Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Comparison of the rolling circle amplification and ligase-dependent reaction methods for the identification of opportunistic Exophiala species

Comparison of the rolling circle amplification and ligase-dependent reaction methods for the... Abstract We developed two ligase-dependent probe amplification assays based on rolling circle amplification (RCA) and the ligase-dependent reaction (LDR) to differentiate species of Exophiala targeting the rDNA internal transcribed spacer region. We focused on Exophiala dermatitidis and E. phaeomuriformis, two opportunistic inhabitants of indoor wet cells, and further detected E. heteromorpha, E. xenobiotica, and E. crusticola; 57 reference isolates representing the five species were tested. Depending on the RCA probes used, the sensitivity was 100%, and the specificity ranged from 3.7% to 88.6% (median: 46.1%). In contrast, the sensitivity and specificity of the LDR probes targeting the same isolates were 88.6–100% (median: 95.8%) and 95.4–100% (median: 97.7%), respectively. We analyzed 198 additional environmental isolates representing the same Exophiala species. Overall, the sensitivity and specificity of LDR ranged from 89.7% to 100% (median: 94.1%) and from 93.9% to 100% (median: 96.9%), respectively. The assessment of performance and validation of LDR probes using SYBR Green quantitative polymerase chain reaction revealed high reproducibility and an acceptable range limit, in line with the guidelines of the European Network of GMO Laboratories. In conclusion, the LDR assay was more reliable and less expensive than RCA for species-level identification of Exophiala isolates. Black yeast, ITS, molecular biology, qPCR, real-time PCR Introduction The black yeast genus Exophiala is taxonomically positioned in the family Herpotrichiellaceae, order Chaetothyriales, class Ascomycetes.1,2 Phenotypic identification of most Exophiala species is difficult and ambiguous because of their highly polymorphic nature.2 Currently, the “gold standard” in the molecular diagnostics of Exophiala species is to sequence the internal transcribed (ITS) region of rDNA,3 which differs sufficiently between species to allow for their differentiation.1 Nevertheless, the sequencing protocol is too time-consuming and expensive (10$/test) for environmental screening and is not suitable for processing a large number of samples simultaneously. To overcome these limitations, many alternative methods have been developed, including molecular approaches (e.g., quantitative polymerase chain reaction [qPCR],4 restriction fragment length polymorphism [RFLP],5 amplified fragment length polymorphism [AFLP],6 and next-generation sequencing7) and protein-based approaches (e.g., matrix-assisted laser desorption ionization-time of flight/mass spectrometry [MALDI-TOF/MS] and attenuated total reflectance-Fourier transform infrared spectroscopy [ATR-FTIR]).8–11 A recent study revealed that MALDI-TOF/MS can accurately identify a very large range of Exophiala species.11 Unlike conventional diagnostic PCR or qPCR, ligase-dependent probe amplification methods such as rolling circle amplification (RCA) and ligase-dependent reaction (LDR) enable the identification of species that do not contain an appropriate target sequence that is specifically targetable by conventional primers.12–15 Ligase-dependent probe amplification methods generally consist of sequential highly accurate steps of the hybridization and ligation of adjacent probes at their 5΄ and 3΄ terminal regions using a thermostable DNA ligase, followed by amplification of the ligated products with universal primers.16–18 LDR (40–45 nucleotides) and RCA (85–100 nucleotides) probes are longer than conventional PCR primers, because they incorporate hybridization and universal barcode sequences.14,19–21 The main differences between the RCA and LDR methods are the amplification step and probe design. In 2008, the RCA method was introduced as a rapid and specific tool in medical mycology diagnostics for identification of the genera Candida, Aspergillus, and Scedosporium,14 and Trichophyton spp.15 Subsequently, this technique was applied for the identification of black yeasts and their relatives (the genera Exophiala and Fonsecaea),13,22 common agents of eumycetoma,23 and dimorphic fungi such as Histoplasma capsulatum24 and Sporothrix schenckii complex.25 Moreover, the LDR method has been typically used in virus studies such as for the detection of variola and Dengue virus,16 and many bacteria.17 However, to the best of our knowledge, LDR has not yet been applied in the field of medical mycology. The motivation for this study is that thermophilic Exophiala dermatitidis and Exophiala phaeomuriformis are the most common human opportunists of the black yeast genus Exophiala, which both occur in indoor wet cells,26,27 but the former species is more pathogenic and a threat to public health.3 There is also a need for development of a rapid and inexpensive tool for routine screening and identification of human-opportunistic Exophiala spp.28 In this study, we aimed to compare the performance of the RCA and LDR methods, without relying on DNA sequencing, for the identification and discrimination of the closely related species E. dermatitidis and E. phaeomuriformis. We also compared the performance of these methods for identification of another closely related species (E. heteromorpha) and some more distant relatives (E. xenobiotica and E. crusticola) as controls. In addition, we examined the suitability of these methods for use in routine examinations in a research laboratory setting. Methods Isolates A total of 255 Exophiala isolates were investigated in this study, including isolates of E. dermatitidis (n = 107), E. phaeomuriformis (n = 109), E. heteromorpha (n = 20), E. xenobiotica (n = 5), and E. crusticola (n = 14). Eleven were clinical E. dermatitidis isolates, and the remaining 244 were recovered from railway sleepers (n = 184) and household dishwashers (n = 60) and had been previously identified by conventional ITS sequencing.29–33 Strain data are given in Tables S1 and S2. The strains are maintained in the reference collection of the CBS-KNAW Fungal Biodiversity Centre (housed at Westerdijk Fungal Biodiversity Institute, Utrecht, the Netherlands) and in the Division of Mycology at Çukurova University, Adana, Turkey. All isolates were subcultured on 2% malt extract agar (Sigma-Aldrich, St. Louis, MO, USA) and incubated at 28°C for 2–7 d prior to the study. DNA extraction and amplification Genomic DNA was purified using a GeneJET Genomic DNA Purification Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer's instructions. The yield and purity of DNA samples were determined with a NanoDrop spectrophotometer (NanoQ, CapitalBio, Beijing, China). PCR amplifications were performed following the protocol described by Turin et al.34 Probe design To design the RCA probes, ITS sequences of the five Exophiala species were retrieved from the GenBank database (https://www.ncbi.nlm.nih.gov/) and were aligned using the MAFFT algorithm (http://www.ebi.ac.uk/Tools/msa/mafft/) to identify informative nucleotide polymorphisms and select optimal probe-binding regions. The padlock probes were designed according to the study of Najafzahed et al.13 The linker regions of each Exophiala species-specific probe were determined as described in Zhou et al.;14 the E. dermatitidis species-specific probe was determined according to Najafzahed et al.13 The 5΄- and the 3΄- binding arms of other Exophiala species-specific probes were newly designed in this study (Table 1). Padlock probes were ordered from Invitrogen Inc. (Breda, the Netherlands). Table 1. RCA probes and probe-specific primers used in this study. Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] aP, 5΄-end phosphorylation. bRCA primer 1 is a reverse-complement of the segment designated by bold capital letters in the padlock probe core sequence. cRCA primer 2 is the same as the segment designated by capital letters (not bold) in the padlock probe core sequence. dThe padlock probe is the probe core and includes a non-specific linker region, shown in lowercase letters. The X and Y sites are the binding arms of padlock probes. View Large Table 1. RCA probes and probe-specific primers used in this study. Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] aP, 5΄-end phosphorylation. bRCA primer 1 is a reverse-complement of the segment designated by bold capital letters in the padlock probe core sequence. cRCA primer 2 is the same as the segment designated by capital letters (not bold) in the padlock probe core sequence. dThe padlock probe is the probe core and includes a non-specific linker region, shown in lowercase letters. The X and Y sites are the binding arms of padlock probes. View Large The LDR probes were designed as two adjacent oligonucleotides (upstream and downstream), each of which comprised a sequence complementary to the target and 20–25-mer zip sequences at the termini, complementary to the designed universal primers. The annealing temperatures of the LDR oligonucleotides were within 60–80°C, with a maximum 5°C difference between the upstream and downstream oligonucleotides (Table 2). All LDR oligonucleotides were newly designed in this study. LDR oligonucleotides were ordered from Sentegen Biyoteknoloji (Ankara, Turkey). The downstream LDR oligonucleotides were phosphorylated at the 5΄-end using a T4 polynucleotide kinase kit (T4 PNK; Thermo Scientific, Waltham, MA, USA) according to the manufacturer's instructions. Table 2. LDR oligonucleotides and oligonucleotide-specific universal primers used in this study. Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study aP, 5΄-end phosphorylation. View Large Table 2. LDR oligonucleotides and oligonucleotide-specific universal primers used in this study. Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study aP, 5΄-end phosphorylation. View Large The thermodynamic features of the RCA probes and LDR oligonucleotides were assessed using Oligo Analyzer 3.135 online software, to ascertain the similarity of their thermodynamic features and to avoid hairpin and self/hetero-dimer formation. EdRCA/EdLDR and ExRCA/ExLDR probes designed for E. dermatitidis and E. xenobiotica, respectively, targeted the same sequences to allow for direct comparison of the two methods. The genetic targets used in primer design are given in Table S3. Ligation reaction A schematic of the main features of the LDR oligonucleotides and the steps of the assay are shown in Figure 1. The ITS amplicon (100 ng) was mixed with 2 U of Pfu DNA ligase (Epicentre Biotechnologies, Madison, WI, USA), 0.1 μmol of each probe/oligonucleotide in 20 mM Tris-HCl (pH 7.5), and 1 μl of 10 × ligase buffer supplied by the enzyme manufacturer. Ligation reaction samples were heated at 94°C for 1 min, followed by 10 cycles of 94°C for 30 s and a 2-min ligation step at the appropriate annealing temperatures (Tables 1 and 2). Figure 1. View largeDownload slide Overview of the ligase detection reaction (LDR). (A) Target DNA and probes: schematic of the target region of Exophiala dermatitidis rDNA (1) and general design of LDR probes. LDR oligonucleotides contain a hybridization region for binding to target DNA and a universal primer region for the amplification of ligated products. (B) Principles of LDR: (1) the ligase covalently joins two adjacently-hybridized probes at the ligation site; (2) ligation products are amplified with universal primers; and (3) amplified products are detected by electrophoresis or real-time PCR. This Figure is reproduced in color in the online version of Medical Mycology. Figure 1. View largeDownload slide Overview of the ligase detection reaction (LDR). (A) Target DNA and probes: schematic of the target region of Exophiala dermatitidis rDNA (1) and general design of LDR probes. LDR oligonucleotides contain a hybridization region for binding to target DNA and a universal primer region for the amplification of ligated products. (B) Principles of LDR: (1) the ligase covalently joins two adjacently-hybridized probes at the ligation site; (2) ligation products are amplified with universal primers; and (3) amplified products are detected by electrophoresis or real-time PCR. This Figure is reproduced in color in the online version of Medical Mycology. Exonuclease digestion and RCA reaction The exonucleolytic cleavage reaction was performed in a 20 μl volume; 10 U each of exonuclease I and III (New England Biolabs, Hitchin, UK) were added to the ligation mixture, followed by incubation at 37°C for 30 min, and a further incubation at 94°C for 3 min to inactivate the enzymes. For the RCA reaction, 1 μl of the ligation product was used as a template. The reaction (50 μl) contained 8 U of Bst DNA polymerase (New England Biolabs, Ipswich, MA, USA), 400 μM of dNTP mix, and 10 pmol of each RCA primer, in molecular biology-grade water. Probe signals were amplified by incubating at 65°C for 30 min. RCA products were visualized on a 1% agarose gel, with a ladder-like product pattern indicating positive reactions. LDR amplification The amplification was performed in a final volume of 25 μl; the reaction contained 1 × PCR buffer, 2.5 μl of MgCl2, 1 μl of dNTPs, 0.5 μl of 10 μM of universal LDR primers, 1.25 U of Taq DNA polymerase, and nuclease-free water. The PCR was performed as follows: 5 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 50°C, and 45 s at 72°C; with a final extension step of 5 min at 72°C. qPCR The qPCR was performed using 2 × Maxima™ SYBR Green qPCR master mix (Thermo Scientific, Lafayette, CO, USA) and ABI ViiA™ 7 System, according to the manufacturer's instructions. In brief, the reaction was performed in a final volume of 25 μl, containing 12.5 μl of 2 × SYBR Green PCR Mastermix, 0.5 μl of LDR universal forward and reverse primers (5 μM), 1 μl of the LDR reaction product, and 10.5 μl of DNase-free water. The amplification steps were as follows: 10 min at 95°C; 30 cycles of 30 s at 95°C, 30 s at 50°C, and 45 s at 72°C; followed by 5 min at 72°C. Performance assays The sensitivity and selectivity values were calculated according to the methods of Blakely and Salmond.36 To assess the performance of the LDR oligonucleotides, reference strains of each species were used, that is, E. dermatitidis CBS 132752, E. xenobiotica CBS 137226, E. phaeomuriformis CBS 132756, E. heteromorpha CBS 134042, and E. crusticola CBS 134043. The assessment of LDR oligonucleotide performance was carried out using qPCR, according to an approach previously outlined by Broeders et al.37 and Libert et al.38 Different parameters of qPCR were evaluated as the “acceptance and performance parameters,” including efficiency, linearity (R2), sensitivity, selectivity, repeatability, reproducibility, limit of detection (LOD), and limit of quantification (LOQ). To calculate the PCR efficiency and linearity, a dilution series (10−1 to 10−6) of ITS region amplicons was prepared, and each dilution was used in an LDR ligation reaction. Each LDR product was used for standard curve analysis, conducted in duplicate for each dilution point. The linear regression values and the linear regression slopes were obtained using the ViiA™ 7 Software v1.2.1 (Life Technologies, Carlsbad, CA, USA). For the repeatability and reproducibility assays, 10−2 amplicon dilutions were prepared and used in the ligase reactions. The product of the separate ligase reactions was assessed in 10 separate qPCR tests using identical running conditions on the same day to assess repeatability; two separate qPCR tests were performed per day, using identical running conditions for 5 d (i.e., a total of 10 tests) to assess reproducibility. The relative standard derivation (RSDr) of Cq values was calculated using Microsoft Excel. For calculation of the LOD and LOQ, ligase reaction products of the lowest quantifiable dilution of the amplicon were assessed in 10 separate qPCR tests for each LDR probe using the same qPCR conditions in 30 cycles on the same day. Three and 10 multiples of the RSDr of Cq values correspond to the LOD and LOQ, respectively. Assessment of overall assay performance The acceptance criteria of the efficiency, linearity (R2), sensitivity (LOD and LOQ), selectivity, and repeatability parameters were evaluated according to the following European Network of GMO Laboratories (ENGL) guidelines:39 the slope of the regression curve should be between –3.6 and –3.1; the efficiency should fall within 80–120%; the RSDr value of repeatability/reproducibility should be less than 25%; the RSDr value for the LOQ should be less than 1/10th of the target concentration, and that for the LOD should be less than 1/20th of the target concentration.39 Results In this study, we aimed to identify 255 Exophiala isolates, including 57 reference isolates registered in CBS/GenBank, using RCA and LDR methods that do not involve DNA sequencing. The ITS1–5.8S–ITS4 regions of the isolates were amplified and the amplicon lengths were determined to be 600–700 bp (Fig. 2). Figure 2. View largeDownload slide Representative electropherogram of the ITS region (ITS 1–5.8S–ITS4) of Exophiala isolates. M, marker; Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ex, E. xenobiotica; and Ec, E. crusticola. Figure 2. View largeDownload slide Representative electropherogram of the ITS region (ITS 1–5.8S–ITS4) of Exophiala isolates. M, marker; Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ex, E. xenobiotica; and Ec, E. crusticola. When the nucleotide differences between the sequences were analyzed based on the previously obtained ITS1–5.8S–ITS4 sequencing data for the study isolates and the sequence data retrieved from the GenBank database, a 5.8–18.6% (28–93 nucleotides) difference was observed among the species.40 For probe design, the ITS1 region was targeted in E. xenobiotica, E. heteromorpha, and E. crusticola, and the ITS2 region was targeted in E. dermatitidis and E. phaeomuriformis. RCA ligation and amplification reactions Lane smears were observed after electrophoresis of the reaction products (Fig. 3). Because “ladder-like” patterns were not apparent, we concluded that the probe hybridized to the target with low efficiency. The total number of strains used for evaluating the RCA probes, and the sensitivities and specificities of all reactions are summarized in Table 3. No false-negative reaction was observed for the RCA probes. Cross-reaction was observed for EdRCA with the E. phaeomuriformis, E. heteromorpha, and E. crusticola strains, for EpRCA with the E. dermatitidis and E. heteromorpha strains, for EhRCA with all other species, except for E. xenobiotica, for ExRCA with E. heteromorpha and E. crusticola strains, and for EcRCA with E. heteromorpha and E. xenobiotica strains (Fig. 3). Figure 3. View largeDownload slide Agarose gel demonstrating the specificity of rolling circle amplification probes. Amplification products were only observed for hybridized template-probe mixtures (empty lanes denote the absence of products, with non-hybridized template-probe mixtures). The species-specific probes are labeled as shown at the top of the figure. Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; Ex, E. xenobiotica; and Ca, C. albicans. Figure 3. View largeDownload slide Agarose gel demonstrating the specificity of rolling circle amplification probes. Amplification products were only observed for hybridized template-probe mixtures (empty lanes denote the absence of products, with non-hybridized template-probe mixtures). The species-specific probes are labeled as shown at the top of the figure. Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; Ex, E. xenobiotica; and Ca, C. albicans. Table 3. Study isolates, and sensitivity and specificity for each RCA and LDR probe. Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 FN, False-negative; FP, False-positive; NT, Nontargeted species; T, Targeted species; TN, True-negative; TP, True-positive. View Large Table 3. Study isolates, and sensitivity and specificity for each RCA and LDR probe. Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 FN, False-negative; FP, False-positive; NT, Nontargeted species; T, Targeted species; TN, True-negative; TP, True-positive. View Large LDR ligation and amplification reactions Ten probes that targeted the five Exophiala species were used in LDR ligase reactions. The LDR probes comprised two 40–45-base oligonucleotides that incorporated universal regions, and the ligase and amplification reactions yielded 80–95-bp products depending on the target species. Because the generated LDR bands were close to those of any of the possible oligonucleotide dimer products, the bands considered indicative of the LDR reaction were confirmed by DNA sequencing. The general amplicon concentration range for LDR probes targeting different species was between ∼70 ng/μl and ∼6 pg/μl: the probe concentration was 0.2–1 pmol/μl, and the primer binding time was 2 min, with the reaction proceeding over 10 cycles. The total number of strains used for evaluating the LDR probes, and the sensitivities and specificities of all reactions are summarized in Table 3. No false-positive or false-negative results were detected for any LDR probe except EdLDR among the reference isolates. Two false-negatives (CBS 139118 and CBS 139120) and one false-positive (CBS 139126) were detected among the reference isolates targeted with EdLDR probes. In addition, 10 false-negatives and eight false-positives (E. phaeomuriformis, n = 7 and E. xenobiotica, n = 1) were detected among the nonreference isolates (Figs 4 and S1a). No false-negatives or false-positives were detected among the reference isolates evaluated with the EpLDR probes; however, 12 false-negatives were detected among the non-reference isolates (Figs 4 and S1b). No false-negatives or false-positives were detected among the analyzed reference and nonreference isolates with the EhLDR probes (Figs 4 and S1c). Moreover, one false-negative was detected among the nonreference isolates with EcLDR probes, whereas no false-negatives or false-positives were detected among the reference isolates (Figs 4 and S1d). In ExLDR analyses, no false-negatives or false-positives were detected among the reference and nonreference isolates (Figs 4 and S1e). Figure 4. View largeDownload slide Agarose gel demonstrating the specificity of LDR probes: EdLDR (a), EpLDR (b), EhLDR (c), EcLDR (d), and ExLDR (e). Amplification of the ligated products was only detected for hybridized template-probe mixtures. Empty lanes denote no amplification, in non-hybridized template-probe mixtures. Lane M, 100-bp DNA molecular weight marker (Thermo Scientific, Vilnius, Lithuania). Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; and Ex, E. xenobiotica. Figure 4. View largeDownload slide Agarose gel demonstrating the specificity of LDR probes: EdLDR (a), EpLDR (b), EhLDR (c), EcLDR (d), and ExLDR (e). Amplification of the ligated products was only detected for hybridized template-probe mixtures. Empty lanes denote no amplification, in non-hybridized template-probe mixtures. Lane M, 100-bp DNA molecular weight marker (Thermo Scientific, Vilnius, Lithuania). Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; and Ex, E. xenobiotica. Evaluation of the performance of LDR oligonucleotides Performance evaluations were based on 30 qPCR cycles, using the selected reference strains (see Methods; Figs S2–S4). No LDR oligonucleotides met the acceptance criterion for slope; however all oligonucleotides met the linearity, repeatability, reproducibility, and LOD/LOQ criteria. The results are summarized in Table 4. Table 4. Comparison of the performance parameters of LDR oligonucleotides. EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% View Large Table 4. Comparison of the performance parameters of LDR oligonucleotides. EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% View Large Discussion In this study, we aimed to develop a method for the rapid and inexpensive identification of Exophiala species using ligase-dependent probe amplification assays, RCA and LDR. We observed high probe sensitivity (100%) when targeting reference Exophiala strains using the designed RCA probes; however, the probes were not sufficiently specific (3.7–88.6%), which was associated with pronounced cross-reactivity among the tested species. The likely reason contributing to the wide disparity in specificity values is the uneven number of reference strains tested for each species. When the number of strains of each species was normalized by assuming equality, the specificity range was 25–50%. Although RCA performed very poorly in the present study, previous studies successfully identified black yeast-like fungi using RCA but did not report the sensitivity and specificity of the assays.13,22,23 Interestingly, we used the same protocols and same probe designs as these previous studies, with the only differences being the study strains and targeting sequences adopted. These discrepant results therefore highlight certain limitations of the RCA method. Although PCR/qPCR methods were used in conjunction with the barcode primers designed for the identification of Exophiala species,4 a satisfactory specific barcoding approach has not yet been developed because the nucleotide differences among chaetothyrialean fungi are quite low, especially in the ITS region.41 The performance of the LDR method, which is similar to RCA in terms of the reaction conditions and probe design, was also examined in this study with respect to its accuracy and possible limitations for identification and discrimination of Exophiala species. Our data show that the targeted species could be identified in LDR reactions with high sensitivity (88.7–100%) and high specificity (93.9–100%). E. phaeomuriformis was consistently identified using the LDR/PCR method and could be precisely distinguished from the two taxonomically closely related species, E. dermatitidis and E. heteromorpha, when the amplicon concentration was sufficiently high. Thermophilic E. dermatitidis and E. phaeomuriformis species are most frequently isolated in extreme habitats associated with human activity (e.g., dishwashers), and they often share the same habitat;26,27,29–33 therefore, it is highly relevant that these species can be identified using LDR/PCR probes. Reactions containing the EdRCA/EdLDR and ExRCA/ExLDR probes targeting the same sequences were evaluated with the two methods, demonstrating that the LDR probe reactions were much more specific than the RCA probe reactions conducted under the same reaction conditions. To our knowledge, this is the first study to directly compare the effectiveness of the RCA and LDR methods. We also found that the LDR method was more affordable than the RCA method (1–2$ vs. 4–5$/test, respectively) and was also more reliable in terms of practicality and sensitivity/specificity. In contrast to Najafzadeh et al.,13 we suggested that RCA is not a reliable and inexpensive method for the identification of Exophiala spp. and should not be recommended for clinical laboratory use. Although it has been reported that thermostable DNA ligases possess high discriminatory power with respect to mispairs in the ligation region, the accuracy of this discrimination has also been shown to be dependent on the targeted discriminative nucleotides.42,43 In general, ligases can more efficiently discriminate purine–purine mispairs than pyrimidine–pyrimidine and purine–pyrimidine mispairs.42 In this regard, it has been suggested that these enzymes can make errors in discriminating among purine–pyrimidine or pyrimidine–pyrimidine mispairs (G:T, G:G, C:C, A:G, C:T, and T:C), which results in high background signals.42 Lohman et al.43 reported that the background signals in a reaction catalyzed by Taq DNA ligase could be effectively reduced after optimization of certain reaction parameters such as temperature, pH, and monovalent cation concentrations (KCl) that prevent mispairing in the ligase reaction. Moreover, it was also reported that the presence of more than four identical nucleotides within the discriminative probe was important for improving the specificity of the ligase reaction.44,45 In the current study, SYBR Green-based qPCR was used for evaluation of the performance and validation of the LDR method. Considering the ENGL reference guidelines, the EhLDR probe performance was closest to the standard curve quality criteria (slope: 3.647, R2: 0.999, efficiency%: 88%), followed by EcLDR, EdLDR, EpLDR, and ExLDR. When the validation parameters of repeatability and reproducibility (RSDr range: 1.7–8%) were considered, the LDR for each probe was within the ENGL limit values.46,47 The products of the ligated ExLDR probe were detected at a higher Cq value (23–25) than those of the other LDR probes. Although the sensitivity and specificity of this probe were high, a smaller amount of ligated product of the ExLDR probes appeared to be generated compared to those of other LDR probes under the same ligase reaction conditions. Therefore, the standard curve with the ExLDR probe could only be generated based on three amplicon concentrations in 30 qPCR cycles because sufficiently accurate linearity could not be obtained when the amplicon concentration was below 6 ng/μl. When ligase-based probe amplification methods are compared with other nucleic acid-based methods, the basic knowledge of optimization parameters, from primer design to the reaction conditions and target sequence features, is not sufficient for designing a successful LDR assay. Although ligase-based probe amplification methods are routinely used, and a commercial kit (MRC-Holland, MLPA®)48 was developed for the detection of mutations in genetic diseases, no commercial product is currently available for the detection of pathogenic microorganisms or species discrimination in medical microbiology. Thermophilic E. dermatitidis and E. phaeomuriformis are often isolated together with Candida parapsilosis and Magnusiomyces/Saprochaete clade from household dishwashers.26,27,31,33 Although beyond the scope of this study, once the LDR/qPCR method is adequately optimized, it might be developed for the unequivocal targeting of E. dermatitidis and E. phaeomuriformis species directly from the genomic DNA pool extracted from samples. This would eliminate the need for conducting time-consuming and labor-intensive fungal culture, especially for samples collected from highly selective environments such as dishwashers. Conclusively, LDR performed much better than RCA as an alternative to DNA sequencing. The main advantage of the LDR method is that it may be applied to differentiate cryptic species without the need for sequence analysis by targeting “difficult” DNA regions that only differ with respect to a few bases. Although the optimization requirement would increase the reaction costs, once an optimized and highly specific LDR probe is developed, examination of numerous samples using the LDR method will become more affordable than sequencing-based identification. Its potential applications in routine screenings in both research and clinical laboratories make this method even more relevant. Supplementary material Supplementary data are available at MMYCOL online. Acknowledgements We express gratitude to the curators of the Centraalbureau voor Schimmelcultures (housed at Westerdijk Fungal Biodiversity Institute, Utrecht, Netherlands) for kindly providing the clinical Exophiala isolates. Funding This study was funded by the Research Fund of Çukurova University (project no: TF2014 D3). Author contributions Conceived and designed the experiments: EK, MI, GSH. Performed the experiments: EK. Analyzed the data: EK, MI. Contributed reagents/materials/analysis tools: EK, MI, GSH. Wrote the paper: EK, MI, GSH. Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper. References 1. de Hoog GS , Guarro J , Figueras MJ , Gene J . Atlas of Clinical Fungi: The ultimate benchtool for diagnostics . 4th CD-ROM ed . Utrecht, the Netherlands : CBS-KNAW Fungal Biodiversity Centre , Utrecht; Universitat Rovira i Virgili, Reus , 2014 . 2. Revankar SG , Sutton DA . Melanized fungi in human disease . Clin Microbiol Rev . 2010 ; 23 : 884 – 928 . Google Scholar CrossRef Search ADS PubMed 3. Zeng JS , Sutton DA , Fothergill AW , Rinaldi MG , Harrak MJ , de Hoog GS . Spectrum of clinically relevant Exophiala species in the United States . J Clin Microbiol . 2007 ; 45 : 3713 – 3720 . Google Scholar CrossRef Search ADS PubMed 4. Libert X , Chasseur C , Packeu A , Bureau F , Roosens NH , de Keersmaecker SJ . A molecular approach for the rapid, selective and sensitive detection of Exophiala jeanselmei in environmental samples: development and performance assessment of a real-time PCR assay . Appl Microbiol Biotechnol . 2016 ; 100 : 1377 – 1392 . Google Scholar CrossRef Search ADS PubMed 5. Sudhadham M , de Hoog GS , Menken SB , Gerrits van den Ende AH , Sihanonth P . Rapid screening for genotypes as possible markers of virulence in the neurotropic black yeast Exophiala dermatitidis using PCR-RFLP. J Microbiol Methods . 2010 ; 80 : 138 – 142 . Google Scholar CrossRef Search ADS PubMed 6. Sudhadham M , Gerrits van den Ende AH , Sihanonth P et al. Elucidation of distribution patterns and possible infection routes of the neurotropic black yeast Exophiala dermatitidis using AFLP. Fungal Biol . 2011 ; 115 : 1051 – 1065 . Google Scholar CrossRef Search ADS PubMed 7. Heinrichs G , Hübner I , Schmidt C , de Hoog GS , Haase G . Analysis of black fungal biofilms occurring at domestic water taps (I): compositional analysis using Tag-Encoded FLX Amplicon Pyrosequencing. Mycopathologia . 2013 ; 175 : 387 – 397 . Google Scholar CrossRef Search ADS PubMed 8. Ergin Ç , Gök Y , Bayğu Y et al. ATR-FTIR spectroscopy highlights the problem of distinguishing between Exophiala dermatitidis and E. phaeomuriformis using MALDI-TOF MS . Microb Ecol . 2016 ; 71 : 339 – 346 . Google Scholar CrossRef Search ADS PubMed 9. Kondori N , Erhard M , Welinder-Olsson C , Groenewald M , Verkley G , Moore ER . Analyses of black fungi by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS): species-level identification of clinical isolates of Exophiala dermatitidis . FEMS Microbiol Lett . 2015 ; 362 : 1 – 6 . Google Scholar CrossRef Search ADS PubMed 10. Özhak-Baysan B , Öğünç D , Döğen A , Ilkit M , de Hoog GS . MALDI-TOF MS-based identification of black yeasts of the genus Exophiala . Med Mycol . 2015 ; 53 : 347 – 352 . Google Scholar CrossRef Search ADS PubMed 11. Borman AM , Fraser M , Szekely A , Larcombe DE , Johnson EM . Rapid identification of clinically relevant members of the genus Exophiala by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry and description of two novel species, Exophiala campbellii and Exophiala lavatrina . J Clin Microbiol . 2017 ; 55 : 1162 – 1176 . Google Scholar CrossRef Search ADS PubMed 12. Nilsson M. Lock and roll: single-molecule genotyping in situ using padlock probes and rolling-circle amplification . Histochem Cell Biol . 2006 ; 126 : 159 – 164 . Google Scholar CrossRef Search ADS PubMed 13. Najafzadeh MJ , Dolatabadi S , Saradeghi Keisari M , Naseri A , Feng P , de Hoog GS . Detection and identification of opportunistic Exophiala species using the rolling circle amplification of ribosomal internal transcribed spacers . J Microbiol Methods . 2013 ; 94 : 338 – 342 . Google Scholar CrossRef Search ADS PubMed 14. Zhou X , Kong F , Sorrell TC , Wang H , Duan Y , Chen SCA . Practical method for detection and identification of Candida, Aspergillus, and Scedosporium spp. by use of rolling circle amplification . J Clin Microbiol . 2008 ; 46 : 2423 – 2427 . Google Scholar CrossRef Search ADS PubMed 15. Kong F , Tong Z , Chen X et al. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification . J Clin Microbiol . 2008 ; 46 : 1192 – 1199 . Google Scholar CrossRef Search ADS PubMed 16. Das S , Rundell MS , Mirza AH et al. A multiplex PCR/LDR assay for the simultaneous identification of category A infectious pathogens: agents of viral hemorrhagic fever and variola virus . PLOS One . 2015 ; 10 : e0138484 . Google Scholar CrossRef Search ADS PubMed 17. Rundell MS , Pingle M , Das S et al. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens . Diagn Microbiol Infect Dis . 2014 ; 79 : 135 – 140 . Google Scholar CrossRef Search ADS PubMed 18. Wolffs PF , Vink C , Keijdener J et al. Evaluation of MeningoFinder, a novel multiplex ligation-dependent probe amplification assay for simultaneous detection of six virus species causing central nervous system infections . J Clin Microbiol . 2009 ; 47 : 2620 – 2622 . Google Scholar CrossRef Search ADS PubMed 19. Severo LC , Oliveira FM , Vettorato G , Londero AT . Mycetoma caused by Exophiala jeanselmei . Report of a case successfully treated with itraconazole and review of the literature . Rev Iberoam Micol . 1999 ; 16 : 57 – 59 . Google Scholar PubMed 20. Barany F. Genetic disease detection and DNA amplification using cloned thermostable ligase . Proc Natl Acad Sci U S A . 1991 ; 88 : 189 – 193 . Google Scholar CrossRef Search ADS PubMed 21. Abravaya K CJ , Muldoon S , Lee HH . Detection of point mutations with a modified ligase chain reaction (Gap-LCR). Nucleic Acids Res . 1995 ; 23 : 675 – 682 . Google Scholar CrossRef Search ADS PubMed 22. Najafzadeh MJ , Sun J , Vicente VA , de Hoog GS . Rapid identification of fungal pathogens by rolling circle amplification using Fonsecaea as a model . Mycoses . 2011 ; 54 : e577 – 582 . Google Scholar CrossRef Search ADS PubMed 23. Ahmed SA , van den Ende BH , Fahal AH , van de Sande WW , de Hoog GS. Rapid identification of black grain eumycetoma causative agents using rolling circle amplification . PLOS Negl Trop Dis . 2014 ; 8 : e3368 . Google Scholar CrossRef Search ADS PubMed 24. Furuie JL , Sun J , do Nascimento MM et al. Molecular identification of Histoplasma capsulatum using rolling circle amplification . Mycoses . 2016 ; 59 : 12 – 19 . Google Scholar CrossRef Search ADS PubMed 25. Rodrigues AM , Najafzadeh MJ , de Hoog GS , de Camargo ZP . Rapid identification of emerging human-pathogenic Sporothrix species with rolling circle amplification . Front Microbiol . 2015 ; 6 : 1385 . Google Scholar PubMed 26. Zalar P , Novak M , de Hoog GS , Gunde-Cimerman N . Dishwashers—A man-made ecological niche accommodating human opportunistic fungal pathogens . Fungal Biol . 2011 ; 115 : 997 – 1007 . Google Scholar CrossRef Search ADS PubMed 27. Zupančič J , Novak Babič M , Zalar P , Gunde-Cimerman N . The black yeast Exophiala dermatitidis and other selected opportunistic human fungal pathogens spread from dishwashers to kitchens . PLOS One . 2016 ; 11 : e0148166 . Google Scholar CrossRef Search ADS PubMed 28. Zeng P , Feng P , Gerrits van den Ende AHG , Xi L , Harrak MJ , de Hoog GS . Multilocus analysis of the Exophiala jeanselmei clade containing black yeasts involved in opportunistic disease in humans . Fungal Diversity . 2014 ; 65 : 3 – 16 . Google Scholar CrossRef Search ADS 29. Döğen A , Ilkit M , de Hoog GS . Black yeast habitat choices and species spectrum on high altitude creosote-treated railway ties . Fungal Biol . 2013 ; 117 : 692 – 696 . Google Scholar CrossRef Search ADS PubMed 30. Döğen A , Kaplan E , Ilkit M , de Hoog GS . Massive contamination of Exophiala dermatitidis and E. phaeomuriformis in railway stations in subtropical Turkey . Mycopathologia . 2013 ; 175 : 381 – 386 . Google Scholar CrossRef Search ADS PubMed 31. Döğen A , Kaplan E , Öksüz Z , Serin MS , Ilkit M , de Hoog GS . Dishwashers are a major source of human opportunistic yeast-like fungi in indoor environments in Mersin, Turkey. Med Mycol . 2013 ; 51 : 493 – 498 . Google Scholar CrossRef Search ADS PubMed 32. Gümral R , Tümgör A , Saraçlı MA , Yıldıran ŞT , Ilkit M , de Hoog GS . Black yeast diversity on creosoted railway sleepers changes with ambient climatic conditions . Microb Ecol . 2014 ; 68 : 699 – 707 . Google Scholar CrossRef Search ADS PubMed 33. Gümral R , Özhak-Baysan B , Tümgör A et al. Dishwashers provide a selective extreme environment for human-opportunistic yeast-like fungi . Fungal Diversity . 2016 ; 76 : 1 – 9 . Google Scholar CrossRef Search ADS 34. Turin L , Riva F , Galbiati G , Cainelli T . Fast, simple and highly sensitive double-rounded polymerase chain reaction assay to detect medically relevant fungi in dermatological specimens . Eur J Clin Invest . 2000 ; 30 : 511 – 518 . Google Scholar CrossRef Search ADS PubMed 35. Owczarzy R , Tataurov AV , Wu Y et al. IDT SciTools: a suite for analysis and design of nucleic acid oligomers . Nucleic Acids Res . 2008 ; 36 : 163 – 169 . Google Scholar CrossRef Search ADS 36. Blakely T , Salmond C . Probabilistic record linkage and a method to calculate the positive predictive value . Int J Epidemiol . 2002 ; 31 : 1246 – 1252 . Google Scholar CrossRef Search ADS PubMed 37. Broeders S , Huber I , Grohmann L et al. Guidelines for validation of quantitative real-time PCR methods . Trends Food Sci Tech . 2014 ; 37 : 115 – 126 . Google Scholar CrossRef Search ADS 38. Libert X , Chasseur C , Bladt S et al. Development and performance assessment of a qualitative SYBR® green real-time PCR assay for the detection of Aspergillus versicolor in indoor air . Appl Microbiol Biotechnol . 2015 ; 99 : 7267 – 7282 . Google Scholar CrossRef Search ADS PubMed 39. European Network of GMO Laboratories . Verification of analytical methods for GMO testing when implementing interlaboratory validated methods . Joint Research Centre , Luxembourg, Luxembourg , 2011 . 40. Tamura K , Stecher G , Peterson D , Filipski A , Kumar S . MEGA6: Molecular Evolutionary Genetics Analysis version 6.0 . Mol Biol Evol . 2013 ; 30 : 2725 – 2729 . Google Scholar CrossRef Search ADS PubMed 41. Heinrichs G , de Hoog GS , Haase G . Barcode identifiers as a practical tool for reliable species assignment of medically important black yeast species . J Clin Microbiol . 2012 ; 50 : 3023 – 3030 . Google Scholar CrossRef Search ADS PubMed 42. Luo J , Bergstrom DE , Barany F . Improving the fidelity of Thermus thermophilus DNA ligase . Nucleic Acids Res . 2016 ; 24 : 3071 – 3078 . Google Scholar CrossRef Search ADS 43. Lohman GJ , Bauer RJ , Nichols NM et al. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity . Nucleic Acids Res . 2016 ; 44 : e14 . Google Scholar CrossRef Search ADS PubMed 44. Shuman S. Closing the gap on DNA ligase . Structure . 1996 ; 4 : 653 – 656 . Google Scholar CrossRef Search ADS PubMed 45. Stewart J , Kozlowski P , Sowden M , Messing E , Smith HC . A quantitative assay for assessing allelic proportions by iterative gap ligation . Nucleic Acids Res . 1998 ; 26 : 961 – 966 . Google Scholar CrossRef Search ADS PubMed 46. European Network of GMO Laboratories (ENGL) . Definition of minimum performance requirements for analytical methods of GMO testing . EUR-Scientific and Technical Research Reports . Luxembourg, Luxembourg , 2008 . 47. European Network of GMO Laboratories (ENGL) . Definition of minimum performance requirements for analytical methods of GMO testing . EUR-Scientific and Technical Research Reports . Luxembourg, Luxembourg , 2015 . 48. MLPA® - an introduction . Available from: http://www.mrc-holland.com/WebForms/WebFormMain.aspx?Tag=fNPBLedDVp38p-CxU2h0mQ . © The Author(s) 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Medical Mycology Oxford University Press

Comparison of the rolling circle amplification and ligase-dependent reaction methods for the identification of opportunistic Exophiala species

Medical Mycology , Volume 56 (6) – Aug 1, 2018
Download PDF
11 pages

Loading next page...
 
/lp/oxford-university-press/comparison-of-the-rolling-circle-amplification-and-ligase-dependent-yLPkt8Nthi

References (49)

Publisher
Oxford University Press
Copyright
© The Author(s) 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology.
ISSN
1369-3786
eISSN
1460-2709
DOI
10.1093/mmy/myx095
pmid
29087521
Publisher site
See Article on Publisher Site

Abstract

Abstract We developed two ligase-dependent probe amplification assays based on rolling circle amplification (RCA) and the ligase-dependent reaction (LDR) to differentiate species of Exophiala targeting the rDNA internal transcribed spacer region. We focused on Exophiala dermatitidis and E. phaeomuriformis, two opportunistic inhabitants of indoor wet cells, and further detected E. heteromorpha, E. xenobiotica, and E. crusticola; 57 reference isolates representing the five species were tested. Depending on the RCA probes used, the sensitivity was 100%, and the specificity ranged from 3.7% to 88.6% (median: 46.1%). In contrast, the sensitivity and specificity of the LDR probes targeting the same isolates were 88.6–100% (median: 95.8%) and 95.4–100% (median: 97.7%), respectively. We analyzed 198 additional environmental isolates representing the same Exophiala species. Overall, the sensitivity and specificity of LDR ranged from 89.7% to 100% (median: 94.1%) and from 93.9% to 100% (median: 96.9%), respectively. The assessment of performance and validation of LDR probes using SYBR Green quantitative polymerase chain reaction revealed high reproducibility and an acceptable range limit, in line with the guidelines of the European Network of GMO Laboratories. In conclusion, the LDR assay was more reliable and less expensive than RCA for species-level identification of Exophiala isolates. Black yeast, ITS, molecular biology, qPCR, real-time PCR Introduction The black yeast genus Exophiala is taxonomically positioned in the family Herpotrichiellaceae, order Chaetothyriales, class Ascomycetes.1,2 Phenotypic identification of most Exophiala species is difficult and ambiguous because of their highly polymorphic nature.2 Currently, the “gold standard” in the molecular diagnostics of Exophiala species is to sequence the internal transcribed (ITS) region of rDNA,3 which differs sufficiently between species to allow for their differentiation.1 Nevertheless, the sequencing protocol is too time-consuming and expensive (10$/test) for environmental screening and is not suitable for processing a large number of samples simultaneously. To overcome these limitations, many alternative methods have been developed, including molecular approaches (e.g., quantitative polymerase chain reaction [qPCR],4 restriction fragment length polymorphism [RFLP],5 amplified fragment length polymorphism [AFLP],6 and next-generation sequencing7) and protein-based approaches (e.g., matrix-assisted laser desorption ionization-time of flight/mass spectrometry [MALDI-TOF/MS] and attenuated total reflectance-Fourier transform infrared spectroscopy [ATR-FTIR]).8–11 A recent study revealed that MALDI-TOF/MS can accurately identify a very large range of Exophiala species.11 Unlike conventional diagnostic PCR or qPCR, ligase-dependent probe amplification methods such as rolling circle amplification (RCA) and ligase-dependent reaction (LDR) enable the identification of species that do not contain an appropriate target sequence that is specifically targetable by conventional primers.12–15 Ligase-dependent probe amplification methods generally consist of sequential highly accurate steps of the hybridization and ligation of adjacent probes at their 5΄ and 3΄ terminal regions using a thermostable DNA ligase, followed by amplification of the ligated products with universal primers.16–18 LDR (40–45 nucleotides) and RCA (85–100 nucleotides) probes are longer than conventional PCR primers, because they incorporate hybridization and universal barcode sequences.14,19–21 The main differences between the RCA and LDR methods are the amplification step and probe design. In 2008, the RCA method was introduced as a rapid and specific tool in medical mycology diagnostics for identification of the genera Candida, Aspergillus, and Scedosporium,14 and Trichophyton spp.15 Subsequently, this technique was applied for the identification of black yeasts and their relatives (the genera Exophiala and Fonsecaea),13,22 common agents of eumycetoma,23 and dimorphic fungi such as Histoplasma capsulatum24 and Sporothrix schenckii complex.25 Moreover, the LDR method has been typically used in virus studies such as for the detection of variola and Dengue virus,16 and many bacteria.17 However, to the best of our knowledge, LDR has not yet been applied in the field of medical mycology. The motivation for this study is that thermophilic Exophiala dermatitidis and Exophiala phaeomuriformis are the most common human opportunists of the black yeast genus Exophiala, which both occur in indoor wet cells,26,27 but the former species is more pathogenic and a threat to public health.3 There is also a need for development of a rapid and inexpensive tool for routine screening and identification of human-opportunistic Exophiala spp.28 In this study, we aimed to compare the performance of the RCA and LDR methods, without relying on DNA sequencing, for the identification and discrimination of the closely related species E. dermatitidis and E. phaeomuriformis. We also compared the performance of these methods for identification of another closely related species (E. heteromorpha) and some more distant relatives (E. xenobiotica and E. crusticola) as controls. In addition, we examined the suitability of these methods for use in routine examinations in a research laboratory setting. Methods Isolates A total of 255 Exophiala isolates were investigated in this study, including isolates of E. dermatitidis (n = 107), E. phaeomuriformis (n = 109), E. heteromorpha (n = 20), E. xenobiotica (n = 5), and E. crusticola (n = 14). Eleven were clinical E. dermatitidis isolates, and the remaining 244 were recovered from railway sleepers (n = 184) and household dishwashers (n = 60) and had been previously identified by conventional ITS sequencing.29–33 Strain data are given in Tables S1 and S2. The strains are maintained in the reference collection of the CBS-KNAW Fungal Biodiversity Centre (housed at Westerdijk Fungal Biodiversity Institute, Utrecht, the Netherlands) and in the Division of Mycology at Çukurova University, Adana, Turkey. All isolates were subcultured on 2% malt extract agar (Sigma-Aldrich, St. Louis, MO, USA) and incubated at 28°C for 2–7 d prior to the study. DNA extraction and amplification Genomic DNA was purified using a GeneJET Genomic DNA Purification Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer's instructions. The yield and purity of DNA samples were determined with a NanoDrop spectrophotometer (NanoQ, CapitalBio, Beijing, China). PCR amplifications were performed following the protocol described by Turin et al.34 Probe design To design the RCA probes, ITS sequences of the five Exophiala species were retrieved from the GenBank database (https://www.ncbi.nlm.nih.gov/) and were aligned using the MAFFT algorithm (http://www.ebi.ac.uk/Tools/msa/mafft/) to identify informative nucleotide polymorphisms and select optimal probe-binding regions. The padlock probes were designed according to the study of Najafzahed et al.13 The linker regions of each Exophiala species-specific probe were determined as described in Zhou et al.;14 the E. dermatitidis species-specific probe was determined according to Najafzahed et al.13 The 5΄- and the 3΄- binding arms of other Exophiala species-specific probes were newly designed in this study (Table 1). Padlock probes were ordered from Invitrogen Inc. (Breda, the Netherlands). Table 1. RCA probes and probe-specific primers used in this study. Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] aP, 5΄-end phosphorylation. bRCA primer 1 is a reverse-complement of the segment designated by bold capital letters in the padlock probe core sequence. cRCA primer 2 is the same as the segment designated by capital letters (not bold) in the padlock probe core sequence. dThe padlock probe is the probe core and includes a non-specific linker region, shown in lowercase letters. The X and Y sites are the binding arms of padlock probes. View Large Table 1. RCA probes and probe-specific primers used in this study. Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] Probe/primer Target species Sequences of the two binding arms of padlock probes Reference Site X at 5΄ end Site Y at 3΄ end EdRCA E. dermatitidis 5΄Pa ACGCTCGACCAGACCGTCCAA-3΄ 5΄-AGGGGTCGCGCGGAA-3΄ [13] EpRCA E. phaeomuriformis 5΄Pa GTRATTTTGGCTAYCGGCGG-3΄ 5΄-CGATTATTCAAGAGTTTG-3΄ This study EhRCA E. heteromorpha 5΄Pa GATAGGTTTGGCTACCGGCG-3΄ 5΄-GCTTTTATKCAAGAGTTT-3΄ This study EcRCA E. crusticola 5΄Pa CGAGGGACTAGCCCAGGCCT-3΄ 5΄-CATTGTCTTTAGGAGAGG-3΄ This study ExRCA E. xenobiotica 5΄Pa GGCACTCTCCAGAGGACGTTT 5΄-GGTWTGGGCTATCGGTA-3΄ This study RCA1 primerb 5΄-ATGGGCACCGAAGAAGCA-3΄ [14] RCA2 primerc 5΄-CGCGCAGACACGATA-3΄ [14] Padlock probe cored X-gatcaTGCTTCTTCGGTGCCCATtaccggtgcggatagctacCGCGCAGACACGATAgtcta-Y [14] aP, 5΄-end phosphorylation. bRCA primer 1 is a reverse-complement of the segment designated by bold capital letters in the padlock probe core sequence. cRCA primer 2 is the same as the segment designated by capital letters (not bold) in the padlock probe core sequence. dThe padlock probe is the probe core and includes a non-specific linker region, shown in lowercase letters. The X and Y sites are the binding arms of padlock probes. View Large The LDR probes were designed as two adjacent oligonucleotides (upstream and downstream), each of which comprised a sequence complementary to the target and 20–25-mer zip sequences at the termini, complementary to the designed universal primers. The annealing temperatures of the LDR oligonucleotides were within 60–80°C, with a maximum 5°C difference between the upstream and downstream oligonucleotides (Table 2). All LDR oligonucleotides were newly designed in this study. LDR oligonucleotides were ordered from Sentegen Biyoteknoloji (Ankara, Turkey). The downstream LDR oligonucleotides were phosphorylated at the 5΄-end using a T4 polynucleotide kinase kit (T4 PNK; Thermo Scientific, Waltham, MA, USA) according to the manufacturer's instructions. Table 2. LDR oligonucleotides and oligonucleotide-specific universal primers used in this study. Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study aP, 5΄-end phosphorylation. View Large Table 2. LDR oligonucleotides and oligonucleotide-specific universal primers used in this study. Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study Probe/Primer Target species Target ITS region Sequences of binding arms of LDR oligonucleotides Annealing Tm (oC) Reference Upstream oligonucleotides(5΄–3΄) Downstream oligonucleotides(5΄–3΄) EdLDR E. dermatitidis ITS2 TGGACGGTCTGGTCGAGCGT 5΄Pa-TTCCGCGCGACCCCTCCCA 80 This study EpLDR E. phaeomuriformis ITS2 TTGGACGGTCTGGTCGAGCTG 5΄Pa-CTCGACCCCTCCCAAAGACAA 75 This study EhLDR E. heteromorpha ITS1 CCTCCCAACCCTTTGTTTATCA 5΄Pa-CACCCTTGTTGCTTCGGC 60 This study EcLDR E. crusticola ITS1 AAACGTGTYATTGTCTGAGTACC 5΄Pa-TGATTATTAAATCATAAGCAAAAC 60 This study ExLDR E. xenobiotica ITS1 ACCGKMAAACGTCCTCTGGA 5΄Pa-GAGTGCCTACCGATRGCC 60 This study Tag F (Upstream) GTATAGGTTCACTGATATAGA This study Tag R (Downstream) GAGAGAGAAGTTATTGACTAC This study Universal primer F GTATAGGTTCACTGATATA This study Universal primer R GTAGTCAATAACTTCTCTC This study aP, 5΄-end phosphorylation. View Large The thermodynamic features of the RCA probes and LDR oligonucleotides were assessed using Oligo Analyzer 3.135 online software, to ascertain the similarity of their thermodynamic features and to avoid hairpin and self/hetero-dimer formation. EdRCA/EdLDR and ExRCA/ExLDR probes designed for E. dermatitidis and E. xenobiotica, respectively, targeted the same sequences to allow for direct comparison of the two methods. The genetic targets used in primer design are given in Table S3. Ligation reaction A schematic of the main features of the LDR oligonucleotides and the steps of the assay are shown in Figure 1. The ITS amplicon (100 ng) was mixed with 2 U of Pfu DNA ligase (Epicentre Biotechnologies, Madison, WI, USA), 0.1 μmol of each probe/oligonucleotide in 20 mM Tris-HCl (pH 7.5), and 1 μl of 10 × ligase buffer supplied by the enzyme manufacturer. Ligation reaction samples were heated at 94°C for 1 min, followed by 10 cycles of 94°C for 30 s and a 2-min ligation step at the appropriate annealing temperatures (Tables 1 and 2). Figure 1. View largeDownload slide Overview of the ligase detection reaction (LDR). (A) Target DNA and probes: schematic of the target region of Exophiala dermatitidis rDNA (1) and general design of LDR probes. LDR oligonucleotides contain a hybridization region for binding to target DNA and a universal primer region for the amplification of ligated products. (B) Principles of LDR: (1) the ligase covalently joins two adjacently-hybridized probes at the ligation site; (2) ligation products are amplified with universal primers; and (3) amplified products are detected by electrophoresis or real-time PCR. This Figure is reproduced in color in the online version of Medical Mycology. Figure 1. View largeDownload slide Overview of the ligase detection reaction (LDR). (A) Target DNA and probes: schematic of the target region of Exophiala dermatitidis rDNA (1) and general design of LDR probes. LDR oligonucleotides contain a hybridization region for binding to target DNA and a universal primer region for the amplification of ligated products. (B) Principles of LDR: (1) the ligase covalently joins two adjacently-hybridized probes at the ligation site; (2) ligation products are amplified with universal primers; and (3) amplified products are detected by electrophoresis or real-time PCR. This Figure is reproduced in color in the online version of Medical Mycology. Exonuclease digestion and RCA reaction The exonucleolytic cleavage reaction was performed in a 20 μl volume; 10 U each of exonuclease I and III (New England Biolabs, Hitchin, UK) were added to the ligation mixture, followed by incubation at 37°C for 30 min, and a further incubation at 94°C for 3 min to inactivate the enzymes. For the RCA reaction, 1 μl of the ligation product was used as a template. The reaction (50 μl) contained 8 U of Bst DNA polymerase (New England Biolabs, Ipswich, MA, USA), 400 μM of dNTP mix, and 10 pmol of each RCA primer, in molecular biology-grade water. Probe signals were amplified by incubating at 65°C for 30 min. RCA products were visualized on a 1% agarose gel, with a ladder-like product pattern indicating positive reactions. LDR amplification The amplification was performed in a final volume of 25 μl; the reaction contained 1 × PCR buffer, 2.5 μl of MgCl2, 1 μl of dNTPs, 0.5 μl of 10 μM of universal LDR primers, 1.25 U of Taq DNA polymerase, and nuclease-free water. The PCR was performed as follows: 5 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 50°C, and 45 s at 72°C; with a final extension step of 5 min at 72°C. qPCR The qPCR was performed using 2 × Maxima™ SYBR Green qPCR master mix (Thermo Scientific, Lafayette, CO, USA) and ABI ViiA™ 7 System, according to the manufacturer's instructions. In brief, the reaction was performed in a final volume of 25 μl, containing 12.5 μl of 2 × SYBR Green PCR Mastermix, 0.5 μl of LDR universal forward and reverse primers (5 μM), 1 μl of the LDR reaction product, and 10.5 μl of DNase-free water. The amplification steps were as follows: 10 min at 95°C; 30 cycles of 30 s at 95°C, 30 s at 50°C, and 45 s at 72°C; followed by 5 min at 72°C. Performance assays The sensitivity and selectivity values were calculated according to the methods of Blakely and Salmond.36 To assess the performance of the LDR oligonucleotides, reference strains of each species were used, that is, E. dermatitidis CBS 132752, E. xenobiotica CBS 137226, E. phaeomuriformis CBS 132756, E. heteromorpha CBS 134042, and E. crusticola CBS 134043. The assessment of LDR oligonucleotide performance was carried out using qPCR, according to an approach previously outlined by Broeders et al.37 and Libert et al.38 Different parameters of qPCR were evaluated as the “acceptance and performance parameters,” including efficiency, linearity (R2), sensitivity, selectivity, repeatability, reproducibility, limit of detection (LOD), and limit of quantification (LOQ). To calculate the PCR efficiency and linearity, a dilution series (10−1 to 10−6) of ITS region amplicons was prepared, and each dilution was used in an LDR ligation reaction. Each LDR product was used for standard curve analysis, conducted in duplicate for each dilution point. The linear regression values and the linear regression slopes were obtained using the ViiA™ 7 Software v1.2.1 (Life Technologies, Carlsbad, CA, USA). For the repeatability and reproducibility assays, 10−2 amplicon dilutions were prepared and used in the ligase reactions. The product of the separate ligase reactions was assessed in 10 separate qPCR tests using identical running conditions on the same day to assess repeatability; two separate qPCR tests were performed per day, using identical running conditions for 5 d (i.e., a total of 10 tests) to assess reproducibility. The relative standard derivation (RSDr) of Cq values was calculated using Microsoft Excel. For calculation of the LOD and LOQ, ligase reaction products of the lowest quantifiable dilution of the amplicon were assessed in 10 separate qPCR tests for each LDR probe using the same qPCR conditions in 30 cycles on the same day. Three and 10 multiples of the RSDr of Cq values correspond to the LOD and LOQ, respectively. Assessment of overall assay performance The acceptance criteria of the efficiency, linearity (R2), sensitivity (LOD and LOQ), selectivity, and repeatability parameters were evaluated according to the following European Network of GMO Laboratories (ENGL) guidelines:39 the slope of the regression curve should be between –3.6 and –3.1; the efficiency should fall within 80–120%; the RSDr value of repeatability/reproducibility should be less than 25%; the RSDr value for the LOQ should be less than 1/10th of the target concentration, and that for the LOD should be less than 1/20th of the target concentration.39 Results In this study, we aimed to identify 255 Exophiala isolates, including 57 reference isolates registered in CBS/GenBank, using RCA and LDR methods that do not involve DNA sequencing. The ITS1–5.8S–ITS4 regions of the isolates were amplified and the amplicon lengths were determined to be 600–700 bp (Fig. 2). Figure 2. View largeDownload slide Representative electropherogram of the ITS region (ITS 1–5.8S–ITS4) of Exophiala isolates. M, marker; Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ex, E. xenobiotica; and Ec, E. crusticola. Figure 2. View largeDownload slide Representative electropherogram of the ITS region (ITS 1–5.8S–ITS4) of Exophiala isolates. M, marker; Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ex, E. xenobiotica; and Ec, E. crusticola. When the nucleotide differences between the sequences were analyzed based on the previously obtained ITS1–5.8S–ITS4 sequencing data for the study isolates and the sequence data retrieved from the GenBank database, a 5.8–18.6% (28–93 nucleotides) difference was observed among the species.40 For probe design, the ITS1 region was targeted in E. xenobiotica, E. heteromorpha, and E. crusticola, and the ITS2 region was targeted in E. dermatitidis and E. phaeomuriformis. RCA ligation and amplification reactions Lane smears were observed after electrophoresis of the reaction products (Fig. 3). Because “ladder-like” patterns were not apparent, we concluded that the probe hybridized to the target with low efficiency. The total number of strains used for evaluating the RCA probes, and the sensitivities and specificities of all reactions are summarized in Table 3. No false-negative reaction was observed for the RCA probes. Cross-reaction was observed for EdRCA with the E. phaeomuriformis, E. heteromorpha, and E. crusticola strains, for EpRCA with the E. dermatitidis and E. heteromorpha strains, for EhRCA with all other species, except for E. xenobiotica, for ExRCA with E. heteromorpha and E. crusticola strains, and for EcRCA with E. heteromorpha and E. xenobiotica strains (Fig. 3). Figure 3. View largeDownload slide Agarose gel demonstrating the specificity of rolling circle amplification probes. Amplification products were only observed for hybridized template-probe mixtures (empty lanes denote the absence of products, with non-hybridized template-probe mixtures). The species-specific probes are labeled as shown at the top of the figure. Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; Ex, E. xenobiotica; and Ca, C. albicans. Figure 3. View largeDownload slide Agarose gel demonstrating the specificity of rolling circle amplification probes. Amplification products were only observed for hybridized template-probe mixtures (empty lanes denote the absence of products, with non-hybridized template-probe mixtures). The species-specific probes are labeled as shown at the top of the figure. Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; Ex, E. xenobiotica; and Ca, C. albicans. Table 3. Study isolates, and sensitivity and specificity for each RCA and LDR probe. Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 FN, False-negative; FP, False-positive; NT, Nontargeted species; T, Targeted species; TN, True-negative; TP, True-positive. View Large Table 3. Study isolates, and sensitivity and specificity for each RCA and LDR probe. Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 Method Probe Total Reference isolates (n = 57) Nonreference isolates (n = 198) Total T NT TP FP FN TN Sensitivity Specificity Sensitivity Specificity Sensitivity Specificity (n) (n) (n) (n) (n) (n) (%) (%) (%) (%) (%) (%) RCA EdRCA 34 23 34 21 0 2 100 8.7 - - 100 8.7 EpRCA 13 44 13 38 0 6 100 13.6 - - 100 13.6 EhRCA 4 53 4 51 0 2 100 3.7 - - 100 3.7 ExRCA 2 55 2 8 0 47 100 85.7 - - 100 85.7 EcRCA 4 53 4 6 0 47 100 88.6 - - 100 88.6 LDR EdLDR 107 148 95 9 12 139 88.6 95.4 86.6 93.5 88.7 93.9 EpLDR 109 198 97 0 12 198 100 100 87.5 100 88.9 100 EhLDR 20 234 20 0 0 234 100 100 100 100 100 100 ExLDR 5 249 5 0 0 249 100 100 100 100 100 100 EcLDR 14 234 13 0 1 234 100 100 90.9 100 92.8 100 FN, False-negative; FP, False-positive; NT, Nontargeted species; T, Targeted species; TN, True-negative; TP, True-positive. View Large LDR ligation and amplification reactions Ten probes that targeted the five Exophiala species were used in LDR ligase reactions. The LDR probes comprised two 40–45-base oligonucleotides that incorporated universal regions, and the ligase and amplification reactions yielded 80–95-bp products depending on the target species. Because the generated LDR bands were close to those of any of the possible oligonucleotide dimer products, the bands considered indicative of the LDR reaction were confirmed by DNA sequencing. The general amplicon concentration range for LDR probes targeting different species was between ∼70 ng/μl and ∼6 pg/μl: the probe concentration was 0.2–1 pmol/μl, and the primer binding time was 2 min, with the reaction proceeding over 10 cycles. The total number of strains used for evaluating the LDR probes, and the sensitivities and specificities of all reactions are summarized in Table 3. No false-positive or false-negative results were detected for any LDR probe except EdLDR among the reference isolates. Two false-negatives (CBS 139118 and CBS 139120) and one false-positive (CBS 139126) were detected among the reference isolates targeted with EdLDR probes. In addition, 10 false-negatives and eight false-positives (E. phaeomuriformis, n = 7 and E. xenobiotica, n = 1) were detected among the nonreference isolates (Figs 4 and S1a). No false-negatives or false-positives were detected among the reference isolates evaluated with the EpLDR probes; however, 12 false-negatives were detected among the non-reference isolates (Figs 4 and S1b). No false-negatives or false-positives were detected among the analyzed reference and nonreference isolates with the EhLDR probes (Figs 4 and S1c). Moreover, one false-negative was detected among the nonreference isolates with EcLDR probes, whereas no false-negatives or false-positives were detected among the reference isolates (Figs 4 and S1d). In ExLDR analyses, no false-negatives or false-positives were detected among the reference and nonreference isolates (Figs 4 and S1e). Figure 4. View largeDownload slide Agarose gel demonstrating the specificity of LDR probes: EdLDR (a), EpLDR (b), EhLDR (c), EcLDR (d), and ExLDR (e). Amplification of the ligated products was only detected for hybridized template-probe mixtures. Empty lanes denote no amplification, in non-hybridized template-probe mixtures. Lane M, 100-bp DNA molecular weight marker (Thermo Scientific, Vilnius, Lithuania). Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; and Ex, E. xenobiotica. Figure 4. View largeDownload slide Agarose gel demonstrating the specificity of LDR probes: EdLDR (a), EpLDR (b), EhLDR (c), EcLDR (d), and ExLDR (e). Amplification of the ligated products was only detected for hybridized template-probe mixtures. Empty lanes denote no amplification, in non-hybridized template-probe mixtures. Lane M, 100-bp DNA molecular weight marker (Thermo Scientific, Vilnius, Lithuania). Ed, E. dermatitidis; Ep, E. phaeomuriformis; Eh, E. heteromorpha; Ec, E. crusticola; and Ex, E. xenobiotica. Evaluation of the performance of LDR oligonucleotides Performance evaluations were based on 30 qPCR cycles, using the selected reference strains (see Methods; Figs S2–S4). No LDR oligonucleotides met the acceptance criterion for slope; however all oligonucleotides met the linearity, repeatability, reproducibility, and LOD/LOQ criteria. The results are summarized in Table 4. Table 4. Comparison of the performance parameters of LDR oligonucleotides. EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% View Large Table 4. Comparison of the performance parameters of LDR oligonucleotides. EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% EdLDR EpLDR EhLDR EcLDR ExLDR Acceptance criteria Slope –4.407 –4.237 –3.647 –3.968 –5.898 –3.6 and –3.1 Linearity (R2) 0.99 0.995 0.99 0.998 0.99 >0.99 Efficiency (%) 68.6 72.2 88,0 78.6 47.7 80% to 120% Repeatability (RSDr%) 4.2 8.6 8.8 5.2 5.3 <25% Reproducibility (RSDr%) 3.7 4.8 4.8 1.8 1.9 <30% Limit of detection (RSDr%) 6.8 5.1 1.4 2.6 1.9 <25% View Large Discussion In this study, we aimed to develop a method for the rapid and inexpensive identification of Exophiala species using ligase-dependent probe amplification assays, RCA and LDR. We observed high probe sensitivity (100%) when targeting reference Exophiala strains using the designed RCA probes; however, the probes were not sufficiently specific (3.7–88.6%), which was associated with pronounced cross-reactivity among the tested species. The likely reason contributing to the wide disparity in specificity values is the uneven number of reference strains tested for each species. When the number of strains of each species was normalized by assuming equality, the specificity range was 25–50%. Although RCA performed very poorly in the present study, previous studies successfully identified black yeast-like fungi using RCA but did not report the sensitivity and specificity of the assays.13,22,23 Interestingly, we used the same protocols and same probe designs as these previous studies, with the only differences being the study strains and targeting sequences adopted. These discrepant results therefore highlight certain limitations of the RCA method. Although PCR/qPCR methods were used in conjunction with the barcode primers designed for the identification of Exophiala species,4 a satisfactory specific barcoding approach has not yet been developed because the nucleotide differences among chaetothyrialean fungi are quite low, especially in the ITS region.41 The performance of the LDR method, which is similar to RCA in terms of the reaction conditions and probe design, was also examined in this study with respect to its accuracy and possible limitations for identification and discrimination of Exophiala species. Our data show that the targeted species could be identified in LDR reactions with high sensitivity (88.7–100%) and high specificity (93.9–100%). E. phaeomuriformis was consistently identified using the LDR/PCR method and could be precisely distinguished from the two taxonomically closely related species, E. dermatitidis and E. heteromorpha, when the amplicon concentration was sufficiently high. Thermophilic E. dermatitidis and E. phaeomuriformis species are most frequently isolated in extreme habitats associated with human activity (e.g., dishwashers), and they often share the same habitat;26,27,29–33 therefore, it is highly relevant that these species can be identified using LDR/PCR probes. Reactions containing the EdRCA/EdLDR and ExRCA/ExLDR probes targeting the same sequences were evaluated with the two methods, demonstrating that the LDR probe reactions were much more specific than the RCA probe reactions conducted under the same reaction conditions. To our knowledge, this is the first study to directly compare the effectiveness of the RCA and LDR methods. We also found that the LDR method was more affordable than the RCA method (1–2$ vs. 4–5$/test, respectively) and was also more reliable in terms of practicality and sensitivity/specificity. In contrast to Najafzadeh et al.,13 we suggested that RCA is not a reliable and inexpensive method for the identification of Exophiala spp. and should not be recommended for clinical laboratory use. Although it has been reported that thermostable DNA ligases possess high discriminatory power with respect to mispairs in the ligation region, the accuracy of this discrimination has also been shown to be dependent on the targeted discriminative nucleotides.42,43 In general, ligases can more efficiently discriminate purine–purine mispairs than pyrimidine–pyrimidine and purine–pyrimidine mispairs.42 In this regard, it has been suggested that these enzymes can make errors in discriminating among purine–pyrimidine or pyrimidine–pyrimidine mispairs (G:T, G:G, C:C, A:G, C:T, and T:C), which results in high background signals.42 Lohman et al.43 reported that the background signals in a reaction catalyzed by Taq DNA ligase could be effectively reduced after optimization of certain reaction parameters such as temperature, pH, and monovalent cation concentrations (KCl) that prevent mispairing in the ligase reaction. Moreover, it was also reported that the presence of more than four identical nucleotides within the discriminative probe was important for improving the specificity of the ligase reaction.44,45 In the current study, SYBR Green-based qPCR was used for evaluation of the performance and validation of the LDR method. Considering the ENGL reference guidelines, the EhLDR probe performance was closest to the standard curve quality criteria (slope: 3.647, R2: 0.999, efficiency%: 88%), followed by EcLDR, EdLDR, EpLDR, and ExLDR. When the validation parameters of repeatability and reproducibility (RSDr range: 1.7–8%) were considered, the LDR for each probe was within the ENGL limit values.46,47 The products of the ligated ExLDR probe were detected at a higher Cq value (23–25) than those of the other LDR probes. Although the sensitivity and specificity of this probe were high, a smaller amount of ligated product of the ExLDR probes appeared to be generated compared to those of other LDR probes under the same ligase reaction conditions. Therefore, the standard curve with the ExLDR probe could only be generated based on three amplicon concentrations in 30 qPCR cycles because sufficiently accurate linearity could not be obtained when the amplicon concentration was below 6 ng/μl. When ligase-based probe amplification methods are compared with other nucleic acid-based methods, the basic knowledge of optimization parameters, from primer design to the reaction conditions and target sequence features, is not sufficient for designing a successful LDR assay. Although ligase-based probe amplification methods are routinely used, and a commercial kit (MRC-Holland, MLPA®)48 was developed for the detection of mutations in genetic diseases, no commercial product is currently available for the detection of pathogenic microorganisms or species discrimination in medical microbiology. Thermophilic E. dermatitidis and E. phaeomuriformis are often isolated together with Candida parapsilosis and Magnusiomyces/Saprochaete clade from household dishwashers.26,27,31,33 Although beyond the scope of this study, once the LDR/qPCR method is adequately optimized, it might be developed for the unequivocal targeting of E. dermatitidis and E. phaeomuriformis species directly from the genomic DNA pool extracted from samples. This would eliminate the need for conducting time-consuming and labor-intensive fungal culture, especially for samples collected from highly selective environments such as dishwashers. Conclusively, LDR performed much better than RCA as an alternative to DNA sequencing. The main advantage of the LDR method is that it may be applied to differentiate cryptic species without the need for sequence analysis by targeting “difficult” DNA regions that only differ with respect to a few bases. Although the optimization requirement would increase the reaction costs, once an optimized and highly specific LDR probe is developed, examination of numerous samples using the LDR method will become more affordable than sequencing-based identification. Its potential applications in routine screenings in both research and clinical laboratories make this method even more relevant. Supplementary material Supplementary data are available at MMYCOL online. Acknowledgements We express gratitude to the curators of the Centraalbureau voor Schimmelcultures (housed at Westerdijk Fungal Biodiversity Institute, Utrecht, Netherlands) for kindly providing the clinical Exophiala isolates. Funding This study was funded by the Research Fund of Çukurova University (project no: TF2014 D3). Author contributions Conceived and designed the experiments: EK, MI, GSH. Performed the experiments: EK. Analyzed the data: EK, MI. Contributed reagents/materials/analysis tools: EK, MI, GSH. Wrote the paper: EK, MI, GSH. Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper. References 1. de Hoog GS , Guarro J , Figueras MJ , Gene J . Atlas of Clinical Fungi: The ultimate benchtool for diagnostics . 4th CD-ROM ed . Utrecht, the Netherlands : CBS-KNAW Fungal Biodiversity Centre , Utrecht; Universitat Rovira i Virgili, Reus , 2014 . 2. Revankar SG , Sutton DA . Melanized fungi in human disease . Clin Microbiol Rev . 2010 ; 23 : 884 – 928 . Google Scholar CrossRef Search ADS PubMed 3. Zeng JS , Sutton DA , Fothergill AW , Rinaldi MG , Harrak MJ , de Hoog GS . Spectrum of clinically relevant Exophiala species in the United States . J Clin Microbiol . 2007 ; 45 : 3713 – 3720 . Google Scholar CrossRef Search ADS PubMed 4. Libert X , Chasseur C , Packeu A , Bureau F , Roosens NH , de Keersmaecker SJ . A molecular approach for the rapid, selective and sensitive detection of Exophiala jeanselmei in environmental samples: development and performance assessment of a real-time PCR assay . Appl Microbiol Biotechnol . 2016 ; 100 : 1377 – 1392 . Google Scholar CrossRef Search ADS PubMed 5. Sudhadham M , de Hoog GS , Menken SB , Gerrits van den Ende AH , Sihanonth P . Rapid screening for genotypes as possible markers of virulence in the neurotropic black yeast Exophiala dermatitidis using PCR-RFLP. J Microbiol Methods . 2010 ; 80 : 138 – 142 . Google Scholar CrossRef Search ADS PubMed 6. Sudhadham M , Gerrits van den Ende AH , Sihanonth P et al. Elucidation of distribution patterns and possible infection routes of the neurotropic black yeast Exophiala dermatitidis using AFLP. Fungal Biol . 2011 ; 115 : 1051 – 1065 . Google Scholar CrossRef Search ADS PubMed 7. Heinrichs G , Hübner I , Schmidt C , de Hoog GS , Haase G . Analysis of black fungal biofilms occurring at domestic water taps (I): compositional analysis using Tag-Encoded FLX Amplicon Pyrosequencing. Mycopathologia . 2013 ; 175 : 387 – 397 . Google Scholar CrossRef Search ADS PubMed 8. Ergin Ç , Gök Y , Bayğu Y et al. ATR-FTIR spectroscopy highlights the problem of distinguishing between Exophiala dermatitidis and E. phaeomuriformis using MALDI-TOF MS . Microb Ecol . 2016 ; 71 : 339 – 346 . Google Scholar CrossRef Search ADS PubMed 9. Kondori N , Erhard M , Welinder-Olsson C , Groenewald M , Verkley G , Moore ER . Analyses of black fungi by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS): species-level identification of clinical isolates of Exophiala dermatitidis . FEMS Microbiol Lett . 2015 ; 362 : 1 – 6 . Google Scholar CrossRef Search ADS PubMed 10. Özhak-Baysan B , Öğünç D , Döğen A , Ilkit M , de Hoog GS . MALDI-TOF MS-based identification of black yeasts of the genus Exophiala . Med Mycol . 2015 ; 53 : 347 – 352 . Google Scholar CrossRef Search ADS PubMed 11. Borman AM , Fraser M , Szekely A , Larcombe DE , Johnson EM . Rapid identification of clinically relevant members of the genus Exophiala by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry and description of two novel species, Exophiala campbellii and Exophiala lavatrina . J Clin Microbiol . 2017 ; 55 : 1162 – 1176 . Google Scholar CrossRef Search ADS PubMed 12. Nilsson M. Lock and roll: single-molecule genotyping in situ using padlock probes and rolling-circle amplification . Histochem Cell Biol . 2006 ; 126 : 159 – 164 . Google Scholar CrossRef Search ADS PubMed 13. Najafzadeh MJ , Dolatabadi S , Saradeghi Keisari M , Naseri A , Feng P , de Hoog GS . Detection and identification of opportunistic Exophiala species using the rolling circle amplification of ribosomal internal transcribed spacers . J Microbiol Methods . 2013 ; 94 : 338 – 342 . Google Scholar CrossRef Search ADS PubMed 14. Zhou X , Kong F , Sorrell TC , Wang H , Duan Y , Chen SCA . Practical method for detection and identification of Candida, Aspergillus, and Scedosporium spp. by use of rolling circle amplification . J Clin Microbiol . 2008 ; 46 : 2423 – 2427 . Google Scholar CrossRef Search ADS PubMed 15. Kong F , Tong Z , Chen X et al. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification . J Clin Microbiol . 2008 ; 46 : 1192 – 1199 . Google Scholar CrossRef Search ADS PubMed 16. Das S , Rundell MS , Mirza AH et al. A multiplex PCR/LDR assay for the simultaneous identification of category A infectious pathogens: agents of viral hemorrhagic fever and variola virus . PLOS One . 2015 ; 10 : e0138484 . Google Scholar CrossRef Search ADS PubMed 17. Rundell MS , Pingle M , Das S et al. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens . Diagn Microbiol Infect Dis . 2014 ; 79 : 135 – 140 . Google Scholar CrossRef Search ADS PubMed 18. Wolffs PF , Vink C , Keijdener J et al. Evaluation of MeningoFinder, a novel multiplex ligation-dependent probe amplification assay for simultaneous detection of six virus species causing central nervous system infections . J Clin Microbiol . 2009 ; 47 : 2620 – 2622 . Google Scholar CrossRef Search ADS PubMed 19. Severo LC , Oliveira FM , Vettorato G , Londero AT . Mycetoma caused by Exophiala jeanselmei . Report of a case successfully treated with itraconazole and review of the literature . Rev Iberoam Micol . 1999 ; 16 : 57 – 59 . Google Scholar PubMed 20. Barany F. Genetic disease detection and DNA amplification using cloned thermostable ligase . Proc Natl Acad Sci U S A . 1991 ; 88 : 189 – 193 . Google Scholar CrossRef Search ADS PubMed 21. Abravaya K CJ , Muldoon S , Lee HH . Detection of point mutations with a modified ligase chain reaction (Gap-LCR). Nucleic Acids Res . 1995 ; 23 : 675 – 682 . Google Scholar CrossRef Search ADS PubMed 22. Najafzadeh MJ , Sun J , Vicente VA , de Hoog GS . Rapid identification of fungal pathogens by rolling circle amplification using Fonsecaea as a model . Mycoses . 2011 ; 54 : e577 – 582 . Google Scholar CrossRef Search ADS PubMed 23. Ahmed SA , van den Ende BH , Fahal AH , van de Sande WW , de Hoog GS. Rapid identification of black grain eumycetoma causative agents using rolling circle amplification . PLOS Negl Trop Dis . 2014 ; 8 : e3368 . Google Scholar CrossRef Search ADS PubMed 24. Furuie JL , Sun J , do Nascimento MM et al. Molecular identification of Histoplasma capsulatum using rolling circle amplification . Mycoses . 2016 ; 59 : 12 – 19 . Google Scholar CrossRef Search ADS PubMed 25. Rodrigues AM , Najafzadeh MJ , de Hoog GS , de Camargo ZP . Rapid identification of emerging human-pathogenic Sporothrix species with rolling circle amplification . Front Microbiol . 2015 ; 6 : 1385 . Google Scholar PubMed 26. Zalar P , Novak M , de Hoog GS , Gunde-Cimerman N . Dishwashers—A man-made ecological niche accommodating human opportunistic fungal pathogens . Fungal Biol . 2011 ; 115 : 997 – 1007 . Google Scholar CrossRef Search ADS PubMed 27. Zupančič J , Novak Babič M , Zalar P , Gunde-Cimerman N . The black yeast Exophiala dermatitidis and other selected opportunistic human fungal pathogens spread from dishwashers to kitchens . PLOS One . 2016 ; 11 : e0148166 . Google Scholar CrossRef Search ADS PubMed 28. Zeng P , Feng P , Gerrits van den Ende AHG , Xi L , Harrak MJ , de Hoog GS . Multilocus analysis of the Exophiala jeanselmei clade containing black yeasts involved in opportunistic disease in humans . Fungal Diversity . 2014 ; 65 : 3 – 16 . Google Scholar CrossRef Search ADS 29. Döğen A , Ilkit M , de Hoog GS . Black yeast habitat choices and species spectrum on high altitude creosote-treated railway ties . Fungal Biol . 2013 ; 117 : 692 – 696 . Google Scholar CrossRef Search ADS PubMed 30. Döğen A , Kaplan E , Ilkit M , de Hoog GS . Massive contamination of Exophiala dermatitidis and E. phaeomuriformis in railway stations in subtropical Turkey . Mycopathologia . 2013 ; 175 : 381 – 386 . Google Scholar CrossRef Search ADS PubMed 31. Döğen A , Kaplan E , Öksüz Z , Serin MS , Ilkit M , de Hoog GS . Dishwashers are a major source of human opportunistic yeast-like fungi in indoor environments in Mersin, Turkey. Med Mycol . 2013 ; 51 : 493 – 498 . Google Scholar CrossRef Search ADS PubMed 32. Gümral R , Tümgör A , Saraçlı MA , Yıldıran ŞT , Ilkit M , de Hoog GS . Black yeast diversity on creosoted railway sleepers changes with ambient climatic conditions . Microb Ecol . 2014 ; 68 : 699 – 707 . Google Scholar CrossRef Search ADS PubMed 33. Gümral R , Özhak-Baysan B , Tümgör A et al. Dishwashers provide a selective extreme environment for human-opportunistic yeast-like fungi . Fungal Diversity . 2016 ; 76 : 1 – 9 . Google Scholar CrossRef Search ADS 34. Turin L , Riva F , Galbiati G , Cainelli T . Fast, simple and highly sensitive double-rounded polymerase chain reaction assay to detect medically relevant fungi in dermatological specimens . Eur J Clin Invest . 2000 ; 30 : 511 – 518 . Google Scholar CrossRef Search ADS PubMed 35. Owczarzy R , Tataurov AV , Wu Y et al. IDT SciTools: a suite for analysis and design of nucleic acid oligomers . Nucleic Acids Res . 2008 ; 36 : 163 – 169 . Google Scholar CrossRef Search ADS 36. Blakely T , Salmond C . Probabilistic record linkage and a method to calculate the positive predictive value . Int J Epidemiol . 2002 ; 31 : 1246 – 1252 . Google Scholar CrossRef Search ADS PubMed 37. Broeders S , Huber I , Grohmann L et al. Guidelines for validation of quantitative real-time PCR methods . Trends Food Sci Tech . 2014 ; 37 : 115 – 126 . Google Scholar CrossRef Search ADS 38. Libert X , Chasseur C , Bladt S et al. Development and performance assessment of a qualitative SYBR® green real-time PCR assay for the detection of Aspergillus versicolor in indoor air . Appl Microbiol Biotechnol . 2015 ; 99 : 7267 – 7282 . Google Scholar CrossRef Search ADS PubMed 39. European Network of GMO Laboratories . Verification of analytical methods for GMO testing when implementing interlaboratory validated methods . Joint Research Centre , Luxembourg, Luxembourg , 2011 . 40. Tamura K , Stecher G , Peterson D , Filipski A , Kumar S . MEGA6: Molecular Evolutionary Genetics Analysis version 6.0 . Mol Biol Evol . 2013 ; 30 : 2725 – 2729 . Google Scholar CrossRef Search ADS PubMed 41. Heinrichs G , de Hoog GS , Haase G . Barcode identifiers as a practical tool for reliable species assignment of medically important black yeast species . J Clin Microbiol . 2012 ; 50 : 3023 – 3030 . Google Scholar CrossRef Search ADS PubMed 42. Luo J , Bergstrom DE , Barany F . Improving the fidelity of Thermus thermophilus DNA ligase . Nucleic Acids Res . 2016 ; 24 : 3071 – 3078 . Google Scholar CrossRef Search ADS 43. Lohman GJ , Bauer RJ , Nichols NM et al. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity . Nucleic Acids Res . 2016 ; 44 : e14 . Google Scholar CrossRef Search ADS PubMed 44. Shuman S. Closing the gap on DNA ligase . Structure . 1996 ; 4 : 653 – 656 . Google Scholar CrossRef Search ADS PubMed 45. Stewart J , Kozlowski P , Sowden M , Messing E , Smith HC . A quantitative assay for assessing allelic proportions by iterative gap ligation . Nucleic Acids Res . 1998 ; 26 : 961 – 966 . Google Scholar CrossRef Search ADS PubMed 46. European Network of GMO Laboratories (ENGL) . Definition of minimum performance requirements for analytical methods of GMO testing . EUR-Scientific and Technical Research Reports . Luxembourg, Luxembourg , 2008 . 47. European Network of GMO Laboratories (ENGL) . Definition of minimum performance requirements for analytical methods of GMO testing . EUR-Scientific and Technical Research Reports . Luxembourg, Luxembourg , 2015 . 48. MLPA® - an introduction . Available from: http://www.mrc-holland.com/WebForms/WebFormMain.aspx?Tag=fNPBLedDVp38p-CxU2h0mQ . © The Author(s) 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Medical Mycology – Oxford University Press

Published: Aug 1, 2018

There are no references for this article.