Metformin inhibits high glucose-induced smooth muscle cell proliferation and migration

Metformin inhibits high glucose-induced smooth muscle cell proliferation and migration www.aging-us.com AGING 2020, Vol. 12, No. 6 Research Paper Metformin inhibits high glucose-induced smooth muscle cell proliferation and migration 1,* 2,* 3,4,* 3 2 2 Dong-Ming Zhou , Feng Ran , Hai-Zhen Ni , Li-Li Sun , Lun Xiao , Xiao-Qiang Li , Wen-Dong Li Department of Hematology, The Affiliated Drum Tower Hospital, Nanjing University Medical School, Jiangsu, China Department of Vascular Surgery, The Affiliated Drum Tower Hospital, Nanjing University Medical School, Jiangsu, China Department of Vascular Surgery, The Second Affiliated Hospital of Soochow University, Jiangsu, China Department of Vascular Surgery, The First Affiliated Hospital of Wenzhou Medical University, Zhejiang, China *Equal contribution Correspondence to: Xiao-Qiang Li, Wen-Dong Li; email: vasculars@126.com, vasculars@163.com Keywords: metformin, smooth muscle cells, HMGB1, autophagy, miR-142-3p Received: December 30, 2019 Accepted: February 20, 2020 Published: March 24, 2020 Copyright: Zhou et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT We investigated the protective effects and mechanism of action of metformin on high glucose-induced smooth muscle cell proliferation and migration. Vascular smooth muscle cells (VSMCs) were subjected to a series of concentrations (0-10 mM) of metformin. CCK-8, wound healing, and transwell assays were performed. Correlations between metformin concentration and high-mobility group box 1 (HMGB1) and miR-142-3p levels were assessed. In addition, miR-142-3p mimic and siRNA were used to investigate VSMC migration in the presence or absence of metformin. In the high-glucose condition, metformin decreased cell growth and inhibited cell migration. HMGB1 gene expression correlated negatively with metformin concentration, whereas miR-142-3p expression correlated positively with metformin concentration. In addition, mimic-induced miR- 142-3p elevation resulted in decreased HMGB1 and LC3II levels and elevated p62 levels in the high-glucose condition, whereas miR-142-3p knockdown had the reverse effects, and metformin abolished those effects. Metformin inhibits high glucose–induced VSMC hyperproliferation and increased migration by inducing miR- 142-3p-mediated inhibition of HMGB1 expression via the HMGB1-autophagy related pathway. inhibition potentially effective theraputic approach to INTRODUCTION atherosclerosis. Arteriosclerosis obliterans (ASO) is a major cause of death and disability, particularly in patients with MicroRNAs affect gene expression, and their diabetes mellitus (DM) [1, 2]. This is because the dysregulation increases inflammation and leads to inflammation underlying atherosclerosis exacerbated by atherosclerosis [11–13]. Studies have shown that many hyperglycemic states [3]. High-mobility group box 1 microRNAs, including miR- 504, -200, -138 and -210, (HMGB1), is a crucial inflammatory factor in athero- regulate the proliferation and migration of VSMCs [3]. Furthermore, studies have determined that some sclerosis [4–6], and a danger signal for vascular disease microRNAs inhibit the expression of HMGB1 [14–16]. [7]. Abundant HMGB1 within carotid and coronary Thus inhibiting HMGB1 expression via microRNAs in atherosclerotic plaques [8] contributes to the abnormal VSMCs may be a therapeutic approach to reduce proliferation and migration of vascular smooth muscle atherothrombotic events. cells (VSMCs) [9, 10]. This makes HMGB1 www.aging-us.com 5352 AGING Metformin, which is used to treat type 2 DM, may that metformin at concentrations of 1, 5, and 10 mM suppress diabetes-accelerated atherosclerosis [17, 18] via significantly inhibited high glucose–induced VSMC AMPK-mediated inhibition of VSMC proliferation and hyperproliferation (Figure 1B). migration [19]. Metformin’s promotion of microRNA expression and anti-inflammatory effects also contribute Metformin inhibited high glucose-induced VSMC to this process [19–21]. In prior studies, metformin was migration via the HMGB1-autophagy related pathway found to inhibit the expression and release of HMGB1 [22, 23]. We therefore speculated that metformin may To further evaluate the effects of metformin on high inhibit high glucose–induced VSMC proliferation and glucose–induced VSMC behavior, a two dimensional migration via microRNA–mediated inhibition of scratch assay and three dimensional transwell assay were HMGB1 expression. To test that idea, VSMCs were performed. The results showed significant inhibition of isolated from the rat aorta and characterized by high glucose–induced cell migration when metformin was added to the assays. Metformin also resulted in fluorescence microscopy and subjected to a high-glucose environment and a series metformin concentrations (0-10 decreased cell migration under normal glucose condition mM). Our findings suggest metformin inhibits glucose- (Figure 2A, 2B). In addition, we also evaluated the induced VSMC hyperproliferation and migration by expression of HMGB1-autophagy related pathway inhibiting HMGB1 expression via the HMGB1- molecules and found that metformin treatment resulted in autophagy related pathway inhibition of the elevated HMGB1 and LC3II levels and the decreased p62 level found in the high-glucose condition. Similarly, the addition of metformin resulted RESULTS in decreased HMGB1 and LC3II levels and increased p62 level in the normal glucose condition (Figure 2C). Metformin inhibited high glucose–induced VSMC These results indicate that metformin rectifies high hyperplasia in a dose-dependent manner glucose–induced VSMC migration enhancement via the HMGB1-autophagy related pathway. To evaluate the effects of metformin on VSMCs in a high-glucose condition, we first isolated and Metformin inhibited HMGB1 expression by characterized the VSMC and confirmed the presence increasing miR-142-3p expression in VSMC of the VSMC marker α-SMA in these cells (Figure 1A). We then subjected the cells to a high-glucose To further clarify the regulatory network involved in the environment and examined the cell proliferation. effects of metformin on high glucose–induced VSMC Finally, metformin was added, and the results showed Figure 1. Metformin inhibited high glucose–induced vascular smooth muscle cell (VSMC) hyperplasia in a dose-dependent manner. (A) VSMC characterization by fluorescence microscopy. Expression of smooth muscle cell marker α-SMA was confirmed by red fluorescence. (B) CCK-8 evaluation of the effects of metformin on VSMC proliferation. Significant inhibition of high glucose–induced cell proliferation was found at metformin concentrations of 1, 5, and 10 mM. **p < 0.01 and ***p < 0.001 for between-group comparisons. www.aging-us.com 5353 AGING proliferation and migration, we performed gene To confirm that HMGB1 is regulated by miR-142-3p, expression analysis and correlation analysis between reporter assays were performed. Results showed that HMGB1, and miR-142-3p expression and metformin miR-142-3p mimics significantly reduced the concentration. A negative correlation was found expression of HMGB1 (Figure 3E). miR-142-3p was between HMGB1 gene level and metformin con- also shown to inhibit HMGB1 expression by directly centration (Figure 3A, 3B), and a positive correlation binding to its 3′-UTR segment. To confirm the ability was found between miR-142-3p level and metformin of miR-142-3p to suppress HMGB1 expression, concentration (Figure 3C, 3D). VSMCs were transfected with miR-142-3p mimics Figure 2. Metformin inhibited high glucose–induced vascular smooth muscle cell (VSMC) migration via HMGB1-autophagy related pathway. (A) Metformin inhibited high glucose–induced VSMC migration in a two dimensional scratch assay. Significant inhibition of cell migration was found when metformin was added in the high-glucose condition; in addition, metformin resulted in decreased cell migration in the normal glucose condition. (B) Metformin inhibited high glucose–induced VSMC migration in a three dimensional transwell assay. Significant inhibition of cell migration was found when metformin was added in the high-glucose condition; in addition, metformin resulted in decreased cell migration in the normal glucose condition. (C) The HMGB1-autophagy related pathway was involved in the effects of metformin on high glucose–induced cell migration. Metformin resulted in decreased HMGB1 and LC3II levels and increased the p62 level in the high-glucose condition. In addition, metformin resulted in decreased HMGB1 and p62 levels and increased LC3II level in the normal glucose condition. *p < 0.05, **p < 0.01 and ***p < 0.001 for between-group comparison. www.aging-us.com 5354 AGING and inhibitor (Figure 3F). The group containing miR- miR-142-3p overexpression by mimic and inhibition by 142-3p mimics displayed a robustly decreased siRNA result in inhibition and promotion, respectively HMGB1 protein level, whereas VSMCs in the group of high glucose–induced VSMCs migration via the with miR-142-3p inhibitor demonstrated an increased Akt/PI3K/autophagy related pathway HMGB1 protein level (Figure 3G, 3H). These results indicate that metformin decreases HMGB1 expression To further verify the role of miR-142-3p in high by promoting miR-142-3p in VSMCs. glucose–induced VSMC migration, miR-142-3p Figure 3. Metformin exerts effects on HMGB1 via affecting miR-142-3p in vascular smooth muscle cells (VSMCs). (A) Decreased HMGB1 gene expression in a metformin dose-dependent manner by quantitative real-time PCR. (B) Correlation analysis revealed that negative correlation was found between metformin concentration and HMGB1 gene expression. (C) Increased miR-142-3p expression in a metformin dose-dependent manner by quantitative real-time PCR. (D) Correlation analysis revealed that positive correlation was found between metformin concentration and miR-142-3p gene expression. (E) Decreased HMGB1 level was found in HMGB1-WT-3’’UTR + miR-142- 3p transfected VSMCs compared to HMGB1-WT-3’'UTR + control vector transfected VSMCs, whereas HMGB1 level was similar between HMGB1-MUT-3’’UTR + miR-142-3p transfected VSMCs and HMGB1- MUT -3’’UTR + control vector transfected VSMCs. (F) miR-142-3p overexpression and inhibition by mimics and siRNA resulted in decreased and increased HMGB1 gene expression in VSMCs, respectively. (G) miR-142-3p overexpression and inhibition by mimics and siRNA resulted in decreased and increased HMGB1 protein expression in VSMCs, respectively. (H) Relative quantification of HMGB1 level. **p < 0.01 and ***p < 0.001 for between group comparison. www.aging-us.com 5355 AGING overexpression and inhibition were induced by mimic 142-3p overexpression by mimic resulted in inhibition and siRNA transfection, respectively. We found that of HMGB1 and LC3II levels and elevated p62 level in miR-142-3p overexpression by mimic and inhibition by high glucose–induced VSMC migration enhancement. siRNA resulted in inhibition and promotion, However, miR-142-3p siRNA generated the reverse respectively, of high glucose–induced VSMC migration effects, and metformin abolished the effects of miR- via the HMGB1-autophagy related pathway. However, 142-3p siRNA (Figure 4C). These results confirm the metformin abolished the effects of miR-142-3p siRNA effects of miR-142-3p on the migration behavior of (Figure 4A, 4B). Further analysis revealed that miR- VSMCs in the high-glucose condition. Figure 4. miR-142-3p overexpression by mimic and miR-142-3p inhibition by siRNA resulted in inhibition and promotion, respectively, of high glucose–induced vascular smooth muscle cell (VSMC) migration enhancement via the HMGB1-autophagy related pathway, whereas metformin abolished the effects of miR-142-3p siRNA. (A) Scratch assay for the effects of miR-142-3p overexpression and inhibition. (B) Transwell assay for the effects of miR-142-3p overexpression and inhibition. (C) miR-142-3p overexpression by mimic results in decreased HMGB1 and LC3II and elevated p62 level in high glucose–induced VSMC migration enhancement, whereas miR-142- 3p siRNA caused the opposite effects and metformin abolished the effects of miR-142-3p siRNA. (D) Schematic of the role of metformin in the regulation of VSMC proliferation and migration. *p < 0.05, **p < 0.01 and ***p < 0.001 for between-group comparison. www.aging-us.com 5356 AGING model studies, of microRNAs involved in the regulation DISCUSSION of cell growth should be performed to clarify these issues. In conclusion, we demonstrated that metformin Abnormal proliferation and migration of VSMC, which inhibits high glucose–induced VSMC hyper- is enhanced by inflammation in hyperglycemic states, proliferation and migration enhancement by promoting contribute to the formation of atherosclerotic lesions [24]. miR-142-3p–mediated inhibition of HMGB1 expression According to previous studies, metformin attenuates via the autophagy pathway. early-stage atherosclerosis in mildly hyperglycemic Oikawa-Nagao mice [17]. This may be due to the inhibition of the inflammatory response and vascular MATERIALS AND METHODS calcification in VSMC by metformin [24, 25]. Metformin also inhibits proliferation of tumor and endothelial cells VSMC isolation and characterization [26, 27]. In our study, metformin decreased VSMC proliferation in the high-glucose condition. In addition, All research involving experimental animals was VSMC migration was also inhibited by metformin. approved by the Institutional Review Board of the Finally, increased miR-142-3p expression was shown to Drum Tower Hospital Affiliated to Medical School of inhibit VSMC proliferation and migration via the Nanjing University, Nanjing, China, and adhere to the HMGB1-autophagy related pathway (Figure 4D). international experiment guideline. VSMCs, obtained from the aortic artery, were cultured with DMEM HMGB1 is an inflammatory factor that increase VSMC containing 20% FBS at 37°C. Immunofluorescence with proliferation and high glucose–induced calcification in α-actin was carried out to identify the cells [43]. VSMC and subsequent vascular inflammation and atherosclerosis [4, 28, 29]. In addition, HMGB1 has Cell treatment been identified as an autophagy sensor in oxidative stress [30], and autophagy may regulate the expression VSMCs were grown to 70%-80% cell confluence and and release of HMGB1 [31]. However, increasing exposed to normal glucose (5.6 + 19.4 mmol/L mannitol) evidences indicates that HMGB1 is downregulated by or High Glucose (25 mmol/L) for 24 hours. Metformin metformin [23]. In our previous studies, we found that was added to the high glucose–treated cells. In the cell metformin induced autophagy by activating AMPK, proliferation assay, metformin was used at a serial resulting in decreased proliferation and migration of concentration of 1, 5, and 10 mM. The concentration of endothelial progenitor cells [32, 33]. In the present metformin in the cell migration assay was 5 mM. study, we also found that metformin inhibits the proliferation and migration of VSMC induced by CCK-8 assay for cell growth elevated glucose. This might be related to the autophagy pathway promoted by metformin. Trypsinized VSMCs (2 × 10 cells) were resuspended in complete VSMC medium and seeded in a 12-well plate It has been well demonstrated that many microRNAs and incubated with 0, 1, 5 and 10 mM of metformin in affect atherosclerosis by inhibiting cardiovascular the previously mentioned normal and high-glucose inflammation [13, 34]. MiR-142-3p, one of the novel conditions under 37°C, 5% CO . One day later, cell inflammation-related miRNAs [35], is significantly proliferation was evaluated by CCK-8 assay following upregulated by metformin [36]. It may inhibit cell the manufacturer’s instructions. At least triplicate proliferation and migration via the WNT signaling repeats were completed in all the experiments. pathway and autophagy [37–39]. In addition, miR-142- 3p may target HMGB1 in tumor cells [14, 40]. Wound healing assay Consistently, we found that miR-142-3p inhibited migration enhancement in high glucose–stimulated VSMCs were allowed to be grown to 80%-90% cell VSMC. These findings validate that miR-142-3p is confluence and treated with normal glucose or high involved in the regulation of abnormal VSMC glucose in the absence or presence of metformin. A proliferation and migration, which contribute to ASO scratch was made by a 200 µL pipette tip at 0 h and and in-stent restenosis. However, these findings incubated at 37°C, 5% CO . Pictures were taken using contradict some previous studies. For example, Bao et microscopy at 0 and 24 h for migration evaluation. al found that miR-142-3p promoted endothelial cell proliferation via Bcl-2–associated transcription factor 1 Transwell assay [41]. In addition, Wu et al found that miR-142-3p promoted the neuronal cell cycle and inhibited A modified transwell assay in 24-well plates was used for apoptosis after peripheral nerve injury [42]. Thus, cell migration evaluation (BD Biosciences, San Jose, CA, further investigation, especially the appropriate animal USA). After cell transfection for 24 h, cells were www.aging-us.com 5357 AGING Table 1. Primer sequence. Gene name Forward Reverse HMGB1 5′-AGCAATCTGAACGTCTGTCC-3′ 5′-GTTCTTGTGATAGCCTTCGC-3′ GAPDH 5′-GCGCTGAGTACGTCG-3′ 5′-CAGTTGGTGGTGCAG-3′ MiR-142-3p TGTAGTGTTTCCTACTTTATGGA U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT suspended with serum-free DMEM at a concentration of Relative microRNA expression was normalized to the 3 × 10 cells and added to the upper chamber, while the reference microRNA expression using the ΔΔCt lower chamber was filled with DMEM supplemented method. All primer sequences arelisted in Table 1. with 20% FBS as a chemoattractant. Then the transwell plate was incubated at 37°C for 24 h, and a cotton swab Western blot analysis was used to remove upper chamber residue cells. The transwell membrane close to the lower chamber was cut Cellar protein was extracted from VSMCs (1 × 10 by scissors, stained with crystal violet and photographed cells), as previously reported [44]. Briefly, the proteins by a microscope. The cells were then counted according were separated and then transferred. After blocking, to the pictures. membranes were incubated with HMGB1(Cell Signaling Technology [CST], Danvers, MA, USA), Cell transfection LC3II/I(CST), p62(CST), and Actin (Sigma, St. Louis, MO, USA). Appropriate secondary antibodies were miR-142-3p mimic, siRNA, and their negative controls used. The protein bands were detected using an Infrared were purchased from Thermo. miR-142-3p mimic (50 Imaging System (LI-COR). nM), siRNA (150 nM), and their negative controls were transfected, into VSMCs at 80% confluence using Statistical analysis Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 48 h All statistical analyses were performed using SPSS v21. of transfection, cells were harvested for subsequent Data are presented as mean ± SD. Student’s t test or experiments, and the expression of microRNA was one-way ANOVA was used to examine the differences confirmed by real-time reverse transcriptase quantitative between the groups. Correlations between HMGB-1 and polymerase chain reaction (RT-qPCR), described later. miR-142-3p levels and metformin concentration were analyzed using the Pearson correlation method. P < 0.05 Luciferase assay was considered as statistically significant. Luciferase reporter assay was performed, as previously CONFLICTS OF INTEREST described [44], to explore the potential regulation mechanisms of miR-142-3p. For the measurement of The authors confirm that there are no potential conflicts luciferase activity, cells were cotransfected in 24-well of interest. plates with 100 ng of luciferase plasmid and 50 ng of Renilla plasmid (Ambion) as a control, as well as with FUNDING 400 ng of miR-142-3p mimics or negative control microRNA. The luciferase and Renilla plasmid This work was supported by grants from the National activities were measured 48 h later using the Dual Natural Science Foundation of China (No. 81770483, Luciferase Reporter 1000 Assay System (Promega, 81800418), the Natural Science Foundation of Jiangsu Madison, WI, USA). Province (No. BK20180125), the Key Project supported by Medical Science and technology development RT-qPCR Foundation (No. YKK18063), Nanjing Department of Health, and the Fundamental Research Funds for the RT-qPCR was performed as previously reported Central Universities (No. 021414380362). [44, 45]. Briefly, total RNA was isolated from the VSMCs treated with the series of metformin REFERENCES concentration. Real-time PCR detection was performed when generation of cDNA for RT-qPCR was done. 1. Low Wang CC, Hess CN, Hiatt WR, Goldfine AB. Clinical GAPDH expression and U6 expression were used as Update: Cardiovascular Disease in Diabetes Mellitus: controls for HMGB1 and microRNA gene, respectively. www.aging-us.com 5358 AGING Atherosclerotic Cardiovascular Disease and Heart proliferate in response to high mobility group box 1 Failure in Type 2 Diabetes Mellitus - Mechanisms, protein. FASEB J. 2006; 20:2565–66. Management, and Clinical Considerations. Circulation. https://doi.org/10.1096/fj.06-5867fje PMID:17060403 2016; 133:2459–502. 10. Jang EJ, Baek SE, Kim EJ, Park SY, Kim CD. HMGB1 https://doi.org/10.1161/CIRCULATIONAHA.116.022194 enhances AGE-mediated VSMC proliferation via an PMID:27297342 increase in 5-LO-linked RAGE expression. Vascul Pharmacol. 2019; 118-119:106559. 2. Eckel RH, Hokanson JE. The Prediction of https://doi.org/10.1016/j.vph.2019.04.001 Atherosclerotic Cardiovascular Disease in Type 1 PMID:30954689 Diabetes Mellitus: Do We Just Stop Here? Circulation. 2016; 133:1051–53. 11. Nazari-Jahantigh M, Egea V, Schober A, Weber C. https://doi.org/10.1161/CIRCULATIONAHA.116.021654 MicroRNA-specific regulatory mechanisms in PMID:26888766 atherosclerosis. J Mol Cell Cardiol. 2015; 89:35–41. https://doi.org/10.1016/j.yjmcc.2014.10.021 3. Yuan T, Yang T, Chen H, Fu D, Hu Y, Wang J, Yuan Q, Yu PMID:25450610 H, Xu W, Xie X. New insights into oxidative stress and inflammation during diabetes mellitus-accelerated 12. Menghini R, Stöhr R, Federici M. MicroRNAs in vascular atherosclerosis. Redox Biol. 2019; 20:247–60. aging and atherosclerosis. Ageing Res Rev. 2014; https://doi.org/10.1016/j.redox.2018.09.025 17:68–78. https://doi.org/10.1016/j.arr.2014.03.005 PMID:30384259 PMID:24681293 4. de Souza AW, Westra J, Limburg PC, Bijl M, Kallenberg 13. Martens CR, Bansal SS, Accornero F. Cardiovascular CG. HMGB1 in vascular diseases: its role in vascular inflammation: RNA takes the lead. J Mol Cell Cardiol. inflammation and atherosclerosis. Autoimmun Rev. 2019; 129:247–56. 2012; 11:909–17. https://doi.org/10.1016/j.yjmcc.2019.03.012 https://doi.org/10.1016/j.autrev.2012.03.007 PMID:30880251 PMID:22495229 14. Liu K, Huang J, Ni J, Song D, Ding M, Wang J, Huang X, Li 5. Fan Z, Yang J, Yang J, Yang C, Guo X. HMGB1: A W. MALAT1 promotes osteosarcoma development by promising therapeutic approach for atherosclerosis. Int regulation of HMGB1 via miR-142-3p and miR-129-5p. J Cardiol. 2016; 202:507–08. Cell Cycle. 2017; 16:578–87. https://doi.org/10.1016/j.ijcard.2015.09.101 https://doi.org/10.1080/15384101.2017.1288324 PMID:26440462 PMID:28346809 6. Cai J, Wen J, Bauer E, Zhong H, Yuan H, Chen AF. The 15. Dormoy-Raclet V, Cammas A, Celona B, Lian XJ, van der Role of HMGB1 in Cardiovascular Biology: danger Giessen K, Zivojnovic M, Brunelli S, Riuzzi F, Sorci G, Signals. Antioxid Redox Signal. 2015; 23:1351–69. Wilhelm BT, Di Marco S, Donato R, Bianchi ME, Gallouzi https://doi.org/10.1089/ars.2015.6408 IE. HuR and miR-1192 regulate myogenesis by PMID:26066838 modulating the translation of HMGB1 mRNA. Nat Commun. 2013; 4:2388. 7. Yan XX, Lu L, Peng WH, Wang LJ, Zhang Q, Zhang RY, https://doi.org/10.1038/ncomms3388 PMID:24005720 Chen QJ, Shen WF. Increased serum HMGB1 level is associated with coronary artery disease in nondiabetic 16. Zhan LY, Lei SQ, Zhang BH, Li WL, Wang HX, Zhao B, Cui and type 2 diabetic patients. Atherosclerosis. 2009; SS, Ding H, Huang QM. Overexpression of miR-381 205:544–48. relieves neuropathic pain development via targeting https://doi.org/10.1016/j.atherosclerosis.2008.12.016 HMGB1 and CXCR4. Biomed Pharmacother. 2018; PMID:19150066 107:818–23. https://doi.org/10.1016/j.biopha.2018.08.053 8. Inoue K, Kawahara K, Biswas KK, Ando K, Mitsudo K, PMID:30142543 Nobuyoshi M, Maruyama I. HMGB1 expression by activated vascular smooth muscle cells in advanced 17. Asai A, Shuto Y, Nagao M, Kawahara M, Miyazawa T, human atherosclerosis plaques. Cardiovasc Pathol. Sugihara H, Oikawa S. Metformin Attenuates Early- 2007; 16:136–43. Stage Atherosclerosis in Mildly Hyperglycemic Oikawa- https://doi.org/10.1016/j.carpath.2006.11.006 Nagao Mice. J Atheroscler Thromb. 2019; 26:1075–83. PMID:17502242 https://doi.org/10.5551/jat.48223 PMID:30971640 9. Porto A, Palumbo R, Pieroni M, Aprigliano G, Chiesa R, 18. Wang Q, Zhang M, Torres G, Wu S, Ouyang C, Xie Z, Sanvito F, Maseri A, Bianchi ME, Porto A, Palumbo R, Zou MH. Metformin Suppresses Diabetes-Accelerated Pieroni M, Aprigliano G, Chiesa R, et al. Smooth muscle Atherosclerosis via the Inhibition of Drp1-Mediated cells in human atherosclerotic plaques secrete and Mitochondrial Fission. Diabetes. 2017; 66:193–205. www.aging-us.com 5359 AGING https://doi.org/10.2337/db16-0915 Proliferation and Apoptosis Through AMPK/CREB/BDNF PMID:27737949 Pathway. Front Pharmacol. 2018; 9:1266. https://doi.org/10.3389/fphar.2018.01266 19. Luo F, Das A, Chen J, Wu P, Li X, Fang Z. Metformin in PMID:30459620 patients with and without diabetes: a paradigm shift in cardiovascular disease management. Cardiovasc 28. Yang J, Chen L, Ding J, Fan Z, Li S, Wu H, Zhang J, Yang Diabetol. 2019; 18:54. C, Wang H, Zeng P, Yang J. MicroRNA-24 inhibits high https://doi.org/10.1186/s12933-019-0860-y glucose-induced vascular smooth muscle cell PMID:31029144 proliferation and migration by targeting HMGB1. Gene. 2016; 586:268–73. 20. Zhou JY, Xu B, Li L. A New Role for an Old Drug: https://doi.org/10.1016/j.gene.2016.04.027 Metformin Targets MicroRNAs in Treating Diabetes PMID:27085480 and Cancer. Drug Dev Res. 2015; 76:263–69. https://doi.org/10.1002/ddr.21265 29. Wang Y, Shan J, Yang W, Zheng H, Xue S. High mobility PMID:26936407 group box 1 (HMGB1) mediates high-glucose-induced calcification in vascular smooth muscle cells of 21. Pulito C, Donzelli S, Muti P, Puzzo L, Strano S, Blandino saphenous veins. Inflammation. 2013; 36:1592–604. G. microRNAs and cancer metabolism reprogramming: https://doi.org/10.1007/s10753-013-9704-1 the paradigm of metformin. Ann Transl Med. 2014; 2:58. PMID:23928875 https://doi.org/10.3978/j.issn.2305-5839.2014.06.03 PMID:25333033 30. Kang R, Livesey KM, Zeh HJ 3rd, Lotze MT, Tang D. HMGB1 as an autophagy sensor in oxidative stress. 22. Tsoyi K, Jang HJ, Nizamutdinova IT, Kim YM, Lee YS, Autophagy. 2011; 7:904–06. Kim HJ, Seo HG, Lee JH, Chang KC. Metformin inhibits https://doi.org/10.4161/auto.7.8.15704 HMGB1 release in LPS-treated RAW 264.7 cells and PMID:21487246 increases survival rate of endotoxaemic mice. Br J Pharmacol. 2011; 162:1498–508. 31. Thorburn J, Frankel AE, Thorburn A. Regulation of https://doi.org/10.1111/j.1476-5381.2010.01126.x HMGB1 release by autophagy. Autophagy. 2009; PMID:21091653 5:247–49. https://doi.org/10.4161/auto.5.2.7552 23. Huang WS, Lin CT, Chen CN, Chang SF, Chang HI, Lee PMID:19098461 KC. Metformin increases the cytotoxicity of oxaliplatin in human DLD-1 colorectal cancer cells through down- 32. Li WD, Li NP, Song DD, Rong JJ, Qian AM, Li XQ. regulating HMGB1 expression. J Cell Biochem. 2018; Metformin inhibits endothelial progenitor cell 119:6943–52. https://doi.org/10.1002/jcb.26898 migration by decreasing matrix metalloproteinases, PMID:29737584 MMP-2 and MMP-9, via the AMPK/mTOR/autophagy pathway. Int J Mol Med. 2017; 39:1262–68. 24. Kim SA, Choi HC. Metformin inhibits inflammatory https://doi.org/10.3892/ijmm.2017.2929 response via AMPK-PTEN pathway in vascular smooth PMID:28339020 muscle cells. Biochem Biophys Res Commun. 2012; 425:866–72. 33. Li WD, Du XL, Qian AM, Hu N, Kong LS, Wei S, Li CL, Li https://doi.org/10.1016/j.bbrc.2012.07.165 XQ. Metformin regulates differentiation of bone PMID:22898050 marrow-derived endothelial progenitor cells via multiple mechanisms. Biochem Biophys Res Commun. 25. Cao X, Li H, Tao H, Wu N, Yu L, Zhang D, Lu X, Zhu J, Lu Z, 2015; 465:803–09. Zhu Q. Metformin inhibits vascular calcification in https://doi.org/10.1016/j.bbrc.2015.08.091 female rat aortic smooth muscle cells via the AMPK- PMID:26319555 eNOS-NO pathway. Endocrinology. 2013; 154:3680–89. https://doi.org/10.1210/en.2013-1002 34. Laffont B, Rayner KJ. MicroRNAs in the Pathobiology PMID:24025223 and Therapy of Atherosclerosis. Can J Cardiol. 2017; 33:313–24. https://doi.org/10.1016/j.cjca.2017.01.001 26. Shao X, Cao X, Song G, Zhao Y, Shi B. Metformin PMID:28232017 rescues the MG63 osteoblasts against the effect of high glucose on proliferation. J Diabetes Res. 2014; 35. Boomiraj H, Mohankumar V, Lalitha P, Devarajan B. 2014:453940. Human corneal microRNA expression profile in fungal https://doi.org/10.1155/2014/453940 keratitis. Invest Ophthalmol Vis Sci. 2015; 56:7939–46. PMID:24812633 https://doi.org/10.1167/iovs.15-17619 PMID:26720440 27. Han X, Wang B, Sun Y, Huang J, Wang X, Ma W, Zhu Y, Xu R, Jin H, Liu N. Metformin Modulates High Glucose- 36. Xia C, Liang S, He Z, Zhu X, Chen R, Chen J. Metformin, Incubated Human Umbilical Vein Endothelial Cells a first-line drug for type 2 diabetes mellitus, disrupts www.aging-us.com 5360 AGING the MALAT1/miR-142-3p sponge to decrease invasion 41. Bao H, Chen YX, Huang K, Zhuang F, Bao M, Han Y, Chen and migration in cervical cancer cells. Eur J Pharmacol. XH, Shi Q, Yao QP, Qi YX. Platelet-derived microparticles 2018; 830:59–67. promote endothelial cell proliferation in hypertension https://doi.org/10.1016/j.ejphar.2018.04.027 via miR-142-3p. FASEB J. 2018; 32:3912–23. PMID:29704494 https://doi.org/10.1096/fj.201701073R PMID:29481306 37. Kim K, Yang DK, Kim S, Kang H. miR-142-3p Is a Regulator of the TGFβ-Mediated Vascular Smooth 42. Wu DM, Wen X, Han XR, Wang S, Wang YJ, Shen M, Muscle Cell Phenotype. J Cell Biochem. 2015; Fan SH, Zhuang J, Zhang ZF, Shan Q, Li MQ, Hu B, Sun 116:2325–33. CH, et al. MiR-142-3p Enhances Cell Viability and https://doi.org/10.1002/jcb.25183 Inhibits Apoptosis by Targeting CDKN1B and TIMP3 PMID:25832008 Following Sciatic Nerve Injury. Cell Physiol Biochem. 2018; 46:2347–57. 38. Carraro G, Shrestha A, Rostkovius J, Contreras A, Chao https://doi.org/10.1159/000489626 CM, El Agha E, Mackenzie B, Dilai S, Guidolin D, Taketo PMID:29742504 MM, Günther A, Kumar ME, Seeger W, et al. miR-142- 3p balances proliferation and differentiation of 43. Sun J, Marx SO, Chen HJ, Poon M, Marks AR, Rabbani mesenchymal cells during lung development. LE. Role for p27(Kip1) in Vascular Smooth Muscle Cell Development. 2014; 141:1272–81. Migration. Circulation. 2001; 103:2967–72. https://doi.org/10.1242/dev.105908 https://doi.org/10.1161/01.CIR.103.24.2967 PMID:24553287 PMID:11413088 39. Zhai Z, Wu F, Dong F, Chuang AY, Messer JS, Boone DL, 44. Li WD, Zhou DM, Sun LL, Xiao L, Liu Z, Zhou M, Wang Kwon JH. Human autophagy gene ATG16L1 is post- WB, Li XQ. LncRNA WTAPP1 Promotes Migration and transcriptionally regulated by MIR142-3p. Autophagy. Angiogenesis of Endothelial Progenitor Cells via MMP1 2014; 10:468–79. https://doi.org/10.4161/auto.27553 Through MicroRNA 3120 and Akt/PI3K/Autophagy PMID:24401604 Pathways. Stem Cells. 2018; 36:1863–74. https://doi.org/10.1002/stem.2904 PMID:30171660 40. Fu Y, Sun LQ, Huang Y, Quan J, Hu X, Tang D, Kang R, Li N, Fan XG. miR-142-3p Inhibits the Metastasis of 45. Livak KJ, Schmittgen TD. Analysis of relative gene Hepatocellular Carcinoma Cells by Regulating HMGB1 expression data using real-time quantitative PCR and Gene Expression. Curr Mol Med. 2018; 18:135–41. the 2(-Delta Delta C(T)) Method. Methods. 2001; https://doi.org/10.2174/1566524018666180907161124 25:402–08. https://doi.org/10.1006/meth.2001.1262 PMID:30198432 PMID:11846609 www.aging-us.com 5361 AGING http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Aging (Albany NY) Pubmed Central

Metformin inhibits high glucose-induced smooth muscle cell proliferation and migration

Aging (Albany NY), Volume 12 (6) – Mar 24, 2020

Loading next page...
 
/lp/pubmed-central/metformin-inhibits-high-glucose-induced-smooth-muscle-cell-2nRTX4Q0KG
Publisher
Pubmed Central
Copyright
Copyright © 2020 Zhou et al.
eISSN
1945-4589
DOI
10.18632/aging.102955
Publisher site
See Article on Publisher Site

Abstract

www.aging-us.com AGING 2020, Vol. 12, No. 6 Research Paper Metformin inhibits high glucose-induced smooth muscle cell proliferation and migration 1,* 2,* 3,4,* 3 2 2 Dong-Ming Zhou , Feng Ran , Hai-Zhen Ni , Li-Li Sun , Lun Xiao , Xiao-Qiang Li , Wen-Dong Li Department of Hematology, The Affiliated Drum Tower Hospital, Nanjing University Medical School, Jiangsu, China Department of Vascular Surgery, The Affiliated Drum Tower Hospital, Nanjing University Medical School, Jiangsu, China Department of Vascular Surgery, The Second Affiliated Hospital of Soochow University, Jiangsu, China Department of Vascular Surgery, The First Affiliated Hospital of Wenzhou Medical University, Zhejiang, China *Equal contribution Correspondence to: Xiao-Qiang Li, Wen-Dong Li; email: vasculars@126.com, vasculars@163.com Keywords: metformin, smooth muscle cells, HMGB1, autophagy, miR-142-3p Received: December 30, 2019 Accepted: February 20, 2020 Published: March 24, 2020 Copyright: Zhou et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT We investigated the protective effects and mechanism of action of metformin on high glucose-induced smooth muscle cell proliferation and migration. Vascular smooth muscle cells (VSMCs) were subjected to a series of concentrations (0-10 mM) of metformin. CCK-8, wound healing, and transwell assays were performed. Correlations between metformin concentration and high-mobility group box 1 (HMGB1) and miR-142-3p levels were assessed. In addition, miR-142-3p mimic and siRNA were used to investigate VSMC migration in the presence or absence of metformin. In the high-glucose condition, metformin decreased cell growth and inhibited cell migration. HMGB1 gene expression correlated negatively with metformin concentration, whereas miR-142-3p expression correlated positively with metformin concentration. In addition, mimic-induced miR- 142-3p elevation resulted in decreased HMGB1 and LC3II levels and elevated p62 levels in the high-glucose condition, whereas miR-142-3p knockdown had the reverse effects, and metformin abolished those effects. Metformin inhibits high glucose–induced VSMC hyperproliferation and increased migration by inducing miR- 142-3p-mediated inhibition of HMGB1 expression via the HMGB1-autophagy related pathway. inhibition potentially effective theraputic approach to INTRODUCTION atherosclerosis. Arteriosclerosis obliterans (ASO) is a major cause of death and disability, particularly in patients with MicroRNAs affect gene expression, and their diabetes mellitus (DM) [1, 2]. This is because the dysregulation increases inflammation and leads to inflammation underlying atherosclerosis exacerbated by atherosclerosis [11–13]. Studies have shown that many hyperglycemic states [3]. High-mobility group box 1 microRNAs, including miR- 504, -200, -138 and -210, (HMGB1), is a crucial inflammatory factor in athero- regulate the proliferation and migration of VSMCs [3]. Furthermore, studies have determined that some sclerosis [4–6], and a danger signal for vascular disease microRNAs inhibit the expression of HMGB1 [14–16]. [7]. Abundant HMGB1 within carotid and coronary Thus inhibiting HMGB1 expression via microRNAs in atherosclerotic plaques [8] contributes to the abnormal VSMCs may be a therapeutic approach to reduce proliferation and migration of vascular smooth muscle atherothrombotic events. cells (VSMCs) [9, 10]. This makes HMGB1 www.aging-us.com 5352 AGING Metformin, which is used to treat type 2 DM, may that metformin at concentrations of 1, 5, and 10 mM suppress diabetes-accelerated atherosclerosis [17, 18] via significantly inhibited high glucose–induced VSMC AMPK-mediated inhibition of VSMC proliferation and hyperproliferation (Figure 1B). migration [19]. Metformin’s promotion of microRNA expression and anti-inflammatory effects also contribute Metformin inhibited high glucose-induced VSMC to this process [19–21]. In prior studies, metformin was migration via the HMGB1-autophagy related pathway found to inhibit the expression and release of HMGB1 [22, 23]. We therefore speculated that metformin may To further evaluate the effects of metformin on high inhibit high glucose–induced VSMC proliferation and glucose–induced VSMC behavior, a two dimensional migration via microRNA–mediated inhibition of scratch assay and three dimensional transwell assay were HMGB1 expression. To test that idea, VSMCs were performed. The results showed significant inhibition of isolated from the rat aorta and characterized by high glucose–induced cell migration when metformin was added to the assays. Metformin also resulted in fluorescence microscopy and subjected to a high-glucose environment and a series metformin concentrations (0-10 decreased cell migration under normal glucose condition mM). Our findings suggest metformin inhibits glucose- (Figure 2A, 2B). In addition, we also evaluated the induced VSMC hyperproliferation and migration by expression of HMGB1-autophagy related pathway inhibiting HMGB1 expression via the HMGB1- molecules and found that metformin treatment resulted in autophagy related pathway inhibition of the elevated HMGB1 and LC3II levels and the decreased p62 level found in the high-glucose condition. Similarly, the addition of metformin resulted RESULTS in decreased HMGB1 and LC3II levels and increased p62 level in the normal glucose condition (Figure 2C). Metformin inhibited high glucose–induced VSMC These results indicate that metformin rectifies high hyperplasia in a dose-dependent manner glucose–induced VSMC migration enhancement via the HMGB1-autophagy related pathway. To evaluate the effects of metformin on VSMCs in a high-glucose condition, we first isolated and Metformin inhibited HMGB1 expression by characterized the VSMC and confirmed the presence increasing miR-142-3p expression in VSMC of the VSMC marker α-SMA in these cells (Figure 1A). We then subjected the cells to a high-glucose To further clarify the regulatory network involved in the environment and examined the cell proliferation. effects of metformin on high glucose–induced VSMC Finally, metformin was added, and the results showed Figure 1. Metformin inhibited high glucose–induced vascular smooth muscle cell (VSMC) hyperplasia in a dose-dependent manner. (A) VSMC characterization by fluorescence microscopy. Expression of smooth muscle cell marker α-SMA was confirmed by red fluorescence. (B) CCK-8 evaluation of the effects of metformin on VSMC proliferation. Significant inhibition of high glucose–induced cell proliferation was found at metformin concentrations of 1, 5, and 10 mM. **p < 0.01 and ***p < 0.001 for between-group comparisons. www.aging-us.com 5353 AGING proliferation and migration, we performed gene To confirm that HMGB1 is regulated by miR-142-3p, expression analysis and correlation analysis between reporter assays were performed. Results showed that HMGB1, and miR-142-3p expression and metformin miR-142-3p mimics significantly reduced the concentration. A negative correlation was found expression of HMGB1 (Figure 3E). miR-142-3p was between HMGB1 gene level and metformin con- also shown to inhibit HMGB1 expression by directly centration (Figure 3A, 3B), and a positive correlation binding to its 3′-UTR segment. To confirm the ability was found between miR-142-3p level and metformin of miR-142-3p to suppress HMGB1 expression, concentration (Figure 3C, 3D). VSMCs were transfected with miR-142-3p mimics Figure 2. Metformin inhibited high glucose–induced vascular smooth muscle cell (VSMC) migration via HMGB1-autophagy related pathway. (A) Metformin inhibited high glucose–induced VSMC migration in a two dimensional scratch assay. Significant inhibition of cell migration was found when metformin was added in the high-glucose condition; in addition, metformin resulted in decreased cell migration in the normal glucose condition. (B) Metformin inhibited high glucose–induced VSMC migration in a three dimensional transwell assay. Significant inhibition of cell migration was found when metformin was added in the high-glucose condition; in addition, metformin resulted in decreased cell migration in the normal glucose condition. (C) The HMGB1-autophagy related pathway was involved in the effects of metformin on high glucose–induced cell migration. Metformin resulted in decreased HMGB1 and LC3II levels and increased the p62 level in the high-glucose condition. In addition, metformin resulted in decreased HMGB1 and p62 levels and increased LC3II level in the normal glucose condition. *p < 0.05, **p < 0.01 and ***p < 0.001 for between-group comparison. www.aging-us.com 5354 AGING and inhibitor (Figure 3F). The group containing miR- miR-142-3p overexpression by mimic and inhibition by 142-3p mimics displayed a robustly decreased siRNA result in inhibition and promotion, respectively HMGB1 protein level, whereas VSMCs in the group of high glucose–induced VSMCs migration via the with miR-142-3p inhibitor demonstrated an increased Akt/PI3K/autophagy related pathway HMGB1 protein level (Figure 3G, 3H). These results indicate that metformin decreases HMGB1 expression To further verify the role of miR-142-3p in high by promoting miR-142-3p in VSMCs. glucose–induced VSMC migration, miR-142-3p Figure 3. Metformin exerts effects on HMGB1 via affecting miR-142-3p in vascular smooth muscle cells (VSMCs). (A) Decreased HMGB1 gene expression in a metformin dose-dependent manner by quantitative real-time PCR. (B) Correlation analysis revealed that negative correlation was found between metformin concentration and HMGB1 gene expression. (C) Increased miR-142-3p expression in a metformin dose-dependent manner by quantitative real-time PCR. (D) Correlation analysis revealed that positive correlation was found between metformin concentration and miR-142-3p gene expression. (E) Decreased HMGB1 level was found in HMGB1-WT-3’’UTR + miR-142- 3p transfected VSMCs compared to HMGB1-WT-3’'UTR + control vector transfected VSMCs, whereas HMGB1 level was similar between HMGB1-MUT-3’’UTR + miR-142-3p transfected VSMCs and HMGB1- MUT -3’’UTR + control vector transfected VSMCs. (F) miR-142-3p overexpression and inhibition by mimics and siRNA resulted in decreased and increased HMGB1 gene expression in VSMCs, respectively. (G) miR-142-3p overexpression and inhibition by mimics and siRNA resulted in decreased and increased HMGB1 protein expression in VSMCs, respectively. (H) Relative quantification of HMGB1 level. **p < 0.01 and ***p < 0.001 for between group comparison. www.aging-us.com 5355 AGING overexpression and inhibition were induced by mimic 142-3p overexpression by mimic resulted in inhibition and siRNA transfection, respectively. We found that of HMGB1 and LC3II levels and elevated p62 level in miR-142-3p overexpression by mimic and inhibition by high glucose–induced VSMC migration enhancement. siRNA resulted in inhibition and promotion, However, miR-142-3p siRNA generated the reverse respectively, of high glucose–induced VSMC migration effects, and metformin abolished the effects of miR- via the HMGB1-autophagy related pathway. However, 142-3p siRNA (Figure 4C). These results confirm the metformin abolished the effects of miR-142-3p siRNA effects of miR-142-3p on the migration behavior of (Figure 4A, 4B). Further analysis revealed that miR- VSMCs in the high-glucose condition. Figure 4. miR-142-3p overexpression by mimic and miR-142-3p inhibition by siRNA resulted in inhibition and promotion, respectively, of high glucose–induced vascular smooth muscle cell (VSMC) migration enhancement via the HMGB1-autophagy related pathway, whereas metformin abolished the effects of miR-142-3p siRNA. (A) Scratch assay for the effects of miR-142-3p overexpression and inhibition. (B) Transwell assay for the effects of miR-142-3p overexpression and inhibition. (C) miR-142-3p overexpression by mimic results in decreased HMGB1 and LC3II and elevated p62 level in high glucose–induced VSMC migration enhancement, whereas miR-142- 3p siRNA caused the opposite effects and metformin abolished the effects of miR-142-3p siRNA. (D) Schematic of the role of metformin in the regulation of VSMC proliferation and migration. *p < 0.05, **p < 0.01 and ***p < 0.001 for between-group comparison. www.aging-us.com 5356 AGING model studies, of microRNAs involved in the regulation DISCUSSION of cell growth should be performed to clarify these issues. In conclusion, we demonstrated that metformin Abnormal proliferation and migration of VSMC, which inhibits high glucose–induced VSMC hyper- is enhanced by inflammation in hyperglycemic states, proliferation and migration enhancement by promoting contribute to the formation of atherosclerotic lesions [24]. miR-142-3p–mediated inhibition of HMGB1 expression According to previous studies, metformin attenuates via the autophagy pathway. early-stage atherosclerosis in mildly hyperglycemic Oikawa-Nagao mice [17]. This may be due to the inhibition of the inflammatory response and vascular MATERIALS AND METHODS calcification in VSMC by metformin [24, 25]. Metformin also inhibits proliferation of tumor and endothelial cells VSMC isolation and characterization [26, 27]. In our study, metformin decreased VSMC proliferation in the high-glucose condition. In addition, All research involving experimental animals was VSMC migration was also inhibited by metformin. approved by the Institutional Review Board of the Finally, increased miR-142-3p expression was shown to Drum Tower Hospital Affiliated to Medical School of inhibit VSMC proliferation and migration via the Nanjing University, Nanjing, China, and adhere to the HMGB1-autophagy related pathway (Figure 4D). international experiment guideline. VSMCs, obtained from the aortic artery, were cultured with DMEM HMGB1 is an inflammatory factor that increase VSMC containing 20% FBS at 37°C. Immunofluorescence with proliferation and high glucose–induced calcification in α-actin was carried out to identify the cells [43]. VSMC and subsequent vascular inflammation and atherosclerosis [4, 28, 29]. In addition, HMGB1 has Cell treatment been identified as an autophagy sensor in oxidative stress [30], and autophagy may regulate the expression VSMCs were grown to 70%-80% cell confluence and and release of HMGB1 [31]. However, increasing exposed to normal glucose (5.6 + 19.4 mmol/L mannitol) evidences indicates that HMGB1 is downregulated by or High Glucose (25 mmol/L) for 24 hours. Metformin metformin [23]. In our previous studies, we found that was added to the high glucose–treated cells. In the cell metformin induced autophagy by activating AMPK, proliferation assay, metformin was used at a serial resulting in decreased proliferation and migration of concentration of 1, 5, and 10 mM. The concentration of endothelial progenitor cells [32, 33]. In the present metformin in the cell migration assay was 5 mM. study, we also found that metformin inhibits the proliferation and migration of VSMC induced by CCK-8 assay for cell growth elevated glucose. This might be related to the autophagy pathway promoted by metformin. Trypsinized VSMCs (2 × 10 cells) were resuspended in complete VSMC medium and seeded in a 12-well plate It has been well demonstrated that many microRNAs and incubated with 0, 1, 5 and 10 mM of metformin in affect atherosclerosis by inhibiting cardiovascular the previously mentioned normal and high-glucose inflammation [13, 34]. MiR-142-3p, one of the novel conditions under 37°C, 5% CO . One day later, cell inflammation-related miRNAs [35], is significantly proliferation was evaluated by CCK-8 assay following upregulated by metformin [36]. It may inhibit cell the manufacturer’s instructions. At least triplicate proliferation and migration via the WNT signaling repeats were completed in all the experiments. pathway and autophagy [37–39]. In addition, miR-142- 3p may target HMGB1 in tumor cells [14, 40]. Wound healing assay Consistently, we found that miR-142-3p inhibited migration enhancement in high glucose–stimulated VSMCs were allowed to be grown to 80%-90% cell VSMC. These findings validate that miR-142-3p is confluence and treated with normal glucose or high involved in the regulation of abnormal VSMC glucose in the absence or presence of metformin. A proliferation and migration, which contribute to ASO scratch was made by a 200 µL pipette tip at 0 h and and in-stent restenosis. However, these findings incubated at 37°C, 5% CO . Pictures were taken using contradict some previous studies. For example, Bao et microscopy at 0 and 24 h for migration evaluation. al found that miR-142-3p promoted endothelial cell proliferation via Bcl-2–associated transcription factor 1 Transwell assay [41]. In addition, Wu et al found that miR-142-3p promoted the neuronal cell cycle and inhibited A modified transwell assay in 24-well plates was used for apoptosis after peripheral nerve injury [42]. Thus, cell migration evaluation (BD Biosciences, San Jose, CA, further investigation, especially the appropriate animal USA). After cell transfection for 24 h, cells were www.aging-us.com 5357 AGING Table 1. Primer sequence. Gene name Forward Reverse HMGB1 5′-AGCAATCTGAACGTCTGTCC-3′ 5′-GTTCTTGTGATAGCCTTCGC-3′ GAPDH 5′-GCGCTGAGTACGTCG-3′ 5′-CAGTTGGTGGTGCAG-3′ MiR-142-3p TGTAGTGTTTCCTACTTTATGGA U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT suspended with serum-free DMEM at a concentration of Relative microRNA expression was normalized to the 3 × 10 cells and added to the upper chamber, while the reference microRNA expression using the ΔΔCt lower chamber was filled with DMEM supplemented method. All primer sequences arelisted in Table 1. with 20% FBS as a chemoattractant. Then the transwell plate was incubated at 37°C for 24 h, and a cotton swab Western blot analysis was used to remove upper chamber residue cells. The transwell membrane close to the lower chamber was cut Cellar protein was extracted from VSMCs (1 × 10 by scissors, stained with crystal violet and photographed cells), as previously reported [44]. Briefly, the proteins by a microscope. The cells were then counted according were separated and then transferred. After blocking, to the pictures. membranes were incubated with HMGB1(Cell Signaling Technology [CST], Danvers, MA, USA), Cell transfection LC3II/I(CST), p62(CST), and Actin (Sigma, St. Louis, MO, USA). Appropriate secondary antibodies were miR-142-3p mimic, siRNA, and their negative controls used. The protein bands were detected using an Infrared were purchased from Thermo. miR-142-3p mimic (50 Imaging System (LI-COR). nM), siRNA (150 nM), and their negative controls were transfected, into VSMCs at 80% confluence using Statistical analysis Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 48 h All statistical analyses were performed using SPSS v21. of transfection, cells were harvested for subsequent Data are presented as mean ± SD. Student’s t test or experiments, and the expression of microRNA was one-way ANOVA was used to examine the differences confirmed by real-time reverse transcriptase quantitative between the groups. Correlations between HMGB-1 and polymerase chain reaction (RT-qPCR), described later. miR-142-3p levels and metformin concentration were analyzed using the Pearson correlation method. P < 0.05 Luciferase assay was considered as statistically significant. Luciferase reporter assay was performed, as previously CONFLICTS OF INTEREST described [44], to explore the potential regulation mechanisms of miR-142-3p. For the measurement of The authors confirm that there are no potential conflicts luciferase activity, cells were cotransfected in 24-well of interest. plates with 100 ng of luciferase plasmid and 50 ng of Renilla plasmid (Ambion) as a control, as well as with FUNDING 400 ng of miR-142-3p mimics or negative control microRNA. The luciferase and Renilla plasmid This work was supported by grants from the National activities were measured 48 h later using the Dual Natural Science Foundation of China (No. 81770483, Luciferase Reporter 1000 Assay System (Promega, 81800418), the Natural Science Foundation of Jiangsu Madison, WI, USA). Province (No. BK20180125), the Key Project supported by Medical Science and technology development RT-qPCR Foundation (No. YKK18063), Nanjing Department of Health, and the Fundamental Research Funds for the RT-qPCR was performed as previously reported Central Universities (No. 021414380362). [44, 45]. Briefly, total RNA was isolated from the VSMCs treated with the series of metformin REFERENCES concentration. Real-time PCR detection was performed when generation of cDNA for RT-qPCR was done. 1. Low Wang CC, Hess CN, Hiatt WR, Goldfine AB. Clinical GAPDH expression and U6 expression were used as Update: Cardiovascular Disease in Diabetes Mellitus: controls for HMGB1 and microRNA gene, respectively. www.aging-us.com 5358 AGING Atherosclerotic Cardiovascular Disease and Heart proliferate in response to high mobility group box 1 Failure in Type 2 Diabetes Mellitus - Mechanisms, protein. FASEB J. 2006; 20:2565–66. Management, and Clinical Considerations. Circulation. https://doi.org/10.1096/fj.06-5867fje PMID:17060403 2016; 133:2459–502. 10. Jang EJ, Baek SE, Kim EJ, Park SY, Kim CD. HMGB1 https://doi.org/10.1161/CIRCULATIONAHA.116.022194 enhances AGE-mediated VSMC proliferation via an PMID:27297342 increase in 5-LO-linked RAGE expression. Vascul Pharmacol. 2019; 118-119:106559. 2. Eckel RH, Hokanson JE. The Prediction of https://doi.org/10.1016/j.vph.2019.04.001 Atherosclerotic Cardiovascular Disease in Type 1 PMID:30954689 Diabetes Mellitus: Do We Just Stop Here? Circulation. 2016; 133:1051–53. 11. Nazari-Jahantigh M, Egea V, Schober A, Weber C. https://doi.org/10.1161/CIRCULATIONAHA.116.021654 MicroRNA-specific regulatory mechanisms in PMID:26888766 atherosclerosis. J Mol Cell Cardiol. 2015; 89:35–41. https://doi.org/10.1016/j.yjmcc.2014.10.021 3. Yuan T, Yang T, Chen H, Fu D, Hu Y, Wang J, Yuan Q, Yu PMID:25450610 H, Xu W, Xie X. New insights into oxidative stress and inflammation during diabetes mellitus-accelerated 12. Menghini R, Stöhr R, Federici M. MicroRNAs in vascular atherosclerosis. Redox Biol. 2019; 20:247–60. aging and atherosclerosis. Ageing Res Rev. 2014; https://doi.org/10.1016/j.redox.2018.09.025 17:68–78. https://doi.org/10.1016/j.arr.2014.03.005 PMID:30384259 PMID:24681293 4. de Souza AW, Westra J, Limburg PC, Bijl M, Kallenberg 13. Martens CR, Bansal SS, Accornero F. Cardiovascular CG. HMGB1 in vascular diseases: its role in vascular inflammation: RNA takes the lead. J Mol Cell Cardiol. inflammation and atherosclerosis. Autoimmun Rev. 2019; 129:247–56. 2012; 11:909–17. https://doi.org/10.1016/j.yjmcc.2019.03.012 https://doi.org/10.1016/j.autrev.2012.03.007 PMID:30880251 PMID:22495229 14. Liu K, Huang J, Ni J, Song D, Ding M, Wang J, Huang X, Li 5. Fan Z, Yang J, Yang J, Yang C, Guo X. HMGB1: A W. MALAT1 promotes osteosarcoma development by promising therapeutic approach for atherosclerosis. Int regulation of HMGB1 via miR-142-3p and miR-129-5p. J Cardiol. 2016; 202:507–08. Cell Cycle. 2017; 16:578–87. https://doi.org/10.1016/j.ijcard.2015.09.101 https://doi.org/10.1080/15384101.2017.1288324 PMID:26440462 PMID:28346809 6. Cai J, Wen J, Bauer E, Zhong H, Yuan H, Chen AF. The 15. Dormoy-Raclet V, Cammas A, Celona B, Lian XJ, van der Role of HMGB1 in Cardiovascular Biology: danger Giessen K, Zivojnovic M, Brunelli S, Riuzzi F, Sorci G, Signals. Antioxid Redox Signal. 2015; 23:1351–69. Wilhelm BT, Di Marco S, Donato R, Bianchi ME, Gallouzi https://doi.org/10.1089/ars.2015.6408 IE. HuR and miR-1192 regulate myogenesis by PMID:26066838 modulating the translation of HMGB1 mRNA. Nat Commun. 2013; 4:2388. 7. Yan XX, Lu L, Peng WH, Wang LJ, Zhang Q, Zhang RY, https://doi.org/10.1038/ncomms3388 PMID:24005720 Chen QJ, Shen WF. Increased serum HMGB1 level is associated with coronary artery disease in nondiabetic 16. Zhan LY, Lei SQ, Zhang BH, Li WL, Wang HX, Zhao B, Cui and type 2 diabetic patients. Atherosclerosis. 2009; SS, Ding H, Huang QM. Overexpression of miR-381 205:544–48. relieves neuropathic pain development via targeting https://doi.org/10.1016/j.atherosclerosis.2008.12.016 HMGB1 and CXCR4. Biomed Pharmacother. 2018; PMID:19150066 107:818–23. https://doi.org/10.1016/j.biopha.2018.08.053 8. Inoue K, Kawahara K, Biswas KK, Ando K, Mitsudo K, PMID:30142543 Nobuyoshi M, Maruyama I. HMGB1 expression by activated vascular smooth muscle cells in advanced 17. Asai A, Shuto Y, Nagao M, Kawahara M, Miyazawa T, human atherosclerosis plaques. Cardiovasc Pathol. Sugihara H, Oikawa S. Metformin Attenuates Early- 2007; 16:136–43. Stage Atherosclerosis in Mildly Hyperglycemic Oikawa- https://doi.org/10.1016/j.carpath.2006.11.006 Nagao Mice. J Atheroscler Thromb. 2019; 26:1075–83. PMID:17502242 https://doi.org/10.5551/jat.48223 PMID:30971640 9. Porto A, Palumbo R, Pieroni M, Aprigliano G, Chiesa R, 18. Wang Q, Zhang M, Torres G, Wu S, Ouyang C, Xie Z, Sanvito F, Maseri A, Bianchi ME, Porto A, Palumbo R, Zou MH. Metformin Suppresses Diabetes-Accelerated Pieroni M, Aprigliano G, Chiesa R, et al. Smooth muscle Atherosclerosis via the Inhibition of Drp1-Mediated cells in human atherosclerotic plaques secrete and Mitochondrial Fission. Diabetes. 2017; 66:193–205. www.aging-us.com 5359 AGING https://doi.org/10.2337/db16-0915 Proliferation and Apoptosis Through AMPK/CREB/BDNF PMID:27737949 Pathway. Front Pharmacol. 2018; 9:1266. https://doi.org/10.3389/fphar.2018.01266 19. Luo F, Das A, Chen J, Wu P, Li X, Fang Z. Metformin in PMID:30459620 patients with and without diabetes: a paradigm shift in cardiovascular disease management. Cardiovasc 28. Yang J, Chen L, Ding J, Fan Z, Li S, Wu H, Zhang J, Yang Diabetol. 2019; 18:54. C, Wang H, Zeng P, Yang J. MicroRNA-24 inhibits high https://doi.org/10.1186/s12933-019-0860-y glucose-induced vascular smooth muscle cell PMID:31029144 proliferation and migration by targeting HMGB1. Gene. 2016; 586:268–73. 20. Zhou JY, Xu B, Li L. A New Role for an Old Drug: https://doi.org/10.1016/j.gene.2016.04.027 Metformin Targets MicroRNAs in Treating Diabetes PMID:27085480 and Cancer. Drug Dev Res. 2015; 76:263–69. https://doi.org/10.1002/ddr.21265 29. Wang Y, Shan J, Yang W, Zheng H, Xue S. High mobility PMID:26936407 group box 1 (HMGB1) mediates high-glucose-induced calcification in vascular smooth muscle cells of 21. Pulito C, Donzelli S, Muti P, Puzzo L, Strano S, Blandino saphenous veins. Inflammation. 2013; 36:1592–604. G. microRNAs and cancer metabolism reprogramming: https://doi.org/10.1007/s10753-013-9704-1 the paradigm of metformin. Ann Transl Med. 2014; 2:58. PMID:23928875 https://doi.org/10.3978/j.issn.2305-5839.2014.06.03 PMID:25333033 30. Kang R, Livesey KM, Zeh HJ 3rd, Lotze MT, Tang D. HMGB1 as an autophagy sensor in oxidative stress. 22. Tsoyi K, Jang HJ, Nizamutdinova IT, Kim YM, Lee YS, Autophagy. 2011; 7:904–06. Kim HJ, Seo HG, Lee JH, Chang KC. Metformin inhibits https://doi.org/10.4161/auto.7.8.15704 HMGB1 release in LPS-treated RAW 264.7 cells and PMID:21487246 increases survival rate of endotoxaemic mice. Br J Pharmacol. 2011; 162:1498–508. 31. Thorburn J, Frankel AE, Thorburn A. Regulation of https://doi.org/10.1111/j.1476-5381.2010.01126.x HMGB1 release by autophagy. Autophagy. 2009; PMID:21091653 5:247–49. https://doi.org/10.4161/auto.5.2.7552 23. Huang WS, Lin CT, Chen CN, Chang SF, Chang HI, Lee PMID:19098461 KC. Metformin increases the cytotoxicity of oxaliplatin in human DLD-1 colorectal cancer cells through down- 32. Li WD, Li NP, Song DD, Rong JJ, Qian AM, Li XQ. regulating HMGB1 expression. J Cell Biochem. 2018; Metformin inhibits endothelial progenitor cell 119:6943–52. https://doi.org/10.1002/jcb.26898 migration by decreasing matrix metalloproteinases, PMID:29737584 MMP-2 and MMP-9, via the AMPK/mTOR/autophagy pathway. Int J Mol Med. 2017; 39:1262–68. 24. Kim SA, Choi HC. Metformin inhibits inflammatory https://doi.org/10.3892/ijmm.2017.2929 response via AMPK-PTEN pathway in vascular smooth PMID:28339020 muscle cells. Biochem Biophys Res Commun. 2012; 425:866–72. 33. Li WD, Du XL, Qian AM, Hu N, Kong LS, Wei S, Li CL, Li https://doi.org/10.1016/j.bbrc.2012.07.165 XQ. Metformin regulates differentiation of bone PMID:22898050 marrow-derived endothelial progenitor cells via multiple mechanisms. Biochem Biophys Res Commun. 25. Cao X, Li H, Tao H, Wu N, Yu L, Zhang D, Lu X, Zhu J, Lu Z, 2015; 465:803–09. Zhu Q. Metformin inhibits vascular calcification in https://doi.org/10.1016/j.bbrc.2015.08.091 female rat aortic smooth muscle cells via the AMPK- PMID:26319555 eNOS-NO pathway. Endocrinology. 2013; 154:3680–89. https://doi.org/10.1210/en.2013-1002 34. Laffont B, Rayner KJ. MicroRNAs in the Pathobiology PMID:24025223 and Therapy of Atherosclerosis. Can J Cardiol. 2017; 33:313–24. https://doi.org/10.1016/j.cjca.2017.01.001 26. Shao X, Cao X, Song G, Zhao Y, Shi B. Metformin PMID:28232017 rescues the MG63 osteoblasts against the effect of high glucose on proliferation. J Diabetes Res. 2014; 35. Boomiraj H, Mohankumar V, Lalitha P, Devarajan B. 2014:453940. Human corneal microRNA expression profile in fungal https://doi.org/10.1155/2014/453940 keratitis. Invest Ophthalmol Vis Sci. 2015; 56:7939–46. PMID:24812633 https://doi.org/10.1167/iovs.15-17619 PMID:26720440 27. Han X, Wang B, Sun Y, Huang J, Wang X, Ma W, Zhu Y, Xu R, Jin H, Liu N. Metformin Modulates High Glucose- 36. Xia C, Liang S, He Z, Zhu X, Chen R, Chen J. Metformin, Incubated Human Umbilical Vein Endothelial Cells a first-line drug for type 2 diabetes mellitus, disrupts www.aging-us.com 5360 AGING the MALAT1/miR-142-3p sponge to decrease invasion 41. Bao H, Chen YX, Huang K, Zhuang F, Bao M, Han Y, Chen and migration in cervical cancer cells. Eur J Pharmacol. XH, Shi Q, Yao QP, Qi YX. Platelet-derived microparticles 2018; 830:59–67. promote endothelial cell proliferation in hypertension https://doi.org/10.1016/j.ejphar.2018.04.027 via miR-142-3p. FASEB J. 2018; 32:3912–23. PMID:29704494 https://doi.org/10.1096/fj.201701073R PMID:29481306 37. Kim K, Yang DK, Kim S, Kang H. miR-142-3p Is a Regulator of the TGFβ-Mediated Vascular Smooth 42. Wu DM, Wen X, Han XR, Wang S, Wang YJ, Shen M, Muscle Cell Phenotype. J Cell Biochem. 2015; Fan SH, Zhuang J, Zhang ZF, Shan Q, Li MQ, Hu B, Sun 116:2325–33. CH, et al. MiR-142-3p Enhances Cell Viability and https://doi.org/10.1002/jcb.25183 Inhibits Apoptosis by Targeting CDKN1B and TIMP3 PMID:25832008 Following Sciatic Nerve Injury. Cell Physiol Biochem. 2018; 46:2347–57. 38. Carraro G, Shrestha A, Rostkovius J, Contreras A, Chao https://doi.org/10.1159/000489626 CM, El Agha E, Mackenzie B, Dilai S, Guidolin D, Taketo PMID:29742504 MM, Günther A, Kumar ME, Seeger W, et al. miR-142- 3p balances proliferation and differentiation of 43. Sun J, Marx SO, Chen HJ, Poon M, Marks AR, Rabbani mesenchymal cells during lung development. LE. Role for p27(Kip1) in Vascular Smooth Muscle Cell Development. 2014; 141:1272–81. Migration. Circulation. 2001; 103:2967–72. https://doi.org/10.1242/dev.105908 https://doi.org/10.1161/01.CIR.103.24.2967 PMID:24553287 PMID:11413088 39. Zhai Z, Wu F, Dong F, Chuang AY, Messer JS, Boone DL, 44. Li WD, Zhou DM, Sun LL, Xiao L, Liu Z, Zhou M, Wang Kwon JH. Human autophagy gene ATG16L1 is post- WB, Li XQ. LncRNA WTAPP1 Promotes Migration and transcriptionally regulated by MIR142-3p. Autophagy. Angiogenesis of Endothelial Progenitor Cells via MMP1 2014; 10:468–79. https://doi.org/10.4161/auto.27553 Through MicroRNA 3120 and Akt/PI3K/Autophagy PMID:24401604 Pathways. Stem Cells. 2018; 36:1863–74. https://doi.org/10.1002/stem.2904 PMID:30171660 40. Fu Y, Sun LQ, Huang Y, Quan J, Hu X, Tang D, Kang R, Li N, Fan XG. miR-142-3p Inhibits the Metastasis of 45. Livak KJ, Schmittgen TD. Analysis of relative gene Hepatocellular Carcinoma Cells by Regulating HMGB1 expression data using real-time quantitative PCR and Gene Expression. Curr Mol Med. 2018; 18:135–41. the 2(-Delta Delta C(T)) Method. Methods. 2001; https://doi.org/10.2174/1566524018666180907161124 25:402–08. https://doi.org/10.1006/meth.2001.1262 PMID:30198432 PMID:11846609 www.aging-us.com 5361 AGING

Journal

Aging (Albany NY)Pubmed Central

Published: Mar 24, 2020

References

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create folders to
organize your research

Export folders, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off