Access the full text.
Sign up today, get DeepDyve free for 14 days.
Y. Ueda, M. Hijikata, S. Takagi, T. Chiba, K. Shimotohno (1999)
New p73 variants with altered C-terminal structures have varied transcriptional activitiesOncogene, 18
Gang Liu, Xinbin Chen (2005)
The C-terminal Sterile α Motif and the Extreme C Terminus Regulate the Transcriptional Activity of the α Isoform of p73*Journal of Biological Chemistry, 280
A. Zaika, M. Irwin, C. Sansome, U. Moll (2001)
Oncogenes Induce and Activate Endogenous p73 Protein*The Journal of Biological Chemistry, 276
Chang-Woo Lee, N. Thangue (1999)
Promoter specificity and stability control of the p53-related protein p73Oncogene, 18
Gang Liu, Xinbin Chen (2005)
The C-terminal sterile alpha motif and the extreme C terminus regulate the transcriptional activity of the alpha isoform of p73.The Journal of biological chemistry, 280 20
C. Jost, M. Marin, W. Kaelin (1997)
p73 is a human p53-related protein that can induce apoptosisNature, 389
Seung‐Mo Hong, HyungJun Cho, C. Moskaluk, E. Yu, A. Zaika (2007)
p63 and p73 expression in extrahepatic bile duct carcinoma and their clinical significanceJournal of Molecular Histology, 38
M. Irwin, K. Kondo, M. Marin, Lynn Cheng, W. Hahn, W. Kaelin (2003)
Chemosensitivity linked to p73 function.Cancer cell, 3 4
W. Toh, S. Kyo, K. Sabapathy (2005)
Relief of p53-mediated Telomerase Suppression by p73*Journal of Biological Chemistry, 280
W. Wang, M. Bycroft, N. Foster, A. Buckle, A. Fersht, Yu Chen (2001)
Structure of the C-terminal sterile α-motif (SAM) domain of human p73αActa Crystallographica Section D-biological Crystallography, 57
S. Kovalev, Natalia Marchenko, Steve Swendeman, Michael LaQuaglia, Ute Moll (1998)
Expression level, allelic origin, and mutation analysis of the p73 gene in neuroblastoma tumors and cell lines.Cell growth & differentiation : the molecular biology journal of the American Association for Cancer Research, 9 11
C. Pozniak, S. Radinovic, A. Yang, F. McKeon, D. Kaplan, F. Miller (2000)
An anti-apoptotic role for the p53 family member, p73, during developmental neuron death.Science, 289 5477
W. Wang, M. Bycroft, N. Foster, A. Buckle, A. Fersht, Y. Chen (2001)
Structure of the C-terminal sterile alpha-motif (SAM) domain of human p73 alpha.Acta crystallographica. Section D, Biological crystallography, 57 Pt 4
A. Zaika, W. El-Rifai (2006)
The role of p53 protein family in gastrointestinal malignanciesCell Death and Differentiation, 13
T. Stiewe, Sonja Zimmermann, A. Frilling, H. Esche, B. Pützer (2002)
Transactivation-deficient ΔTA-p73 Acts as an OncogeneCancer Research, 62
Gang Liu, S. Nozell, Hui Xiao, Xinbin Chen (2004)
DeltaNp73beta is active in transactivation and growth suppression.Molecular and cellular biology, 24 2
T. Stiewe, Sonja Zimmermann, A. Frilling, H. Esche, B. Pützer (2002)
Transactivation-deficient DeltaTA-p73 acts as an oncogene.Cancer research, 62 13
Anna Lee, Daniel Ho, P. Zanassi, G. Walsh, D. Kaplan, F. Miller (2004)
Evidence That ΔNp73 Promotes Neuronal Survival by p53-Dependent and p53-Independent MechanismsThe Journal of Neuroscience, 24
F. Vikhanskaya, W. Toh, I. Dulloo, Qiang Wu, Lakshmanane Boominathan, H. Ng, K. Vousden, K. Sabapathy (2007)
p73 supports cellular growth through c-Jun-dependent AP-1 transactivationNature Cell Biology, 9
N. Kartasheva, Claudia Lenz-Bauer, O. Hartmann, H. Schäfer, M. Eilers, M. Dobbelstein (2003)
ΔNp73 can modulate the expression of various genes in a p53-independent fashionOncogene, 22
Gang Liu, S. Nozell, Hui Xiao, Xinbin Chen (2004)
ΔNp73β Is Active in Transactivation and Growth SuppressionMolecular and Cellular Biology, 24
L. Wang, M. Miura, L. Bergeron, Hong Zhu, Junying Yuan (1994)
Ich-1, an Ice/ced-3-related gene, encodes both positive and negative regulators of programmed cell deathCell, 78
A. Ito, T. Uehara, Yasuyuki Nomura (2000)
Isolation of Ich‐1S (caspase‐2S)‐binding protein that partially inhibits caspase activityFEBS Letters, 470
A. Zaika, S. Kovalev, N. Marchenko, U. Moll (1999)
Overexpression of the wild type p73 gene in breast cancer tissues and cell lines.Cancer research, 59 13
N. Concin, Kirsten Becker, N. Slade, S. Erster, E. Mueller-Holzner, H. Ulmer, G. Daxenbichler, A. Zeimet, R. Zeillinger, C. Marth, U. Moll (2004)
Transdominant ΔTAp73 Isoforms Are Frequently Up-regulated in Ovarian Cancer. Evidence for Their Role as Epigenetic p53 Inhibitors in VivoCancer Research, 64
Sharad Kumar, Makoto Kinoshita, Makoto Noda, N. Copeland, N. Jenkins (1994)
Induction of apoptosis by the mouse Nedd2 gene, which encodes a protein similar to the product of the Caenorhabditis elegans cell death gene ced-3 and the mammalian IL-1 beta-converting enzyme.Genes & development, 8 14
A. Yang, N. Walker, R. Bronson, M. Kaghad, M. Oosterwegel, J. Bonnin, C. Vagner, Hélène Bonnet, P. Dikkes, A. Sharpe, F. McKeon, D. Caput (2000)
p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumoursNature, 404
E. Logette, A. Wotawa, S. Solier, L. Desoche, E. Solary, L. Corcos (2003)
The human caspase-2 gene: alternative promoters, pre-mRNA splicing and AUG usage direct isoform-specific expressionOncogene, 22
K. Tomkova, A. Belkhiri, W. El-Rifai, A. Zaika (2004)
p73 Isoforms Can Induce T-Cell Factor–Dependent Transcription in Gastrointestinal CellsCancer Research, 64
G. Melino, V. Laurenzi, K. Vousden (2002)
p73: Friend or foe in tumorigenesisNature Reviews Cancer, 2
S. Ishii, J. Kadonaga, R. Tjian, J. Brady, G. Merlino, I. Pastan (1986)
Binding of the Sp1 transcription factor by the human Harvey ras1 proto-oncogene promoter.Science, 232 4756
C. Jost, M. Marin, W. Kaelin (1997)
p73 is a simian [correction of human] p53-related protein that can induce apoptosis.Nature, 389 6647
W. Jacobs, D. Kaplan, F. Miller (2006)
The p53 family in nervous system development and diseaseJournal of Neurochemistry, 97
M. Kaghad, Hélène Bonnet, A. Yang, L. Créancier, Jean-Christophe Biscan, A. Valent, A. Minty, P. Chalon, J. Lelias, X. Dumont, P. Ferrara, F. McKeon, D. Caput (1997)
Monoallelically Expressed Gene Related to p53 at 1p36, a Region Frequently Deleted in Neuroblastoma and Other Human CancersCell, 90
E. Flores, K. Tsai, D. Crowley, Shomit Sengupta, A. Yang, F. McKeon, T. Jacks (2002)
p63 and p73 are required for p53-dependent apoptosis in response to DNA damageNature, 416
J. Kadonaga, K. Carner, F. Masiarz, R. Tjian (1987)
Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domainCell, 51
S. Ramadan, A. Terrinoni, M. Catani, A. Sayan, R. Knight, Martin Mueller, P. Krammer, G. Melino, E. Candi (2005)
p73 induces apoptosis by different mechanisms.Biochemical and biophysical research communications, 331 3
E. Flores, Shomit Sengupta, John Miller, J. Newman, R. Bronson, D. Crowley, A. Yang, F. McKeon, T. Jacks (2005)
Tumor predisposition in mice mutant for p63 and p73: evidence for broader tumor suppressor functions for the p53 family.Cancer cell, 7 4
K. Tomkova, W. El-Rifai, A. Vilgelm, M. Kelly, T. Wang, A. Zaika (2006)
The gastrin gene promoter is regulated by p73 isoforms in tumor cellsOncogene, 25
T. Stiewe, C. Theseling, B. Pützer (2002)
Transactivation-deficient Delta TA-p73 inhibits p53 by direct competition for DNA binding: implications for tumorigenesis.The Journal of biological chemistry, 277 16
K. Becker, P. Pančoška, N. Concin, Kelly Heuvel, N. Slade, M. Fischer, E. Chalas, U. Moll (2006)
Patterns of p73 N-terminal isoform expression and p53 status have prognostic value in gynecological cancers.International journal of oncology, 29 4
S. Solier, E. Logette, L. Desoche, E. Solary, L. Corcos (2005)
Nonsense-mediated mRNA decay among human caspases: the caspase-2S putative protein is encoded by an extremely short-lived mRNACell Death and Differentiation, 12
Yigong Shi (2002)
Mechanisms of caspase activation and inhibition during apoptosis.Molecular cell, 9 3
4498–4509 Nucleic Acids Research, 2008, Vol. 36, No. 13 Published online 8 July 2008 doi:10.1093/nar/gkn414 TAp73b and DNp73b activate the expression of the pro-survival caspase-2 1 2 3 1,4,5, Wen Hong Toh , Emmanuelle Logette , Laurent Corcos and Kanaga Sabapathy * Division of Cellular & Molecular Research, Humphrey Oei Institute of Cancer Research, National Cancer Centre, 11, Hospital Drive, Singapore 169610, Singapore, Institute of Biochemistry, Chemin des Boveresses, 155, ´ ´ CH-1066 Epalinges, Switzerland, INSERM U613/EA948, Faculte de Medecine, 22, Avenue Camille Desmoulins, 29238 Brest Cedex 3, France, Cancer and Stem Cell Biology Program, Duke-NUS Graduate Medical School, 2 Jalan Bukit Merah, Singapore 169547 and Department of Biochemistry, National University of Singapore, 8, Medical Drive, Singapore 117597, Singapore Received April 16, 2008; Revised and Accepted June 13, 2008 INTRODUCTION ABSTRACT p73 is a member of the p53 family of transcription factors, p73, the p53 homologue, exists as a transactivation- existing as numerous NH - and COOH-terminal isoforms domain-proficient TAp73 or deficient deltaN(DN)p73 (1,2) The NH -terminal variant, known as the deltaNp73 form. Expectedly, the oncogenic DNp73 that is cap- (DNp73), is generated from an internal intronic promoter able of inactivating both TAp73 and p53 function, is and lacks the NH -terminal transactivation (TA) domain, over-expressed in cancers. However, the role of and hence, has been suggested to bind to and counter the TAp73, which exhibits tumour-suppressive proper- tumour-suppressive properties of the TA proficient full- ties in gain or loss of function models, in human length TAp73 forms (3,4). However, some reports have cancers where it is hyper-expressed is unclear. We suggested that DNp73 have some ability to transactivate demonstrate here that both TAp73 and DNp73 are target genes due to the presence of a second TA domain, able to specifically transactivate the expression of which includes the PxxP motif (5). The COOH-terminal the anti-apoptotic member of the caspase family, variants arise due to alternate splicing resulting in multiple isoforms that exhibit varying degrees of TApotential (6,7). caspase-2 . Neither p53 nor TAp63 has this proper- The longest isoform, the TAp73a, generally shows weaker ty, and only the p73b form, but not the p73a form, activity than TAp73b and TAp73g that exhibit stronger has this competency. Caspase-2 promoter anal- TA potential (7,8). Hitherto, it has been classically ysis revealed that a non-canonical, 18 bp GC-rich thought that the TAp73 forms primarily function as Sp-1-binding site-containing region is essential for tumour suppressors, albeit weaker than p53 itself, whereas p73b-mediated activation. However, mutating the the DNp73 forms act as oncogenes, as has been demon- Sp-1-binding site or silencing Sp-1 expression did strated by genetic, over-expression and other in vitro stu- not affect p73b’s transactivation ability. In vitro dies (3,9,10). DNA binding and in vivo chromatin immunoprecipi- However, clinical reports analysing p73 expression pro- tation assays indicated that p73b is capable of file have highlighted a complicating scenario. Not only are the DNp73 forms over-expressed as expected, but also the directly binding to this region, and consistently, TAp73 forms are over-expressed in a multitude of human DNA binding p73 mutant was unable to transactivate cancers (6,11–17). It was shown that one-third of tumours caspase-2 . Finally, DNp73b over-expression in neu- that over-express DNp73 forms also exhibited concomi- roblastoma cells led to resistance to cell death, and tant up-regulation of the antagonistic TAp73 (12). concomitantly to elevated levels of caspase-2 S. Although co-over-expression of DNp73 with TAp73 Silencing p73 expression in these cells led to reduc- may nullify the tumour-suppressive properties of the tion of caspase-2 expression and increased cell latter in human tumours, it is still unclear why there is a death. Together, the data identifies caspase-2 as need for TAp73 forms to be over-expressed at all. Recent a novel transcriptional target common to both data from others and us have provided evidence for a role TAp73 and DNp73, and raises the possibility that for TAp73 in supporting cellular growth, and hence, in TAp73 may be over-expressed in cancers to pro- tumour development. Ectopic expression of TAp73 was mote survival. shown to support cellular survival under defined *To whom correspondence should be addressed. Tel: +65 6436 8349; Fax: +65 6226 5694; Email: cmrksb@nccs.com.sg 2008 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2008, Vol. 36, No. 13 4499 conditions, and conversely, absence of p73 led to reduced dependent on a unique 18-bp p73b-recognition sequence proliferation, through the regulation of AP-1 activity (18). on the caspase-2 promoter to which both TA73b and Consistently, TAp73 expression was also found to lead to DN73b bind directly in vivo and in vitro. Consistently, the activation of the promoter of gastrin, a peptide hor- over-expression of DN73b in neuroblastoma cells led to mone that is important in determining the progression of a elevated levels of caspase-2 expression and these cells number of human malignancies, and a strong correlation were resistant to cell death induced by several means. was noted between gastrin and TAp73 levels in gastric The data together identify caspase-2 as a novel target cancers (19). In addition, over-expression of both TAp73 of both TA73b and DN73b isoforms, suggesting a role and DNp73 seen in upper gastrointestinal carcinomas cor- for them in promoting cellular survival. related with TCF-dependent transcriptional activation and the up-regulation of b-catenin in gastrointestinal MATERIALS AND METHODS cells, implying a tumour-promoting role for combined expression of TAp73 and DNp73 (20). Finally, TAp73 Cells, plasmids and transfections was seen to negate p53-mediated suppression of human The p53 null H1299 cells and Saos-2 cells inducibly expres- telomerase expression, suggesting a contributory role for sing TAp73b have been described (18). SH-SY5Y neuro- TAp73 in carcinogenesis (21). These data therefore suggest blastoma cells were transfected with pcDNA or DNp73b that TAp73 forms may support cellular survival, besides and selected on G418 to generate stable transfectants. their classical roles as tumour suppressors, though the Saos2-TAp73b inducible cells were maintained in exact context in which these properties are exhibited is DMEM supplemented with 10% tetracycline free FBS, unclear. and TAp73b was induced by addition of 2mM doxocycline Nevertheless, as with p53, p73 forms have also been prior to harvesting at the indicated time points. shown to regulate apoptosis, a critical process suppressing The 2 10 cells (in 6-well dishes) were used for trans- tumourigenesis. TAp73 has been shown to induce the fection experiments using Lipofectamine PLUS-Reagent expression of genes like puma and scotin amongst others according to manufacturer’s instructions (Invitrogen, (22), and absence of the anti-apoptotic DNp73 was shown Carlsbad, CA, USA). H1299 cells were transiently trans- to lead to massive apoptosis in the developing mouse brain fected with various plasmids, and collected 36 or 24 h later (23). However, whether the core component of the apo- for RT–PCR or luciferase analysis, respectively. siRNA ptotic machinery—the proteolytic system involving a was transfected at 3mg per well using RNAifect (Qiagen, family of proteases known as caspases (24)—is regulated Valencia, CA, USA), as per manufacturer’s protocols. by p73 members is unclear. There are 14 members in the The pCDNA3-based expression plasmids for p53, caspase family, which can be generally grouped into two TAp63a, TAp63b, TAp73a, TAp73b, TAp73b-292, main groups according to their functions: those involved DNp73b and DNp73b-292 have been described (21). in cytokine processing (caspase-1, -4, -5, -11 to -14) and TAp63a and TAp63b expression plasmids are gifts from those in apoptosis (caspase-2, -3, -6 to -10) (25). Of the Dr Giovanni Blandino (Regina Elena Cancer Institute, apoptotic caspases studied, the function and regulation of Rome) and Dr Massimo Broggini (Mario Negri Institute, caspase-2, -8 and -9 have been the best characterized. Of Milan). The Sp-1 cDNA was a gift from Dr Robert Tjian these, caspase-2 is interesting as it exists as two distinct (University of California, Berkerly, USA) (29). PCM2, isoforms with opposing functions: the long caspase-2 Del1, Del2, Del3 and Del4 caspase-2 promoter-luciferase form induces cell death, while the short caspase-2 isoform constructs have been described (28). Site-directed mutagen- inhibits cell death upon over-expression (26,27). The esis was performed as per manufacturer’s instructions dominant caspase-2 form is expressed in most tissues, (Stratagene, La Jolla, CA, USA) using the Del4 promoter whereas caspase-2 is preferentially expressed in brain to generate Del4 truncations Del4.1, Del4.2 and Del4.3 by and skeletal muscles (27). The two mRNAs differ at 0 PCR cloning, using primers as follows: Del4.1-for: 5 AA their 5 -end, suggesting the existence of distinct transcrip- 0 AAGGTACCAGCCTGACTCCGCGCAAGG3 , Del4.2- tional start sites (28). The 5 RT–RACE and RNase pro- for: 5 AAAAGGTACCTCCTTATGAGGGAAACTAT tection assays showed that the main transcription start site 0 0 AA3 , Del4.3-for: 5 AAAAGGTACCGTCTCTCGTGG of caspase-2 differs from the transcription start site of GAAAAGACTGGC3 and a common reverse primer caspase-2 . Caspase-2 transcription initiates within L S Del4-rev: 5 ACTTAGATCGCAGATCTCGAGTCGAT intron 1 of the caspase-2 gene and the presence of a AC3 . Sp-1 siRNA was purchased from Santa Cruz Bio- TATA box in caspase-2 promoter suggest that under spe- technology Inc (Santa Cruz, CA, USA), and p73 and the cific conditions, caspase-2 expression can be up-regulated control siRNA were purchased from Qiagen. The sequence (28). In addition, caspase-2 isoform is produced 0 of p73 siRNA is as follows: 5 - - - AAGGCAATAATCT by the insertion of a 61-bp exon at the 3 -end of the CTCGCAGT - - -3 , and targets both TAp73 and DNp73 caspase-2 pre-mRNA, which introduces a premature forms. stop codon (27). Since TAp73 appears to regulate both apoptosis and Cell death assays also support cellular survival, we explored the possibility that it would differentially regulate caspase expression. SH-SY5Y cells stably expressing pCDNA or DNp73b Interestingly, we found that both TA73b and DN73b iso- were seeded in triplicates in 6-well plates and serum- forms were able to induce the expression of caspase-2 , starved in serum-free DMEM for indicated time periods but not of the other caspases tested. This induction is before harvesting for sub-G1 analysis. Cells were fixed in 4500 Nucleic Acids Research, 2008, Vol. 36, No. 13 70% ethanol overnight, washed twice with cold PBS, treat- (pH 6.8, 10 mM NaCl, 1.5 mM MgCl , 1 mM EGTA, ed with RNase A for 20 min before addition of 5mg/ml PI 5 mM dithiothreitol, 10% glycerol, 10 mM MOPS), at and analysed by BD Biosciences FACScalibur (Mountain 10 min interval. Cells were then lysed for 30 min using View, CA, USA). Similarly, cells were treated with 20mM 4 ml KM buffer + 1% NP40 + protease inhibitors at 48C cisplatin for 24 h or serum-starved for 48 h, and analysed and further incubated in 2.7 ml 5 M NaCl for 60 min at for cell viability by their ability to exclude propidium 48C. Lysates were collected with TE buffer and sonicated iodide, by flow cytometry. For siRNA experiments, with VCX130PB (Jencons, Bridgeville, PA, USA) five siRNA was transfected 24 h prior to serum-starvation for times for 10 s each, with about 10 min intervals on ice, a further 48 h before analysis of cell death. centrifuged at 13 000 r.p.m. at 48C for 30 min and super- natant was collected. A total of 400ml of supernatant was Luciferase assays used for immunoprecipitation with 10ml of anti-p73 (ER15) or anti-HA (Santa Cruz) antibodies for 2 h at H1299 cells were transiently transfected with 0.2mgof 48C. 1ml of Dynabeads Protein A and G (Invitrogen) the various plasmids along with indicated caspase-2 pro- were added for a further 2 h. Immune complexes were moter–reporter constructs and b-galactosidase construct then washed with 2 RIPA buffer, 1 HS buffer (0.1% to normalize for transfection efficiency. Luciferase assays SDS, 1% Triton-X, 2 mM EDTA, 20 mM Tris–HCl, pH were performed as described (21). 8, 500 mM NaCl), 1 LS buffer (0.1% SDS, 1% Triton-X, 2 mM EDTA, 20 mM Tris–HCl, pH 8, 150 mM NaCl), RNA analysis 1 0.25 M LiCl buffer, 1 0.5 M LiCl buffer at 378C for Total RNA was prepared from cells using TRIzol reagent 10 min, followed by 2 RIPA buffer, 2 TE buffer. DNA/ (Invitrogen) as per manufacturer’s instructions. Semi- protein complex was eluted with 100ml of TE buffer con- quantitative RT–PCR was performed using TAp73 taining 1% SDS and was then reverse cross-linked by (32 cycles), TAp63 (30), caspase-2 (33), caspase-2 (33), L S 200 mM NaCl at 658C for 4 h, followed by proteinase caspase-8 (30), caspase-9 (30), MDM2 (30), DNp73 (34) K treatment (500mg/ml) at 558C for 2 h. DNA fragments and gapdh (22) primers, under the following conditions: were isolated using Qiagen PCR purification kit. PCR was 948C for 3 min, followed by cycling at 948C for 50 s, 528C performed using Taq polymerase (Qiagen) in a 50ml solu- for 50 s and 728C for 1 min. Primers used are as follows— tion as follows: 5ml of DNA, 1ml each of 10 pmol/mlof cas2 -for: 5 GCG GCG CCG AGC GCG GGG TCT L primers, 1ml of 10 mM dNTPs, 5mlof 10 buffer and 0 0 TGG3 , cas2 -rev: 5 GTG GGA GGG TGT CCT GGG L 0.4 ml of Taq polymerase. PCR conditions are as follows: 0 0 AAC3 , cas2 -for: 5 GAT GTG GAC CAC AGT ACT S Caspase-2 promoter containing the 18bp site ! 958C— 0 0 CTA G3 , cas2 -rev: 5 TCA TAG AGC AAG AGA S 3 min, 508C—1 min, 728C—30 s, 39 using caspase-2 RE- 0 0 0 0 GGC GGT G3 , cas8-for: 5 CAA GAA CCC ATC for: 5 GGA CGC CCG CCC GAG CCG CTC3 and cas- 0 0 AAG GAT GCC TTG3 , cas8-rev: 5 CCA AAG TCT pase-2 RE-rev: 5 AGT CTT TTC CCA CGA GAG AGA 0 0 GTG ATT CAC TAT CC3 , cas9-for: 5 TGA TCG CAA GGC C3 (100 bp); non-specific site on Caspase-2 0 0 AGG ACA TCC AGC GG3 , cas9-rev: 5 GAA GCG promoter using non-specific-for: 5 GGAATTGTGTGCT 0 0 0 0 ACG CCG CAA CTT CTC AC3 , mdm2-for: 5 ATG GCGGCTG3 and non-specific-rev: 5 CGCAGAGCTC TGC AAT ACC AAC ATG TCT GTA CCT3 , mdm2- TAGCGGCGGC3 (400 bp). rev: 5 AGG GGA AAT AAG TTA GCA CAA TCA TTT 0 0 GA3 , TAp73-for: 5 TCT GGA ACC AGA CAG CAC GST protein purification and in vitro DNA/protein 0 0 CT3 , TAp73-rev: 5 GTG CTG GAC TGC TGG AAA binding assay 0 0 GT3 , DNp73-for: 5 CGC CTA CCA TGC TGT ACG 0 0 TAp73a, TAp73b, DNp73b and p53 were cloned into TC3 , DNp73-rev: 5 GTG CTG GAC TGC TGG AAA 0 0 pGEX4T-1 (Pharmacia Biotech, GE, Princeton, NJ, GT3 , TAp63-for: 5 ACC TGA GTG ACC CCA TGT G 00 0 USA) to generate GST-73a, GST-73b, GSTDNp73b and 3 , TAp63-rev: 5 CGG GTG ATG GAG AGA GAG 00 0 GST-p53 fusion proteins. These plasmids were trans- CA3 , gapdh-for: 5 ACC CCT TCA TTG ACC TCA 0 0 0 formed into BL21 Escherichia coli and cultured in 200 ml AC3 , gapdh-rev: 5 CAG CGC CAG TAG AGG CAG3 . LB broth for 4–5 h, until OD = 0.5. 1 mM of IPTG was then added to the cultures and further cultured at Immunoblot analysis 378C for 4 h. The cultures were harvested and washed in Cell lysates prepared in lysis buffer containing 0.5% PBS, and then lysed by sonication at rating 3, 30 s pulse, Nonidet P-40 or luciferase extracts were separated on 30 s interval, 10 and the lysate was collected by centrifu- SDS–polyacrylamide gels and western blotted using anti- gation. The lysates were incubated with gluthatione beads p73 (ER15, Oncogene, Cambridge, MA, USA), anti-actin for 2 h at 48C. The beads were then washed several times in (Sigma, St Louis, MO, USA), anti-Sp-1, anti-TAp63 and PBS and bound GST fusion proteins eluted with glu- anti-p53 (Santa Cruz) antibodies. tathione elution buffer (10 mM Tris, pH 8, 5 mM glu- tathione). A 18 bp TAp73b recognition site on caspase-2 Chromatin immunoprecipitation assay promoter containing oligonucleotides, 5 GAC GCC Cells were fixed with 1% formaldehyde for 15 min at room CGC CCG AGC CGC TCC GAG3 , was synthesized temperature (RT), stopped with glycine to a final concen- with 5 biotin label on both strands. The biotin-labelled tration of 125 mM for 15min. Treated cells were then recognition sequence was then attached to avidin- washed twice with PBS and once with KM buffer conjugated sepharose beads (Invitrogen). Purified GST Nucleic Acids Research, 2008, Vol. 36, No. 13 4501 proteins diluted in RIPA buffer (0.1% SDS, 1% Triton-X, 2 mM EDTA, 20 mM Tris–HCl, pH 8, 150 mM NaCl) were then incubated with the recognition sequence attached beads for 2 h at 48C. After incubation, the mix was caspase-9 washed six times with RIPA buffer. After the last wash, 30ml of protein loading buffer was added to the beads and boiled for 5 min before loading onto SDS–acrylamide gel caspase-2 for separation. caspase-2 RESULTS TAp73b, but not TAp73a, p53 or TAp63, induces caspase-8 caspase-2 expression We first evaluated if p73 can transcriptionally regulate any of the initiator caspases. TAp73b was ectopically expressed TAp73 in p53 null H1299 cells and the levels of caspase-2,-8 and -9 mRNA were determined by semi-quantitative RT–PCR. gapdh Although none of the full-length initiator caspases were up-regulated by TAp73b over-expression, the short iso- form of the caspase-2, caspase-2 , was significantly B up-regulated (Figure 1A). Unfortunately, we were unable to detect endogenous caspase-2 protein levels, as it is gen- erated from a short-lived mRNA and hence, not easily caspase-2 detectable under these conditions (data not shown) (30). S Nonetheless, we evaluated if this increase in caspase-2 was specific to TAp73b over-expression by expressing the caspase-2 other p53 family members. Surprisingly, we found that only TAp73b, but not p53, TAp73a, TAp63a or TAp63b was able to induce the expression of caspase-2 (Figure 1B). TAp73 It is noteworthy that TAp73a and both TAp63a or TAp63b were unable to activate caspase-2 , though they were cap- able of activating Mdm2, suggesting that this induction is TAp63 specific to the TAp73b form of TAp73. p53 Both TAp73b and DNp73b activate the caspase-2 promoter As TAp73b expression led to an increase in the steady-state mdm2 levels of caspase-2 mRNA, we ascertained if this was due to transcriptional activation of the caspase-2 promoter. gapdh To this end, we utilized several caspase-2 promoter-lucifer- ase reporter constructs described in our earlier study, which Figure 1. TAp73b, but not p53, TAp73a, TAp63a or TAp63b, induce revealed that caspase-2 can be transcribed from an alter- caspase-2 expression. (A) TAp73b expression induces the up-regulation nate promoter within intron 1 of the caspase-2 gene (28) of caspase-2 but not other caspase transcripts. The pcDNA and (Figure 2A, left panel). Expectedly, TAp73b expression led TAp73 expression constructs were transfected into H1299 cells for to a significant increase in the reporter activity from the 36 h before RNA extraction and cDNA synthesis. Semi-quantitative RT–PCR was performed for caspase-2 , caspase-8, caspase-9 and cas- construct containing only caspase-2 promoter located pase-2 transcripts. (B) The pcDNA, p53, TAp63a, TAp63b, TAp73a within intron 1 (Del 4), but not from the construct contain- and TAp73b expression constructs were transfected into H1299 cells ing full-length caspase-2 promoter (PCM2) (Figure 2A, similarly and expression of caspase-2 and caspase-2 transcripts were L S right panel). TAp73b was also unable to effectively activate analysed. Mdm2 was used as a positive control and the expression of the transfected p53 family members is shown. luciferase activity from the sequentially deleted promoter constructs containing the caspase-2 exon 1 and intron 1 TAp63a or TAp63b is able to effectively activate the (Del 1, Del 2 and Del 3) (28), despite all of them containing caspase-2 promoter (Del4), though all proteins were the caspase-2 promoter located in intron 1 (Figure 2A, approximately equally expressed (Figure 2B). Next, we right panel). This suggests that there may be negative evaluated if the DNA-binding ability and TA domain of regulatory elements in exon 1, preventing TAp73b- mediated caspase-2 activation. Nonetheless, these data TAp73b are required to activate the Del4 reporter con- confirms our initial finding that TAp73b induces caspase- struct by utilizing the TAp73b-R292H, which has a 2s expression by transcriptionally activating its promoter. point mutation in the DNA-binding domain and hence, Analysis using the other p53 family members confirmed defective in its ability to specifically bind DNA, and the our earlier RT–PCR data that only TAp73b, but not p53, DNp73b that lacks the TA domain. This analysis revealed TAp73β TAp73β TAp73α pcDNA pcDNA TAp63α TAp63β p53 4502 Nucleic Acids Research, 2008, Vol. 36, No. 13 Figure 2. Activation of caspase-2 promoter by TAp73b and DNp73b.(A) Left panel shows the schematic of the caspase-2 promoter-luciferase S S constructs used in the study. Curved arrows represent the TATA box. Exon 1 of caspase-2 and caspase-2 are shown. These constructs were S L transfected together with TAp73b and b-gal plasmid into H1299 cells for 24 h. The cultures were then lysed and used for luciferase assays (right panel). (B) Activation of Del 4 reporter construct is specific only to TAp73b. The indicated reporter constructs were transfected together with either of the following: p53, TAp63a, TAp63b, TAp73a and TAp73b, together with the b-gal plasmid into H1299 cells for 24 h, prior to analysis of luciferase activity (left panel). Right panel shows immunoblot analysis of the expression of the transfected plasmids. (C) DNA-binding ability of p73b is essential for induction of Del4 promoter. Del4 reporter constructs were transfected together with either TAp73b or TAp73b-292, or DNp73b or DNp73b-292 together with b-gal plasmid into H1299 cells, prior to analysis of luciferase activity (left panel). Right panel shows immunoblot analysis of the expression of the transfected plasmids. All luciferase assays were repeated at least thrice, each time in duplicates. The graphs are representation of average SED. that the DNA-binding ability of TAp73b is essential to promoter, though the NH -terminal TA domain is dispen- activate caspase-2 promoter, as the TAp73b-R292H sable for this process. mutant was almost completely defective in transactiva- tion, though being expressed efficiently (Figure 2C). A unique element in the caspase-2 promoter is required However, unexpectedly, we found that DNp73b without for activation by p73b the TA domain was able to transactivate the caspase-2 promoter, and mutation in the DNA-binding domain of We next characterized the caspase-2 promoter to define DNp73b abrogated this effect (Figure 2C). These results the minimal DNA sequence required for activation, by together indicate that TAp73b and DNp73b are specifi- making sequential deletions of the Del 4 construct cally capable of transcriptionally activating the caspase-2 (Figure 3A). We made the assumption that the essential S TAp73β TAp73β Nucleic Acids Research, 2008, Vol. 36, No. 13 4503 AB pcDNA Del 4 −2595 −2870 Del 4.1 −2852 Del 4.2 −2833 Del 4.3 −2803 −2595 C 90 Del 4 Del 4.1 Del 4.2 Del 4.3 Sp1 Sp1 + TAp73β Sp1 p73 Actin Del4 Del 4-Sp-1-mut D 40 siRNA: control Sp-1 Sp-1 Actin Control siRNA Sp-1 siRNA Figure 3. Characterization of DNA elements required for activation of caspase-2 promoter by p73. (A) Schematic shows the deletion constructs made sequentially using Del 4. (B) The sequentially truncated Del4 constructs were transfected together with TAp73b and b-gal into H1299 cells for 24 h, prior to luciferase analysis. (C) Del4 and Del4-Sp-1 mutant reporter constructs were transfected together with TAp73b or Sp-1, alone or in combination, into H1299 cells for luciferase analysis. The fold induction of luciferase activity was derived by dividing the values obtained with the respective constructs with that of pcDNA-transfected samples. Right panel shows immunoblot analysis of the expression of the transfected plasmids. (D) Knockdown of Sp-1 does not significantly affect the activation of Del4 promoter by TAp73b. Control or Sp-1 siRNA were transfected into H1299 for 24 h prior to transfection of the Del4, TAp73b and b-gal constructs for luciferase analysis. Fold induction of luciferase activity is shown. Right panel shows efficiency of Sp-1 knockdown by immunoblotting. All luciferase assays were repeated at least thrice, each time in duplicates. The graphs are representation of average SED. site should lie upstream of the TATA box (Supplementary their activity. Surprisingly, TAp73b was unable to activate Figure 1A, indicated in bold), and hence, made deletions any of these deletions constructs, when compared to the 0 0 starting from the 5 -end of Del4 towards the 3 -end till parent Del4 promoter (Figure 3B), suggesting that the site prior to the TATA box (Figures 3A and Supplementary that is required for TAp73b to activate the caspase-2 Figure 1A). These constructs, termed Del 4.1, 4.2 and 4.3, promoter probably lies upstream of Del 4.1. The fragment were co-transfected together with TAp73b to analyse between Del 4 and Del 4.1 is only about 18-bp long and TAp73β+Sp1 pcDNA TAp73β Sp1 Fold induction of luciferase activity per beta-galactosidase unit Fold induction of luciferase activity per beta-galactosidase unit Luciferase activity per beta-galactosidase unit 4504 Nucleic Acids Research, 2008, Vol. 36, No. 13 contains a GC-rich box to which the Sp-1 transcription (Figure 4A, compare lanes 1 to 3). This binding, though factor could potentially bind (31) (Supplementary weak, was reproducible. To confirm this result, we Figure 1B). To test if the Sp-1-binding site is required attempted to detect endogenous binding of TAp73b and for TAp73b-mediated activation, we generated a mutant DNp73b to the caspase-2 promoter in vivo, using chro- construct in which the Sp-1 site was mutated by site-direc- matin immunoprecipitation (ChIP) assays. We used two cell lines for this purpose: the Saos2-TAp73b inducible ted mutagenesis (Supplementary Figure 1B). Luciferase cells and the human SH-SY5Y neuroblastoma cell line assays indicted that though there was a slight decrease in stably expressing DNp73b. The caspase-2 mRNA expres- total activity, TAp73b was still capable of consistently activating the Del4-Sp-1 mutant construct, and the fold sion was up-regulated upon TAp73b induction in Saos2- of activation of the promoter–luciferase activity was sig- TAp73b cells and was higher in SH-SY5Y cells stably expressing DNp73b compared to their pcDNA-expressing nificant for both the wild-type and Sp-1-mutant promoters (Del4 versus Sp-1-mut: 83.0 versus 62.0) (Figure 3C, control counterparts (Figure 4B and C). There were no left panel). To evaluate if Sp-1 would affect TAp73b- differences in the levels of caspase-2 in both cases mediated caspase-2 promoter activation, we co-trans- (Figure 4B and C). Immunoprecipitation with anti-p73 fected Sp-1 cDNA with TAp73b cDNA. Expression of or the irrelevant anti-HA antibodies was followed by Sp-1 alone led to a marginal activation of the caspase-2 PCR amplification of the region flanking the 18-bp site promoter, and this effect was abrogated when the Sp-1 site on the caspase-2 promoter (indicated as Casp-2 )oran S S was mutated (Del4 versus Sp-1-mut: 8.0 versus 3.0) irrelevant site away from this region. As shown in (Figure 3C, left panel). Co-expression of TAp73b with Figure 4D, strong and specific binding of TAp73 was Sp-1 resulted in a decrease in the TA potential compared noted on the region surrounding the 18-bp element but to when TAp73b was expressed alone (Del4 versus Sp-1- not on the non-specific site in Saos2-TAp73b cells. Both mut: 40.0 versus 44.0) (Figure 3C, left panel). Nonetheless, these sites were amplifiable from crude lysates prior to the combined effect of TAp73b and Sp-1 was not affected immunoprecipitation, indicating the presence of these by mutation of the Sp-1-binding site. Immunoblot analysis DNA fragments in the lysates (input). Similarly, ChIP indicated that both the levels of Sp-1 and TAp73 were analysis using the SH-SY5Y cells indicated a PCR product consistently reduced when co-expressed, suggesting other amplified specifically in DNp73b-expressing cells and not inter-regulation between them (Figure 3C, right panel). in pcDNA cells with the anti-p73 antibody, which was also These data together suggest that the Sp-1-binding site not significantly present in anti-HA immunoprecipitates may not be crucial for p73 to activate caspase-2 , and (Figure 4E, upper panel). No PCR product was amplified that Sp-1 may not have a significant role in regulating from the non-specific site on the caspase-2 promoter TAp73b-mediated caspase-2 promoter activation. (Figure 4E, lower panel). These data together suggest To further determine if Sp-1 is required for TAp73b- that TAp73b and DNp73b can bind to the caspase-2 dependent activation of the caspase-2 promoter, we promoter containing the 18-bp site identified by the lucif- silenced its expression using Sp-1-specific siRNA 24 h erase assays, both in vitro and in vivo, and highlight that prior to luciferase assays using the Del4 construct. As the lack of the TA domain does not affect the binding of seen in Figure 3D, silencing of Sp-1 expression did not DNp73b to DNA sequences. affect the induction of Del4 activity by TAp73b, and the ratio of activation was comparable between control and Over-expression of DNp73b protects cells from cell death Sp-1 siRNA treatment (control versus Sp-1 siRNA: 26.5 through caspase-2 activation versus 33.5). These results therefore together suggest that Over-expression of caspase-2 has been shown to protect the 18-bp element within the GC-rich box in caspase-2 cells from cell death induced by serum deprivation (27). promoter is required for TAp73b-mediated expression, Hence, we tested if the SH-SY5Y-DNp73b cells, which which is probably independent of Sp-1. express higher levels of caspase-2 mRNA, are also more resistant to serum deprivation-induced cell death. Serum TAp73b and DNp73b bind to the unique site deprivation of both SH-SY5Y-pcDNA and SH-SY5Y- in vitro and in vivo DNp73b cells followed by analysis of DNA content to Since both TAp73b and DNp73b activated the caspase-2 monitor the sub-G population—which reflects apoptotic promoter through their DNA-binding domains, we tested cells—indicated that there was less cell death in the if they can directly bind to the 18-bp element identified as SH-SY5Y-DNp73b cells (% sub-G1 cells ! pcDNA being important for caspase-2 promoter activation by versus DNp73b cells: 28.9 versus 16.0 [day2]; 31.0 versus 20.0 [day3]) (Figure 5A and B). Similarly, though treat- TAp73b. In the first instance, in vitro DNA-binding ment with another cellular insult, cisplatin, resulted in an assays were performed using bacterially purified GST- increase in cell death of pcDNA cells, there was no sig- TAp73b, GST-TAp73a, GST-DN73b and GST-p53, and a biotin-labeled 24-bp oligonucleotide encompassing the nificant death in DNp73b cells (% dead cells !/+ 18-bp element. Incubation of GST proteins and oligonu- cisplatin—pcDNA versus DNp73b cells: 8.0/20.0 versus cleotides together with avidin-conjugated agarose beads, 5.0/4.8) (Figure 5C). followed by washing to remove excess unbound proteins In order to verify if the resistance to cell death is due to and subsequent immunoblotting revealed that only DNp73b-mediated caspase-2 activation, we silenced the TAp73b and DN73b, but not TAp73a or p53, could expression of the over-expressed DNp73b using p73-spe- bind to the beads containing the 18-bp DNA sequence cific siRNA, followed by serum-starvation for up to 48 h. Nucleic Acids Research, 2008, Vol. 36, No. 13 4505 TAp73β TAp73α DNp73β p53 1 2 3 BC Dox. (hrs.): 0 14 24 casp2 casp2 S S casp2 casp2 L L mdm2 mdm2 TAp73 DNp73 gapdh gapdh DE SHSY5Y- SHSY5Y- DNp73β pcDNA Saos2-TAp73β Casp2 S Casp2 Non-specific Non-specific site site Figure 4. The p73 binds to the 18-bp sequence element on the caspase-2 promoter in vitro and in vivo.(A) In vitro DNA-GSTp73 binding assay. Purified GST-TAp73a GST-TAp73b GST-DNp73b or GST-p53 proteins were incubated with biotinylated 18 bp caspase-2 promoter containing sequence elements before further incubation with avidin-conjugated beads. GST-p73/p53 without biotinylated DNA but with beads alone was used as negative controls. The beads were washed and separated onto SDS–acrylamide gel for immunoblot analysis with the indicated antibodies. Lane1: GST-protein + 18-bp element + beads. Lane 2: GST-protein + beads. Lane 3: GST-protein lysate. (B–C) Up-regulation of caspase-2 in Saos2- TAp73b inducible cell line (B) and in SH-SY5Y cells stably expressing DNp73b (C). TAp73b was induced by doxocycline (Dox) addition for 14–24 h prior to RNA extraction. RT–PCR was performed to assess expression of caspase-2 , caspase-2 , p73 and mdm2 in both the cell systems. (D and E) S L ChIP analysis was performed with anti-p73 and anti-HA antibodies using the two cellular systems described earlier. Cells were collected 15 h after TAp73 induction (D). The promoter sequence encompassing the 18-bp elements on the caspase-2 promoter was analysed by PCR (Casp2 ). A non- S S specific site on the caspase-2 promoter was used as negative control. All experiments were repeated at least thrice independently. Silencing of p73 resulted in a decrease in the DNp73b leads to up-regulation of caspase-2 , contributes to protec- levels, as expected (Figure 5D). Importantly, the levels tion of cells against cell death induced by multiple means. of caspase-2 were also reduced concomitantly (Figure 5D), indicating that DNp73b is indeed responsible for caspase-2 activation. Analysis of cell death revealed DISCUSSION that silencing DNp73b expression consistently led to an The findings presented here highlight two salient points: increase in cell death, compared to control siRNA treated that the tumour-suppressor TAp73b is able to induce the cells (% dead cells upon serum-starvation: SH-SY5Y- pCDNA cells–20.0; SH-SY5Y-DNp73b cells—control expression of the anti-apoptotic caspase-2 , and that versus p73 siRNA: 11.0 versus 16.5) (Figure 5E). These DNp73b, without the NH -terminal TA domain, is also data together indicate that expression of DNp73b, which capable of activating caspase-2 expression. The former I.P: anti-HA I.P: anti-HA I.P: anti-HA I.P.: anti-p73 I.P.: anti-p73 I.P.: anti-p73 Input Input Input SHSY5Y- pcDNA SHSY5Y- DNp73β Beads + 18 bp RE Beads Input 4506 Nucleic Acids Research, 2008, Vol. 36, No. 13 pcDNA DNp73β Serum Starvation (days): 0 1 2 3 C 25 Untreated Cisplatin B 35 pcDNA DNp73β 0 12 3 DNp73β Vector Days Figure 5. DNp73b over-expressing SH-SY5Y cells are resistant to cell death. (A and B) SH-SY5Y cells stably over-expressing pcDNA or DNp73b were seeded in 6-well plates in triplicates and serum starved in serum free DMEM for up to 72 h. Cultures were harvested at days 0, 1, 2 and 3 during serum starvation for cell cycle analysis. Representative flow cytometric graphics (A). Average of the sub-G population, representing apoptotic cells, for each cell line and time point is plotted SED (B). (C) These cells were treated with 20mM cisplatin for 24 h prior to analysis of total cell death by propidium iodide exclusion assay. (D and E) Knockdown of p73 results in reduced caspase-2 expression and increased cell death. The above cells were transfected with control or p73-siRNA and serum-starved for the indicated time periods. The mRNA analysis was performed to determine expression of caspase-2 , DNp73 and gapdh (D), and cells were harvested after 48 h for analysis of cell death by propidium iodide exclusion assay (E). All experiments were repeated at least thrice independently. finding, though at first instance perplexing, is entirely anti-apoptotic capase-2 gene. Though loss of all p73 compatible with the emerging view that TAp73b may forms result in increased resistance to cell death (9,32), have other roles in supporting cellular growth. The latter TAp73 is over-expressed in many human cancers (6,11– finding highlight the fact that some targets can be 17). Intriguingly, it is to be noted that physiologically, common to both TAp73b and DNp73b, and hence, may TAp73b transcripts are not readily detectable (33). These explain why many human tumours co-over-express mitigating reasons raise the interesting possibility that both TAp73 and DNp73 to provide a strong survival TAp73b may have evolved to also support cellular survival pressure. under certain conditions, such as seen in human cancers. In It is striking that expression of the tumour-suppressor support of this, we have recently shown that expression of TAp73b, which induces cell death when over-expressed TAp73 can cooperate with c-Jun to activate AP-1 target in many cellular systems, is able to transactivate the genes such as cyclinD1, and hence, promote cellular % sub-G1 population % propidium iodide positive population Serum- starved Nucleic Acids Research, 2008, Vol. 36, No. 13 4507 D pcDNA- DNp73β- DNp73b levels by gene silencing led to a decrease in cas- SHSY5Y SHSY5Y pase-2 expression and a concomitant reversal of resistance to cell death, suggesting that the activation of caspase-2 by siRNA: Control Control p73 DNp73b indeed leads to protection against cell death. Serum starvation (hrs): 0 24 48 0 24 48 0 24 48 However, we have not been able to specifically silence the expression of caspase-2 in DNp73b-over-expressing cells to demonstrate its relevance due to the sequence similarity Casp2 of caspase-2 and caspase-2 (data not shown). S L Nonetheless, our data suggest that physiologically, DNp73b may act through caspase-2 to protect neuronal DNp73 S cells from cell death. Activation of caspase-2 was found to be specific to the p73 family, but not to p53, TAp63a and TAp63b though all gapdh three p53 family members share similar DNA-binding domains and are thought to be able to activate a large E subset of p53 target genes (6,36). However, the specificity Untreated of the p73 family could arise due to subtle differences else- where, which may be more critical for binding to the unique site on the caspase-2 promoter, besides the common DNA-binding domain. However, this cannot explain why TAp73a, which also share the same DNA-binding and other domains as TAp73b, and is over-expressed in human cancers as TAp73b, cannot induce caspase-2 expression. The sterile a-domain present in TAp73a but not in TAp73b has been shown to play an inhibitory role in TA, making TAp73a a weaker transactivator of target genes compared to TAp73b (37,38). This could be a reason for the inability of TAp73a to activate caspase-2 in experi- mental conditions, though it may be able to activate cas- siRNA: Control Control p73 pase-2 expression in vivo, in conditions where the effect of pcDNA- DNp73β- the sterile alpha motif (SAM) domain is negated by other SHSY5Y SHSY5Y means. This possibility remains to be explored. Nevertheless, the 18-bp site to which the p73 members Figure 5. Continued. bind to on the caspase-2 promoter does not resemble the p53 consensus binding site. Rather, it contains a GC box, a survival (18). Moreover, absence of p73 led to reduced putative binding site for Sp-1 transcription factor. expression of cyclinD1 and decreased cellular proliferation. Mutation of the GC box and knockdown of Sp-1 expres- In addition, other groups have also raised the possibility sion did not significantly affect TAp73b’s ability to activate that TAp73 may be involved in the activation of genes that the caspase-2 promoter, suggesting that TAp73b does not are involved in tumourigenesis, such as b-catenin and gas- depend on Sp-1 to activate the promoter. Moreover, com- trin (19,20). Thus, these findings together favour the argu- parison of Sp-1 and TAp73b’s ability to activate the cas- ment for a contributory role of TAp73 in supporting pase-2 promoter indicated that TAp73b was a better cellular survival, in one way by activating the expression activator than Sp-1, which only had a marginal effect, of capase-2 as demonstrated here. thereby excluding any critical role for the latter in cas- In addition, DNp73b is the variant of p73 that is predo- pase-2 activation. Furthermore, DNA-binding mutants minantly expressed in the brain and sympathetic neurons of p73 were unable to activate the caspase-2 promoter (23). The p73 mice display severe defects in their nervous and conversely, both in vivo ChIP experiments and system including massive cell death, suggesting that in vitro DNA-binding assays revealed that p73 was able DNp73b plays an anti-apoptotic role in the brain (33). to bind to this DNA element, indicating that p73 can Over-expression of DNp73b in sympathetic neurons was indeed directly bind to and activate the caspase-2 promo- also able to rescue cell death resulting from nerve growth ter. Whether this 18-bp element is a unique site that is of factor withdrawal (34). Similarly, caspase-2 is highly general utility for activation of p73-specific (and not p53- or expressed in the brain and caspase-2 has been shown to p63-dependent) targets is yet to be explored. Overall, the protect cells from cell death induced by several means findings highlight the specificity of TAp73b and DNp73b in (27,35). Therefore, our results that the SH-SY5Y neuro- the induction of caspase-2 expression. blastoma cells stably over-expressing DNp73b—which The ability of both full-length TAp73b and the TA-defi- express higher level of caspase-2 compared with pcDNA cient DNp73b to induce caspase-2 promoter activation is S S expressing control cells—are resistant to cell death upon also surprising, but highlights that the DNp73 form may serum starvation and cisplatin treatment are entirely con- have the ability to activate target genes. There are not sistent with a protective role for DNp73b in some cellular many reports that have highlighted that both of these contexts. Importantly, reducing the exogenously expressed forms can activate classical p53/p73 target genes, as % propidium iodide positive population 4508 Nucleic Acids Research, 2008, Vol. 36, No. 13 2. Kaghad,M., Bonnet,H., Yang,A., Creancier,L., Biscan,J.C., traditionally, it has been thought that the TA domain is Valent,A., Minty,A., Chalon,P., Lelias,J.M., Dumont,X. et al. essential for transcription factors to recruit co-factors for (1997) Monoallelically expressed gene related to p53 at 1p36, transactivation of target genes. Therefore, the findings a region frequently deleted in neuroblastoma and other human presented here suggest that DNp73b has unique transac- cancers. Cell, 90, 809–819. tivation ability, besides its role as a dominant-negative 3. Stiewe,T., Zimmermann,S., Frilling,A., Esche,H. and Putzer,B.M. (2002) Transactivation-deficient DeltaTA-p73 acts as an oncogene. protein to inhibit p73 and p53 function. Two similar Cancer Res., 62, 3598–3602. examples were reported, whereby DNp73a was shown to 4. Stiewe,T., Theseling,C.C. and Putzer,B.M. (2002) Transactivation- activate the expression of EGR1 and CDC6, and DNp73b deficient Delta TA-p73 inhibits p53 by direct competition for DNA was shown to activate classical p53 target genes (5,39). binding: implications for tumorigenesis. J. Biol. Chem., 277, 14177–14185. Mechanistically, how this occurs is unclear. It was specu- 5. Liu,G., Nozell,S., Xiao,H. and Chen,X. (2004) DeltaNp73beta is lated that the presence of a secondary TA domain in active in transactivation and growth suppression. Mol. Cell Biol., DNp73, which encompass the 13 unique residues at the 24, 487–501. NH -terminus together with the PXXP motifs, may form 2 6. Melino,G., De Laurenzi,V. and Vousden,K.H. (2002) p73: friend or a TA domain responsible for the activity of DNp73 (5). foe in tumorigenesis. Nat. Rev. Cancer, 2, 605–615. 7. Ueda,Y., Hijikata,M., Takagi,S., Chiba,T. and Shimotohno,K. Alternatively, DNp73b may recruit other transcription (1999) New p73 variants with altered C-terminal structures have factors to activate the capase-2 promoter activity. varied transcriptional activities. Oncogene, 18, 4993–4998. Whatever the mechanism may be, it is evident that 8. Lee,C.W. and La Thangue,N.B. (1999) Promoter specificity and DNp73 has the ability to activate target genes, which are stability control of the p53-related protein p73. Oncogene, 18, 4171–4181. unique and does not fall into to the classical ‘p53-target’ 9. Flores,E.R., Tsai,K.Y., Crowley,D., Sengupta,S., Yang,A., gene group. McKeon,F. and Jacks,T. (2002) p63 and p73 are required Another noteworthy point is that both TAp73b and for p53-dependent apoptosis in response to DNA damage. Nature, DNp73b were not able to activate the expression from 416, 560–564. the full-length caspase-2 promoter. Only after truncating 10. Flores,E.R., Sengupta,S., Miller,J.B., Newman,J.J., Bronson,R., Crowley,D., Yang,A., McKeon,F. and Jacks,T. (2005) Tumor the promoter to retain the caspase-2 promoter region predisposition in mice mutant for p63 and p73: evidence for specifically did we see an increase in promoter activity, broader tumor suppressor functions for the p53 family. Cancer Cell, suggesting the existence of repressor elements that may 7, 363–373. interfere with the induction of caspase-2 by p73b. 11. Becker,K., Pancoska,P., Concin,N., Vanden,H.K., Slade,N., Moreover, we cannot exclude the possibility that usage Fischer,M., Chalas,E. and Moll,U.M. (2006) Patterns of p73 N-terminal isoform expression and p53 status have of one promoter may be at the expense of the other, prognostic value in gynecological cancers. Int. J. Oncol., 29, though this needs further investigation. This indicates 889–902. that specific conditions may be required for the 12. Concin,N., Becker,K., Slade,N., Erster,S., Mueller-Holzner,E., induction of caspase-2 by p73b in vivo in the physiologi- Ulmer,H., Daxenbichler,G., Zeimet,A., Zeillinger,R., Marth,C. et al. (2004) Transdominant DeltaTAp73 isoforms are frequently cal setting. up-regulated in ovarian cancer. Evidence for their role as epigenetic In conclusion, the data presented here provide evidence p53 inhibitors in vivo. Cancer Res., 64, 2449–2460. for the activation of the anti-apoptotic caspase-2 by both 13. Hong,S.M., Cho,H., Moskaluk,C.A., Yu,E. and Zaika,A.I. (2007) the tumour-suppressive TAp73b and the anti-apoptotic p63 and p73 expression in extrahepatic bile duct carcinoma and DNp73b, which could be yet another mechanism to pro- their clinical significance. J. Mol. Histol., 38, 167–175. 14. Kovalev,S., Marchenko,N., Swendeman,S., LaQuaglia,M. and mote cellular survival in tumor settings where both p73 Moll,U.M. (1998) Expression level, allelic origin, and mutation forms are over-expressed. analysis of the p73 gene in neuroblastoma tumors and cell lines. Cell Growth Differ., 9, 897–903. 15. Zaika,A., Irwin,M., Sansome,C. and Moll,U.M. (2001) Oncogenes SUPPLEMENTARY DATA induce and activate endogenous p73 protein. J. Biol. Chem., 276, 11310–11316. Supplementary Data are available at NAR Online. 16. Zaika,A.I., Kovalev,S., Marchenko,N.D. and Moll,U.M. (1999) Overexpression of the wild type p73 gene in breast cancer tissues and cell lines. Cancer Res., 59, 3257–3263. ACKNOWLEDGEMENTS 17. Zaika,A.I. and El-Rifai,W. (2006) The role of p53 protein family in gastrointestinal malignancies. Cell Death Differ., 13, 935–940. T.W.H. was partially supported by a Singapore Mil- 18. Vikhanskaya,F., Toh,W.H., Dulloo,I., Wu,Q., Boominathan,L., lennium Foundation fellowship. We thank the National Ng,H.H., Vousden,K.H. and Sabapathy,K. (2007) p73 supports cellular growth through c-Jun-dependent AP-1 transactivation. Nat. Medical Research Council of Singapore and the Biomedi- Cell Biol., 9, 698–706. cal Research Council of Singapore for their generous fund- 19. Tomkova,K., El-Rifai,W., Vilgelm,A., Kelly,M.C., Wang,T.C. and ing and support to K.S. Funding to pay the Open Access Zaika,A.I. (2006) The gastrin gene promoter is regulated by p73 publication charges for this article was provided by Biome- isoforms in tumor cells. Oncogene, 25, 6032–6036. dical Research Council of Singapore. 20. Tomkova,K., Belkhiri,A., El-Rifai,W. and Zaika,A.I. (2004) p73 isoforms can induce T-cell factor-dependent transcription in gas- Conflict of interest statement. None declared. trointestinal cells. Cancer Res., 64, 6390–6393. 21. Toh,W.H., Kyo,S. and Sabapathy,K. (2005) Relief of p53- mediated telomerase suppression by p73. J. Biol. Chem., 280, 17329–17338. REFERENCES 22. Ramadan,S., Terrinoni,A., Catani,M.V., Sayan,A.E., Knight,R.A., 1. Jost,C.A., Marin,M.C. and Kaelin,W.G. Jr. (1997) p73 is a simian Mueller,M., Krammer,P.H., Melino,G. and Candi,E. (2005) p73 [correction of human] p53-related protein that can induce apoptosis. induces apoptosis by different mechanisms. Biochem. Biophys. Res. Nature, 389, 191–194. Commun., 331, 713–717. Nucleic Acids Research, 2008, Vol. 36, No. 13 4509 23. Pozniak,C.D., Radinovic,S., Yang,A., McKeon,F., Kaplan,D.R. 31. Kadonaga,J.T., Carner,K.R., Masiarz,F.R. and Tjian,R. (1987) and Miller,F.D. (2000) An anti-apoptotic role for the p53 family Isolation of cDNA encoding transcription factor Sp1 and functional member, p73, during developmental neuron death. Science, 289, analysis of the DNA binding domain. Cell, 51, 1079–1090. 304–306. 32. Irwin,M.S., Kondo,K., Marin,M.C., Cheng,L.S., Hahn,W.C. and 24. Shi,Y. (2002) Mechanisms of caspase activation and inhibition Kaelin,W.G. Jr. (2003) Chemosensitivity linked to p73 function. during apoptosis. Mol. Cell, 9, 459–470. Cancer Cell, 3, 403–410. 25. Ramadan,S., Terrinoni,A., Catani,M.V., Sayan,A.E., Knight,R.A., 33. Yang,A., Walker,N., Bronson,R., Kaghad,M., Oosterwegel,M., Mueller,M., Krammer,P.H., Melino,G. and Candi,E. (2005) p73 Bonnin,J., Vagner,C., Bonnet,H., Dikkes,P., Sharpe,A. et al. (2000) induces apoptosis by different mechanisms. Biochem. Biophys. Res. p73-deficient mice have neurological, pheromonal and inflammatory Commun., 331, 713–717. defects but lack spontaneous tumours. Nature, 404, 99–103. 26. Kumar,S., Kinoshita,M., Noda,M., Copeland,N.G. and 34. Lee,A.F., Ho,D.K., Zanassi,P., Walsh,G.S., Kaplan,D.R. and Jenkins,N.A. (1994) Induction of apoptosis by the mouse Nedd2 Miller,F.D. (2004) Evidence that DeltaNp73 promotes neuronal gene, which encodes a protein similar to the product of the survival by p53-dependent and p53-independent mechanisms. Caenorhabditis elegans cell death gene ced-3 and the mammalian J. Neurosci., 24, 9174–9184. IL-1 beta-converting enzyme. Genes Dev., 8, 1613–1626. 35. Ito,A., Uehara,T. and Nomura,Y. (2000) Isolation of Ich-1S 27. Wang,L., Miura,M., Bergeron,L., Zhu,H. and Yuan,J. (1994) (caspase-2S)-binding protein that partially inhibits caspase activity. Ich-1, an Ice/ced-3-related gene, encodes both positive FEBS Lett., 470, 360–364. and negative regulators of programmed cell death. Cell, 78, 36. Jacobs,W.B., Kaplan,D.R. and Miller,F.D. (2006) The p53 family 739–750. in nervous system development and disease. J. Neurochem., 97, 28. Logette,E., Wotawa,A., Solier,S., Desoche,L., Solary,E. and 1571–1584. Corcos,L. (2003) The human caspase-2 gene: alternative promoters, 37. Liu,G. and Chen,X. (2005) The C-terminal sterile alpha motif and pre-mRNA splicing and AUG usage direct isoform-specific expres- the extreme C terminus regulate the transcriptional activity of the sion. Oncogene, 22, 935–946. alpha isoform of p73. J. Biol. Chem., 280, 20111–20119. 29. Ishii,S., Kadonaga,J.T., Tjian,R., Brady,J.N., Merlino,G.T. and 38. Wang,W.K., Bycroft,M., Foster,N.W., Buckle,A.M., Fersht,A.R. Pastan,I. (1986) inding of the Sp1 transcription factor by the and Chen,Y.W. (2001) Structure of the C-terminal sterile alpha- human Harvey ras1 proto-oncogene promoter. Science, 232, motif (SAM) domain of human p73 alpha. Acta Crystallogr. 1410–1413. D. Biol. Crystallogr., 57, 545–551. 30. Solier,S., Logette,E., Desoche,L., Solary,E. and Corcos,L. (2005) 39. Kartasheva,N.N., Lenz-Bauer,C., Hartmann,O., Schafer,H., Nonsense-mediated mRNA decay among human caspases: the Eilers,M. and Dobbelstein,M. (2003) DeltaNp73 can modulate the caspase-2S putative protein is encoded by an extremely short-lived expression of various genes in a p53-independent fashion. Oncogene, mRNA. Cell Death Differ., 12, 687–689. 22, 8246–8254.
Nucleic Acids Research – Oxford University Press
Published: Aug 8, 2008
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.