Distribution of major diazotrophs in the surface water of the Kuroshio from northeastern Taiwan to south of mainland Japan

Distribution of major diazotrophs in the surface water of the Kuroshio from northeastern Taiwan... Abstract We investigated the composition and distribution of diazotrophs in waters of the Kuroshio, the “hot spot” of nitrogen fixation in the Pacific Ocean, as well as in adjacent waters and the North Pacific tropical gyre (NPTG). Specifically, we explored the abundance of nifH in seven commonly observed diazotrophs: Trichodesmium, Crocosphaera, UCYN-A, UCYN-C, Richelia associated with Rhizosolenia (RR) or Hemiaulus (HR) and a gammaproteobacterium (γ-24774A11). The surface diazotroph community in the Kuroshio was distinguished from those in other waters by its higher abundances of Trichodesmium, RR, HR and UCYN-C. The distributions of these diazotrophs were not well explained by temperature and macronutrient concentrations, although they may be influenced by the current flow and micronutrient content. γ-24774A11 occurred extensively in the oligotrophic waters, and its abundance was significantly correlated with water temperature. The surface abundances of Crocosphaera and UCYN-A1 decreased from upstream to downstream in the Kuroshio, and their abundances were lower in the Kuroshio than in the NPTG. Temperature and nitrate + nitrite levels were comparable between the Kuroshio and NPTG, but phosphate and chlorophyll a level were lower and higher, respectively, in the Kuroshio. These results suggest that the growth of Crocosphaera and UCYN-A1 in the Kuroshio may be regulated by phosphorus availability, which would be severely limited due to intense competition with non-diazotrophs and other diazotrophs. INTRODUCTION Nitrogen fixation is the process by which dinitrogen gas is converted to ammonia, the major source of reactive nitrogen in the ocean, thereby maintaining the nitrogen inventory (Gruber and Galloway, 2008). In oligotrophic tropical and subtropical oceans, nitrogen fixation is a significant source of new production, and the process influences primary and export production in these ecosystems (Karl et al., 1997; Subramaniam et al., 2008; Shiozaki et al., 2013; Bonnet et al., 2016). Nitrogen fixation is mediated by specialized prokaryotes termed “diazotrophs”. The filamentous cyanobacterium genus Trichodesmium and diatom-diazotroph associations (DDAs) have long been studied in the evaluation of oceanic nitrogen fixation. However, nano- and pico-planktonic diazotrophs, including unicellular cyanobacteria and heterotrophic bacteria, were recently discovered via molecular approaches (Zehr et al., 2001, 2003; Riemann et al., 2010; Bombar et al., 2016). These organisms are currently recognized to significantly contribute to oceanic nitrogen fixation (Montoya et al., 2004; Halm et al., 2012; Shiozaki et al., 2014a; Martínez-Pérez et al., 2016). Diazotrophs differ physiologically, and thus, they are expected to exhibit different distributions (Dyhrman et al., 2006; Moisander et al., 2010; Saito et al., 2011). Accumulating evidence suggests that the fates of fixed nitrogen depend on the type of diazotroph involved (Glibert and Bronk, 1994; Foster et al., 2011; Krupke et al., 2015). Therefore, understanding the biogeographical features of diazotrophs is essential for exploring the biogeochemical cycles of tropical and subtropical oligotrophic oceans. In this study, we focused on the surface diazotroph community of the Kuroshio Current, in which the extent of nitrogen fixation is greater than that in the North Pacific tropical gyre (NPTG) (termed the hot spot of nitrogen fixation, Shiozaki et al., 2010). Nitrogen fixation activity in the Kuroshio is known to be highest in surface waters (Liu et al., 2013; Shiozaki et al., 2010, 2015a; Chen et al., 2014). The biogeography of Trichodesmium in the Kuroshio has been well studied (e.g. Marumo and Asaoka, 1974; Chang et al., 2000; Chen et al., 2008; Shiozaki et al., 2015a), but other diazotrophs, especially nano- and pico-planktonic diazotrophs, have received less attention (Shiozaki et al., 2014b; Langlois et al., 2015; Cheung et al., 2017). In this study, we determined the abundance of nifH in seven major diazotrophic phylotypes in the Kuroshio, adjacent waters and the NPTG. Our study region covered the ~1750-km long Kuroshio from northeastern Taiwan to south of mainland Japan. The Kuroshio enters the East China Sea off eastern Taiwan, flows along the edge of the continental shelf, and returns to the Pacific Ocean through the Tokara Strait. A branch of the Kuroshio bifurcates northward into the East China Sea. We characterized the surface diazotroph community in the Kuroshio in comparison with those in other waters and examined the factor(s) determining their distribution within the Kuroshio and in the basin-wide tropical and subtropical North Pacific. MATERIALS AND METHODS Hydrography and nutrient and chlorophyll a measurements Samples were obtained during cruises made by the T/V Kakuyo-maru KY513 (September 3–6, 2015) and R/V Hakuho-maru KH-15-3 (October 14 to 2 November 2015) in the western North Pacific, and R/V Hakuho-maru KH-14-3 (June 23 to 11 August 2014) in the NPTG (Fig. 1). Temperature and salinity profiles were measured using an SBE 911 plus CTD system (Sea-Bird Electronics, Inc., Washington, DC, USA) during the three cruises. Surface water samples were collected using a bucket or from the underway water supply (~2.5 m, Kakuyo-maru; ~5 m, Hakuho-maru). Excluding the surface samples, samples were collected using Niskin-X bottles. Water samples for nutrient and chlorophyll (chl) a measurements were collected from 3 to 12 depths within the upper 200 m except at stations EK1, EK2 and EJ2. Samples for DNA analysis were collected from the surface water. Fig. 1. View largeDownload slide Sampling stations in the western North Pacific during the KY513 (triangles) and KH-15-3 (circles) cruises and in the NPTG during the KH-14-3 (squares) cruise. The shaded dashed line indicates the approximate position of the Kuroshio axis during the KH-15-3 cruise (http://www1.kaiho.mlit.go.jp/KANKYO/KAIYO/qboc/). Dashed lines denote the 200-m isobaths. The stations enclosed by the solid line in the western North Pacific are classified as ECSMW stations. Surface samples at stations EK1, EK2, EJ2, Ka1, Ka2, Ka11 and Ka14 were collected from the underway water supply, and those at the other stations were collected using a bucket. Fig. 1. View largeDownload slide Sampling stations in the western North Pacific during the KY513 (triangles) and KH-15-3 (circles) cruises and in the NPTG during the KH-14-3 (squares) cruise. The shaded dashed line indicates the approximate position of the Kuroshio axis during the KH-15-3 cruise (http://www1.kaiho.mlit.go.jp/KANKYO/KAIYO/qboc/). Dashed lines denote the 200-m isobaths. The stations enclosed by the solid line in the western North Pacific are classified as ECSMW stations. Surface samples at stations EK1, EK2, EJ2, Ka1, Ka2, Ka11 and Ka14 were collected from the underway water supply, and those at the other stations were collected using a bucket. Nitrate + nitrite (N + N) and phosphate concentrations at the surface were determined using supersensitive colorimetric systems (Hashihama et al., 2009). Their detection limits were 2–3 and 3–4 nM, respectively. Silicate concentrations during all three cruises were determined colorimetrically using QuAAtro, AACS IV and AACS II auto-analyzers (SEAL Analytical Ltd). Silicate concentration was not determined below 0.5 μM. Chl a concentrations were measured fluorometrically using a 10-AU fluorometer (Turner Designs, Inc. San Jose, CA, USA) after sample extraction with N,N-dimethylformamide. DNA sampling, extraction and qPCR assays Seawater samples for DNA extraction (2.3 L) were filtered through Sterivex-GP pressure filters with 0.22-μm pores (Millipore, Billerica, MA, USA) and then stored at −20°C prior to onshore analysis. DNA was extracted using ChargeSwitch Forensic DNA Purification kits (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol (Shiozaki et al., 2015b, 2017). qPCR analysis targeted the seven nifH phylotypes commonly detected in tropical and subtropical oligotrophic oceans worldwide, namely Trichodesmium, Crocosphaera, UCYN-A1, UCYN-C, Richelia associated with Rhizosolenia (RR) or Hemiaulus (HR) and a gammaproteobacterium (γ-24774A11). The utilized TaqMan probe and primer sets have been described previously (Table I). Among target diazotrophs, UCYN-A1 is of particular concern when comparing the abundance to those in other studies because of the potential presence of UCYN-A sublineages. The primer and probe set of UCYN-A1 used in the present study is more specific to UCYN-A1 than the other published ones (Farnelid et al., 2016) and do not cross-react with nifH sequence of UCYN-A2 (Shiozaki et al., 2017). All qPCR analyses were performed using a LightCycler 480 System (Roche Applied Science, Penzberg, Germany). Each reaction mixture (20 μL) contained 10 μL of 2× Premix Ex Taq (Probe qPCR; Takara Bio, Shiga, Japan), 5.6 μL of nuclease-free water, 1 μL each of the forward and reverse primers (10 μmol L−1), 0.4 μL of 10 μmol L−1 TaqMan probe and 2 μL of template DNA. All qPCR assays were performed in triplicate. The qPCR efficiency ranged from 92.7 to 99.7% (average, 96.3%). Sterile distilled water served as a control. As the negative control was not amplified, and 2 μL of template DNA in 150 μL of TE were used in the qPCR assay, ≥75 copies L−1 were considered detectable for all seven diazotrophs. Table I: Primers, TaqMan probes, and standard clones for the qPCR assays Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Table I: Primers, TaqMan probes, and standard clones for the qPCR assays Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Statistical analysis We compared the surface abundances of diazotrophs with that of Trichodesmium, which is well studied in our study regions, to illustrate the numerical importance of each diazotroph in each region. Furthermore, we examined the difference between the abundance of each diazotroph in the Kuroshio and those in the other regions to characterize the diazotroph community in the Kuroshio. Significant differences were determined using the Mann–Whitney U test. We performed multiple regression analysis to investigate the relationship between diazotroph abundance and environmental parameters. All data were log (x + 1)-transformed to standardize variances before the analysis. We used the Akaike information criterion (Akaike, 1974) for model selection using the MASS package (Venables and Ripley, 2002) in R software. RESULTS Environmental conditions In the western North Pacific, the water masses cluster into three groups on a temperature–salinity (T–S) diagram (Fig. 2). Using the criteria of Gong et al. (Gong et al.,1996) and the location, we divided the low-temperature, low-salinity water and the high-salinity water encountered during the KH-15-3 cruise into East China Sea Mixed Water (ECSMW) and Kuroshio water, respectively. The high-temperature, low-salinity water encountered during the KY513 cruise was not included in the specific water masses defined by Gong et al. (Gong et al.,1996), indicating that we explored a different geographical region. The surface salinity is lower near the Kyushu region than in the Kuroshio (Kodama et al., 2011). We thus defined low-salinity water as Kyushu Coastal Water (KCW). The surface temperature ranges of the ECSMW, Kuroshio and KCW were 21.7–23.3, 24.1–28.2 and 26.2–27.5°C, respectively (Figs 2 and 3a). The surface temperature of the NPTG (24.2–28.2°C) was comparable to those of the Kuroshio and KCW. The surface salinity of the NPTG (34.6–35.5) tended to be higher than that of Kuroshio water (33.6–34.9; Figs 2 and 3b). Fig. 2. View largeDownload slide T–S diagram of the surface waters. The various water types are described in the text. Fig. 2. View largeDownload slide T–S diagram of the surface waters. The various water types are described in the text. Fig. 3. View largeDownload slide Surface distributions of (a) temperature (°C), (b) salinity, (c) chlorophyll a (μg L−1), (d) nitrate + nitrite (N + N) (nM), (e) phosphate (nM), (f) N + N/phosphate ratio and (g) silicate (nM). White circles: undetectable. Dashed lines: 200-m isobaths. Fig. 3. View largeDownload slide Surface distributions of (a) temperature (°C), (b) salinity, (c) chlorophyll a (μg L−1), (d) nitrate + nitrite (N + N) (nM), (e) phosphate (nM), (f) N + N/phosphate ratio and (g) silicate (nM). White circles: undetectable. Dashed lines: 200-m isobaths. The surface chl a concentration was notably higher in the ECSMW (0.52–1.88 μg L−1) than in the other three regions (Fig. 3c). Its concentrations in the Kuroshio (0.09–1.84 μg L−1) and the KCW (0.09–0.49 μg L−1) were similar but were significantly higher than that in the NPTG (0.04–0.09 μg L−1). The surface N + N concentrations were much higher in the ECSMW (up to 7000 nM at station E14) than in the other regions (Fig. 3d). The surface N + N concentration in the Kuroshio was <60 nM at all stations excluding E35 (121 nM) and E36 (221 nM). In the KCW, the surface N + N concentration varied from below the detection limit (BDL) (3 nM) to 150 nM. In the NPTG, the surface N + N concentration was always <3 nM. The surface phosphate concentrations (Fig. 3e) were extremely low (<59 nM) in the Kuroshio and KCW and were significantly lower than in the NPTG (P < 0.05). The surface N + N/phosphate (N/P) ratio tended to be higher in the ECSMW than in other regions, and the ratio exceeded the Redfield ratio (16) at stations E13, E14 and E15 (Fig. 3f). Silicate was detectable in surface water at all stations, and its levels tended to be higher in the ECSMW (6920–19 900 nM) than in the other regions. The surface silicate concentrations in the KCW (1900–2490 nM) and NPTG (1240–2960 nM) were constant, but that in the Kuroshio varied from 1080 to 12 900 nM. Distribution of diazotrophs Trichodesmium was observed in all four regions (Fig. 4a), but it was present only at stations E10, E13 and E16 in the ECSMW. The abundance of Trichodesmium largely varied from BDL to 2.0 × 104 copies L−1 in the Kuroshio and the abundance was comparable to those in the KCW and ECSMW (Fig. 5a). On the other hand, the abundance of Trichodesmium was significantly lower in the NPTG than in the Kuroshio (P < 0.05). In total, 44% of the variation of the abundance of Trichodesmium was explained by temperature and salinity in the Kuroshio (Table IIa) and 33% was explained by salinity and phosphate in all regions (Table IIb). Fig. 4. View largeDownload slide Surface nifH abundances (log10(copies L−1)) of (a) Trichodesmium, (b) Crocosphaera, (c) UCYN-A1, (d) UCYN-C, Richelia associated with (e) Rhizosolenia (RR) or (f) Hemiaulus (HR) and (g) γ-24774A11. White circles: undetectable. Dashed lines: 200-m isobaths. Fig. 4. View largeDownload slide Surface nifH abundances (log10(copies L−1)) of (a) Trichodesmium, (b) Crocosphaera, (c) UCYN-A1, (d) UCYN-C, Richelia associated with (e) Rhizosolenia (RR) or (f) Hemiaulus (HR) and (g) γ-24774A11. White circles: undetectable. Dashed lines: 200-m isobaths. Fig. 5. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio, KCW, ECSMW and NPTG. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with the Kuroshio. Error bars: standard deviations of the means. Fig. 5. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio, KCW, ECSMW and NPTG. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with the Kuroshio. Error bars: standard deviations of the means. Table II: Multiple regression analysis of the environmental parameters on the abundance of each diazotroph using (a) all datasets and (b) dataset obtained in the Kuroshio Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS NS: not selected by Akaike information criteria (Akaike, 1974). aLevel of significance: *P < 0.05, **P < 0.01, ***P < 0.001. Table II: Multiple regression analysis of the environmental parameters on the abundance of each diazotroph using (a) all datasets and (b) dataset obtained in the Kuroshio Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS NS: not selected by Akaike information criteria (Akaike, 1974). aLevel of significance: *P < 0.05, **P < 0.01, ***P < 0.001. The unicellular cyanobacterial diazotrophs Crocosphaera, UCYN-A1 and UCYN-C did not occur in the ECSMW and were rare in the KCW (Fig. 4b–d). The abundances of Crocosphaera, UCYN-A1 and UCYN-C in the Kuroshio ranged from BDL to 8.2 × 102 copies L−1, BDL to 1.7 × 104 copies L−1 and BDL to 1.3 × 103 copies L−1, respectively. UCYN-A1 had a similar abundance as Trichodesmium in the Kuroshio, but those of Crocosphaera and UCYN-C were significantly lower than that of Trichodesmium (P < 0.05) (Fig. 6). Interestingly, the abundances of Crocosphaera, UCYN-A1 and UCYN-C were significantly lower at downstream Kuroshio stations EK1, EK2, E03, EJ2 and E04 than at upstream stations E22, E23, E24 and E25 (P < 0.05) which were all categorized as Kuroshio stations in the T–S diagram. The abundances of Crocosphaera and UCYN-A1 were significantly lower in the Kuroshio than in the NPTG (P < 0.05) (Fig. 5b and c). Meanwhile, the abundance of UCYN-C was higher in the Kuroshio than in the NPTG (Fig. 5d). In the Kuroshio, the environmental factors explained 71, 69 and 81% of the variations of the distribution patterns of Crocosphaera, UCYN-A1 and UCYN-C, respectively. However, in all regions, these factors explained only 36–46% of the variation in abundance of the unicellular cyanobacterial diazotrophs. The explanatory variables of Crocosphaera and UCYN-A1 differed between the Kuroshio and all regions. Fig. 6. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with Trichodesmium. Error bars: standard deviations of the means. Fig. 6. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with Trichodesmium. Error bars: standard deviations of the means. RR and HR were detected in all regions excluding the ECSMW (Fig. 4e and f). The abundances of RR and HR in the Kuroshio ranged from BLD to 3.3 × 103 copies L−1 and BLD to 1.8 × 103 copies L−1, respectively, both being lower than that of Trichodesmium (P < 0.05) (Fig. 6). Although the abundance of RR was lower in the Kuroshio than in the KCW (P < 0.05) (Fig. 5e), that of HR did not differ between the Kuroshio and KCW (Fig. 5f). The abundances of RR and HR in the Kuroshio were significantly elevated compared with those in the NPTG (P < 0.05). The multiple R2 values were low for both the Kuroshio and all regions. γ-24774A11 was not detected in the ECSMW. The abundance range of γ-24774A11 (1.7 × 102–2.9 × 103 copies L−1) in the Kuroshio excluding station E11 tended to be smaller than those of the other cyanobacterial diazotrophs. In the Kuroshio, γ-24774A11 had a lower abundance than Trichodesmium (P < 0.05) (Fig. 6). The abundance of γ-24774A11 in the Kuroshio was comparable with that in the KCW, whereas it was lower than that in the NPTG (P < 0.05) (Fig. 5g). The abundance of γ-24774A11 was well correlated with temperature in both the Kuroshio and all regions. DISCUSSION The community composition of diazotrophs in the Kuroshio clearly differed from those in the ECSMW and NPTG. In the Kuroshio, the abundance of cyanobacterial diazotrophs varied considerably compared with that of γ-24774A11. Below we consider some factors which might influence the distribution of diazotrophs in the basin-scale North Pacific and Kuroshio. Differences of the diazotroph community between the Kuroshio and the other regions The environmental factors explained 80% of the variations of the distribution patterns of γ-24774A11 in all regions. The abundance of γ-24774A11 was especially well correlated with temperature, and a similar relationship was reported in the South Pacific (Moisander et al., 2014). Therefore, the abundance of γ-24774A11 may be controlled by temperature or other environmental factors that act synergistically with temperature. On the other hand, only 33–46% of the abundances of cyanobacterial diazotrophs were explained by environmental data when using all datasets. Similarly, the coefficient of determination for Trichodesmium, Crocosphaera and UCYN-A1 was 0.33, 0.55 and 0.46, respectively, in the multiple regression analysis when our previous datasets in the tropical and subtropical North Pacific (Shiozaki et al., 2014b) were pooled. These results suggest that their basin-scale distributions in the North Pacific are associated with not only by the factors we investigated but also may be influenced by interspecific competition for a limiting resource as mentioned below. The distributions of cyanobacterial diazotrophs are also recognized to be related to current fields (Shiozaki et al., 2013, 2015a,b, 2017; Rivero-Calle et al., 2016) or dissolved iron (Berman-Frank et al., 2001; Saito et al., 2011). Regarding the current fields, the plankton community in the Kuroshio is distinct from that in adjacent waters because the Kuroshio transports some species from the equatorial region to a region farther north (McGowan, 1971). Therefore, it is understandable that a distinct diazotroph community occurs in the Kuroshio. Diazotroph abundances in the KCW were similar to those in the Kuroshio. The KCW stations were located in the Kuroshio bifurcation, and therefore, the diazotroph community in the KCW was possibly influenced by the Kuroshio Current. Of the cyanobacterial diazotrophs, Trichodesmium was the only form evident in the ECSMW, which is a mixture of Yellow Sea-derived water and other shelf water (Gong et al., 1996). On occasion, Trichodesmium has been detected near the Chinese coast and in the shelf region (Chang et al., 2000; Zhang et al., 2014). The other diazotrophs have not been examined in this region. The absence of DDAs, unicellular cyanobacterial diazotrophs and γ-24774A11 implies that the seed populations of these phylotypes are not present in this water mass. Iron is a well-known controlling factor of diazotrophy. For example, Trichodesmium grows poorly in iron-deficient environments but well in iron-rich environments (Berman-Frank et al., 2001). The abundance of Trichodesmium was higher in the Kuroshio than in the NPTG in the present study. A similar distribution of Trichodesmium was reported previously, and this finding was attributable to the higher dissolved iron levels of the Kuroshio waters (Shiozaki et al., 2010). In contrast, Crocosphaera and UCYN-A1 were less abundant in the Kuroshio than in the NPTG. Regarding Crocosphaera, because the organism can use iron more effectively than Trichodesmium (Saito et al., 2011), it can be thrive in the iron-depleted NPTG (Shiozaki et al., 2017), but this cannot explain why Crocosphaera did not thrive in the Kuroshio. The low abundance of Crocosphaera might be due to limited phosphorus content. The surface phosphate concentration was significantly lower in the Kuroshio than in the NPTG, and chl a levels were higher in the Kuroshio than in the NPTG. At the Pacific Ocean basin scale, Crocosphaera has a lower abundance in phosphate-depleted regions, in which Crocosphaera, Trichodesmium, and non-diazotrophs possibly compete for the available phosphorus (Sato et al., 2010). Trichodesmium can use phosphonates, which are key components of dissolved organic phosphorus, under phosphate-depleted conditions, but Crocosphaera cannot possibly due to lack of C-P lyase pathway (Dyhrman et al., 2006). The higher chl a concentration, which means higher phytoplankton biomass (Furuya, 1990), and abundant Trichodesmium in the Kuroshio suggest that Crocosphaera might be limited by phosphorus resource competition from non-diazotrophs and Trichodesmium. Crocosphaera occurs in extremely low abundance (BDL to 2.0 × 102 copies L−1) in the low-phosphate high-chl a (>0.2 μg L−1) subtropical North Atlantic (Goebel et al., 2010). It should be noted that the abundance of Crocosphaera did not show any correlation with phosphate concentrations (Table II). This may be attributable to the existence of a variable phosphate threshold that is complicatedly related with other plankton communities and/or a less clear relationship between the in situ phosphate concentration and the physiological state of Crocosphaera, as phosphate supplied to the surface would be immediately consumed, leading to an extremely low concentration. UCYN-A1 also lacks C-P lyase genes (Tripp et al., 2010). Although UCYN-A1 forms symbioses with prymnesiophytes, and thus the genome content may not simply reflect the environment, the low abundance in the Kuroshio was potentially due to the same reason for the low abundance of Crocosphaera. However, the presence or absence of C-P lyase gene alone cannot explain the distribution of diazotrophs. In particular, although Richelia intracellularis and UCYN-C lack these genes (Bandyopadhyay et al., 2011; Hilton et al., 2013), their abundances were elevated in the Kuroshio. Little is known regarding environmental factors controlling the abundances of DDAs and UCYN-C. Although DDAs were reported to be most abundant in high-silicate waters (Bar Zeev et al., 2008; Subramaniam et al., 2008), RR and HR were absent from the silicate-rich ECSMW, and their abundances were not significantly correlated with the silicate concentration. Meanwhile, our results corresponded with the previous findings that DDAs were more abundant in the Kuroshio than in the adjacent waters (Gómez et al., 2005). In this study, we found for the first time that the abundance of UCYN-C is elevated in the Kuroshio. Cheung et al. (Cheung et al., 2017) recently reported that many nifH sequences of UCYN-C were recovered from Kuroshio waters. UCYN-C is rarely detected in the high sea area of the Pacific Ocean (Church et al., 2008; Halm et al., 2012). It can be said that high abundance of UCYN-C is one of the features of the Kuroshio diazotroph community. Variations of cyanobacterial diazotrophs in the Kuroshio Interestingly, the distributions of Crocosphaera, UCYN-A1 and UCYN-C in the Kuroshio were well described by environmental parameters, a finding that clearly differed from the result using all datasets. When our previous dataset in the Kuroshio (Shiozaki et al., 2014b) was pooled, we also found high coefficient of determination for Crocosphaera (0.76) and UCYN-A1 (0.63) in the multiple regression analysis. These results suggest that undetermined factors such as dissolved iron would little limit their abundance within the Kuroshio. Salinity, phosphate and the N/P ratio explained 81% of the distribution pattern of UCYN-C in the Kuroshio. The abundances of Crocosphaera and UCYN-A1 in the Kuroshio are known to be positively correlated with temperature within the observed temperature range (Shiozaki et al., 2014b), and the same trends were found in the present study. However, this relationship did not hold in the downstream Kuroshio. The abundance of Crocosphaera and UCYN-A1 was lower at downstream Kuroshio stations than at upstream stations, whereas temperature was higher at downstream Kuroshio stations (P < 0.05). The abundance of Crocosphaera and UCYN-A1 was previously reported in the Kuroshio southeast of Taiwan (21.4°N, 122–122.5°E) (Shiozaki et al., 2014b). Crocosphaera was present at levels >1.0 × 103 copies L−1 throughout the year in Kuroshio southeast of Taiwan (Shiozaki et al., 2014b), but its abundance was always <1.0 × 103 copies L−1 in the Kuroshio in our study area. These results indicate that the abundance of Crocosphaera decreases during delivery by the Kuroshio, which may be caused by low phosphorus availability for their growth in the Kuroshio. In contrast, UCYN-A1 abundance varied from BDL to 1.9 × 104 copies L−1 in the surface water of Kuroshio southeast of Taiwan (Shiozaki et al., 2014b), which was comparable with that in our study area (BDL to 1.7 × 104 copies L−1). Thus, it is not clear whether the decreasing trend of UCYN-A1 in the Kuroshio was robust, and future studies should establish their general distribution and the factors involved in their distribution. Compared to unicellular diazotrophs, environmental parameters were poorly associated with the distribution patterns of Trichodesmium, RR and HR in the Kuroshio. Similarly, in the pooled multiple regression analysis of present and previous datasets (Shiozaki et al., 2014b), environmental parameters only explain 53% of the variation in abundance of Trichodesmium. Regarding the distribution of Trichodesmium, Shiozaki et al. (2015a) also showed that there was no significant correlation between Trichodesmium abundance and environmental variables in the Kuroshio. This could be because the abundance of Trichodesmium in the Kuroshio is highly influenced by the current’s collection of Trichodesmium growing around the Ryukyu Islands (Shiozaki et al., 2015a). The heterogeneity of RR and HR might be explained as well since DDAs also increased near oceanic islands (Shiozaki et al., 2010). CONCLUSION We characterized a distinctive diazotroph community in the Kuroshio, the “hot spot” of nitrogen fixation in the Pacific Ocean. Although Crocosphaera is considered to be distributed extensively in the North Pacific (Saito et al., 2011), we found abundance was lower in the Kuroshio than in the NPTG, and decreased from upstream to downstream in the Kuroshio. This pattern could be attributable to the low-phosphate and high-chl a environment of the Kuroshio. Trichodesmium was major diazotrophs in the whole area of Kuroshio as expected (Marumo and Asaoka, 1974; Chen et al., 2008; Shiozaki et al., 2015a) while, in the upstream Kuroshio, UCYN-A1 was similar in numerical to Trichodesmium. Although lower in abundances than the two aforementioned diazotrophs, the abundances of HR, RR and UCYN-C were higher in the Kuroshio than in the adjacent waters. DDAs and UCYN-C are known to have high-sinking rates due to the high cell density of their host diatom and the aggregate formation, respectively (Subramaniam et al. 2008; Bonnet et al., 2016), while Trichodesmium have gas vacuoles and becomes buoyant (Capone et al., 1997). Hence, higher abundance of DDAs and UCYN-C in the Kuroshio suggested that they could be key controllers of the export production in this region. Further detailed studies of spatial and temporal dynamics of DDAs and UCYN-C, therefore, would be important for better understanding of the biogeochemical cycles in the Kuroshio. ACKNOWLEDGEMENTS We thank J. Zhang; H. Ogawa; and the captains, crew members and participants of the T/V Kakuyo-maru and R/V Hakuho-maru cruises for their cooperation at sea. We also thank Y. Tada for his suggestion on statistical analyses, Y. Nakaguchi, H. Ogawa and F. Hashihama for sharing their N + N and phosphate data and for their assistance with silicate analysis during the R/V Hakuho-maru cruises, and anonymous reviewers for helpful comments on the manuscript. Funding This research was supported financially by JSPS KAKENHI grant nos JP25-7341, JP24121006, JP26241009, JP16K12586 and JP18H03361. REFERENCES Akaike , H. ( 1974 ) A new look at the statistical model identification . IEEE Trans. Automat. Contr. , 19 , 716 – 723 . Google Scholar CrossRef Search ADS Bandyopadhyay , A. , Elvitigala , T. , Welsh , E. , Stöckel , J. , Liberton , M. , Min , H. , Sherman , L. A. and Pakrasi , H. B. ( 2011 ) Novel metabolic attributes of the genus Cyanothece, comprising a group of unicellular nitrogen-fixing cyanobacteria . MBio , 2 , e00214-11. Berman-Frank , I. , Cullen , J. T. , Shaked , Y. , Sherrell , R. M. and Falkowski , P. G. ( 2001 ) Iron availability, cellular iron quotas, and nitrogen fixation in Trichodesmium . Limnol. Oceanogr. , 46 , 1249 – 1260 . Google Scholar CrossRef Search ADS Bombar , D. , Paerl , R. W. and Riemann , L. ( 2016 ) Marine non-cyanobacterial diazotrophs: Moving beyond molecular detection . Trends Microbiol. , 24 , 916 – 927 . Google Scholar CrossRef Search ADS PubMed Bonnet , S. , Berthelot , H. , Turk-Kubo , K. , Fawcett , S. , Rahav , E. , L’Helguen , S. and Berman-Frank , I. ( 2016 ) Dynamics of N2 fixation and fate of diazotroph-derived nitrogen in a low-nutrient, low-chlorophyll ecosystem: result from the VAHINE mesocosm experiment (New Caledonia) . Biogeosciences , 13 , 2653 – 2673 . Google Scholar CrossRef Search ADS Capone , D. G. , Zehr , J. P. , Paerl , H. W. , Bergman , B. and Carpenter , E. J. ( 1997 ) Trichodesmium, a globally significant marine cyanobacterium . Science , 276 , 1221 – 1229 . Google Scholar CrossRef Search ADS Chang , J. , Chiang , K.-P. and Gong , G.-C. ( 2000 ) Seasonal variation and cross-shelf distribution of the nitrogen-fixing cyanobacterium, Trichodesmium, in southern East China Sea . Cont. Shelf Res. , 20 , 479 – 492 . Google Scholar CrossRef Search ADS Chen , Y.-L. L. , Chen , H. Y. , Lin , Y.-H. , Yong , T.-C. , Taniuchi , Y. and Tuo , S.-H. ( 2014 ) The relative contributions of unicellular and filamentous diazotrophs to N2 fixation in the South China Sea and the upstream Kuroshio . Deep Sea Res. Part I , 85 , 56 – 71 . Google Scholar CrossRef Search ADS Chen , Y.-L. L. , Chen , H.-Y. , Tuo , S.-H. and Ohki , K. ( 2008 ) Seasonal dynamics of new production from Trichodesmium N2 fixation and nitrate uptake in the upstream Kuroshio and South China Sea basin . Limnol. Oceanogr. , 53 , 1705 – 1721 . Google Scholar CrossRef Search ADS Cheung , S. , Suzuki , K. , Saito , H. , Umezawa , Y. , Xia , X. and Liu , H. ( 2017 ) Highly heterogenous diazotroph communities in the Kuroshio Current and the Tokara Strait, Japan . PLoS One , 12 , e0186875 . Google Scholar CrossRef Search ADS PubMed Church , M. J. , Björkman , K. M. , Karl , D. M. , Saito , M. A. and Zehr , J. P. ( 2008 ) Regional distributions of nitrogen-fixation bacteria in the Pacific Ocean . Limnol. Oceanogr. , 53 , 63 – 77 . Google Scholar CrossRef Search ADS Dyhrman , S. T. , Chappell , P. D. , Haley , S. T. , Moffett , J. W. , Orchard , E. D. , Waterbury , J. B. and Webb , E. A. ( 2006 ) Phosphonate utilization by the globally important marine diazotroph Trichodesmium . Nature , 439 , 68 – 71 . Google Scholar CrossRef Search ADS PubMed Farnelid , H. , Turk-Kubo , K. , Muñoz-Marín , M. C. and Zehr , J. P. ( 2016 ) New insights into the ecology of the globally significant uncultured nitrogen-fixing symbiont UCYN-A . Aquat. Microb. Ecol. , 77 , 125 – 138 . Google Scholar CrossRef Search ADS Foster , R. A. , Kuypers , M. M. M. , Vagner , T. , Paerl , R. W. , Musat , N. and Zehr , J. P. ( 2011 ) Nitrogen fixation and transfer in open ocean diatom-cyanobacterial symbioses . ISME J. , 5 , 1484 – 1493 . Google Scholar CrossRef Search ADS PubMed Foster , R. A. , Subramaniam , A. , Mahaffey , C. , Carpenter , E. J. , Capone , D. G. and Zehr , J. P. ( 2007 ) Influence of the Amazon River plume on distributions of free-living and symbiotic cyanobacteria in the western tropical north Atlantic Ocean . Limnol. Oceanogr. , 52 , 517 – 532 . Google Scholar CrossRef Search ADS Furuya , K. ( 1990 ) Subsurface chlorophyll maximum in the tropical and subtropical western Pacific Ocean: vertical profiles of phytoplankton biomass and its relationship with chlorophyll a and particulate organic carbon . Mar. Biol. , 107 , 529 – 539 . Google Scholar CrossRef Search ADS Glibert , P. M. and Bronk , D. A. ( 1994 ) Release of dissolved organic nitrogen by marine diazotrophic cyanobacteria, Trichodesmium spp . Appl. Environ. Microbiol. , 60 , 3996 – 4000 . Google Scholar PubMed Goebel , N. , Turk , K. A. , Achilles , K. M. , Paerl , R. , Hewson , I. , Morrison , A. E. , Montoya , J. P. , Edwards , C. A. et al. . ( 2010 ) Abundance and distribution of major groups of diazotrophic cyanobacteria and their potential contribution to N2 fixation in the tropical Atlantic Ocean . Environ. Microbiol. , 12 , 3272 – 3289 . Google Scholar CrossRef Search ADS PubMed Gong , G.-C. , Chen , Y.-L. L. and Liu , K.-K. ( 1996 ) Chemical hydrography and chlorophyll a distribution in the East China Sea in summer: implications in nutrient dynamics . Cont. Shelf Res. , 16 , 1561 – 1590 . Google Scholar CrossRef Search ADS Gruber , N. and Galloway , J. N. ( 2008 ) An Earth-system perspective of the global nitrogen cycle . Nature , 451 , 293 – 296 . Google Scholar CrossRef Search ADS PubMed Gómez , F. , Furuya , K. and Takeda , S. ( 2005 ) Distribution of the cyanobacterium Richelia intracellularis ad and epiphyte of the diatom Chaetoceros compressus in the western Pacific Ocean . J. Plankton Res. , 27 , 323 – 330 . Google Scholar CrossRef Search ADS Halm , H. , Lam , P. , Ferdelman , T. G. , Lavik , G. , Dittmar , T. , LaRoche , J. , D’Hondt , S. and Kuypers , M. M. M. ( 2012 ) Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre . ISME J. , 6 , 1238 – 1249 . Google Scholar CrossRef Search ADS PubMed Hashihama , F. , Furuya , K. , Kitajima , S. , Takeda , S. , Takemura , T. and Kanda , J. ( 2009 ) Macro-scale exhausion of surface phosphate by dinitrogen fixation in the western North Pacific . Geophys. Res. Lett. , 36 , L03610 . Google Scholar CrossRef Search ADS Hilton , J. A. , Foster , R. A. , Tripp , H. J. , Carter , B. J. , Zehr , J. P. and Villareal , T. A. ( 2013 ) Genomic deletions disrupt nitrogen metabolism pathways of a cyanobacterial diatom symbiont . Nat. Commun. , 4 , 1767 , doi:10.1038/ncomms2748 . Google Scholar CrossRef Search ADS PubMed Karl , D. , Letelier , R. , Tupas , L. , Dore , J. , Christian , J. and Hebel , D. ( 1997 ) The role of nitrogen fixation in biogeochemical cycling in the subtropical North Pacific Ocean . Nature , 388 , 533 – 538 . Google Scholar CrossRef Search ADS Kodama , T. , Furuya , K. , Hashihama , F. , Takeda , S. and Kanda , J. ( 2011 ) Occurrence of rain-origin nitrate patches at the nutrient-depleted surface in the East China Sea and the Philippine Sea during summer . J. Geophys. Res. , 116 , C08003 . Google Scholar CrossRef Search ADS Krupke , A. , Mohr , W. , LaRoche , J. , Fuchs , B. M. , Amann , R. I. and Kuypers , M. M. M. ( 2015 ) The effect of nutrients on carbon and nitrogen fixation by the UCYN-A-haptophyte symbiosis . ISME J. , 9 , 1635 – 1647 . Google Scholar CrossRef Search ADS PubMed Langlois , R. , Großkopf , T. , Mills , M. , Takeda , S. and LaRoche , J. ( 2015 ) Widespread distribution and expression of Gamma A (UMB), an uncultured, diazotrophic, γ-proteobacterial nifH phylotype . PLoS One , 10 , e0128912 . Google Scholar CrossRef Search ADS PubMed Langlois , R. J. , Hümmer , D. and LaRoche , J. ( 2008 ) Abundances and distributions of the dominant nifH phylotypes in the Northern Atlantic Ocean . Appl. Environ. Microbiol. , 74 , 1922 – 1931 . Google Scholar CrossRef Search ADS PubMed Liu , X. , Furuya , K. , Shiozaki , T. , Masuda , T. , Kodama , T. , Sato , M. , Kaneko , H. , Nagawasa , M. et al. ( 2013 ) Variability in nitrogen source for new production in the vicinity of the shelf edge of the East China Sea in summer . Cont. Shelf Res. , 61–62 , 23 – 30 . Google Scholar CrossRef Search ADS Martínez-Pérez , C. , Mohr , W. , Löscher , C. R. , Dekaezemacker , J. , Littmann , S. , Yilmaz , P. , Lehnen , N. , Fuchs , B. M. et al. . ( 2016 ) The small unicellular diazotrophic symbiont, UCYN-A, is a key player in the marine nitrogen cycle . Nat. Microbiol. , 1 , 16163 . Google Scholar CrossRef Search ADS PubMed Marumo , R. and Asaoka , O. ( 1974 ) Trichodesmium in the East China Sea. 1. Distribution of Trichodesmium thiebautii GOMONT during 1961–1967 . J. Oceanogr. Soc. Japan , 30 , 298 – 303 . Google Scholar CrossRef Search ADS McGowan , J. A. ( 1971 ) Oceanic biogeography of the Pacific. In Funnell , B.M. and Riedel , W.R. (eds) , The Micropaleontology of Oceans . Cambridge University Press , Cambridge, UK , pp. 3 – 74 . Moisander , P. H. , Beinart , R. A. , Hewson , I. , White , A. E. , Johnson , K. S. , Carlson , C. A. , Montoya , J. P. and Zehr , J. P. ( 2010 ) Unicellular cyanobacterial distributions broaden the oceanic N2 fixation domain . Science , 327 , 1512 – 1514 . Google Scholar CrossRef Search ADS PubMed Moisander , P. H. , Serros , T. , Paerl , R. W. , Beinart , R. A. and Zehr , J. P. ( 2014 ) Gammaproteobacterial diazotrophs and nifH gene expression in surface waters of the South Pacific Ocean . ISME J. , 8 , 1962 – 1973 . Google Scholar CrossRef Search ADS PubMed Montoya , J. P. , Holl , C. M. , Zehr , J. P. , Hansen , A. , Villareal , T. A. and Capone , D. G. ( 2004 ) High rates of N2 fixation by unicellular diazotrophs in the oligotrophic Pacific Ocean . Nature , 430 , 1027 – 1031 . Google Scholar CrossRef Search ADS PubMed Riemann , L. , Farnelid , H. and Steward , G. F. ( 2010 ) Nitrogenase genes in non-cyanobacterial plankton: prevalence, diversity and regulation in marine waters . Aquat. Microb. Ecol ., 61 , 235 – 247 . Google Scholar CrossRef Search ADS Rivero-Calle , S. , Del Castillo , C. E. , Gnanadesikan , A. , Dezfuli , A. , Zaitchik , B. and Johns , D. G. ( 2016 ) Interdecadal Trichodesmium variability in cold North Atlantic waters . Global Biogeochem. Cycles , 30 , 1620 – 1638 . Google Scholar CrossRef Search ADS Saito , M. A. , Bertrand , E. M. , Dutkiewicz , S. , Bulygin , V. V. , Moran , D. M. , Monteiro , F. M. , Follows , M. J. , Valois , F. W. et al. . ( 2011 ) Iron conservation by reduction of metalloenzyme inventories in the marine diazotroph Crocosphaera watsonii . Proc. Natl Acad. Sci. USA , 108 , 2184 – 2189 . Google Scholar CrossRef Search ADS Sato , M. , Hashihama , F. , Kitajima , S. and Takeda , S. ( 2010 ) Distribution of nano-sized Cyanobacteria in the western and central Pacific Ocean . Aquat. Microb. Ecol. , 59 , 273 – 282 . Google Scholar CrossRef Search ADS Shiozaki , T. , Bombar , D. , Riemann , L. , Hashihama , F. , Takeda , S. , Yamaguchi , T. , Ehama , M. , Hamasaki , K. et al. ( 2017 ) Basin scale variability of active diazotrophs and nitrogen fixation in the North Pacific, from the tropics to the subarctic Bering Sea . Global Biogeochem. Cycles , 31 , 996 – 1009 doi:10.1002/2017GB005681 . Google Scholar CrossRef Search ADS Shiozaki , T. , Chen , T.-L. L. , Lin , Y.-H. , Taniuchi , Y. , Sheu , D.-S. , Furuya , K. and Chen , H.-Y. ( 2014 b) Seasonal variations of unicellular diazotroph groups A and B, and Trichodesmium in the northern South China Sea and neighboring upstream Kuroshio Current . Cont. Shelf Res ., 80 , 20 – 31 . Google Scholar CrossRef Search ADS Shiozaki , T. , Furuya , K. , Kodama , T. , Kitajima , S. , Takeda , S. , Takemura , T. and Kanda , J. ( 2010 ) New estimation of N2 fixation in the western and central Pacific Ocean and its marginal seas . Global Biogeochem. Cycles , 24 , GB1015 . Google Scholar CrossRef Search ADS Shiozaki , T. , Ijichi , M. , Kodama , T. , Takeda , S. and Furuya , K. ( 2014 a) Heterotrophic bacteria as major nitrogen fixers in the euphotic zone of the Indian Ocean . Global Biogeochem. Cycles , 28 , 1096 – 1110 . Google Scholar CrossRef Search ADS Shiozaki , T. , Kodama , T. , Kitajima , S. , Sato , M. and Furuya , K. ( 2013 ) Advective transport of diazotrophs and importance of their nitrogen fixation on new and primary production in the western Pacific warm pool . Limnol. Oceanogr. , 58 , 49 – 60 . Google Scholar CrossRef Search ADS Shiozaki , T. , Nagata , T. , Ijichi , M. and Furuya , K. ( 2015 b) Nitrogen fixation and the diazotroph community in the temperate coastal region of the northwestern North Pacific . Biogeosciences , 12 , 4751 – 4764 . Google Scholar CrossRef Search ADS Shiozaki , T. , Takeda , S. , Itoh , S. , Kodama , T. , Liu , X. , Hashihama , F. and Furuya , K. ( 2015 a) Why is Trichodesmium abundant in the Kuroshio? Biogeosciences , 12 , 6931 – 6943 . Google Scholar CrossRef Search ADS Subramaniam , A. , Yager , P. L. , Carpenter , E. J. , Mahaffey , C. , Björkman , K. , Cooley , S. , Kustka , A. B. , Montoya , J. P. et al. ( 2008 ) Amazon River enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean . Proc. Natl Acad. Sci. USA , 105 , 10460 – 10465 . Google Scholar CrossRef Search ADS Tripp , H. J. , Bench , S. R. , Turk , K. A. , Foster , R. A. , Desany , B. A. , Niazi , F. , Affourtit , J. P. and Zehr , J. P. ( 2010 ) Metabolic streamlining in an open-ocean nitrogen-fixing cyanobacterium . Nature , 464 , 90 – 94 . Google Scholar CrossRef Search ADS PubMed Vanables , W. N. and Ripley , B. D. ( 2002 ) Modern Applied Statistics with S , 4th edn. Springer , New York . Google Scholar CrossRef Search ADS Zeev , E.B. , Yogev , T. , Man-Aharonovich , D. , Kress , N. , Herut , B. , Béjà , O. and Berman-Frank , I. ( 2008 ) Seasonal dynamics of the endosymbiotic, nitrogen-fixing cyanobacterium Richelia intracellularis in the eastern Mediterranean Sea . ISME J. , 2 , 911 – 923 . Google Scholar CrossRef Search ADS PubMed Zehr , J. P. , Jenkins , B. D. , Short , S. M. and Steward , G. F. ( 2003 ) Nitrogenase gene diversity and microbial community structure: a cross-system comparison . Environ. Microbiol. , 5 , 539 – 554 . Google Scholar CrossRef Search ADS PubMed Zehr , J. P. , Waterbury , J. B. , Turner , P. J. , Montoya , J. P. , Omoregie , E. , Steward , G. F. , Hansen , A. and Karl , D. M. ( 2001 ) Unicellular cyanobacteria fix N2 in the subtropical North Pacific Ocean . Nature , 412 , 635 – 638 . Google Scholar CrossRef Search ADS PubMed Zhang , D.-S. , Lu , D.-D. , Li , H.-L. , Ni , X.-B. , Wang , C.-S. and Jiang , Z.-B. ( 2014 ) Seasonal dynamics of Trichodesmium in the northern East China Sea . Cont. Shelf Res. , 88 , 161 – 170 . Google Scholar CrossRef Search ADS Author notes Corresponding editor: Pia Moisander © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Plankton Research Oxford University Press

Distribution of major diazotrophs in the surface water of the Kuroshio from northeastern Taiwan to south of mainland Japan

Journal of Plankton Research , Volume Advance Article (4) – Jul 11, 2018

Loading next page...
 
/lp/oxford-university-press/distribution-of-major-diazotrophs-in-the-surface-water-of-the-kuroshio-hBUgM01c1s
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0142-7873
eISSN
1464-3774
D.O.I.
10.1093/plankt/fby027
Publisher site
See Article on Publisher Site

Abstract

Abstract We investigated the composition and distribution of diazotrophs in waters of the Kuroshio, the “hot spot” of nitrogen fixation in the Pacific Ocean, as well as in adjacent waters and the North Pacific tropical gyre (NPTG). Specifically, we explored the abundance of nifH in seven commonly observed diazotrophs: Trichodesmium, Crocosphaera, UCYN-A, UCYN-C, Richelia associated with Rhizosolenia (RR) or Hemiaulus (HR) and a gammaproteobacterium (γ-24774A11). The surface diazotroph community in the Kuroshio was distinguished from those in other waters by its higher abundances of Trichodesmium, RR, HR and UCYN-C. The distributions of these diazotrophs were not well explained by temperature and macronutrient concentrations, although they may be influenced by the current flow and micronutrient content. γ-24774A11 occurred extensively in the oligotrophic waters, and its abundance was significantly correlated with water temperature. The surface abundances of Crocosphaera and UCYN-A1 decreased from upstream to downstream in the Kuroshio, and their abundances were lower in the Kuroshio than in the NPTG. Temperature and nitrate + nitrite levels were comparable between the Kuroshio and NPTG, but phosphate and chlorophyll a level were lower and higher, respectively, in the Kuroshio. These results suggest that the growth of Crocosphaera and UCYN-A1 in the Kuroshio may be regulated by phosphorus availability, which would be severely limited due to intense competition with non-diazotrophs and other diazotrophs. INTRODUCTION Nitrogen fixation is the process by which dinitrogen gas is converted to ammonia, the major source of reactive nitrogen in the ocean, thereby maintaining the nitrogen inventory (Gruber and Galloway, 2008). In oligotrophic tropical and subtropical oceans, nitrogen fixation is a significant source of new production, and the process influences primary and export production in these ecosystems (Karl et al., 1997; Subramaniam et al., 2008; Shiozaki et al., 2013; Bonnet et al., 2016). Nitrogen fixation is mediated by specialized prokaryotes termed “diazotrophs”. The filamentous cyanobacterium genus Trichodesmium and diatom-diazotroph associations (DDAs) have long been studied in the evaluation of oceanic nitrogen fixation. However, nano- and pico-planktonic diazotrophs, including unicellular cyanobacteria and heterotrophic bacteria, were recently discovered via molecular approaches (Zehr et al., 2001, 2003; Riemann et al., 2010; Bombar et al., 2016). These organisms are currently recognized to significantly contribute to oceanic nitrogen fixation (Montoya et al., 2004; Halm et al., 2012; Shiozaki et al., 2014a; Martínez-Pérez et al., 2016). Diazotrophs differ physiologically, and thus, they are expected to exhibit different distributions (Dyhrman et al., 2006; Moisander et al., 2010; Saito et al., 2011). Accumulating evidence suggests that the fates of fixed nitrogen depend on the type of diazotroph involved (Glibert and Bronk, 1994; Foster et al., 2011; Krupke et al., 2015). Therefore, understanding the biogeographical features of diazotrophs is essential for exploring the biogeochemical cycles of tropical and subtropical oligotrophic oceans. In this study, we focused on the surface diazotroph community of the Kuroshio Current, in which the extent of nitrogen fixation is greater than that in the North Pacific tropical gyre (NPTG) (termed the hot spot of nitrogen fixation, Shiozaki et al., 2010). Nitrogen fixation activity in the Kuroshio is known to be highest in surface waters (Liu et al., 2013; Shiozaki et al., 2010, 2015a; Chen et al., 2014). The biogeography of Trichodesmium in the Kuroshio has been well studied (e.g. Marumo and Asaoka, 1974; Chang et al., 2000; Chen et al., 2008; Shiozaki et al., 2015a), but other diazotrophs, especially nano- and pico-planktonic diazotrophs, have received less attention (Shiozaki et al., 2014b; Langlois et al., 2015; Cheung et al., 2017). In this study, we determined the abundance of nifH in seven major diazotrophic phylotypes in the Kuroshio, adjacent waters and the NPTG. Our study region covered the ~1750-km long Kuroshio from northeastern Taiwan to south of mainland Japan. The Kuroshio enters the East China Sea off eastern Taiwan, flows along the edge of the continental shelf, and returns to the Pacific Ocean through the Tokara Strait. A branch of the Kuroshio bifurcates northward into the East China Sea. We characterized the surface diazotroph community in the Kuroshio in comparison with those in other waters and examined the factor(s) determining their distribution within the Kuroshio and in the basin-wide tropical and subtropical North Pacific. MATERIALS AND METHODS Hydrography and nutrient and chlorophyll a measurements Samples were obtained during cruises made by the T/V Kakuyo-maru KY513 (September 3–6, 2015) and R/V Hakuho-maru KH-15-3 (October 14 to 2 November 2015) in the western North Pacific, and R/V Hakuho-maru KH-14-3 (June 23 to 11 August 2014) in the NPTG (Fig. 1). Temperature and salinity profiles were measured using an SBE 911 plus CTD system (Sea-Bird Electronics, Inc., Washington, DC, USA) during the three cruises. Surface water samples were collected using a bucket or from the underway water supply (~2.5 m, Kakuyo-maru; ~5 m, Hakuho-maru). Excluding the surface samples, samples were collected using Niskin-X bottles. Water samples for nutrient and chlorophyll (chl) a measurements were collected from 3 to 12 depths within the upper 200 m except at stations EK1, EK2 and EJ2. Samples for DNA analysis were collected from the surface water. Fig. 1. View largeDownload slide Sampling stations in the western North Pacific during the KY513 (triangles) and KH-15-3 (circles) cruises and in the NPTG during the KH-14-3 (squares) cruise. The shaded dashed line indicates the approximate position of the Kuroshio axis during the KH-15-3 cruise (http://www1.kaiho.mlit.go.jp/KANKYO/KAIYO/qboc/). Dashed lines denote the 200-m isobaths. The stations enclosed by the solid line in the western North Pacific are classified as ECSMW stations. Surface samples at stations EK1, EK2, EJ2, Ka1, Ka2, Ka11 and Ka14 were collected from the underway water supply, and those at the other stations were collected using a bucket. Fig. 1. View largeDownload slide Sampling stations in the western North Pacific during the KY513 (triangles) and KH-15-3 (circles) cruises and in the NPTG during the KH-14-3 (squares) cruise. The shaded dashed line indicates the approximate position of the Kuroshio axis during the KH-15-3 cruise (http://www1.kaiho.mlit.go.jp/KANKYO/KAIYO/qboc/). Dashed lines denote the 200-m isobaths. The stations enclosed by the solid line in the western North Pacific are classified as ECSMW stations. Surface samples at stations EK1, EK2, EJ2, Ka1, Ka2, Ka11 and Ka14 were collected from the underway water supply, and those at the other stations were collected using a bucket. Nitrate + nitrite (N + N) and phosphate concentrations at the surface were determined using supersensitive colorimetric systems (Hashihama et al., 2009). Their detection limits were 2–3 and 3–4 nM, respectively. Silicate concentrations during all three cruises were determined colorimetrically using QuAAtro, AACS IV and AACS II auto-analyzers (SEAL Analytical Ltd). Silicate concentration was not determined below 0.5 μM. Chl a concentrations were measured fluorometrically using a 10-AU fluorometer (Turner Designs, Inc. San Jose, CA, USA) after sample extraction with N,N-dimethylformamide. DNA sampling, extraction and qPCR assays Seawater samples for DNA extraction (2.3 L) were filtered through Sterivex-GP pressure filters with 0.22-μm pores (Millipore, Billerica, MA, USA) and then stored at −20°C prior to onshore analysis. DNA was extracted using ChargeSwitch Forensic DNA Purification kits (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol (Shiozaki et al., 2015b, 2017). qPCR analysis targeted the seven nifH phylotypes commonly detected in tropical and subtropical oligotrophic oceans worldwide, namely Trichodesmium, Crocosphaera, UCYN-A1, UCYN-C, Richelia associated with Rhizosolenia (RR) or Hemiaulus (HR) and a gammaproteobacterium (γ-24774A11). The utilized TaqMan probe and primer sets have been described previously (Table I). Among target diazotrophs, UCYN-A1 is of particular concern when comparing the abundance to those in other studies because of the potential presence of UCYN-A sublineages. The primer and probe set of UCYN-A1 used in the present study is more specific to UCYN-A1 than the other published ones (Farnelid et al., 2016) and do not cross-react with nifH sequence of UCYN-A2 (Shiozaki et al., 2017). All qPCR analyses were performed using a LightCycler 480 System (Roche Applied Science, Penzberg, Germany). Each reaction mixture (20 μL) contained 10 μL of 2× Premix Ex Taq (Probe qPCR; Takara Bio, Shiga, Japan), 5.6 μL of nuclease-free water, 1 μL each of the forward and reverse primers (10 μmol L−1), 0.4 μL of 10 μmol L−1 TaqMan probe and 2 μL of template DNA. All qPCR assays were performed in triplicate. The qPCR efficiency ranged from 92.7 to 99.7% (average, 96.3%). Sterile distilled water served as a control. As the negative control was not amplified, and 2 μL of template DNA in 150 μL of TE were used in the qPCR assay, ≥75 copies L−1 were considered detectable for all seven diazotrophs. Table I: Primers, TaqMan probes, and standard clones for the qPCR assays Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Table I: Primers, TaqMan probes, and standard clones for the qPCR assays Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Type Forward primer 5′---3′ Probe 5′---3′ Reverse primer 5′---3′ Standard clone Reference Trichodesmium GACGAAGTATTGAAGCCAGGTTTC CATTAAGTGTGTTGAGTCTGGTGGTCCTG ACGGCCAGCGCAACCTA AB928304 Shiozaki et al. (2014b) Crocosphaera AGGCATCAAGTGTGTAGAATCTGGTG CTGAGCCTGGAGTTGGTTGTGCTGGTCGT CTTCTTCTAGGAAGTTGATGGAGGTG AB928305 Shiozaki et al. (2014b) UCYN-A1 GAAGTAGTAATTCCTGGCTATAACAACG ATGCGTTGAGTCCGGTGGTCCTGAGCCTG GCAGTAATAATACCACGACCAGCAC AB928219 Shiozaki et al. (2014b) Rhizosolenia clevei–Richelia (RR) CGGTTTCCGTGGTGTACGTT TCCGGTGGTCCTGAGCCTGGTGT AATACCACGACCCGCACAAC DQ118191 Foster et al. (2007) Hemiaulus haukii–Richelia (HR) TGGTTACCGTGATGTACGTT TCTGGTGGTCCTGAGCCTGGTGT AATGCCGCGACCAGCACAAC DQ225754 Foster et al. (2007) UCYN-C TCTACCCGTTTGATGCTACACACTAA AAACTACCATTCTTCACTTAGCAG GGTATCCTTCAAGTAGTACTTCGTCTAGCT AY896461 Langlois et al. (2008) γ-proteobacteria (γ-2477A11) CGGTAGAGGATCTTGAGCTTGAA AAGTGCTTAAGGTTGGCTTTGGCGACA CACCTGACTCCACGCACTTA AB928220 Moisander et al. (2010) Statistical analysis We compared the surface abundances of diazotrophs with that of Trichodesmium, which is well studied in our study regions, to illustrate the numerical importance of each diazotroph in each region. Furthermore, we examined the difference between the abundance of each diazotroph in the Kuroshio and those in the other regions to characterize the diazotroph community in the Kuroshio. Significant differences were determined using the Mann–Whitney U test. We performed multiple regression analysis to investigate the relationship between diazotroph abundance and environmental parameters. All data were log (x + 1)-transformed to standardize variances before the analysis. We used the Akaike information criterion (Akaike, 1974) for model selection using the MASS package (Venables and Ripley, 2002) in R software. RESULTS Environmental conditions In the western North Pacific, the water masses cluster into three groups on a temperature–salinity (T–S) diagram (Fig. 2). Using the criteria of Gong et al. (Gong et al.,1996) and the location, we divided the low-temperature, low-salinity water and the high-salinity water encountered during the KH-15-3 cruise into East China Sea Mixed Water (ECSMW) and Kuroshio water, respectively. The high-temperature, low-salinity water encountered during the KY513 cruise was not included in the specific water masses defined by Gong et al. (Gong et al.,1996), indicating that we explored a different geographical region. The surface salinity is lower near the Kyushu region than in the Kuroshio (Kodama et al., 2011). We thus defined low-salinity water as Kyushu Coastal Water (KCW). The surface temperature ranges of the ECSMW, Kuroshio and KCW were 21.7–23.3, 24.1–28.2 and 26.2–27.5°C, respectively (Figs 2 and 3a). The surface temperature of the NPTG (24.2–28.2°C) was comparable to those of the Kuroshio and KCW. The surface salinity of the NPTG (34.6–35.5) tended to be higher than that of Kuroshio water (33.6–34.9; Figs 2 and 3b). Fig. 2. View largeDownload slide T–S diagram of the surface waters. The various water types are described in the text. Fig. 2. View largeDownload slide T–S diagram of the surface waters. The various water types are described in the text. Fig. 3. View largeDownload slide Surface distributions of (a) temperature (°C), (b) salinity, (c) chlorophyll a (μg L−1), (d) nitrate + nitrite (N + N) (nM), (e) phosphate (nM), (f) N + N/phosphate ratio and (g) silicate (nM). White circles: undetectable. Dashed lines: 200-m isobaths. Fig. 3. View largeDownload slide Surface distributions of (a) temperature (°C), (b) salinity, (c) chlorophyll a (μg L−1), (d) nitrate + nitrite (N + N) (nM), (e) phosphate (nM), (f) N + N/phosphate ratio and (g) silicate (nM). White circles: undetectable. Dashed lines: 200-m isobaths. The surface chl a concentration was notably higher in the ECSMW (0.52–1.88 μg L−1) than in the other three regions (Fig. 3c). Its concentrations in the Kuroshio (0.09–1.84 μg L−1) and the KCW (0.09–0.49 μg L−1) were similar but were significantly higher than that in the NPTG (0.04–0.09 μg L−1). The surface N + N concentrations were much higher in the ECSMW (up to 7000 nM at station E14) than in the other regions (Fig. 3d). The surface N + N concentration in the Kuroshio was <60 nM at all stations excluding E35 (121 nM) and E36 (221 nM). In the KCW, the surface N + N concentration varied from below the detection limit (BDL) (3 nM) to 150 nM. In the NPTG, the surface N + N concentration was always <3 nM. The surface phosphate concentrations (Fig. 3e) were extremely low (<59 nM) in the Kuroshio and KCW and were significantly lower than in the NPTG (P < 0.05). The surface N + N/phosphate (N/P) ratio tended to be higher in the ECSMW than in other regions, and the ratio exceeded the Redfield ratio (16) at stations E13, E14 and E15 (Fig. 3f). Silicate was detectable in surface water at all stations, and its levels tended to be higher in the ECSMW (6920–19 900 nM) than in the other regions. The surface silicate concentrations in the KCW (1900–2490 nM) and NPTG (1240–2960 nM) were constant, but that in the Kuroshio varied from 1080 to 12 900 nM. Distribution of diazotrophs Trichodesmium was observed in all four regions (Fig. 4a), but it was present only at stations E10, E13 and E16 in the ECSMW. The abundance of Trichodesmium largely varied from BDL to 2.0 × 104 copies L−1 in the Kuroshio and the abundance was comparable to those in the KCW and ECSMW (Fig. 5a). On the other hand, the abundance of Trichodesmium was significantly lower in the NPTG than in the Kuroshio (P < 0.05). In total, 44% of the variation of the abundance of Trichodesmium was explained by temperature and salinity in the Kuroshio (Table IIa) and 33% was explained by salinity and phosphate in all regions (Table IIb). Fig. 4. View largeDownload slide Surface nifH abundances (log10(copies L−1)) of (a) Trichodesmium, (b) Crocosphaera, (c) UCYN-A1, (d) UCYN-C, Richelia associated with (e) Rhizosolenia (RR) or (f) Hemiaulus (HR) and (g) γ-24774A11. White circles: undetectable. Dashed lines: 200-m isobaths. Fig. 4. View largeDownload slide Surface nifH abundances (log10(copies L−1)) of (a) Trichodesmium, (b) Crocosphaera, (c) UCYN-A1, (d) UCYN-C, Richelia associated with (e) Rhizosolenia (RR) or (f) Hemiaulus (HR) and (g) γ-24774A11. White circles: undetectable. Dashed lines: 200-m isobaths. Fig. 5. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio, KCW, ECSMW and NPTG. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with the Kuroshio. Error bars: standard deviations of the means. Fig. 5. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio, KCW, ECSMW and NPTG. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with the Kuroshio. Error bars: standard deviations of the means. Table II: Multiple regression analysis of the environmental parameters on the abundance of each diazotroph using (a) all datasets and (b) dataset obtained in the Kuroshio Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS NS: not selected by Akaike information criteria (Akaike, 1974). aLevel of significance: *P < 0.05, **P < 0.01, ***P < 0.001. Table II: Multiple regression analysis of the environmental parameters on the abundance of each diazotroph using (a) all datasets and (b) dataset obtained in the Kuroshio Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS Trichodesmium Crocosphaera UCYN-A1 UCYN-C RR HR γ-24774A11 (a) Multiple R2 0.33 0.36 0.42 0.46 0.42 0.46 0.80 P-value for model <0.01 <0.01 <0.001 <0.001 <0.001 <0.001 <0.001 Coefficient for each parametera  Temperature NS 22.7 NS NS 22.0* 25.1* 37.8***  Salinity 53.8* 52.8* 106** 65.1*** NS NS 31.6*  Nitrate + nitrite NS NS 0.66 NS 1.37 1.81 NS  Phosphate −1.33** 0.73 NS −0.94* −1.15 −1.53* 0.49  N/P ratio NS NS NS 1.48** −2.85 −4.31* 0.52  Silicate NS 1.99 NS NS NS NS NS  Chl a 4.20 NS NS NS NS 3.91 NS (b) Multiple R2 0.44 0.71 0.69 0.81 0.51 0.39 0.70 P-value for model <0.05 <0.001 <0.001 <0.001 <0.05 >0.05 <0.001 Coefficient for each parametera  Temperature 43.1* 98.2*** 69.9* NS −42.8 NS 62.1***  Salinity −129* NS NS 369*** 364** −139 −91.9  Nitrate + nitrite NS 1.49 3.04* NS NS 1.46 −0.65  Phosphate −1.07 NS −3.99* −2.91** 2.03 NS NS  N/P ratio NS −2.21 −6.75* −1.67* −1.47 −3.61* 1.46  Silicate 1.24 1.86 NS NS NS −1.57 NS  Chl a NS NS NS 14.0 NS −5.39 NS NS: not selected by Akaike information criteria (Akaike, 1974). aLevel of significance: *P < 0.05, **P < 0.01, ***P < 0.001. The unicellular cyanobacterial diazotrophs Crocosphaera, UCYN-A1 and UCYN-C did not occur in the ECSMW and were rare in the KCW (Fig. 4b–d). The abundances of Crocosphaera, UCYN-A1 and UCYN-C in the Kuroshio ranged from BDL to 8.2 × 102 copies L−1, BDL to 1.7 × 104 copies L−1 and BDL to 1.3 × 103 copies L−1, respectively. UCYN-A1 had a similar abundance as Trichodesmium in the Kuroshio, but those of Crocosphaera and UCYN-C were significantly lower than that of Trichodesmium (P < 0.05) (Fig. 6). Interestingly, the abundances of Crocosphaera, UCYN-A1 and UCYN-C were significantly lower at downstream Kuroshio stations EK1, EK2, E03, EJ2 and E04 than at upstream stations E22, E23, E24 and E25 (P < 0.05) which were all categorized as Kuroshio stations in the T–S diagram. The abundances of Crocosphaera and UCYN-A1 were significantly lower in the Kuroshio than in the NPTG (P < 0.05) (Fig. 5b and c). Meanwhile, the abundance of UCYN-C was higher in the Kuroshio than in the NPTG (Fig. 5d). In the Kuroshio, the environmental factors explained 71, 69 and 81% of the variations of the distribution patterns of Crocosphaera, UCYN-A1 and UCYN-C, respectively. However, in all regions, these factors explained only 36–46% of the variation in abundance of the unicellular cyanobacterial diazotrophs. The explanatory variables of Crocosphaera and UCYN-A1 differed between the Kuroshio and all regions. Fig. 6. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with Trichodesmium. Error bars: standard deviations of the means. Fig. 6. View largeDownload slide Average nifH abundances in the surface water of the Kuroshio. The asterisks indicate significant differences (P < 0.05, Mann–Whitney U test) compared with Trichodesmium. Error bars: standard deviations of the means. RR and HR were detected in all regions excluding the ECSMW (Fig. 4e and f). The abundances of RR and HR in the Kuroshio ranged from BLD to 3.3 × 103 copies L−1 and BLD to 1.8 × 103 copies L−1, respectively, both being lower than that of Trichodesmium (P < 0.05) (Fig. 6). Although the abundance of RR was lower in the Kuroshio than in the KCW (P < 0.05) (Fig. 5e), that of HR did not differ between the Kuroshio and KCW (Fig. 5f). The abundances of RR and HR in the Kuroshio were significantly elevated compared with those in the NPTG (P < 0.05). The multiple R2 values were low for both the Kuroshio and all regions. γ-24774A11 was not detected in the ECSMW. The abundance range of γ-24774A11 (1.7 × 102–2.9 × 103 copies L−1) in the Kuroshio excluding station E11 tended to be smaller than those of the other cyanobacterial diazotrophs. In the Kuroshio, γ-24774A11 had a lower abundance than Trichodesmium (P < 0.05) (Fig. 6). The abundance of γ-24774A11 in the Kuroshio was comparable with that in the KCW, whereas it was lower than that in the NPTG (P < 0.05) (Fig. 5g). The abundance of γ-24774A11 was well correlated with temperature in both the Kuroshio and all regions. DISCUSSION The community composition of diazotrophs in the Kuroshio clearly differed from those in the ECSMW and NPTG. In the Kuroshio, the abundance of cyanobacterial diazotrophs varied considerably compared with that of γ-24774A11. Below we consider some factors which might influence the distribution of diazotrophs in the basin-scale North Pacific and Kuroshio. Differences of the diazotroph community between the Kuroshio and the other regions The environmental factors explained 80% of the variations of the distribution patterns of γ-24774A11 in all regions. The abundance of γ-24774A11 was especially well correlated with temperature, and a similar relationship was reported in the South Pacific (Moisander et al., 2014). Therefore, the abundance of γ-24774A11 may be controlled by temperature or other environmental factors that act synergistically with temperature. On the other hand, only 33–46% of the abundances of cyanobacterial diazotrophs were explained by environmental data when using all datasets. Similarly, the coefficient of determination for Trichodesmium, Crocosphaera and UCYN-A1 was 0.33, 0.55 and 0.46, respectively, in the multiple regression analysis when our previous datasets in the tropical and subtropical North Pacific (Shiozaki et al., 2014b) were pooled. These results suggest that their basin-scale distributions in the North Pacific are associated with not only by the factors we investigated but also may be influenced by interspecific competition for a limiting resource as mentioned below. The distributions of cyanobacterial diazotrophs are also recognized to be related to current fields (Shiozaki et al., 2013, 2015a,b, 2017; Rivero-Calle et al., 2016) or dissolved iron (Berman-Frank et al., 2001; Saito et al., 2011). Regarding the current fields, the plankton community in the Kuroshio is distinct from that in adjacent waters because the Kuroshio transports some species from the equatorial region to a region farther north (McGowan, 1971). Therefore, it is understandable that a distinct diazotroph community occurs in the Kuroshio. Diazotroph abundances in the KCW were similar to those in the Kuroshio. The KCW stations were located in the Kuroshio bifurcation, and therefore, the diazotroph community in the KCW was possibly influenced by the Kuroshio Current. Of the cyanobacterial diazotrophs, Trichodesmium was the only form evident in the ECSMW, which is a mixture of Yellow Sea-derived water and other shelf water (Gong et al., 1996). On occasion, Trichodesmium has been detected near the Chinese coast and in the shelf region (Chang et al., 2000; Zhang et al., 2014). The other diazotrophs have not been examined in this region. The absence of DDAs, unicellular cyanobacterial diazotrophs and γ-24774A11 implies that the seed populations of these phylotypes are not present in this water mass. Iron is a well-known controlling factor of diazotrophy. For example, Trichodesmium grows poorly in iron-deficient environments but well in iron-rich environments (Berman-Frank et al., 2001). The abundance of Trichodesmium was higher in the Kuroshio than in the NPTG in the present study. A similar distribution of Trichodesmium was reported previously, and this finding was attributable to the higher dissolved iron levels of the Kuroshio waters (Shiozaki et al., 2010). In contrast, Crocosphaera and UCYN-A1 were less abundant in the Kuroshio than in the NPTG. Regarding Crocosphaera, because the organism can use iron more effectively than Trichodesmium (Saito et al., 2011), it can be thrive in the iron-depleted NPTG (Shiozaki et al., 2017), but this cannot explain why Crocosphaera did not thrive in the Kuroshio. The low abundance of Crocosphaera might be due to limited phosphorus content. The surface phosphate concentration was significantly lower in the Kuroshio than in the NPTG, and chl a levels were higher in the Kuroshio than in the NPTG. At the Pacific Ocean basin scale, Crocosphaera has a lower abundance in phosphate-depleted regions, in which Crocosphaera, Trichodesmium, and non-diazotrophs possibly compete for the available phosphorus (Sato et al., 2010). Trichodesmium can use phosphonates, which are key components of dissolved organic phosphorus, under phosphate-depleted conditions, but Crocosphaera cannot possibly due to lack of C-P lyase pathway (Dyhrman et al., 2006). The higher chl a concentration, which means higher phytoplankton biomass (Furuya, 1990), and abundant Trichodesmium in the Kuroshio suggest that Crocosphaera might be limited by phosphorus resource competition from non-diazotrophs and Trichodesmium. Crocosphaera occurs in extremely low abundance (BDL to 2.0 × 102 copies L−1) in the low-phosphate high-chl a (>0.2 μg L−1) subtropical North Atlantic (Goebel et al., 2010). It should be noted that the abundance of Crocosphaera did not show any correlation with phosphate concentrations (Table II). This may be attributable to the existence of a variable phosphate threshold that is complicatedly related with other plankton communities and/or a less clear relationship between the in situ phosphate concentration and the physiological state of Crocosphaera, as phosphate supplied to the surface would be immediately consumed, leading to an extremely low concentration. UCYN-A1 also lacks C-P lyase genes (Tripp et al., 2010). Although UCYN-A1 forms symbioses with prymnesiophytes, and thus the genome content may not simply reflect the environment, the low abundance in the Kuroshio was potentially due to the same reason for the low abundance of Crocosphaera. However, the presence or absence of C-P lyase gene alone cannot explain the distribution of diazotrophs. In particular, although Richelia intracellularis and UCYN-C lack these genes (Bandyopadhyay et al., 2011; Hilton et al., 2013), their abundances were elevated in the Kuroshio. Little is known regarding environmental factors controlling the abundances of DDAs and UCYN-C. Although DDAs were reported to be most abundant in high-silicate waters (Bar Zeev et al., 2008; Subramaniam et al., 2008), RR and HR were absent from the silicate-rich ECSMW, and their abundances were not significantly correlated with the silicate concentration. Meanwhile, our results corresponded with the previous findings that DDAs were more abundant in the Kuroshio than in the adjacent waters (Gómez et al., 2005). In this study, we found for the first time that the abundance of UCYN-C is elevated in the Kuroshio. Cheung et al. (Cheung et al., 2017) recently reported that many nifH sequences of UCYN-C were recovered from Kuroshio waters. UCYN-C is rarely detected in the high sea area of the Pacific Ocean (Church et al., 2008; Halm et al., 2012). It can be said that high abundance of UCYN-C is one of the features of the Kuroshio diazotroph community. Variations of cyanobacterial diazotrophs in the Kuroshio Interestingly, the distributions of Crocosphaera, UCYN-A1 and UCYN-C in the Kuroshio were well described by environmental parameters, a finding that clearly differed from the result using all datasets. When our previous dataset in the Kuroshio (Shiozaki et al., 2014b) was pooled, we also found high coefficient of determination for Crocosphaera (0.76) and UCYN-A1 (0.63) in the multiple regression analysis. These results suggest that undetermined factors such as dissolved iron would little limit their abundance within the Kuroshio. Salinity, phosphate and the N/P ratio explained 81% of the distribution pattern of UCYN-C in the Kuroshio. The abundances of Crocosphaera and UCYN-A1 in the Kuroshio are known to be positively correlated with temperature within the observed temperature range (Shiozaki et al., 2014b), and the same trends were found in the present study. However, this relationship did not hold in the downstream Kuroshio. The abundance of Crocosphaera and UCYN-A1 was lower at downstream Kuroshio stations than at upstream stations, whereas temperature was higher at downstream Kuroshio stations (P < 0.05). The abundance of Crocosphaera and UCYN-A1 was previously reported in the Kuroshio southeast of Taiwan (21.4°N, 122–122.5°E) (Shiozaki et al., 2014b). Crocosphaera was present at levels >1.0 × 103 copies L−1 throughout the year in Kuroshio southeast of Taiwan (Shiozaki et al., 2014b), but its abundance was always <1.0 × 103 copies L−1 in the Kuroshio in our study area. These results indicate that the abundance of Crocosphaera decreases during delivery by the Kuroshio, which may be caused by low phosphorus availability for their growth in the Kuroshio. In contrast, UCYN-A1 abundance varied from BDL to 1.9 × 104 copies L−1 in the surface water of Kuroshio southeast of Taiwan (Shiozaki et al., 2014b), which was comparable with that in our study area (BDL to 1.7 × 104 copies L−1). Thus, it is not clear whether the decreasing trend of UCYN-A1 in the Kuroshio was robust, and future studies should establish their general distribution and the factors involved in their distribution. Compared to unicellular diazotrophs, environmental parameters were poorly associated with the distribution patterns of Trichodesmium, RR and HR in the Kuroshio. Similarly, in the pooled multiple regression analysis of present and previous datasets (Shiozaki et al., 2014b), environmental parameters only explain 53% of the variation in abundance of Trichodesmium. Regarding the distribution of Trichodesmium, Shiozaki et al. (2015a) also showed that there was no significant correlation between Trichodesmium abundance and environmental variables in the Kuroshio. This could be because the abundance of Trichodesmium in the Kuroshio is highly influenced by the current’s collection of Trichodesmium growing around the Ryukyu Islands (Shiozaki et al., 2015a). The heterogeneity of RR and HR might be explained as well since DDAs also increased near oceanic islands (Shiozaki et al., 2010). CONCLUSION We characterized a distinctive diazotroph community in the Kuroshio, the “hot spot” of nitrogen fixation in the Pacific Ocean. Although Crocosphaera is considered to be distributed extensively in the North Pacific (Saito et al., 2011), we found abundance was lower in the Kuroshio than in the NPTG, and decreased from upstream to downstream in the Kuroshio. This pattern could be attributable to the low-phosphate and high-chl a environment of the Kuroshio. Trichodesmium was major diazotrophs in the whole area of Kuroshio as expected (Marumo and Asaoka, 1974; Chen et al., 2008; Shiozaki et al., 2015a) while, in the upstream Kuroshio, UCYN-A1 was similar in numerical to Trichodesmium. Although lower in abundances than the two aforementioned diazotrophs, the abundances of HR, RR and UCYN-C were higher in the Kuroshio than in the adjacent waters. DDAs and UCYN-C are known to have high-sinking rates due to the high cell density of their host diatom and the aggregate formation, respectively (Subramaniam et al. 2008; Bonnet et al., 2016), while Trichodesmium have gas vacuoles and becomes buoyant (Capone et al., 1997). Hence, higher abundance of DDAs and UCYN-C in the Kuroshio suggested that they could be key controllers of the export production in this region. Further detailed studies of spatial and temporal dynamics of DDAs and UCYN-C, therefore, would be important for better understanding of the biogeochemical cycles in the Kuroshio. ACKNOWLEDGEMENTS We thank J. Zhang; H. Ogawa; and the captains, crew members and participants of the T/V Kakuyo-maru and R/V Hakuho-maru cruises for their cooperation at sea. We also thank Y. Tada for his suggestion on statistical analyses, Y. Nakaguchi, H. Ogawa and F. Hashihama for sharing their N + N and phosphate data and for their assistance with silicate analysis during the R/V Hakuho-maru cruises, and anonymous reviewers for helpful comments on the manuscript. Funding This research was supported financially by JSPS KAKENHI grant nos JP25-7341, JP24121006, JP26241009, JP16K12586 and JP18H03361. REFERENCES Akaike , H. ( 1974 ) A new look at the statistical model identification . IEEE Trans. Automat. Contr. , 19 , 716 – 723 . Google Scholar CrossRef Search ADS Bandyopadhyay , A. , Elvitigala , T. , Welsh , E. , Stöckel , J. , Liberton , M. , Min , H. , Sherman , L. A. and Pakrasi , H. B. ( 2011 ) Novel metabolic attributes of the genus Cyanothece, comprising a group of unicellular nitrogen-fixing cyanobacteria . MBio , 2 , e00214-11. Berman-Frank , I. , Cullen , J. T. , Shaked , Y. , Sherrell , R. M. and Falkowski , P. G. ( 2001 ) Iron availability, cellular iron quotas, and nitrogen fixation in Trichodesmium . Limnol. Oceanogr. , 46 , 1249 – 1260 . Google Scholar CrossRef Search ADS Bombar , D. , Paerl , R. W. and Riemann , L. ( 2016 ) Marine non-cyanobacterial diazotrophs: Moving beyond molecular detection . Trends Microbiol. , 24 , 916 – 927 . Google Scholar CrossRef Search ADS PubMed Bonnet , S. , Berthelot , H. , Turk-Kubo , K. , Fawcett , S. , Rahav , E. , L’Helguen , S. and Berman-Frank , I. ( 2016 ) Dynamics of N2 fixation and fate of diazotroph-derived nitrogen in a low-nutrient, low-chlorophyll ecosystem: result from the VAHINE mesocosm experiment (New Caledonia) . Biogeosciences , 13 , 2653 – 2673 . Google Scholar CrossRef Search ADS Capone , D. G. , Zehr , J. P. , Paerl , H. W. , Bergman , B. and Carpenter , E. J. ( 1997 ) Trichodesmium, a globally significant marine cyanobacterium . Science , 276 , 1221 – 1229 . Google Scholar CrossRef Search ADS Chang , J. , Chiang , K.-P. and Gong , G.-C. ( 2000 ) Seasonal variation and cross-shelf distribution of the nitrogen-fixing cyanobacterium, Trichodesmium, in southern East China Sea . Cont. Shelf Res. , 20 , 479 – 492 . Google Scholar CrossRef Search ADS Chen , Y.-L. L. , Chen , H. Y. , Lin , Y.-H. , Yong , T.-C. , Taniuchi , Y. and Tuo , S.-H. ( 2014 ) The relative contributions of unicellular and filamentous diazotrophs to N2 fixation in the South China Sea and the upstream Kuroshio . Deep Sea Res. Part I , 85 , 56 – 71 . Google Scholar CrossRef Search ADS Chen , Y.-L. L. , Chen , H.-Y. , Tuo , S.-H. and Ohki , K. ( 2008 ) Seasonal dynamics of new production from Trichodesmium N2 fixation and nitrate uptake in the upstream Kuroshio and South China Sea basin . Limnol. Oceanogr. , 53 , 1705 – 1721 . Google Scholar CrossRef Search ADS Cheung , S. , Suzuki , K. , Saito , H. , Umezawa , Y. , Xia , X. and Liu , H. ( 2017 ) Highly heterogenous diazotroph communities in the Kuroshio Current and the Tokara Strait, Japan . PLoS One , 12 , e0186875 . Google Scholar CrossRef Search ADS PubMed Church , M. J. , Björkman , K. M. , Karl , D. M. , Saito , M. A. and Zehr , J. P. ( 2008 ) Regional distributions of nitrogen-fixation bacteria in the Pacific Ocean . Limnol. Oceanogr. , 53 , 63 – 77 . Google Scholar CrossRef Search ADS Dyhrman , S. T. , Chappell , P. D. , Haley , S. T. , Moffett , J. W. , Orchard , E. D. , Waterbury , J. B. and Webb , E. A. ( 2006 ) Phosphonate utilization by the globally important marine diazotroph Trichodesmium . Nature , 439 , 68 – 71 . Google Scholar CrossRef Search ADS PubMed Farnelid , H. , Turk-Kubo , K. , Muñoz-Marín , M. C. and Zehr , J. P. ( 2016 ) New insights into the ecology of the globally significant uncultured nitrogen-fixing symbiont UCYN-A . Aquat. Microb. Ecol. , 77 , 125 – 138 . Google Scholar CrossRef Search ADS Foster , R. A. , Kuypers , M. M. M. , Vagner , T. , Paerl , R. W. , Musat , N. and Zehr , J. P. ( 2011 ) Nitrogen fixation and transfer in open ocean diatom-cyanobacterial symbioses . ISME J. , 5 , 1484 – 1493 . Google Scholar CrossRef Search ADS PubMed Foster , R. A. , Subramaniam , A. , Mahaffey , C. , Carpenter , E. J. , Capone , D. G. and Zehr , J. P. ( 2007 ) Influence of the Amazon River plume on distributions of free-living and symbiotic cyanobacteria in the western tropical north Atlantic Ocean . Limnol. Oceanogr. , 52 , 517 – 532 . Google Scholar CrossRef Search ADS Furuya , K. ( 1990 ) Subsurface chlorophyll maximum in the tropical and subtropical western Pacific Ocean: vertical profiles of phytoplankton biomass and its relationship with chlorophyll a and particulate organic carbon . Mar. Biol. , 107 , 529 – 539 . Google Scholar CrossRef Search ADS Glibert , P. M. and Bronk , D. A. ( 1994 ) Release of dissolved organic nitrogen by marine diazotrophic cyanobacteria, Trichodesmium spp . Appl. Environ. Microbiol. , 60 , 3996 – 4000 . Google Scholar PubMed Goebel , N. , Turk , K. A. , Achilles , K. M. , Paerl , R. , Hewson , I. , Morrison , A. E. , Montoya , J. P. , Edwards , C. A. et al. . ( 2010 ) Abundance and distribution of major groups of diazotrophic cyanobacteria and their potential contribution to N2 fixation in the tropical Atlantic Ocean . Environ. Microbiol. , 12 , 3272 – 3289 . Google Scholar CrossRef Search ADS PubMed Gong , G.-C. , Chen , Y.-L. L. and Liu , K.-K. ( 1996 ) Chemical hydrography and chlorophyll a distribution in the East China Sea in summer: implications in nutrient dynamics . Cont. Shelf Res. , 16 , 1561 – 1590 . Google Scholar CrossRef Search ADS Gruber , N. and Galloway , J. N. ( 2008 ) An Earth-system perspective of the global nitrogen cycle . Nature , 451 , 293 – 296 . Google Scholar CrossRef Search ADS PubMed Gómez , F. , Furuya , K. and Takeda , S. ( 2005 ) Distribution of the cyanobacterium Richelia intracellularis ad and epiphyte of the diatom Chaetoceros compressus in the western Pacific Ocean . J. Plankton Res. , 27 , 323 – 330 . Google Scholar CrossRef Search ADS Halm , H. , Lam , P. , Ferdelman , T. G. , Lavik , G. , Dittmar , T. , LaRoche , J. , D’Hondt , S. and Kuypers , M. M. M. ( 2012 ) Heterotrophic organisms dominate nitrogen fixation in the South Pacific Gyre . ISME J. , 6 , 1238 – 1249 . Google Scholar CrossRef Search ADS PubMed Hashihama , F. , Furuya , K. , Kitajima , S. , Takeda , S. , Takemura , T. and Kanda , J. ( 2009 ) Macro-scale exhausion of surface phosphate by dinitrogen fixation in the western North Pacific . Geophys. Res. Lett. , 36 , L03610 . Google Scholar CrossRef Search ADS Hilton , J. A. , Foster , R. A. , Tripp , H. J. , Carter , B. J. , Zehr , J. P. and Villareal , T. A. ( 2013 ) Genomic deletions disrupt nitrogen metabolism pathways of a cyanobacterial diatom symbiont . Nat. Commun. , 4 , 1767 , doi:10.1038/ncomms2748 . Google Scholar CrossRef Search ADS PubMed Karl , D. , Letelier , R. , Tupas , L. , Dore , J. , Christian , J. and Hebel , D. ( 1997 ) The role of nitrogen fixation in biogeochemical cycling in the subtropical North Pacific Ocean . Nature , 388 , 533 – 538 . Google Scholar CrossRef Search ADS Kodama , T. , Furuya , K. , Hashihama , F. , Takeda , S. and Kanda , J. ( 2011 ) Occurrence of rain-origin nitrate patches at the nutrient-depleted surface in the East China Sea and the Philippine Sea during summer . J. Geophys. Res. , 116 , C08003 . Google Scholar CrossRef Search ADS Krupke , A. , Mohr , W. , LaRoche , J. , Fuchs , B. M. , Amann , R. I. and Kuypers , M. M. M. ( 2015 ) The effect of nutrients on carbon and nitrogen fixation by the UCYN-A-haptophyte symbiosis . ISME J. , 9 , 1635 – 1647 . Google Scholar CrossRef Search ADS PubMed Langlois , R. , Großkopf , T. , Mills , M. , Takeda , S. and LaRoche , J. ( 2015 ) Widespread distribution and expression of Gamma A (UMB), an uncultured, diazotrophic, γ-proteobacterial nifH phylotype . PLoS One , 10 , e0128912 . Google Scholar CrossRef Search ADS PubMed Langlois , R. J. , Hümmer , D. and LaRoche , J. ( 2008 ) Abundances and distributions of the dominant nifH phylotypes in the Northern Atlantic Ocean . Appl. Environ. Microbiol. , 74 , 1922 – 1931 . Google Scholar CrossRef Search ADS PubMed Liu , X. , Furuya , K. , Shiozaki , T. , Masuda , T. , Kodama , T. , Sato , M. , Kaneko , H. , Nagawasa , M. et al. ( 2013 ) Variability in nitrogen source for new production in the vicinity of the shelf edge of the East China Sea in summer . Cont. Shelf Res. , 61–62 , 23 – 30 . Google Scholar CrossRef Search ADS Martínez-Pérez , C. , Mohr , W. , Löscher , C. R. , Dekaezemacker , J. , Littmann , S. , Yilmaz , P. , Lehnen , N. , Fuchs , B. M. et al. . ( 2016 ) The small unicellular diazotrophic symbiont, UCYN-A, is a key player in the marine nitrogen cycle . Nat. Microbiol. , 1 , 16163 . Google Scholar CrossRef Search ADS PubMed Marumo , R. and Asaoka , O. ( 1974 ) Trichodesmium in the East China Sea. 1. Distribution of Trichodesmium thiebautii GOMONT during 1961–1967 . J. Oceanogr. Soc. Japan , 30 , 298 – 303 . Google Scholar CrossRef Search ADS McGowan , J. A. ( 1971 ) Oceanic biogeography of the Pacific. In Funnell , B.M. and Riedel , W.R. (eds) , The Micropaleontology of Oceans . Cambridge University Press , Cambridge, UK , pp. 3 – 74 . Moisander , P. H. , Beinart , R. A. , Hewson , I. , White , A. E. , Johnson , K. S. , Carlson , C. A. , Montoya , J. P. and Zehr , J. P. ( 2010 ) Unicellular cyanobacterial distributions broaden the oceanic N2 fixation domain . Science , 327 , 1512 – 1514 . Google Scholar CrossRef Search ADS PubMed Moisander , P. H. , Serros , T. , Paerl , R. W. , Beinart , R. A. and Zehr , J. P. ( 2014 ) Gammaproteobacterial diazotrophs and nifH gene expression in surface waters of the South Pacific Ocean . ISME J. , 8 , 1962 – 1973 . Google Scholar CrossRef Search ADS PubMed Montoya , J. P. , Holl , C. M. , Zehr , J. P. , Hansen , A. , Villareal , T. A. and Capone , D. G. ( 2004 ) High rates of N2 fixation by unicellular diazotrophs in the oligotrophic Pacific Ocean . Nature , 430 , 1027 – 1031 . Google Scholar CrossRef Search ADS PubMed Riemann , L. , Farnelid , H. and Steward , G. F. ( 2010 ) Nitrogenase genes in non-cyanobacterial plankton: prevalence, diversity and regulation in marine waters . Aquat. Microb. Ecol ., 61 , 235 – 247 . Google Scholar CrossRef Search ADS Rivero-Calle , S. , Del Castillo , C. E. , Gnanadesikan , A. , Dezfuli , A. , Zaitchik , B. and Johns , D. G. ( 2016 ) Interdecadal Trichodesmium variability in cold North Atlantic waters . Global Biogeochem. Cycles , 30 , 1620 – 1638 . Google Scholar CrossRef Search ADS Saito , M. A. , Bertrand , E. M. , Dutkiewicz , S. , Bulygin , V. V. , Moran , D. M. , Monteiro , F. M. , Follows , M. J. , Valois , F. W. et al. . ( 2011 ) Iron conservation by reduction of metalloenzyme inventories in the marine diazotroph Crocosphaera watsonii . Proc. Natl Acad. Sci. USA , 108 , 2184 – 2189 . Google Scholar CrossRef Search ADS Sato , M. , Hashihama , F. , Kitajima , S. and Takeda , S. ( 2010 ) Distribution of nano-sized Cyanobacteria in the western and central Pacific Ocean . Aquat. Microb. Ecol. , 59 , 273 – 282 . Google Scholar CrossRef Search ADS Shiozaki , T. , Bombar , D. , Riemann , L. , Hashihama , F. , Takeda , S. , Yamaguchi , T. , Ehama , M. , Hamasaki , K. et al. ( 2017 ) Basin scale variability of active diazotrophs and nitrogen fixation in the North Pacific, from the tropics to the subarctic Bering Sea . Global Biogeochem. Cycles , 31 , 996 – 1009 doi:10.1002/2017GB005681 . Google Scholar CrossRef Search ADS Shiozaki , T. , Chen , T.-L. L. , Lin , Y.-H. , Taniuchi , Y. , Sheu , D.-S. , Furuya , K. and Chen , H.-Y. ( 2014 b) Seasonal variations of unicellular diazotroph groups A and B, and Trichodesmium in the northern South China Sea and neighboring upstream Kuroshio Current . Cont. Shelf Res ., 80 , 20 – 31 . Google Scholar CrossRef Search ADS Shiozaki , T. , Furuya , K. , Kodama , T. , Kitajima , S. , Takeda , S. , Takemura , T. and Kanda , J. ( 2010 ) New estimation of N2 fixation in the western and central Pacific Ocean and its marginal seas . Global Biogeochem. Cycles , 24 , GB1015 . Google Scholar CrossRef Search ADS Shiozaki , T. , Ijichi , M. , Kodama , T. , Takeda , S. and Furuya , K. ( 2014 a) Heterotrophic bacteria as major nitrogen fixers in the euphotic zone of the Indian Ocean . Global Biogeochem. Cycles , 28 , 1096 – 1110 . Google Scholar CrossRef Search ADS Shiozaki , T. , Kodama , T. , Kitajima , S. , Sato , M. and Furuya , K. ( 2013 ) Advective transport of diazotrophs and importance of their nitrogen fixation on new and primary production in the western Pacific warm pool . Limnol. Oceanogr. , 58 , 49 – 60 . Google Scholar CrossRef Search ADS Shiozaki , T. , Nagata , T. , Ijichi , M. and Furuya , K. ( 2015 b) Nitrogen fixation and the diazotroph community in the temperate coastal region of the northwestern North Pacific . Biogeosciences , 12 , 4751 – 4764 . Google Scholar CrossRef Search ADS Shiozaki , T. , Takeda , S. , Itoh , S. , Kodama , T. , Liu , X. , Hashihama , F. and Furuya , K. ( 2015 a) Why is Trichodesmium abundant in the Kuroshio? Biogeosciences , 12 , 6931 – 6943 . Google Scholar CrossRef Search ADS Subramaniam , A. , Yager , P. L. , Carpenter , E. J. , Mahaffey , C. , Björkman , K. , Cooley , S. , Kustka , A. B. , Montoya , J. P. et al. ( 2008 ) Amazon River enhances diazotrophy and carbon sequestration in the tropical North Atlantic Ocean . Proc. Natl Acad. Sci. USA , 105 , 10460 – 10465 . Google Scholar CrossRef Search ADS Tripp , H. J. , Bench , S. R. , Turk , K. A. , Foster , R. A. , Desany , B. A. , Niazi , F. , Affourtit , J. P. and Zehr , J. P. ( 2010 ) Metabolic streamlining in an open-ocean nitrogen-fixing cyanobacterium . Nature , 464 , 90 – 94 . Google Scholar CrossRef Search ADS PubMed Vanables , W. N. and Ripley , B. D. ( 2002 ) Modern Applied Statistics with S , 4th edn. Springer , New York . Google Scholar CrossRef Search ADS Zeev , E.B. , Yogev , T. , Man-Aharonovich , D. , Kress , N. , Herut , B. , Béjà , O. and Berman-Frank , I. ( 2008 ) Seasonal dynamics of the endosymbiotic, nitrogen-fixing cyanobacterium Richelia intracellularis in the eastern Mediterranean Sea . ISME J. , 2 , 911 – 923 . Google Scholar CrossRef Search ADS PubMed Zehr , J. P. , Jenkins , B. D. , Short , S. M. and Steward , G. F. ( 2003 ) Nitrogenase gene diversity and microbial community structure: a cross-system comparison . Environ. Microbiol. , 5 , 539 – 554 . Google Scholar CrossRef Search ADS PubMed Zehr , J. P. , Waterbury , J. B. , Turner , P. J. , Montoya , J. P. , Omoregie , E. , Steward , G. F. , Hansen , A. and Karl , D. M. ( 2001 ) Unicellular cyanobacteria fix N2 in the subtropical North Pacific Ocean . Nature , 412 , 635 – 638 . Google Scholar CrossRef Search ADS PubMed Zhang , D.-S. , Lu , D.-D. , Li , H.-L. , Ni , X.-B. , Wang , C.-S. and Jiang , Z.-B. ( 2014 ) Seasonal dynamics of Trichodesmium in the northern East China Sea . Cont. Shelf Res. , 88 , 161 – 170 . Google Scholar CrossRef Search ADS Author notes Corresponding editor: Pia Moisander © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Journal of Plankton ResearchOxford University Press

Published: Jul 11, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off