phase-contrast microscope (Nikon Eclipse, TS100). Im- DMEM 5% Horse Serum, 1% Chicken Embryo Extract. ages were acquired with a Nikon DS-Fi2 camera and NIS Elements version 4.0 Imaging System. SC detachment with trypsin SCs were rinsed once with PBS and then incubated with CFSE staining trypsin-EDTA solution (Sigma-Aldrich, T3924) for 5 Isolated SCs were stained with CFSE (ThermoFisher Sci- min at 37 °C. SCs were then collected, centrifuged, re- entific) at a concentration of 1 μM for 10 min at 37 °C suspended in GM, and plated at a density of 10 cells/ in the dark prior to culture. After 4 days of culture, the dish. cells were detached with Accutase Solution (Sigma- Benedetti et al. Skeletal Muscle (2021) 11:7 Page 4 of 12 Aldrich). Samples were acquired with a CyAn ADP as well as the notion that like all stem cells, SCs are sen- (DAKO) flow cytometer and acquired data were ana- sitive to stress signals and are among the first muscle lyzed using FlowJo software version 10 (FlowJo LLC, resident cells to respond to injury [4, 5], we hypothe- Ashland, OR, USA). sized that subjecting a heterogeneous culture of muscle cells to a mild stress stimulus such as ice-cold RNA isolation and quantitative real-time PCR temperature will lead to the detachment of only the SCs. For RNA preparation, cells were lyzed with TRI reagent To test this hypothesis, we obtained a mix of muscle (Sigma-Aldrich) and processed as previously described cells following enzymatic digestion, and after 2 h of pre- [23]. Reverse transcription was performed with Sensi- plating on uncoated dishes, cultured them overnight on FAST™ cDNA Synthesis Kit (Bioline, Memphis, TN, gelatin-coated dishes. The next day, after washing and USA). Quantitative real-time PCR assays were per- removing the non-adhered cells and debris, we placed formed according to the MIQE criteria, using Sensi- the dishes of heterogeneous muscle cells on ice for 30’ FAST™ SYBR No-ROX Kit (Bioline) following (Fig. 1a, b). This time point was chosen based on the manufacturer’s protocol. All reactions were performed purity and number of SCs obtained following 15, 30, 45, in duplicate. Data were collected and analyzed using ABI and 60’ on ice. Although the number of SCs obtained in- PRISM 7500 Sequence Detection System (Life Technolo- creased with longer incubations, the purity of SCs de- gies, Carlsbad, CA, USA). Quantitative RT–PCR values creased from 100% at 15–30’ to 95 and 90% at 45 and were normalized to the expression of GAPDH mRNA. 60’ on ice, respectively (data not shown). The ice-cold The relative gene expression level was calculated using treatment (ICT) method can be used to harvest SCs the 2−ΔΔCT method and reported as mean fold change from the original dish containing the heterogeneous in gene expression. muscle cells for at least the first 3 days of culture. Pla- The following primers were used for amplification: cing the heterogeneous muscle culture dish on ice for Pax7 (FW: 5′ GTCCCAGTCTTACTGCCCAC 3′, RV: 30’ resulted in the detachment of only the SCs giving 5′ TGTGGACAGGCTCACGTTTT 3′), Myogenin (FW: rise to a highly pure culture of SCs that proliferated and 5′ GCATGGAGTTCGGTCCCAA 3′, RV: 5′ TATCCT differentiated into myotubes upon culture in differentiat- CCACCGTGATGCTG 3′), GAPDH (FW: 5′ ACCCAG ing medium (Fig. 1b–d). Satellite cells isolated using the AAGACTGTGGATGG 3′, RV: 5′ CACATTGGGG ICT method were 100% pure as determined by the ex- GTAGGAACAC 3′). pression of the SC markers Pax7 and MyoD (Fig. 1c). At day 3 of proliferation, 100% of the cells were positive for Clonal myogenicity assay the satellite cell marker Pax7 and of these 97% were acti- + + For the clonal myogenicity assay, SCs were plated into vated and expressed MyoD (Pax7 MyoD ) (Fig. 1c). To 0.1% gelatin coated 96-well plates, (excluding the outer examine the myogenic capacity of ICT-isolated SCs we wells of the plate) at 1 cell per well, in growth medium. performed a clonal myogenicity assay, by plating a single Colony formation and number of cells were assessed at cell per well and analyzing the formation of myogenic 24, 48, and 72 h of culture. colonies. Satellite cells isolated with the ICT method dis- played a similar clonal myogenicity of 40 % and a doub- Statistical analysis ling time of 17 h to SCs isolated using the magnetic All statistical analyses were performed using Graph- beads method (Figure S1A and B). The myogenic iden- Pad Prism software version 8 (La Jolla, CA, USA). tity of the cultured cells was further confirmed by the Data are presented as mean ± SEM. Statistical signifi- expression of myosin heavy chain (MHC) and the forma- cance was determined using unpaired 2-tailed Stu- tion of myotubes. After 3 days in differentiating medium dent’s t test with Welch’s correction for unequal the SCs differentiated into myoblasts that fused into variances. A P value of ≤ 0.05 was considered statisti- MHC expressing myotubes with a fusion index of 90% cally significant. (Fig. 1d). The purity of the isolated SCs at the begin- ning of culture, as well as the fusion index and num- Results ber of myonuclei per myotubes were similar between Isolation and characterisation of muscle SCs using the ice- SCs isolated with the ICT and magnetic cell separ- cold treatment method ation (MACS) method (Figure S1C–E). However, by Previous studies have demonstrated that cold day 5–7, the cultures obtained with the MACS temperature causes a reduction in cell adhesion, likely method became overgrown by non-myogenic cells due to the downregulation of adhesion receptors [27, such as PDGFRα fibroblasts, causing premature myo- 28]. Compared to other cells, such as fibroblasts, which tube detachment, whereas cultures obtained with the typically contaminate SC cultures, SC are considered to ICT method remained almost free of contaminating be less adherent [11, 14]. Taking this into consideration, cells (Fig. 1e, f). Benedetti et al. Skeletal Muscle (2021) 11:7 Page 5 of 12 Fig. 1 (See legend on next page.) Benedetti et al. Skeletal Muscle (2021) 11:7 Page 6 of 12 (See figure on previous page.) Fig. 1 Isolation and characterization of muscle SCs using the ICT method. a Schematic representation of the ICT method. b Representative bright field images of the heterogeneous muscle mononuclear cell culture from which SCs were isolated by ICT, and representative images of the ICT- isolated SCs at D2 and D4 in growth medium (GM) and at D3 after adding differentiation medium (DM) (n = 15 independent experiments). c Representative immunofluorescence images of ICT-isolated SCs stained for Pax7 (red), MyoD (green), and nuclei (blue) and a graph showing the percentage of cells positive for Pax7 and/or MyoD at day 3 of culture in GM (n = 3 independent experiments). d Representative immunofluorescence images of ICT-isolated SCs stained for myosin heavy chain (MHC) (red) and nuclei (blue) and a graph showing percent fusion after differentiation (4 days in GM followed by 3 days in differentiating medium (DM)) (n = 3 independent experiments). e Representative immunofluorescence images of ICT-isolated SCs and MB-isolated SCs stained for Myogenin (red) PDGFR⍺ (green) and nuclei (blue) and a graph showing percent PDGFR⍺ cells at day 5 of culture in GM. f Representative bright field images of ICT- and magnetic beads (MB)-isolated SCs and a quantification graph showing percentage of myogenic cells in ICT- and MB-isolated SCs after differentiation at day 7 of culture (n =3 - - independent experiments). Non-myogenic cells were identified as Pax7 MyoD nuclei outside the myotubes. Scale bar = 100 μm. Error bars represent mean ± sem. *p < 0.05 by Student’s t test. Overall, these results confirm our hypothesis that ICT [31]. Unlike the fast-dividing SCs, which have a limited leads to the preferential detachment of SCs and using ability to form secondary myogenic colonies after pas- this method allows the isolation of 99–100% pure SCs. sage and instead undergo differentiation, the slow divid- ing SCs form secondary myogenic colonies when The ICT approach can also be used for serial passaging passaged [30, 31]. To examine the prevalence of fast and and long-term expansion of SCs slow dividing SCs within our population, we labelled the A major obstacle in SC research has been that cultured ICT-passaged SCs with CFSE prior to plating and ana- SCs lose their proliferation potential after a couple of lyzed the rate of proliferation 3 days later. We compared passages and begin to differentiate into myotubes the proliferation rate of ICT-isolated and passaged SCs thereby limiting the number of SCs that can be serially with that of SCs isolated using magnetic beads and pas- expanded in vitro. Loss of differentiation potential has saged with trypsin. In line with previous observations, also been noted with increasing number of passages we found that most of the activated SCs isolated using [10–13, 29]. We reasoned that, since the ICT leads to the commercial kit and passaged with trypsin were fast- lo hi SC detachment, it can also be used to passage growing dividing cells (CFSE ), with slow-dividing cells (CFSE ) cultures of proliferating SCs. Indeed, placing the dishes representing less than 10% of the total. Interestingly, of proliferating SCs on ice for 30 min led to the detach- while similarly heterogeneous, the SCs isolated and pas- ment of around 30% of the proliferating cells and we saged using the ICT method were enriched in the slow were able to serially passage and expand the proliferating dividing SC population (Fig. 2h, i). SCs without compromising their proliferation and differ- Next, we examined the longevity of differentiated ICT- entiation capacity (Fig. 2a). We used the ICT approach isolated SCs in culture. The highly pure cultures of SCs on proliferating SCs and then successively on each isolated using the ICT method gave rise to myotubes established culture of proliferating SCs (for more than that could be maintained in culture for up to 1 month, 10 passages). This approach yielded on average 2.5 × 10 compared to just 7 days when isolated using the mag- cells/g of muscle (Fig. 2b). The SCs passaged using the netic beads (Figure S2A–C) or the pre-plating method ICT method did not lose their proliferation and differen- (Figure S2D). tiation potential and displayed a minimally altered Pax7 Overall, these data show that the ICT method can be and myogenin gene expression (Fig. 2c, d). While ICT- used for the serial expansion of SCs with preserved pro- passaged SCs retained their proliferation and differenti- liferation and myogenic potential over an extended ation capacity even after 10 passages, SCs passaged with period of time compared to other methods. the most commonly used passaging reagent trypsin, lost To examine the potential of ICT-isolated and ex- the ability to form new myogenic colonies after just 2 panded SCs to regenerate injured muscle, we injected passages and instead begun to differentiate into myo- 15,000 SCs isolated from wild-type mice into the tibialis tubes (Fig. 2e–g). Similar to SCs detached by trypsin, anterior of mdx mice (lacking dystrophin) CTX injured SCs detached using a gentler detachment solution such 24 h previously. SCs were either injected immediately as Accutase, exhibited accelerated differentiation after after ICT isolation, or after 3-day in vitro expansion fol- more than 3 passages (data not shown). lowing ICT. Transplantation of both SCs immediately Previous studies have demonstrated that based on after ICT-isolation and after in vitro expansion contrib- their rate of proliferation, SCs can be divided into two uted to the regeneration process to a similar extent as subpopulations: fast dividing and slow dividing [30]. The evidenced by the appearance of newly formed slow-dividing are a subset of SC that have been shown dystrophin-positive fibers (Figure S3A and B). There was to retain stemness and long-term self-renewal ability no difference in the ability of transplanted ICT-isolated Benedetti et al. Skeletal Muscle (2021) 11:7 Page 7 of 12 Fig. 2 (See legend on next page.) Benedetti et al. Skeletal Muscle (2021) 11:7 Page 8 of 12 (See figure on previous page.) Fig. 2 Serial expansion and long-term proliferation potential of SCs using the ICT method. a Representative bright field images of SCs at day 3 of culture in GM following ICT 1, ICT 2, and ICT 3, and differentiated cells at day 3 of culture in DM following ICT 3 (n = 10 independent experiments). b Total number of SCs at day 3 of culture in GM, after 1 and 10 ICTs (n = 10 independent experiments). c Pax7 gene expression in SCs at day 2 of culture in GM after ICT 1 and ICT 2 analyzed by quantitative real time PCR (n = 3 independent experiments). d Myogenin expression in SCs at day 5 of culture in GM after ICT1 and ICT 2 analyzed by quantitative real-time PCR (n = 3 independent experiments). e Representative images of SCs at day 2 of culture in GM, after 1–3 detachments with ICT (top panels) and trypsin (bottom panels). f Pax7 gene expression in SCs detached with ICT or trypsin, at day 2 of culture in GM, analyzed by quantitative real-time PCR (n = 3 independent experiments). g Myogenin gene expression in SCs detached with ICT or trypsin, at day 5 of culture in GM, analyzed by quantitative real time PCR (n = 3 independent experiments). h Representative overlay of histogram plots of CFSE labeled ICT and trypsin detached SCs at time 0 and day 4 of culture in GM. i Graph showing percent CFSE-low or slow-proliferating SCs after ICT or trypsin detachment, at day 4 of culture in GM (n =3 independent experiments). Error bars represent mean ± sem, *p < 0.05, calculated by Student’s t test. SCs and SCs isolated by magnetic beads to regenerate These data show that the ICT method performs injured muscle (Figure S3C and D). These experiments equally well when used for the isolation of human SCs. confirmed that SCs isolated with the ICT method suc- cessfully engraft after transplantation and do not lose Discussion their potential to regenerate injured muscle after expan- Over the past decade, a considerable progress has been sion in vitro. made in the development of new methodologies for the isolation of SCs. Nevertheless, each of the available Efficient isolation, serial expansion and long-term culture methods suffers from at least one disadvantage be it pur- of human satellite cells with the ICT method ity, cost, expertise, or a combination of these [11]. In this The study of human SCs (hSCs) has generally lagged be- study, we describe a novel method for the isolation of hind that of mouse SCs due to the difficulties associated pure mouse and human SCs, that is inexpensive, simple with obtaining muscle tissue, as well as the lack of to perform, and reproducibly efficient. The ICT method methods for the isolation of pure hSCs that can be ex- takes advantage of the differing adhesive properties of panded in vitro without altering their myogenic potential muscle cells as well as the ability of SCs to rapidly re- [13]. Having demonstrated the remarkable efficiency of spond to stress stimuli [5, 11, 14]. Thus, the combin- the ICT method in the isolation of pure mouse SCs, we ation of a mild cold-stress stimulus and cold-induced set to reproduce these findings using human muscle bi- reduction in adhesion, leads to the detachment of only opsies. We obtained gluteus maximus specimens from the SCs. Exposure of mammalian cells to cold stress can patients undergoing surgery, aged between 50 and 90 slow down the progression through the cell cycle and in- years. Using the same approach as described above, we hibit protein synthesis. Moreover, depending on the in- consistently and reproducibly obtained a highly pure cul- tensity and duration, cold stress can activate the ture of hSCs (Fig. 3a, d–g) from a heterogeneous popu- apoptotic program, or lead to necrosis [34]. Thus, it is lation of human muscle cells (Figure S4), that could be conceivable that prolonged exposure to cold serially expanded for more than 10 passages (Fig. 3a). As temperature could interfere with the myogenic proper- previously reported [32], we found that hSCs proliferated ties of SCs. Nevertheless, we found that the brief period slower than mouse SCs, with a doubling time of 46 h of exposure to ice-cold temperature did not interfere (Fig. 3b), reaching a peak around day 10 post isolation, with the ability of SCs to proliferate and differentiate and slowing down thereafter. On average we isolated in vitro or with their in vivo regeneration potential, sug- around 20 × 10 SCs/g of muscle. Using the ICT gesting that ICT does not alter SC function. Indeed, SCs method, these hSCs could be expanded 300-fold over a isolated by ICT behaved similarly to those isolated using period of 2 months to a final total of 6 × 10 /g of muscle the pre-plating method or the magnetic bead isolation (Fig. 3c). Previous studies have shown that hSCs rapidly kit. Of note, both the magnetic bead and the FACS sort- downregulate Pax7 expression in culture [33]. In agree- ing isolation methods involve far lengthier incubation ment with others [33], we found that the expression of times on ice compared to our method without interfer- Pax7 was variable and ranged between 45 and 50% at ing with SC behavior and function in vitro and in vivo day 2 of culture in GM (Fig. 3d). Almost 100% of the [16, 17, 21, 22]. Interestingly, Marg A et al. recently hSCs were myogenin positive at day 5 of culture in GM, found that storing human muscle biopsies at 4 °C, in suggesting that most of them have activated their myo- low serum medium and no O for up to 35 days and genic program (Fig. 3e). The myogenic purity of the hSC subsequent culture at 37 °C and 21% oxygen led to SCs culture was further confirmed by desmin at day 5 (Fig. expansion outside the fiber fragments. Surprisingly, the 3f) and MHC expression at day 10 after shifting to dif- purity of the outgrowing colonies of SCs was 100% myo- ferentiating medium (Fig. 3g). genic cells, since non-myogenic cells such as fibroblasts Benedetti et al. Skeletal Muscle (2021) 11:7 Page 9 of 12 Fig. 3 (See legend on next page.) Benedetti et al. Skeletal Muscle (2021) 11:7 Page 10 of 12 (See figure on previous page.) Fig. 3 Isolation and in vitro expansion of human satellite cells using the ICT method. A. Representative bright field images of ICT- isolated human SCs following 1, 3, 5, and 10 ICTs, at day 3 and 10 of culture in GM, and at day 10 of culture in DM (n = 15 independent experiments). b Number of human SCs at 24, 48, and 72 h following ICT 1. c Total number of human SCs at day 3 of culture in GM after 1 and 10 ICTs. d Representative immunofluorescence images of human SCs stained for Pax7 (red) and nuclei (blue). Graph shows percentage of cells positive for Pax7 at day 2 of culture in GM. e Representative immunofluorescence images of human SCs stained for myogenin (red) and nuclei (blue). Graph shows percentage of cells positive for myogenin at day 5 of culture in GM. f Representative immunofluorescence images of human SCs stained for desmin (red) and nuclei (blue) after differentiation (10 days in GM + 5 days in DM). g Representative immunofluorescence images of human SCs stained for myosin heavy chain (MHC) (red) and nuclei(blue). Graph shows percent fusion after differentiation (10 days GM + 10 days DM). (n =3 independent experiments, 10 images analyzed per experiment) Scale bar = 100 μm. Error bars represent mean ± sem did not survive prolonged storage at hypothermic condi- previously been shown to retain stemness and long-term tions [33]. Therefore, it is likely that SCs tolerance for self-renewal ability [31]. It is conceivable that being ‘true’ cold stress is high compared to other cell types, and this stem cells, the slow dividing SCs detaching in response trait can be exploited as we did with our ICT method, to to cold temperature are the so-called first responders to improve the purity of SCs grown in vitro. stress or injury in vivo [5], a hypothesis that will be the Recently, Yoshioka K et al. described an improved ver- subject of future investigation in our laboratory. sion of the pre-plating method, reducing the isolation In a recent study, Gregory WC et al. demonstrated and purification procedure to 2.5 days in total, while in- that hSCs differentiate and lose their proliferative poten- creasing the cell yield, and significantly improving the tial when maintained in high mitogen conditions purity of the resulting SC culture by introducing a re- ex vivo. They used inhibition of p38 signalling to prevent plating step [15]. The re-plating step performed at day the differentiation of SCs and promote their expansion 2.5 of culture involves the detachment of all adhered [35]. Using our method, we were able to achieve the cells including fibroblasts and SCs with trypsin, and same but with minimal manipulation, maintaining the replating on matrigel coated dishes [15]. While the pur- proliferative capacity of hSC ex vivo for an extended ity of the resultant SC culture is comparable to ours, our period of time, to a similar degree using muscle biopsies method involves fewer steps in total and only one over- taken from a wide range of ages (between 50 and 90 night pre-plating. In addition, the ICT method doubles years old). This is an important technical advance for up as a very gentle passaging technique, allowing long- both basic and clinical research since it will allow re- term serial expansion of SCs ex vivo, without altering searchers to obtain sufficient number of cells for trans- their proliferation and differentiation properties. plantation or intervention studies, while reducing the Whereas the FACS sorting method is and will remain number of human biopsies required. Indeed, a major the gold standard for the study of SCs immediately after obstacle to stem cell-based therapies has been the scar- isolation, the ICT approach will likely become the city of human muscle tissue specimens and the limited method of choice for the in vitro expansion of SCs. After number of cells that can be obtained for transplantation. each ICT passage, the already expanded SCs can be Moreover, successful transplantation requires the use of cryopreserved, and stored until needed. With the ICT freshly isolated SCs because culturing and expanding method we were able to passage proliferating mouse and them in vitro greatly reduces their engraftment capacity human SCs for at least 10 times, expanding their num- [13]. Here, we show that SCs isolated and expanded using ber 150- and 300-fold, respectively. This represents a the ICT method do not lose their regenerative capacity. clear advantage over the most commonly used passaging Another advantage of the ICT method is the im- reagent trypsin, which we and others have shown, typic- proved longevity of cultured myotubes. Generally, SCs ally accelerates the differentiation of passaged SCs after differentiate into myotubes by day 7 of culture and only two passages [11]. Apart from being a relatively shortly after, begin to detach [11, 12]. Notably, SCs harsh enzymatic passaging reagent, trypsin leads to the isolated and passaged with the ICT method could be detachment of all the cells in the dish including SCs that maintained in culture for up to 2 months, even once are already committed to differentiate into myotubes, as they have differentiated into myotubes, likely due to well as any contaminating cells, which might contribute the lack of contaminating cells such as fibroblasts. The towards the loss of SC proliferative potential and accel- purity of the isolated SCs is of paramount importance erated differentiation. Indeed, even a gentler detachment for in vitro studies since even 97% purity is insufficient solution like Accutase leads to loss of myogenic prolifer- to prevent overgrowth by non-myogenic cells, as we ative properties and accelerates differentiation. By con- demonstrated. While important for cell growth, trast, the ICT approach favors the detachment of only growth factors produced by fibroblasts, have been the SCs that have not yet committed to differentiate, linked to senescence induction in long term cultures and in particular the slow dividing population which has of mesenchymal stem cells [36]. Benedetti et al. Skeletal Muscle (2021) 11:7 Page 11 of 12 Conclusions number of dystrophin positive fibers per TA muscle section in mdx mice In the quest for new and improved SC isolation (ICT, n=5 mdx mice; ICT-expanded, n=4 mdx mice). Scale bar=100μm. Error bars represent mean ± sem. C. Representative immunofluorescence methods, the ideal technique would permit the isolation images of dystrophin positive fibers (green) and nuclei (blue) in mdx tibi- of pure SCs with minimal manipulation, that can be ex- 3 alis muscle at 30 days following intra-muscular injection of 15 x 10 ICT- panded ex vivo without losing their stemness and regen- isolated SCs (left), or MB-freshly isolated SCs (right). B. Quantification of the number of dystrophin positive fibers per TA section in mdx mice (ICT, erative capacity. In terms of purity of the isolated cell n=5 mdx mice; MB, n=5 mdx mice). Scale bar=100μm. Error bars repre- population, the ICT method outperforms others such as sent mean ± sem. the pre-plating method or the magnetic beads isolation Additional file 4: Figure S4. Characterisation of the human muscle- method. Compared to other commonly used methods, it derived cells obtained after pre-plating and prior to ICT. A. Representative bright field images of human muscle-derived cells at day 3 and 10 of cul- is fast and easy to perform, and apart from the time re- ture in GM, and at day 10 of culture in DM. B. Representative immuno- quired for enzymatic digestion (1.5 h), it involves min- fluorescence images of the heterogeneous culture of human muscle- imal manipulation of the cells. Finally, using the ICT derived cells stained for Pax7 (red) and nuclei (blue). Graph shows per- centage of cells positive for Pax7 at day 2 of culture in GM. C. Representa- approach, SCs can be expanded for extended periods of tive immunofluorescence images of the heterogeneous human muscle time without losing their proliferation and differentiation cell culture stained for myogenin (red) and nuclei (blue). Graph shows potential. This in turn drastically reduces the number of percent of cells positive for myogenin at day 5 of culture in GM. D. Repre- sentative immunofluorescence images of the heterogeneous culture of mice or muscle biopsies required to obtain sufficient human muscle-derived cells stained for MHC (red) and nuclei (blue). number of cells. Graph shows percent cell fusion after differentiation (10 days in GM Overall, the cost-effectiveness, accessibility and tech- followed by 10 days in DM). E. Graph shows percent myogenic cells in the human heterogenous muscle cells obtained after pre-plating or after nical simplicity of this method, as well as its remarkable ICT at day 5 of culture in GM, calculated by IF staining for myogenin (n= efficiency, represent major improvements over existing 3 independent experiments, 10 images analysed per experiment). Scale methods, and will no doubt accelerate SC basic and bar=100μm. Error bars represent mean ± sem. ****P < 0.0001 by Stu- dent’s t-test. translational research bringing their therapeutic use closer to the clinic. Finally, this is a proof of concept study, and the ICT method can be further optimised, Acknowledgements We thank Dr. Luca Madaro for critical reading of the manuscript and helpful adapted, and improved for use in different experimental discussions. settings. Authors’ contributions BLO conceived, developed, and standardized the method. BLO, AB, and MB Supplementary Information designed the experiments. AB performed experiments. AB and BLO analyzed The online version contains supplementary material available at https://doi. data and prepared the figures. BLO and MB supervised the study. CG, DMD, org/10.1186/s13395-021-00261-w. and VC provided the human muscle biopsy specimens. BLO wrote the manuscript. All authors critically read, edited, and approved the final manuscript. Additional file 1: Figure S1. Myogenic properties of SCs isolated with the ICT method. A. Percent of myogenic colony formation was calculated as percent growing clones out of the total seeded single cells per well Funding (60 per 96-well plate) among ICT- and MB-isolated SCs (n=3 independent This work was supported by a grant from The Dutch Duchenne Parent experiments). B. Number of cells per clone in single clone-derived ICT- Project NL (DPP NL) to BLO; research grants from Parent Project Italy (PP, and MB-isolated SCs at 48 and 72 h of culture in GM. ICT SCs, n= 37 Italy) to MB and from the University of Rome (# RP11715C7D238352, clones analyzed per experiment. MB SCs, n= 37 clones analyzed per ex- RM118164275C7EBE, and RM11916B7E20311C to MB; and # periment. C. Percent of ICT- and MB-isolated SCs positive for Pax7 at day AR11715C7F9E158E, AR11816436905518, and AR11916B7E2A7B64 to AB). 2 of culture in GM. (n=3 independent experiments). D. Percent fusion of single clone-derived ICT and MB-isolated SCs after differentiation (4 days Availability of data and materials in GM followed by 3 days in DM). Fusion index: number of nuclei within All data generated or analyzed during this study are included in this myotubes divided by total number nuclei. E. Number of nuclei per myo- published article [and its supplementary information files]. tube in single clone-derived ICT and MB-isolated SCs after differentiation The datasets used and/or analyzed during the current study are available (4 days in GM followed by 3 days in DM). (n=3 independent experi- from the corresponding author on reasonable request. ments). Error bars represent mean ± sem. Additional file 2: Figure S2. Increased longevity in culture of ICT- Declarations isolated SCs. A. Representative bright field images of ICT-isolated SCs at day 3, 5, 11 and 17 of culture in DM. B. Representative bright field image Ethics approval and consent to participate of MB isolated SCs at day 3 of culture in DM. C. Total number of days in All procedures involving mice were approved by the Italian Ministry for culture of ICT- and MB-isolated SCs. D. Representative bright field images Health and were conducted according to the EU regulations and the Italian showing the heterogeneous muscle cell culture after pre-plating, at 3 Law on Animal Research. and 5 days of culture in GM. Error bars represent mean ± sem. *P < 0.05 According to the Italian law, the authors are not required to ask for approval by Student’s t-test. from an institutional review board or ethical committee for the use of Additional file 3: Figure S3. In vivo functional validation of SCs human tissue removed during surgical procedures. All patients gave their isolated using the ICT and MB method. A. Representative approval to undergo intraoperative muscle biopsy and to publish the clinical immunofluorescence images of dystrophin positive fibers (green) and and laboratory data obtained. nuclei (blue) in mdx tibialis muscle at 30 days following intra-muscular in- jection of 15 x 10 SCs immediately after ICT isolation or after 3 day- Consent for publication expansion in culture following ICT isolation. B. Quantification of the Not applicable. Benedetti et al. Skeletal Muscle (2021) 11:7 Page 12 of 12 Competing interests 22. Blanco-Bose WE, Yao CC, Kramer RH, Blau HM. Purification of mouse primary The authors declare that they have no competing interests. myoblasts based on α7 integrin expression. Exp Cell Res. 2001;265:212–20. 23. Benedetti A, Fiore PF, Madaro L, Lozanoska-Ochser B, Bouché M. Targeting Author details pkcθ promotes satellite cell self-renewal. Int J Mol Sci. 2020;21:2419. Department of Anatomical, Histological, Forensic and Orthopedic Sciences, 24. Fiore PF, Benedetti A, Sandonà M, Madaro L, de Bardi M, Saccone V, et al. Section of Histology and Embryology, Sapienza University of Rome, Rome, Lack of PKCθ promotes regenerative ability of muscle stem cells in chronic Italy. Department of Anatomical, Histological, Forensic and Orthopedic muscle injury. Int J Mol Sci. 2020;21:932. Sciences, Section of Orthopedics, Sapienza University of Rome, Rome, Italy. 25. Rizzo G, di Maggio R, Benedetti A, Morroni J, Bouche M, Lozanoska-Ochser Department of Orthopaedics and Traumatology, Policlinico Umberto I, B. Splenic Ly6Chi monocytes are critical players in dystrophic muscle injury Rome, Italy. and repair. JCI Insight. 2020;5:e130807. 26. Lozanoska-Ochser B, Benedetti A, Rizzo G, Marrocco V, di Maggio R, Fiore P, Received: 21 December 2020 Accepted: 18 February 2021 et al. Targeting early PKCθ-dependent T-cell infiltration of dystrophic muscle reduces disease severity in a mouse model of muscular dystrophy. J Pathol. 2018;244:323–333. 27. Juliano RL, Gagalang E. The adhesion of Chinese hamster cells. I. Effects of References temperature, metabolic inhibitors and proteolytic dissection of cell surface 1. Chang NC, Rudnicki MA. Satellite Cells: The Architects of Skeletal Muscle. macromolecules. J Cell Physiol. 1977;92:209–20. Curr Top Dev Biol. 2014;107:161–81. 28. Rico F, Chu C, Abdulreda MH, Qin Y, Moy VT. Temperature modulation of 2. Wang YX, Dumont NA, Rudnicki MA. Muscle stem cells at a glance. J Cell integrin-mediated cell adhesion. Biophys J. 2010;99:1387–96. Sci. 2014;127:4543–8. 29. Machida S, Spangenburg EE, Booth FW. Primary rat muscle progenitor cells 3. Mauro A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol. have decreased proliferation and myotube formation during passages. Cell 1961;9:493–5. Prolif. 2004;37:267–77. 4. Wang YX, Rudnicki MA. Satellite cells, the engines of muscle repair. Nat Rev 30. Tierney MT, Sacco A. Satellite Cell Heterogeneity in Skeletal Muscle Mol Cell Biol. 2012;13:127–33. Homeostasis. Trends Cell Biol. 2016;26:434–444. 5. Evano B, Tajbakhsh S. Skeletal muscle stem cells in comfort and stress. npj 31. Ono Y, Masuda S, Nam HS, Benezra R, Miyagoe-Suzuki Y, Takeda S. Slow- Regen Med. 2018;3:24. dividing satellite cells retain long-term self-renewal ability in adult muscle. J 6. Feige P, Rudnicki MA. Muscle stem cells. Curr Biol. 2018;28:581–98. Cell Sci. 2012;125:1309–17. 7. Sambasivan R, Yao R, Kissenpfennig A, van Wittenberghe L, Paldi A, 32. Charville GW, Cheung TH, Yoo B, Santos PJ, Lee GK, Shrager JB, et al. Ex vivo Gayraud-Morel B, et al. Pax7-expressing satellite cells are indispensable for expansion and in vivo self-renewal of human muscle stem cells. Stem Cell adult skeletal muscle regeneration. Development. 2011;138:3647–56. Reports. 2015;5:621–32. 8. Relaix F, Zammit PS. Satellite cells are essential for skeletal muscle 33. Marg A, Escobar H, Gloy S, Kufeld M, Zacher J, Spuler A, et al. Human regeneration: The cell on the edge returns centre stage. Development satellite cells have regenerative capacity and are genetically manipulable. J (Cambridge). 2012;139:2845–56. Clin Investig. 2014;124:4257–65. 9. Tedesco FS, Dellavalle A, Diaz-Manera J, Messina G, Cossu G. Repairing 34. Sonna L, Fujita J, Gaffin SL, Craig M. Molecular Biology of Thermoregulation skeletal muscle: Regenerative potential of skeletal muscle stem cells. J Clin Invited Review: Effects of heat and cold stress on mammalian gene Investig. 2010;120:11–9. expression. J Appl Physiol. 2002;92:1725–42. 10. Keire P, Shearer A, Shefer G, Yablonka-Reuveni Z. Isolation and culture of 35. Judson RN, Quarta M, Oudhoff MJ, Soliman H, Yi L, Chang CK, et al. skeletal muscle myofibers as a means to analyze satellite cells. Methods Mol Inhibition of Methyltransferase Setd7 Allows the In Vitro Expansion of Biol. 2013;946:431–68. Myogenic Stem Cells with Improved Therapeutic Potential. Cell Stem Cell. 11. Danoviz ME, Yablonka-Reuveni Z. Skeletal muscle satellite cells: Background 2018;22:177–90. and methods for isolation and analysis in a primary culture system. 36. Ito T, Sawada R, Fujiwara Y, Seyama Y, Tsuchiya T. FGF-2 suppresses cellular Methods Mol Biol. 2012;798:21–52. senescence of human mesenchymal stem cells by down-regulation of TGF- 12. Jonah D, Lee BCS, Lisa M, Larkin KWV. Isolation and Purification of Satellite β2. Biochem Biophys Res Commun. 2007;359:108–14. Cells for Skeletal Muscle Tissue Engineering. J Regen Med. 2015;3:117. 13. Rinaldi F, Perlingeiro RCR. Stem cells for skeletal muscle regeneration: Therapeutic potential and roadblocks. Transl Res. 2014. Publisher’sNote 14. Gharaibeh B, Lu A, Tebbets J, Zheng B, Feduska J, Crisan M, et al. Isolation Springer Nature remains neutral with regard to jurisdictional claims in of a slowly adhering cell fraction containing stem cells from murine skeletal published maps and institutional affiliations. muscle by the preplate technique. Nat Protoc. 2008;163:409–17. 15. Yoshioka K, Kitajima Y, Okazaki N, Chiba K, Yonekura A, Ono Y. A Modified Pre-plating Method for High-Yield and High-Purity Muscle Stem Cell Isolation From Human/Mouse Skeletal Muscle Tissues. Front Cell Dev Biol. 2020;8:793. 16. Pasut A, Oleynik P, Rudnicki MA. Isolation of muscle stem cells by fluorescence activated cell sorting cytometry. Methods Mol Biol. 2012;798: 53–64. 17. Liu L, Cheung TH, Charville GW, Rando TA. Isolation of skeletal muscle stem cells by fluorescence-activated cell sorting. Nat Protoc. 2015;10:1612–24. 18. Chapman MR, Balakrishnan KR, Li J, Conboy MJ, Huang H, Mohanty SK, et al. Sorting single satellite cells from individual myofibers reveals heterogeneity in cell-surface markers and myogenic capacity. Integr Biol (United Kingdom). 2013;5:692–702. 19. Fukada SI, Higuchi S, Segawa M, Koda KI, Yamamoto Y, Tsujikawa K, et al. Purification and cell-surface marker characterization of quiescent satellite cells from murine skeletal muscle by a novel monoclonal antibody. Exp Cell Res. 2004;296:245–55. 20. Sherwood RI, Christensen JL, Conboy IM, Conboy MJ, Rando TA, Weissman IL, et al. Isolation of adult mouse myogenic progenitors: Functional heterogeneity of cells within and engrafting skeletal muscle. Cell. 2004;119: 543–54. 21. Montarras D, Morgan J, Collins C. Direct Isolation of Satellite Cells for Skeletal Muscle Regeneration. Mol Cell Biol. 2005;309:2064–7. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Skeletal Muscle Springer Journals

A novel approach for the isolation and long-term expansion of pure satellite cells based on ice-cold treatment

Loading next page...
 
/lp/springer-journals/a-novel-approach-for-the-isolation-and-long-term-expansion-of-pure-dQLojCtfwH
Publisher
Springer Journals
Copyright
Copyright © The Author(s) 2021
eISSN
2044-5040
DOI
10.1186/s13395-021-00261-w
Publisher site
See Article on Publisher Site

Abstract

Satellite cells (SCs) are muscle stem cells capable of regenerating injured muscle. The study of their functional potential depends on the availability of methods for the isolation and expansion of pure SCs with preserved myogenic properties after serial passages in vitro. Here, we describe the ice-cold treatment (ICT) method, which is a simple, economical, and efficient method for the isolation and in vitro expansion of highly pure mouse and human SCs. It involves a brief (15–30 min) incubation on ice (0 °C) of a dish containing a heterogeneous mix of adherent muscle mononuclear cells, which leads to the detachment of only the SCs, and gives rise to cultures of superior purity compared to other commonly used isolation methods. The ICT method doubles up as a gentle passaging technique, allowing SC expansion over extended periods of time without compromising their proliferation and differentiation potential. Moreover, SCs isolated and expanded using the ICT method are capable of regenerating injured muscle in vivo. The ICT method involves minimal cell manipulation, does not require any expertise or expensive reagents, it is fast, and highly reproducible, and greatly reduces the number of animals or human biopsies required in order to obtain sufficient number of SCs. The cost-effectiveness, accessibility, and technical simplicity of this method, as well as its remarkable efficiency, will no doubt accelerate SC basic and translational research bringing their therapeutic use closer to the clinic. Keywords: Satellite cell isolation, Satellite cells in vitro expansion, Skeletal muscle regeneration Background 5]. As SCs become activated, a proportion of them iden- + - The muscle is endowed with an exceptional regenerative tified as Pax7 MyoD replenish the stem cell pool, while + + ability primarily due to a resident population of stem others acquire the expression of MyoD (Pax7 MyoD ), cells called satellite cells (SCs) [1–3]. Ensconced between differentiate into myoblasts and enter the myogenic pro- the basal lamina and the plasma membrane of muscle fi- gram. After several rounds of division myoblasts give bers, SCs respond to injury or various stress stimuli by rise to Myogenin myocytes, which fuse together to form becoming activated, and undergoing proliferation, self- new myofibers [1, 4, 6–9]. renewal, and differentiation to form new myofibers [4, A major stumbling block in the study of the functional potential of SCs has been the lack of isolation methods involving minimal cell manipulation and allowing the * Correspondence: biliana.lozanoska-ochser@uniroma1.it isolation and expansion of highly pure SCs with pre- Bouche Marina Lozanoska-Ochser Biliana are co-senior authors. served myogenic properties after serial passages in vitro Department of Anatomical, Histological, Forensic and Orthopedic Sciences, Section of Histology and Embryology, Sapienza University of Rome, Rome, [10–12]. Moreover, the success of SC transplantation Italy therapy depends on having an efficient method to isolate Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Benedetti et al. Skeletal Muscle (2021) 11:7 Page 2 of 12 and expand these cells in vitro in undifferentiated state There is therefore a need for new and improved and in sufficient numbers [13]. methods for the isolation, expansion and culture of SCs. Presently, there are three main methods commonly Here, we describe a simple, inexpensive, and efficient used for the isolation of SCs: the pre-plating method, method for the isolation of highly pure mouse and hu- fluorescence activated cell sorting (FACS), and magnetic man SCs that can be serially expanded in vitro to obtain bead isolation method. sufficient number of SCs with preserved proliferation The pre-plating method is based on the differing potential, capable of regenerating injured muscle in vivo. adhesive properties of muscle cells, with SCs being the least adherent. Following enzymatic digestion, a Methods heterogeneous mix of skeletal muscle cells is plated Mice mdx onto uncoated culture dishes and after a 1–24-h incu- C57BL/10ScSn-Dmd , C57BL/10ScSn, and C57BL/6J bation at 37 C, the non-adherent cells are collected mice were purchased from the Jackson laboratory (Bar and plated onto new collagen coated dishes [10–12, Harbor, ME, USA). Both male and female mice were 14]. The resulting cell culture contains both SCs and used. The mice were housed in the Histology Depart- fibroblasts in variable proportion. To improve SC ment–accredited animal facility at the University of purity, the pre-plating step can be repeated every 24 Sapienza. All the procedures were approved by the Ital- h over 6 days [10]. Although cheap and straightfor- ian Ministry for Health and were conducted according ward to perform, this method’s main disadvantage is to the EU regulations and the Italian Law on Animal that it is time consuming and gives rise to cultures of Research. variable purity, with fibroblast contamination and overgrowth by day 7 of culture, leading to early sen- Human muscle sourcing escence and detachment of myotubes [10]. A recently Muscle biopsies (gluteus maximus) were obtained from described version of the pre-plating method intro- patients (8 males and 7 females, age range 50–90 years) duces a re-plating step whereby after a 2-day expan- undergoing surgery at the Department of Orthopaedics sion, the adhered cells are detached with trypsin and and Traumatology, Umberto I Hospital in Rome, Italy. replated onto Matrigel coated dishes, giving rise to According to the Italian law, the authors are not re- SC cultures of much improved purity [15]. quired to ask for approval from an institutional review The FACS sorting method sorts muscle mononuclear board or ethical committee for this type of study. In any cells pre-labelled with SC specific antibodies. Following case, all patients gave their approval to undergo intraop- digestion of muscle with various enzymes the resulting erative muscle biopsy and to publish the clinical and la- mixture of cells is labelled with specific antibodies to fa- boratory data obtained. cilitate the identification of SCs, which are then sorted using a FACS sorter instrument [16–21]. At present, the Satellite cell isolation with the ice-cold treatment method FACS sorting method represents the gold standard for SCs were isolated from hind-limb muscles of 4–8-week- the isolation and study of SCs. Nevertheless, there are old mice or from human biopsies. Muscles were dis- several disadvantages to this method including high cost sected with scissors and finely diced with a scalpel in a and the requirement for a FACS sorter instrument. dish containing DMEM (Sigma-Aldrich, St. Louis, MO, Moreover, this method is time consuming, requires ex- USA, D5671). This was followed by enzymatic digestion pertise to perform and cell purity can be variable. The with 10 ml/g of muscle of Collagenase type II (Sigma-Al- cell labelling step followed by the sorting procedure can drich, SCR103) at a concentration of 0.4 mg/ml in PBS potentially stress or damage the cells, decrease their via- (Sigma-Aldrich), for 45 min in a water bath at 37 °C bility, or alter their functional properties in vitro [12]. with agitation. Digestion was blocked with DMEM 10% The third method is based on magnetic cell separation FBS and after centrifuging the muscle preparation and (MACS) and uses magnetic columns and SC specific removing the supernatant, a second digestion was per- magnetic bead kits [22]. It is based on negative selec- formed with 10 ml/g of muscle of Collagenase/Dispase tion of SCs by magnetically labelling and removing at a concentration of 1 mg/ml (Roche, Basel, CH, other cell lineages. Because this method assumes that 11097113001) in PBS Calcium-Magnesium free (Sigma- all the other cell types are successfully removed from Aldrich), for 30 min at 37 °C in a water bath with agita- the muscle cell preparation, it is less precise than the tion. The digested muscle was then passed first through FACS sorting method. This method is expensive to a 70-μm cell strainer followed by 40-μm cell strainer to perform, time consuming, and stressful for the cells. obtain single cell suspension. Next, the cells were centri- As for the other two methods, cell purity is variable fuged, resuspended in DMEM 10% FBS (Sigma-Aldrich, and often the SC cultures become overgrown by fi- F2442), counted and plated at 2 × 10 cells/100 mm dish broblasts by day 7 [10, 12]. (uncoated) (Corning, NY, USA, 430167), and incubated Benedetti et al. Skeletal Muscle (2021) 11:7 Page 3 of 12 at 37 °C for 1 h. Non-adherent cells were collected, cen- SC transplantation trifuged, and the cell pellet was resuspended in DMEM Acute muscle injury was induced the day before SC 10% FBS, plated again, and incubated for another 1 h at transplantation. To induce muscle injury tibialis muscles 37 °C. After the second pre-plating, non-adherent cells were injected with 0.01 ml of Cardiotoxin from Naja Pal- were collected, centrifuged, counted, resuspended in SC lida (10 μM) (Latoxan ZA, Les Auréats, Fr), using a 30 Growth Medium (GM) DMEM, 20% Horse Serum Gauge micro-syringe [23–26]. (Thermo Fisher Scientific, Waltham, MA, USA, For cell transplantation, 15,000 SCs were resuspended 26050088), 3% Chicken Embryo Extract (Seralab, CE- in 20 μl of DMEM 2% FBS (Sigma-Aldrich) and injected 650-J), and plated into 100 mm dishes coated with 0.1% into the TA muscle of one leg with a single injection by gelatin (Stem Cell Technologies, Vancouver, BC, CAN, using a 30 Gauge micro-syringe. Contralateral TA 07903), at 10 cells/dish. The next day, the dishes con- muscle was injected with only PBS and used as control. taining a heterogeneous mix of adhered muscle cells were washed 3 times with PBS, and 10 ml of ice-cold Immunofluorescence and microscopy PBS was added into each dish. The dishes were then For immunofluorescence analysis cultured SCs were placed on ice (0 °C) for 15–30 min with occasional gen- fixed in PFA 4% for 10 min RT, permeabilized in cold tle manual shaking (swirling motion). The detached cells methanol at – 20 °C for 6 min, blocked in 5% Goat were collected, centrifuged, resuspended in GM, and Serum in PBS for 30 min RT, and incubated overnight plated into 0.1% gelatin-coated 35-mm dishes (Corning, at 4 °C in 4% BSA in PBS with the following primary 353001) at a density of 10 cells/dish. To induce differ- antibodies: mouse anti-Pax7-c (1:10 DSHB, Iowa City, entiation, proliferating cells (day 3 after adding GM) IA, USA), rabbit anti-MyoD (1:50 Santa Cruz C20: sc- were cultured in differentiating medium (DM) contain- 304, Dallas, TX, USA), mouse anti-myogenin (1:20, ing DMEM 5% Horse Serum, 1% Chicken Embryo DSHB), mouse anti-Myosin Heavy Chain (1:20 DSHB), Extract. and mouse anti-desmin (1:20, DSHB). The next day, SCs were washed 3 times in PBS for 15 min, and then incu- bated with secondary antibodies goat anti-rabbit Alexa Fluor 488 (1:1000, Abcam) and goat anti-mouse Alexa Satellite cell isolation with magnetic bead labelling Fluor 555 (1:1000, Thermo Fisher Scientific) diluted in Mouse SC isolation by magnetic bead labelling was per- 1% BSA in PBS, for 1 h RT. Nuclei were counterstained formed by using a SC Isolation Kit (Miltenyi Biotech, with Hoechst. Bergisch Gladbach, DE, REF: 130-104-268) as previously For immunofluorescence analysis of mdx TA muscle described [23]. Briefly, minced muscle was digested as transplanted with WT SCs, 8-μm-thick muscle cryosec- described above. The digested muscle was passed tions were fixed in 4% PFA for 10 min at room through 70 μm and 40 μm cell strainers, and the result- temperature (RT), and then permeabilized in cold ing single cell suspension was centrifuged, resuspended methanol for 6 min at – 20 °C. Sections were then in 80 μl buffer (PBS pH 7.2, 0.5% FBS, 2 mM EDTA), blocked in 5% Goat Serum (Sigma-Aldrich) in PBS for and incubated with 20 μl of Satellite Cell Isolation Kit 30 min at RT. Next, sections were incubated with pri- per gram of muscle, for 15 min at 4 °C. Next, the cell mary rabbit anti-dystrophin antibody (1:200, Abcam, suspension was passed through a LS column (Miltenyi Cambridge, UK) overnight at 4 °C. The next day, sec- Biotech, 130-042-401) placed in a magnetic field of a tions were washed and incubated with a secondary anti- MACS Separator (Miltenyi Biotech). Unlabeled SCs were body goat anti rabbit Alexa Fluor 488 (1:1000 Abcam). collected in the flow-through, counted, washed, resus- Nuclei were counterstained with Hoechst. pended in growth medium (GM), and plated into 35- Samples were analyzed under an epifluorescence Zeiss mm dishes at a density of 10 cells/dish. Axioskop 2 Plus microscope (Carl Zeiss, Oberkochen, Mouse and human SCs were cultured either in GM DE). containing DMEM, 20% Horse Serum (Sigma-Aldrich), Bright field images were acquired with an inverted 3% Chicken Embryo Extract, or in DM containing phase-contrast microscope (Nikon Eclipse, TS100). Im- DMEM 5% Horse Serum, 1% Chicken Embryo Extract. ages were acquired with a Nikon DS-Fi2 camera and NIS Elements version 4.0 Imaging System. SC detachment with trypsin SCs were rinsed once with PBS and then incubated with CFSE staining trypsin-EDTA solution (Sigma-Aldrich, T3924) for 5 Isolated SCs were stained with CFSE (ThermoFisher Sci- min at 37 °C. SCs were then collected, centrifuged, re- entific) at a concentration of 1 μM for 10 min at 37 °C suspended in GM, and plated at a density of 10 cells/ in the dark prior to culture. After 4 days of culture, the dish. cells were detached with Accutase Solution (Sigma- Benedetti et al. Skeletal Muscle (2021) 11:7 Page 4 of 12 Aldrich). Samples were acquired with a CyAn ADP as well as the notion that like all stem cells, SCs are sen- (DAKO) flow cytometer and acquired data were ana- sitive to stress signals and are among the first muscle lyzed using FlowJo software version 10 (FlowJo LLC, resident cells to respond to injury [4, 5], we hypothe- Ashland, OR, USA). sized that subjecting a heterogeneous culture of muscle cells to a mild stress stimulus such as ice-cold RNA isolation and quantitative real-time PCR temperature will lead to the detachment of only the SCs. For RNA preparation, cells were lyzed with TRI reagent To test this hypothesis, we obtained a mix of muscle (Sigma-Aldrich) and processed as previously described cells following enzymatic digestion, and after 2 h of pre- [23]. Reverse transcription was performed with Sensi- plating on uncoated dishes, cultured them overnight on FAST™ cDNA Synthesis Kit (Bioline, Memphis, TN, gelatin-coated dishes. The next day, after washing and USA). Quantitative real-time PCR assays were per- removing the non-adhered cells and debris, we placed formed according to the MIQE criteria, using Sensi- the dishes of heterogeneous muscle cells on ice for 30’ FAST™ SYBR No-ROX Kit (Bioline) following (Fig. 1a, b). This time point was chosen based on the manufacturer’s protocol. All reactions were performed purity and number of SCs obtained following 15, 30, 45, in duplicate. Data were collected and analyzed using ABI and 60’ on ice. Although the number of SCs obtained in- PRISM 7500 Sequence Detection System (Life Technolo- creased with longer incubations, the purity of SCs de- gies, Carlsbad, CA, USA). Quantitative RT–PCR values creased from 100% at 15–30’ to 95 and 90% at 45 and were normalized to the expression of GAPDH mRNA. 60’ on ice, respectively (data not shown). The ice-cold The relative gene expression level was calculated using treatment (ICT) method can be used to harvest SCs the 2−ΔΔCT method and reported as mean fold change from the original dish containing the heterogeneous in gene expression. muscle cells for at least the first 3 days of culture. Pla- The following primers were used for amplification: cing the heterogeneous muscle culture dish on ice for Pax7 (FW: 5′ GTCCCAGTCTTACTGCCCAC 3′, RV: 30’ resulted in the detachment of only the SCs giving 5′ TGTGGACAGGCTCACGTTTT 3′), Myogenin (FW: rise to a highly pure culture of SCs that proliferated and 5′ GCATGGAGTTCGGTCCCAA 3′, RV: 5′ TATCCT differentiated into myotubes upon culture in differentiat- CCACCGTGATGCTG 3′), GAPDH (FW: 5′ ACCCAG ing medium (Fig. 1b–d). Satellite cells isolated using the AAGACTGTGGATGG 3′, RV: 5′ CACATTGGGG ICT method were 100% pure as determined by the ex- GTAGGAACAC 3′). pression of the SC markers Pax7 and MyoD (Fig. 1c). At day 3 of proliferation, 100% of the cells were positive for Clonal myogenicity assay the satellite cell marker Pax7 and of these 97% were acti- + + For the clonal myogenicity assay, SCs were plated into vated and expressed MyoD (Pax7 MyoD ) (Fig. 1c). To 0.1% gelatin coated 96-well plates, (excluding the outer examine the myogenic capacity of ICT-isolated SCs we wells of the plate) at 1 cell per well, in growth medium. performed a clonal myogenicity assay, by plating a single Colony formation and number of cells were assessed at cell per well and analyzing the formation of myogenic 24, 48, and 72 h of culture. colonies. Satellite cells isolated with the ICT method dis- played a similar clonal myogenicity of 40 % and a doub- Statistical analysis ling time of 17 h to SCs isolated using the magnetic All statistical analyses were performed using Graph- beads method (Figure S1A and B). The myogenic iden- Pad Prism software version 8 (La Jolla, CA, USA). tity of the cultured cells was further confirmed by the Data are presented as mean ± SEM. Statistical signifi- expression of myosin heavy chain (MHC) and the forma- cance was determined using unpaired 2-tailed Stu- tion of myotubes. After 3 days in differentiating medium dent’s t test with Welch’s correction for unequal the SCs differentiated into myoblasts that fused into variances. A P value of ≤ 0.05 was considered statisti- MHC expressing myotubes with a fusion index of 90% cally significant. (Fig. 1d). The purity of the isolated SCs at the begin- ning of culture, as well as the fusion index and num- Results ber of myonuclei per myotubes were similar between Isolation and characterisation of muscle SCs using the ice- SCs isolated with the ICT and magnetic cell separ- cold treatment method ation (MACS) method (Figure S1C–E). However, by Previous studies have demonstrated that cold day 5–7, the cultures obtained with the MACS temperature causes a reduction in cell adhesion, likely method became overgrown by non-myogenic cells due to the downregulation of adhesion receptors [27, such as PDGFRα fibroblasts, causing premature myo- 28]. Compared to other cells, such as fibroblasts, which tube detachment, whereas cultures obtained with the typically contaminate SC cultures, SC are considered to ICT method remained almost free of contaminating be less adherent [11, 14]. Taking this into consideration, cells (Fig. 1e, f). Benedetti et al. Skeletal Muscle (2021) 11:7 Page 5 of 12 Fig. 1 (See legend on next page.) Benedetti et al. Skeletal Muscle (2021) 11:7 Page 6 of 12 (See figure on previous page.) Fig. 1 Isolation and characterization of muscle SCs using the ICT method. a Schematic representation of the ICT method. b Representative bright field images of the heterogeneous muscle mononuclear cell culture from which SCs were isolated by ICT, and representative images of the ICT- isolated SCs at D2 and D4 in growth medium (GM) and at D3 after adding differentiation medium (DM) (n = 15 independent experiments). c Representative immunofluorescence images of ICT-isolated SCs stained for Pax7 (red), MyoD (green), and nuclei (blue) and a graph showing the percentage of cells positive for Pax7 and/or MyoD at day 3 of culture in GM (n = 3 independent experiments). d Representative immunofluorescence images of ICT-isolated SCs stained for myosin heavy chain (MHC) (red) and nuclei (blue) and a graph showing percent fusion after differentiation (4 days in GM followed by 3 days in differentiating medium (DM)) (n = 3 independent experiments). e Representative immunofluorescence images of ICT-isolated SCs and MB-isolated SCs stained for Myogenin (red) PDGFR⍺ (green) and nuclei (blue) and a graph showing percent PDGFR⍺ cells at day 5 of culture in GM. f Representative bright field images of ICT- and magnetic beads (MB)-isolated SCs and a quantification graph showing percentage of myogenic cells in ICT- and MB-isolated SCs after differentiation at day 7 of culture (n =3 - - independent experiments). Non-myogenic cells were identified as Pax7 MyoD nuclei outside the myotubes. Scale bar = 100 μm. Error bars represent mean ± sem. *p < 0.05 by Student’s t test. Overall, these results confirm our hypothesis that ICT [31]. Unlike the fast-dividing SCs, which have a limited leads to the preferential detachment of SCs and using ability to form secondary myogenic colonies after pas- this method allows the isolation of 99–100% pure SCs. sage and instead undergo differentiation, the slow divid- ing SCs form secondary myogenic colonies when The ICT approach can also be used for serial passaging passaged [30, 31]. To examine the prevalence of fast and and long-term expansion of SCs slow dividing SCs within our population, we labelled the A major obstacle in SC research has been that cultured ICT-passaged SCs with CFSE prior to plating and ana- SCs lose their proliferation potential after a couple of lyzed the rate of proliferation 3 days later. We compared passages and begin to differentiate into myotubes the proliferation rate of ICT-isolated and passaged SCs thereby limiting the number of SCs that can be serially with that of SCs isolated using magnetic beads and pas- expanded in vitro. Loss of differentiation potential has saged with trypsin. In line with previous observations, also been noted with increasing number of passages we found that most of the activated SCs isolated using [10–13, 29]. We reasoned that, since the ICT leads to the commercial kit and passaged with trypsin were fast- lo hi SC detachment, it can also be used to passage growing dividing cells (CFSE ), with slow-dividing cells (CFSE ) cultures of proliferating SCs. Indeed, placing the dishes representing less than 10% of the total. Interestingly, of proliferating SCs on ice for 30 min led to the detach- while similarly heterogeneous, the SCs isolated and pas- ment of around 30% of the proliferating cells and we saged using the ICT method were enriched in the slow were able to serially passage and expand the proliferating dividing SC population (Fig. 2h, i). SCs without compromising their proliferation and differ- Next, we examined the longevity of differentiated ICT- entiation capacity (Fig. 2a). We used the ICT approach isolated SCs in culture. The highly pure cultures of SCs on proliferating SCs and then successively on each isolated using the ICT method gave rise to myotubes established culture of proliferating SCs (for more than that could be maintained in culture for up to 1 month, 10 passages). This approach yielded on average 2.5 × 10 compared to just 7 days when isolated using the mag- cells/g of muscle (Fig. 2b). The SCs passaged using the netic beads (Figure S2A–C) or the pre-plating method ICT method did not lose their proliferation and differen- (Figure S2D). tiation potential and displayed a minimally altered Pax7 Overall, these data show that the ICT method can be and myogenin gene expression (Fig. 2c, d). While ICT- used for the serial expansion of SCs with preserved pro- passaged SCs retained their proliferation and differenti- liferation and myogenic potential over an extended ation capacity even after 10 passages, SCs passaged with period of time compared to other methods. the most commonly used passaging reagent trypsin, lost To examine the potential of ICT-isolated and ex- the ability to form new myogenic colonies after just 2 panded SCs to regenerate injured muscle, we injected passages and instead begun to differentiate into myo- 15,000 SCs isolated from wild-type mice into the tibialis tubes (Fig. 2e–g). Similar to SCs detached by trypsin, anterior of mdx mice (lacking dystrophin) CTX injured SCs detached using a gentler detachment solution such 24 h previously. SCs were either injected immediately as Accutase, exhibited accelerated differentiation after after ICT isolation, or after 3-day in vitro expansion fol- more than 3 passages (data not shown). lowing ICT. Transplantation of both SCs immediately Previous studies have demonstrated that based on after ICT-isolation and after in vitro expansion contrib- their rate of proliferation, SCs can be divided into two uted to the regeneration process to a similar extent as subpopulations: fast dividing and slow dividing [30]. The evidenced by the appearance of newly formed slow-dividing are a subset of SC that have been shown dystrophin-positive fibers (Figure S3A and B). There was to retain stemness and long-term self-renewal ability no difference in the ability of transplanted ICT-isolated Benedetti et al. Skeletal Muscle (2021) 11:7 Page 7 of 12 Fig. 2 (See legend on next page.) Benedetti et al. Skeletal Muscle (2021) 11:7 Page 8 of 12 (See figure on previous page.) Fig. 2 Serial expansion and long-term proliferation potential of SCs using the ICT method. a Representative bright field images of SCs at day 3 of culture in GM following ICT 1, ICT 2, and ICT 3, and differentiated cells at day 3 of culture in DM following ICT 3 (n = 10 independent experiments). b Total number of SCs at day 3 of culture in GM, after 1 and 10 ICTs (n = 10 independent experiments). c Pax7 gene expression in SCs at day 2 of culture in GM after ICT 1 and ICT 2 analyzed by quantitative real time PCR (n = 3 independent experiments). d Myogenin expression in SCs at day 5 of culture in GM after ICT1 and ICT 2 analyzed by quantitative real-time PCR (n = 3 independent experiments). e Representative images of SCs at day 2 of culture in GM, after 1–3 detachments with ICT (top panels) and trypsin (bottom panels). f Pax7 gene expression in SCs detached with ICT or trypsin, at day 2 of culture in GM, analyzed by quantitative real-time PCR (n = 3 independent experiments). g Myogenin gene expression in SCs detached with ICT or trypsin, at day 5 of culture in GM, analyzed by quantitative real time PCR (n = 3 independent experiments). h Representative overlay of histogram plots of CFSE labeled ICT and trypsin detached SCs at time 0 and day 4 of culture in GM. i Graph showing percent CFSE-low or slow-proliferating SCs after ICT or trypsin detachment, at day 4 of culture in GM (n =3 independent experiments). Error bars represent mean ± sem, *p < 0.05, calculated by Student’s t test. SCs and SCs isolated by magnetic beads to regenerate These data show that the ICT method performs injured muscle (Figure S3C and D). These experiments equally well when used for the isolation of human SCs. confirmed that SCs isolated with the ICT method suc- cessfully engraft after transplantation and do not lose Discussion their potential to regenerate injured muscle after expan- Over the past decade, a considerable progress has been sion in vitro. made in the development of new methodologies for the isolation of SCs. Nevertheless, each of the available Efficient isolation, serial expansion and long-term culture methods suffers from at least one disadvantage be it pur- of human satellite cells with the ICT method ity, cost, expertise, or a combination of these [11]. In this The study of human SCs (hSCs) has generally lagged be- study, we describe a novel method for the isolation of hind that of mouse SCs due to the difficulties associated pure mouse and human SCs, that is inexpensive, simple with obtaining muscle tissue, as well as the lack of to perform, and reproducibly efficient. The ICT method methods for the isolation of pure hSCs that can be ex- takes advantage of the differing adhesive properties of panded in vitro without altering their myogenic potential muscle cells as well as the ability of SCs to rapidly re- [13]. Having demonstrated the remarkable efficiency of spond to stress stimuli [5, 11, 14]. Thus, the combin- the ICT method in the isolation of pure mouse SCs, we ation of a mild cold-stress stimulus and cold-induced set to reproduce these findings using human muscle bi- reduction in adhesion, leads to the detachment of only opsies. We obtained gluteus maximus specimens from the SCs. Exposure of mammalian cells to cold stress can patients undergoing surgery, aged between 50 and 90 slow down the progression through the cell cycle and in- years. Using the same approach as described above, we hibit protein synthesis. Moreover, depending on the in- consistently and reproducibly obtained a highly pure cul- tensity and duration, cold stress can activate the ture of hSCs (Fig. 3a, d–g) from a heterogeneous popu- apoptotic program, or lead to necrosis [34]. Thus, it is lation of human muscle cells (Figure S4), that could be conceivable that prolonged exposure to cold serially expanded for more than 10 passages (Fig. 3a). As temperature could interfere with the myogenic proper- previously reported [32], we found that hSCs proliferated ties of SCs. Nevertheless, we found that the brief period slower than mouse SCs, with a doubling time of 46 h of exposure to ice-cold temperature did not interfere (Fig. 3b), reaching a peak around day 10 post isolation, with the ability of SCs to proliferate and differentiate and slowing down thereafter. On average we isolated in vitro or with their in vivo regeneration potential, sug- around 20 × 10 SCs/g of muscle. Using the ICT gesting that ICT does not alter SC function. Indeed, SCs method, these hSCs could be expanded 300-fold over a isolated by ICT behaved similarly to those isolated using period of 2 months to a final total of 6 × 10 /g of muscle the pre-plating method or the magnetic bead isolation (Fig. 3c). Previous studies have shown that hSCs rapidly kit. Of note, both the magnetic bead and the FACS sort- downregulate Pax7 expression in culture [33]. In agree- ing isolation methods involve far lengthier incubation ment with others [33], we found that the expression of times on ice compared to our method without interfer- Pax7 was variable and ranged between 45 and 50% at ing with SC behavior and function in vitro and in vivo day 2 of culture in GM (Fig. 3d). Almost 100% of the [16, 17, 21, 22]. Interestingly, Marg A et al. recently hSCs were myogenin positive at day 5 of culture in GM, found that storing human muscle biopsies at 4 °C, in suggesting that most of them have activated their myo- low serum medium and no O for up to 35 days and genic program (Fig. 3e). The myogenic purity of the hSC subsequent culture at 37 °C and 21% oxygen led to SCs culture was further confirmed by desmin at day 5 (Fig. expansion outside the fiber fragments. Surprisingly, the 3f) and MHC expression at day 10 after shifting to dif- purity of the outgrowing colonies of SCs was 100% myo- ferentiating medium (Fig. 3g). genic cells, since non-myogenic cells such as fibroblasts Benedetti et al. Skeletal Muscle (2021) 11:7 Page 9 of 12 Fig. 3 (See legend on next page.) Benedetti et al. Skeletal Muscle (2021) 11:7 Page 10 of 12 (See figure on previous page.) Fig. 3 Isolation and in vitro expansion of human satellite cells using the ICT method. A. Representative bright field images of ICT- isolated human SCs following 1, 3, 5, and 10 ICTs, at day 3 and 10 of culture in GM, and at day 10 of culture in DM (n = 15 independent experiments). b Number of human SCs at 24, 48, and 72 h following ICT 1. c Total number of human SCs at day 3 of culture in GM after 1 and 10 ICTs. d Representative immunofluorescence images of human SCs stained for Pax7 (red) and nuclei (blue). Graph shows percentage of cells positive for Pax7 at day 2 of culture in GM. e Representative immunofluorescence images of human SCs stained for myogenin (red) and nuclei (blue). Graph shows percentage of cells positive for myogenin at day 5 of culture in GM. f Representative immunofluorescence images of human SCs stained for desmin (red) and nuclei (blue) after differentiation (10 days in GM + 5 days in DM). g Representative immunofluorescence images of human SCs stained for myosin heavy chain (MHC) (red) and nuclei(blue). Graph shows percent fusion after differentiation (10 days GM + 10 days DM). (n =3 independent experiments, 10 images analyzed per experiment) Scale bar = 100 μm. Error bars represent mean ± sem did not survive prolonged storage at hypothermic condi- previously been shown to retain stemness and long-term tions [33]. Therefore, it is likely that SCs tolerance for self-renewal ability [31]. It is conceivable that being ‘true’ cold stress is high compared to other cell types, and this stem cells, the slow dividing SCs detaching in response trait can be exploited as we did with our ICT method, to to cold temperature are the so-called first responders to improve the purity of SCs grown in vitro. stress or injury in vivo [5], a hypothesis that will be the Recently, Yoshioka K et al. described an improved ver- subject of future investigation in our laboratory. sion of the pre-plating method, reducing the isolation In a recent study, Gregory WC et al. demonstrated and purification procedure to 2.5 days in total, while in- that hSCs differentiate and lose their proliferative poten- creasing the cell yield, and significantly improving the tial when maintained in high mitogen conditions purity of the resulting SC culture by introducing a re- ex vivo. They used inhibition of p38 signalling to prevent plating step [15]. The re-plating step performed at day the differentiation of SCs and promote their expansion 2.5 of culture involves the detachment of all adhered [35]. Using our method, we were able to achieve the cells including fibroblasts and SCs with trypsin, and same but with minimal manipulation, maintaining the replating on matrigel coated dishes [15]. While the pur- proliferative capacity of hSC ex vivo for an extended ity of the resultant SC culture is comparable to ours, our period of time, to a similar degree using muscle biopsies method involves fewer steps in total and only one over- taken from a wide range of ages (between 50 and 90 night pre-plating. In addition, the ICT method doubles years old). This is an important technical advance for up as a very gentle passaging technique, allowing long- both basic and clinical research since it will allow re- term serial expansion of SCs ex vivo, without altering searchers to obtain sufficient number of cells for trans- their proliferation and differentiation properties. plantation or intervention studies, while reducing the Whereas the FACS sorting method is and will remain number of human biopsies required. Indeed, a major the gold standard for the study of SCs immediately after obstacle to stem cell-based therapies has been the scar- isolation, the ICT approach will likely become the city of human muscle tissue specimens and the limited method of choice for the in vitro expansion of SCs. After number of cells that can be obtained for transplantation. each ICT passage, the already expanded SCs can be Moreover, successful transplantation requires the use of cryopreserved, and stored until needed. With the ICT freshly isolated SCs because culturing and expanding method we were able to passage proliferating mouse and them in vitro greatly reduces their engraftment capacity human SCs for at least 10 times, expanding their num- [13]. Here, we show that SCs isolated and expanded using ber 150- and 300-fold, respectively. This represents a the ICT method do not lose their regenerative capacity. clear advantage over the most commonly used passaging Another advantage of the ICT method is the im- reagent trypsin, which we and others have shown, typic- proved longevity of cultured myotubes. Generally, SCs ally accelerates the differentiation of passaged SCs after differentiate into myotubes by day 7 of culture and only two passages [11]. Apart from being a relatively shortly after, begin to detach [11, 12]. Notably, SCs harsh enzymatic passaging reagent, trypsin leads to the isolated and passaged with the ICT method could be detachment of all the cells in the dish including SCs that maintained in culture for up to 2 months, even once are already committed to differentiate into myotubes, as they have differentiated into myotubes, likely due to well as any contaminating cells, which might contribute the lack of contaminating cells such as fibroblasts. The towards the loss of SC proliferative potential and accel- purity of the isolated SCs is of paramount importance erated differentiation. Indeed, even a gentler detachment for in vitro studies since even 97% purity is insufficient solution like Accutase leads to loss of myogenic prolifer- to prevent overgrowth by non-myogenic cells, as we ative properties and accelerates differentiation. By con- demonstrated. While important for cell growth, trast, the ICT approach favors the detachment of only growth factors produced by fibroblasts, have been the SCs that have not yet committed to differentiate, linked to senescence induction in long term cultures and in particular the slow dividing population which has of mesenchymal stem cells [36]. Benedetti et al. Skeletal Muscle (2021) 11:7 Page 11 of 12 Conclusions number of dystrophin positive fibers per TA muscle section in mdx mice In the quest for new and improved SC isolation (ICT, n=5 mdx mice; ICT-expanded, n=4 mdx mice). Scale bar=100μm. Error bars represent mean ± sem. C. Representative immunofluorescence methods, the ideal technique would permit the isolation images of dystrophin positive fibers (green) and nuclei (blue) in mdx tibi- of pure SCs with minimal manipulation, that can be ex- 3 alis muscle at 30 days following intra-muscular injection of 15 x 10 ICT- panded ex vivo without losing their stemness and regen- isolated SCs (left), or MB-freshly isolated SCs (right). B. Quantification of the number of dystrophin positive fibers per TA section in mdx mice (ICT, erative capacity. In terms of purity of the isolated cell n=5 mdx mice; MB, n=5 mdx mice). Scale bar=100μm. Error bars repre- population, the ICT method outperforms others such as sent mean ± sem. the pre-plating method or the magnetic beads isolation Additional file 4: Figure S4. Characterisation of the human muscle- method. Compared to other commonly used methods, it derived cells obtained after pre-plating and prior to ICT. A. Representative bright field images of human muscle-derived cells at day 3 and 10 of cul- is fast and easy to perform, and apart from the time re- ture in GM, and at day 10 of culture in DM. B. Representative immuno- quired for enzymatic digestion (1.5 h), it involves min- fluorescence images of the heterogeneous culture of human muscle- imal manipulation of the cells. Finally, using the ICT derived cells stained for Pax7 (red) and nuclei (blue). Graph shows per- centage of cells positive for Pax7 at day 2 of culture in GM. C. Representa- approach, SCs can be expanded for extended periods of tive immunofluorescence images of the heterogeneous human muscle time without losing their proliferation and differentiation cell culture stained for myogenin (red) and nuclei (blue). Graph shows potential. This in turn drastically reduces the number of percent of cells positive for myogenin at day 5 of culture in GM. D. Repre- sentative immunofluorescence images of the heterogeneous culture of mice or muscle biopsies required to obtain sufficient human muscle-derived cells stained for MHC (red) and nuclei (blue). number of cells. Graph shows percent cell fusion after differentiation (10 days in GM Overall, the cost-effectiveness, accessibility and tech- followed by 10 days in DM). E. Graph shows percent myogenic cells in the human heterogenous muscle cells obtained after pre-plating or after nical simplicity of this method, as well as its remarkable ICT at day 5 of culture in GM, calculated by IF staining for myogenin (n= efficiency, represent major improvements over existing 3 independent experiments, 10 images analysed per experiment). Scale methods, and will no doubt accelerate SC basic and bar=100μm. Error bars represent mean ± sem. ****P < 0.0001 by Stu- dent’s t-test. translational research bringing their therapeutic use closer to the clinic. Finally, this is a proof of concept study, and the ICT method can be further optimised, Acknowledgements We thank Dr. Luca Madaro for critical reading of the manuscript and helpful adapted, and improved for use in different experimental discussions. settings. Authors’ contributions BLO conceived, developed, and standardized the method. BLO, AB, and MB Supplementary Information designed the experiments. AB performed experiments. AB and BLO analyzed The online version contains supplementary material available at https://doi. data and prepared the figures. BLO and MB supervised the study. CG, DMD, org/10.1186/s13395-021-00261-w. and VC provided the human muscle biopsy specimens. BLO wrote the manuscript. All authors critically read, edited, and approved the final manuscript. Additional file 1: Figure S1. Myogenic properties of SCs isolated with the ICT method. A. Percent of myogenic colony formation was calculated as percent growing clones out of the total seeded single cells per well Funding (60 per 96-well plate) among ICT- and MB-isolated SCs (n=3 independent This work was supported by a grant from The Dutch Duchenne Parent experiments). B. Number of cells per clone in single clone-derived ICT- Project NL (DPP NL) to BLO; research grants from Parent Project Italy (PP, and MB-isolated SCs at 48 and 72 h of culture in GM. ICT SCs, n= 37 Italy) to MB and from the University of Rome (# RP11715C7D238352, clones analyzed per experiment. MB SCs, n= 37 clones analyzed per ex- RM118164275C7EBE, and RM11916B7E20311C to MB; and # periment. C. Percent of ICT- and MB-isolated SCs positive for Pax7 at day AR11715C7F9E158E, AR11816436905518, and AR11916B7E2A7B64 to AB). 2 of culture in GM. (n=3 independent experiments). D. Percent fusion of single clone-derived ICT and MB-isolated SCs after differentiation (4 days Availability of data and materials in GM followed by 3 days in DM). Fusion index: number of nuclei within All data generated or analyzed during this study are included in this myotubes divided by total number nuclei. E. Number of nuclei per myo- published article [and its supplementary information files]. tube in single clone-derived ICT and MB-isolated SCs after differentiation The datasets used and/or analyzed during the current study are available (4 days in GM followed by 3 days in DM). (n=3 independent experi- from the corresponding author on reasonable request. ments). Error bars represent mean ± sem. Additional file 2: Figure S2. Increased longevity in culture of ICT- Declarations isolated SCs. A. Representative bright field images of ICT-isolated SCs at day 3, 5, 11 and 17 of culture in DM. B. Representative bright field image Ethics approval and consent to participate of MB isolated SCs at day 3 of culture in DM. C. Total number of days in All procedures involving mice were approved by the Italian Ministry for culture of ICT- and MB-isolated SCs. D. Representative bright field images Health and were conducted according to the EU regulations and the Italian showing the heterogeneous muscle cell culture after pre-plating, at 3 Law on Animal Research. and 5 days of culture in GM. Error bars represent mean ± sem. *P < 0.05 According to the Italian law, the authors are not required to ask for approval by Student’s t-test. from an institutional review board or ethical committee for the use of Additional file 3: Figure S3. In vivo functional validation of SCs human tissue removed during surgical procedures. All patients gave their isolated using the ICT and MB method. A. Representative approval to undergo intraoperative muscle biopsy and to publish the clinical immunofluorescence images of dystrophin positive fibers (green) and and laboratory data obtained. nuclei (blue) in mdx tibialis muscle at 30 days following intra-muscular in- jection of 15 x 10 SCs immediately after ICT isolation or after 3 day- Consent for publication expansion in culture following ICT isolation. B. Quantification of the Not applicable. Benedetti et al. Skeletal Muscle (2021) 11:7 Page 12 of 12 Competing interests 22. Blanco-Bose WE, Yao CC, Kramer RH, Blau HM. Purification of mouse primary The authors declare that they have no competing interests. myoblasts based on α7 integrin expression. Exp Cell Res. 2001;265:212–20. 23. Benedetti A, Fiore PF, Madaro L, Lozanoska-Ochser B, Bouché M. Targeting Author details pkcθ promotes satellite cell self-renewal. Int J Mol Sci. 2020;21:2419. Department of Anatomical, Histological, Forensic and Orthopedic Sciences, 24. Fiore PF, Benedetti A, Sandonà M, Madaro L, de Bardi M, Saccone V, et al. Section of Histology and Embryology, Sapienza University of Rome, Rome, Lack of PKCθ promotes regenerative ability of muscle stem cells in chronic Italy. Department of Anatomical, Histological, Forensic and Orthopedic muscle injury. Int J Mol Sci. 2020;21:932. Sciences, Section of Orthopedics, Sapienza University of Rome, Rome, Italy. 25. Rizzo G, di Maggio R, Benedetti A, Morroni J, Bouche M, Lozanoska-Ochser Department of Orthopaedics and Traumatology, Policlinico Umberto I, B. Splenic Ly6Chi monocytes are critical players in dystrophic muscle injury Rome, Italy. and repair. JCI Insight. 2020;5:e130807. 26. Lozanoska-Ochser B, Benedetti A, Rizzo G, Marrocco V, di Maggio R, Fiore P, Received: 21 December 2020 Accepted: 18 February 2021 et al. Targeting early PKCθ-dependent T-cell infiltration of dystrophic muscle reduces disease severity in a mouse model of muscular dystrophy. J Pathol. 2018;244:323–333. 27. Juliano RL, Gagalang E. The adhesion of Chinese hamster cells. I. Effects of References temperature, metabolic inhibitors and proteolytic dissection of cell surface 1. Chang NC, Rudnicki MA. Satellite Cells: The Architects of Skeletal Muscle. macromolecules. J Cell Physiol. 1977;92:209–20. Curr Top Dev Biol. 2014;107:161–81. 28. Rico F, Chu C, Abdulreda MH, Qin Y, Moy VT. Temperature modulation of 2. Wang YX, Dumont NA, Rudnicki MA. Muscle stem cells at a glance. J Cell integrin-mediated cell adhesion. Biophys J. 2010;99:1387–96. Sci. 2014;127:4543–8. 29. Machida S, Spangenburg EE, Booth FW. Primary rat muscle progenitor cells 3. Mauro A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol. have decreased proliferation and myotube formation during passages. Cell 1961;9:493–5. Prolif. 2004;37:267–77. 4. Wang YX, Rudnicki MA. Satellite cells, the engines of muscle repair. Nat Rev 30. Tierney MT, Sacco A. Satellite Cell Heterogeneity in Skeletal Muscle Mol Cell Biol. 2012;13:127–33. Homeostasis. Trends Cell Biol. 2016;26:434–444. 5. Evano B, Tajbakhsh S. Skeletal muscle stem cells in comfort and stress. npj 31. Ono Y, Masuda S, Nam HS, Benezra R, Miyagoe-Suzuki Y, Takeda S. Slow- Regen Med. 2018;3:24. dividing satellite cells retain long-term self-renewal ability in adult muscle. J 6. Feige P, Rudnicki MA. Muscle stem cells. Curr Biol. 2018;28:581–98. Cell Sci. 2012;125:1309–17. 7. Sambasivan R, Yao R, Kissenpfennig A, van Wittenberghe L, Paldi A, 32. Charville GW, Cheung TH, Yoo B, Santos PJ, Lee GK, Shrager JB, et al. Ex vivo Gayraud-Morel B, et al. Pax7-expressing satellite cells are indispensable for expansion and in vivo self-renewal of human muscle stem cells. Stem Cell adult skeletal muscle regeneration. Development. 2011;138:3647–56. Reports. 2015;5:621–32. 8. Relaix F, Zammit PS. Satellite cells are essential for skeletal muscle 33. Marg A, Escobar H, Gloy S, Kufeld M, Zacher J, Spuler A, et al. Human regeneration: The cell on the edge returns centre stage. Development satellite cells have regenerative capacity and are genetically manipulable. J (Cambridge). 2012;139:2845–56. Clin Investig. 2014;124:4257–65. 9. Tedesco FS, Dellavalle A, Diaz-Manera J, Messina G, Cossu G. Repairing 34. Sonna L, Fujita J, Gaffin SL, Craig M. Molecular Biology of Thermoregulation skeletal muscle: Regenerative potential of skeletal muscle stem cells. J Clin Invited Review: Effects of heat and cold stress on mammalian gene Investig. 2010;120:11–9. expression. J Appl Physiol. 2002;92:1725–42. 10. Keire P, Shearer A, Shefer G, Yablonka-Reuveni Z. Isolation and culture of 35. Judson RN, Quarta M, Oudhoff MJ, Soliman H, Yi L, Chang CK, et al. skeletal muscle myofibers as a means to analyze satellite cells. Methods Mol Inhibition of Methyltransferase Setd7 Allows the In Vitro Expansion of Biol. 2013;946:431–68. Myogenic Stem Cells with Improved Therapeutic Potential. Cell Stem Cell. 11. Danoviz ME, Yablonka-Reuveni Z. Skeletal muscle satellite cells: Background 2018;22:177–90. and methods for isolation and analysis in a primary culture system. 36. Ito T, Sawada R, Fujiwara Y, Seyama Y, Tsuchiya T. FGF-2 suppresses cellular Methods Mol Biol. 2012;798:21–52. senescence of human mesenchymal stem cells by down-regulation of TGF- 12. Jonah D, Lee BCS, Lisa M, Larkin KWV. Isolation and Purification of Satellite β2. Biochem Biophys Res Commun. 2007;359:108–14. Cells for Skeletal Muscle Tissue Engineering. J Regen Med. 2015;3:117. 13. Rinaldi F, Perlingeiro RCR. Stem cells for skeletal muscle regeneration: Therapeutic potential and roadblocks. Transl Res. 2014. Publisher’sNote 14. Gharaibeh B, Lu A, Tebbets J, Zheng B, Feduska J, Crisan M, et al. Isolation Springer Nature remains neutral with regard to jurisdictional claims in of a slowly adhering cell fraction containing stem cells from murine skeletal published maps and institutional affiliations. muscle by the preplate technique. Nat Protoc. 2008;163:409–17. 15. Yoshioka K, Kitajima Y, Okazaki N, Chiba K, Yonekura A, Ono Y. A Modified Pre-plating Method for High-Yield and High-Purity Muscle Stem Cell Isolation From Human/Mouse Skeletal Muscle Tissues. Front Cell Dev Biol. 2020;8:793. 16. Pasut A, Oleynik P, Rudnicki MA. Isolation of muscle stem cells by fluorescence activated cell sorting cytometry. Methods Mol Biol. 2012;798: 53–64. 17. Liu L, Cheung TH, Charville GW, Rando TA. Isolation of skeletal muscle stem cells by fluorescence-activated cell sorting. Nat Protoc. 2015;10:1612–24. 18. Chapman MR, Balakrishnan KR, Li J, Conboy MJ, Huang H, Mohanty SK, et al. Sorting single satellite cells from individual myofibers reveals heterogeneity in cell-surface markers and myogenic capacity. Integr Biol (United Kingdom). 2013;5:692–702. 19. Fukada SI, Higuchi S, Segawa M, Koda KI, Yamamoto Y, Tsujikawa K, et al. Purification and cell-surface marker characterization of quiescent satellite cells from murine skeletal muscle by a novel monoclonal antibody. Exp Cell Res. 2004;296:245–55. 20. Sherwood RI, Christensen JL, Conboy IM, Conboy MJ, Rando TA, Weissman IL, et al. Isolation of adult mouse myogenic progenitors: Functional heterogeneity of cells within and engrafting skeletal muscle. Cell. 2004;119: 543–54. 21. Montarras D, Morgan J, Collins C. Direct Isolation of Satellite Cells for Skeletal Muscle Regeneration. Mol Cell Biol. 2005;309:2064–7.

Journal

Skeletal MuscleSpringer Journals

Published: Mar 17, 2021

There are no references for this article.