Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Amplification of plant U3 and U6 snRNA gene sequences using primers specific for an upstream promoter element and conserved intragenic regions

Amplification of plant U3 and U6 snRNA gene sequences using primers specific for an upstream... Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3459 © 7990 Oxford University Press Amplification of plant U3 and U6 snRNA gene sequences using primers specific for an upstream promoter element and conserved intragenic regions Christopher Marshallsay, Tamas Kiss and Witold Filipowicz* Friedrich Miescher-lnstitut, PO Box 2543, 4002 Basel, Switzerland Received April 20, 1990; Revised and Accepted May 23, 1990 EMBL accession nos X52629, X52630 ABSTRACT U-snRNA genes in higher plants contain two essential the promoters of these genes, in both vertebrates and plants, are promoter elements, the USE with sequence strikingly similar (reviewed in refs 1—4). RTCCCACATCG and the TATA-like box, positioned in The promoters of all plant pol Il-specific U-snRNA genes the -7 0 and -30 regions, respectively. Using an characterized to date contain two upstream signals which are oligodeoxynucleotide containing the USE motif and essential for transcription in vivo: the —70 Upstream Sequence oligodeoxynucleotides specific for the intragenic Element (USE, consensus RTCCCACATCG) and the TATA- regions conserved in U-snRNAs, several sequences like box located in the -3 0 region (4, 11 -14) . The USE is an encoding U6 and U3 snRNAs were determined by snRNA gene-specific element; it is not found in mRNA-coding polymerase chain reaction (PCR) amplification of genes in plants (11). On the other hand, the TATA box is Arabidopsis thaliana and tobacco genomic DNAs. This structurally and functionally indistinguishable from the TATA method provides a simple and rapid procedure for elements of mRNA genes. As in mRNA genes, the TATA box characterisation of plant U-snRNA genes and their in plant U2 genes is responsible for selection of the transcription promoters. It could also be used for the start site (14). In pol Il-specific U-snRNA genes the USE and characterisation of other genes containing conserved TATA are centred approximately four helical DNA turns apart, upstream promoter elements. PCR-derived fragments a property required for optimal promoter function (14). were used as probes for the isolation of the U3 snRNA We have recently characterized three genes which encode U6 genes from a genomic library of Arabidopsis. Two RNA in the higher plant Arabidopsis thaliana (10). These genes, isolated U3 genes were shown to be active when despite being transcribed by pol HI, contain the same two transfected into protoplasts of Nicotiana upstream promoter elements, the USE and TATA, found in pol plumbaginifolia. Both U3 genes contain the USE and Il-specific U-snRNA genes of plants. As in the case of class II TATA-like upstream elements located in similar genes, these elements appear to be the only promoter elements positions to the U6 genes of Arabidopsis. The encoded essential for transcription (10). However, in the U6 genes the Arabidopsis U3 snRNAs can be folded into a secondary USE element is positioned one helical turn closer to the TATA structure which is more similar to that of U3 RNAs from box than in the pol Il-specific genes. We have found that this lower eukaryotes rather than from metazoa. single helical turn difference in the spacing of the USE and TATA is a major determinant of RNA polymerase specificity. It is possible to convert a pol HI U-snRNA gene promoter into a pol INTRODUCTION II promoter, and vice versa, by manipulating the distance between the USE and TATA elements (F. Waibel and W.F., manuscript The promoters of genes encoding small nuclear RNAs (snRNAs) submitted). in vertebrates and plants have several interesting features which distinguish them from the promoters of other gene classes We wish to examine to what extent the upstream elements and (reviewed in refs 1 —4). Perhaps the most interesting aspect of their spacing are conserved in plant U-snRNA genes, and to better transcription of these genes is the relationship between the understand the relationship between promoter structure and RNA promoter structure and the choice of transcribing RNA polymerase specificity in these genes. In this work we describe polymerase (1 -4) . Some of the snRNA genes [for example, U6 a procedure, which is suitable for the rapid characterisation of and 7SK in vertebrates (5-9) and U6 in plants (10)] are U-snRNA gene promoter organisation and also for the isolation transcribed by RNA polymerase HI (pol HI) while most of the of new U-snRNA genes in plants. This procedure, involving the other genes of the U-snRNA class (for example, Ul , U2, U4 use of the polymerase chain reaction (PCR), relies upon the and U5; refs 1 —4) are transcribed by RNA polymerase II (pol unique occurence of the USE element in U-snRNA genes. Using II). Despite being transcribed by different RNA polymerases, this method we have determined additional U6 RNA gene : To whom correspondence should be addressed Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3460 Nucleic Acids Research, Vol. 18, No. 12 sequences from Arabidopsis and have characterized the genes vector (Stratagene) precut with Smal. Recombinant clones with encoding U3 RNA, a component of the nucleolar U3 snRNP inserts of the expected size were sequenced in both directions (reviewed in ref. 15), in Arabidopsis and tobacco. by the dideoxynucleotide method using double-stranded DNA templates and universal M13 primers. MATERIALS AND METHODS Construction and screening of the genomic library Isolation of plant DNA and PCR amplification Unless otherwise stated all techniques for DNA manipulation Nuclear DNAs from 4 week-old Arabidopsis thaliana (strain were as described by Sambrook et al. (17). A genomic library Landsberg) plants and from leaves of Nicotiana tabacum (var. of nuclear DNA (digested to completion with EcoFI) from Xanthi) were prepared according to Kiss and Solymosy (16). The Arabidopsis thaliana was constructed in the X-ZAPII vector following oligodeoxynucleotides were used for amplification of (Stratagene) according to the manufacturer's protocol. For U3 and U6 gene-specific sequences: the USE-specific 14-mer isolation of the U3 genes, a total of 40,000 plaques were screened, Oligo 1, 5'-NNRTCCCACATCGN-3'; the U3 RNA box C- using a 32P-labelled EcoRl-HindUl fragment derived from the specific 16-mer Oligo 2, 5'-GAACGATCATCTACTG-3' and pAra-u3c clone as a probe. The fragment was labelled by the U6 RNA-specific 34-mer Oligo 3, 5'-ATTTCTCGATTTATG- random priming method (18). Hybridization was performed in CGTGTCATCCTTGCGCAGG-3' (Fig. 1). PCR amplification a solution containing 6xSSC, 0.2% SDS, 5xDenhardt, 0.2 was carried out in 100 /tl reactions containing 67 mM Tris-HCl, mg/ml tRNA for 36 h at 42 °C. Filters were washed twice in pH 8.8, 2.5 mM MgCl , 16.6 mM (NH ) SO , 10 mM IX SSC,0.2% SDSandtwiceinO.lxSSC,O.2%SDSat65°C 2 4 2 4 2-mercaptoethanol, 0.25 mM each of four dNTPs, 200 fiM for 15 min. oligonucleotide primers, 50 ng of nuclear DNA and 0.7 U of Ampli-Taq polymerase (Cetus). Samples, under mineral oil, were Characterisation of Arabidopsis U3 genes subjected to 30 cycles of denaturation at 93 °C for 1 min, primer In vitro excision, from the X-ZAPII phages, of the pBScribe annealing at 50°C for 1 min, and primer extension at 72°C for SK(—) plasmids carrying the inserts was carried out according 1 min. Extension was continued for 10 min at 72°C before to the manufacturer's protocol. Two clones obtained, pU3B and terminating the reaction with 20 /A of 500 mM EDTA pH 8.0. pU3C, contained 5.5 and 2.5 kb inserts, respectively. They were Samples were electrophoresed on 2% agarose gels and the subjected to restriction analysis and a 1 kb BamHl subfragment amplified DNA product of the expected length was recovered from pU3C, hybridizing to the probe, was subcloned into from the gel. Amplified fragments were cloned into pBScribe pBScribe to yield pU3C-lK. The entire 1 kb insert of pU3C-lK (A) U6snRNA GENES -6 5 -3 0 + 1 + 56 I I 5' RTCCCACATCG -TATA -YR - -CCTGCGCAAGGATG GAAAT- 3>-GGACGCGTTCCTAC CTTTA-51 5>-NNRTCCCACATCGN-3I "USE" OLIGO (OLIGO #1. 14mer) U6 3'-TERMINAL OLIGO (OLIGO §2, 34mer) (B) U3snRNA GENES 5 ' RTCCCACATCG TATA YR- •CAGTAGATGATCGTTC- 3' 5'-NNRTCCCACATCGN-3' 31-GTCATCTACTAGCAAG-51 "USE" OLIGO (OLIGO #1, 14mer) C-BOX OLIGO (OLIGO #3, 16mer) Fig. 1. Strategy of PCR amplification of the U6 (A) and U3 (B) gene sequences from Arabidopsis and tobacco. Hatched boxes represent coding regions of U6 and U3 genes. The USE-specific oligonucleotide and oligonucleotides complementary to conserved sequences in U6 (ref. 10) and U3 (box C-containing region of bean U3 RNA; ref. 21) RNAs are shown. Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3461 -5 0 -4 0 -3 0 -2 Q -1 0 - 1 u6-22 [GTCCCACATCG]CTTATACAGTAAAACGAAACAGAG rTTATATAlGAGTTAGAGTCGAAGTAGTGCTT u6-26 [GTCCCACATCG]CTTAGATAAGAAAACGAAGCTGAG UTTATATA CAGCTAGAGTCGAAGTAGTGATT u6-25 [GTCCCACATCG]GTTATACAGTAGAAAGAGGAAGAA1ATATATS TAGTTAGAGTTGCTAAGATGGTT 20 30 40 50 GTCCCTTCGGGCACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGGC[CCT GTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCC[CCT. . . GTCCCTTCGT_GGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGGC[CCT B -4 0 -3 0 -2 0 -1 0 - 1 -5 0 Tob-u3c [ATCCCACATCG]GCAATACGCCGCAAAGAAAAGGCA TTTATAAG CACTGACTTCAAAGACAAGTTTC Tob-u3a [GTCCCACATCG]ACGCATTAACTTGTCAGTCTGCTG CTTATAC.fi 3CCATTCACTACAACAGAAGGGC Ara-u3c [GTCCCACATCG]GTGAGCTAGTGAAGAAACGTTTTC CTTATATA TGCAT.AGAAAGCATCAAGGGTC Ara-u3a [GTCCCACATCG]CTATTTTGAAAAACAATGTTGCCG 5ATATATA RCATTGAGAGAGCAGCAATGGTC 1 10 20 30 40 50 60 70 80 • •••• • • • *** * *********************************** * * * ****** * *** * * ****** * 90 100 110 120 130 140 150 ********** * * *********** * TGGTTGATGAGCCGTGGCCATTAGACC&GAGCGTGArTAACAGGCTCCCACGGCCCTCGGGT ATGGTG[CAG. TGGTTGATGAGGTGTGGCTTTGTGAC1AGAGCGTGA rTAATTGCTGCCTTCCATGGTCACTCGTGGGCTTG[GAG. TGGTTGATGAACCATGACCGTGCGGdRGAGCGTGfl rTGACGGCTACGATCGTCCTTGGATGCATCCGGTG[CAG. TGGTTGATGAACCATGACCGTGCGGC1AGAGCGTGA rTGACGGCTACGATTGTCCTCGGACGCATCCGGTG[CAG. Fig. 2. The sequences of the amplified U6 (A) and U3 (B) gene fragments (A). (A) Sequences derived from oligonucleotide primers are shown in brackets. The —30 TATA-like sequences are boxed. Nucleoddes in u6-22 and u6-25 which differ from the U6-26 gene encoding functional U6 RNA in Arabidopsis (10) are underlined. (B) The upstream TATA-like sequences, and the box A and B sequences conserved in U3 RNAs are boxed. Nucleotides conserved in the coding regions of all four DNAs are marked with asterisks. and 0.7 kb of pU3B were sequenced in both orientations using Arabidopsis RNA was extracted as reported (20) and B. napus internal and universal M13 primers. Oligonucleotides nuclear RNA was prepared according to Method I described by corresponding to 5' - and 3'-flanking non-coding sequences of Kiss et al. (21) each genomic clone, which also introduce restriction sites for use in the subsequent subcloning, were used for PCR Transient expression and RNase A/T, mapping amplification of the shorter gene-containing fragments from pU3C-lK and pU3B. PCR amplification was carried out as Protoplasts (6xl05), prepared from leaves of Nicotiana described above except that the annealing temperature was 55°C. plumbaginifolia, were transfected by the polyethylene glycol The U3C gene 556 bp HindTR-Smal fragment and the U3B gene method as described (20), using 10 /tg of plasmid per transfection. 351 bp EcoRI-Hindlll fragments were subcloned into RNA was isolated after 24 h by the guanidinium-phenol- chloroform method and treated with DNAse I to eliminate any appropriately digested pBScribe and their sequences verified. traces of remaining plasmid (20). These PCR subclones, designated pU3B-PCR and pU3C-PCR, were used for synthesis of antisense RNA probes. Probes for RNAse protection analysis were made from the appropriately linearised plasmids pU3B-PCR and pU3C-PCR by Determination of the RNA 5'-terminus using primer extension in vitro transcription with T3 or T7 polymerase using Primer extension was carried out essentially as described by [a-32P]CTP (sp. act. 100 Ci/mmol) as a label. The U3B gene- specific 357 nt-long probe is complementary to the coding region, Montzka and Steitz (19). An 18-mer oligonucleotide and to 73 nt and 51 nt of upstream and downstream non-coding 5'-CAGAGGTACGAGCCTATA-3\ complementary to sequence, respectively. Complementarity of the U3C-specific 607 positions 27-4 5 in U3 RNA (see Fig. 3), was 5'-32P-labeled nt-long probe extends 73 nt upstream and 254 nt downstream using polynucleotide kinase and used as a primer for reverse of the coding region. Approximately 1X105 cpm of gel-purified transcription of 3 fig of total RNA from Arabidopsis plants or antisense probe was hybridized to 2.5 /tg of RNA from transfected 0.1 ng of RNA isolated from nuclei of Brassica napus. Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3462 Nucleic Acids Research, Vol. 18, No. 12 -110 -190 -170 -150 -130 03B 03C -10 -70 -50 ********** * * ** **** ** **** C-AGAAAGCATCAAGGGTC Ara-u3a [ ] CTATTTTGAAAAACAATGTTGCCGGATATATAACATTGAGAGAGCAGCAATGGTC Vts So S© 7® 90 T.A liM IM 150 KW 190 T...T G - T T G. . . 210 230 250 mm 290 * *** ******* **** ** ****** * ** TTTCTTT—TTTTTTCCTTTTCAC-CCTGAAACTTTTAArrTCTTTTATTTTTCACCCTCTAACTTTGTATTATTCCCATCTG Fig. 3 . Sequences of the two Arabidopsis U3 genes, U3B and U3C, isolated from the genomic library. The sequence of the Ara-u3a done, obtained by PCR amplification (see Fig. 2B), is also shown. Numbering corresponds to the gene U3B. Gaps in the U3C, indicated with dashes, are included to accentuate sequence similarity. Asterisks indicate identity in the upstream and downstream non-coding regions. Apart from the short inverted repeats (underlined), no significant similarity is found upstream of the USE. The USE of Ara-u3a is shown in brackets. Dots indicate identical positions in the coding region. protoplasts. Samples were subjected to RNAse A/T[ digestion and RNA analysed by polyacrylamide gel electrophoresis as described (20). 1 2 RESULTS Strategy for the amplification of U-snRNA gene promoter sequences The strategy for the amplification of sequences positioned between the USE and the downstream half of the coding region of U6 genes, and between the USE and the region containing the conserved C box of U3 genes is summarized in Fig. 1. The USE- specific primer (Oligo 1) is a mixture of 128 oligonucleotides with a sequence 5'-NNRTCCCACATCGN-3'. The RTCCCACATCG segment of Oligo 1 corresponds to the USE sequence conserved in eleven out of thirteen different isolated Fig. 4. Analysis of the 5' end of Arabidopsis and Brassica napus U3 RNAs. Arabidopsis genes encoding U2, U4, U5 and U6 RNAs (10-12, Lanes A, C, G and T show the sequence of the coding strand of the gene U3C and F. Waibel and W.F, unpublished results); the USE sequence (plasmid pU3C-lK). Lanes 1 and 2 represent products of reverse transcription is also highly conserved in U-snRNA genes from other plants reactions performed with B. napus nuclear RNA and total Arabidopsis RNA, (13,22—25). Additional nucleotides are included into Oligo 1 respectively. B. napus and Arabidopsis are both the members o f Cntdferae family. The same 18-mer oligonucleotide complementary to positions 28—45 of in order to increase the stability of the hybrid. Oligo 2 is Arabidopsis U3 RNA was used as a primer. complementary to the phylogenetically highly conserved region in Arabidopsis U6 RNA (10). The U3-specific Oligo 3 is derived from the partial RNA sequence obtained for broad bean U3 snRNA (21); it contains the sequence complementary to the box U6 and U3 reactions, respectively (data not shown). Amplified C (consensus GAUGANCNNYY) conserved in U3 snRNAs fragments were cloned into the pBScribe vector and the inserts from different organisms (26-31). of recombinant clones sequenced. Polymerase chain reactions carried out using Arabidopsis and Amplification of U6 gene sequences tobacco genomic DNAs as templates and the appropriate oligonucleotides as primers resulted in the amplification of DNA Three different U6 gene sequences obtained by this methodology fragments of expected lengths, about 150 bp and 230 bp for the are shown in Fig. 2A. Each sequence contains the TATA box- Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3463 like element positioned about three helical DNA turns U3Bprobe U3C probe downstream of die USE, a characteristic feature of the U6 genes of Arabidopsis (10). About 30 bp further downstream start < < sequences identical or similar to that of Arabidopsis U6 RNA z z V C O ? . £ (10). The upstream and coding sequences of the clone u6-26 are Qtf ) .CO Do identical to the sequence of Arabidopsis gene U6-26, expression c Q-< a. o. c a< of which was demonstrated previously (10). [Throughout the -39 6 paper the PCR-derived sequences are denoted with small u while -34 4 the genomic clones are marked with capital letters.] The gene -29 8 corresponding to the PCR clone u6-25 has also been isolated by an independent approach involving direct screening of the genomic library (our unpublished results). The gene corresponding to the third PCR-generated sequence, u6-22, has not been isolated. However, conservation of the upstream -221 promoter elements at the appropriate spacing and the sequence of the coding region strongly suggest that this clone also originates from an authentic U6 gene or pseudogene present in the Arabidopsis genome. These and previous (10) experiments establish the presence of at least five different U6 gene-related sequences in Arabidopsis. -154 Characterisation of the IB gene sequences Two tobacco and two Arabidopsis U3 gene sequences were characterized by PCR amplification (Fig. 2B). In ail of them the TATA-like sequence is positioned about 30 bp downstream of the USE. Regions begining about 30 nt further downstream are very similar to each other and contain sequences, like boxes A (pos. 18—32) and B (pos. 108-116) known to be conserved in U3 RNAs from other organisms (26-31; see also below). Using a PCR-derived gene fragment as a probe, two different genes encoding U3 RNA were isolated from the genomic library of Arabidopsis (Fig. 3). The transcription start site in the U3 123 4 M5678 genes was determined by reverse transcription of Arabidopsis U3 RNA (Fig. 4). The 3' end of Arabidopsis U3 RNA was Fig. S. Expression of Arabidopsis U3 genes in transfected protoplasts of N. inferred from comparison with the 3' end of broad bean (21) plumbaginifolia. Gene-specific complementary RNA probes, indicated at the top, and tomato (T.K. and F. Solymosy, manuscript submitted) U3 were used for RNase mapping. Lanes 1,2,6 and 7, mapping of RNA extracted RNAs. The upstream regions of both genes contain USE and from nontransfected protoplasts or protoplasts transfected with the pBS vector. Lanes 4 and 5, RNA from protoplasts transfected with pU3C-lK and pU3B, TATA elements in positions similar to the pol m-specific U6 respectively. Lanes 3 and 8, mapping of RNA (2.5 /tg) extracted from Arabidopsis genes of Arabidopsis (10). The coding regions of the two U3 plants. Lane M, size markers (A/infl-digested pBR322). genes differ by six single nucleotide substitutions and a single nucleotide deletion. Downstream regions of the genes contain long stretches of T residues, which are known to function as terminators for transcription by pol III (32). These regions do protoplasts of Nicotiana plumbaginifolia. RNA was isolated 24 not contain sequences resembling the sequence h after transfection and analysed by RNase A/T, mapping using CAN _9AGTNNAA which is found immediately downstream 4 32P-labelled antisense RNA probes specific for each gene. RNA of the coding region in pol H-specific U-snRNA genes of plants isolated from protoplasts transfected with the U3B and U3C genes (11-13) . (but not from control protoplasts) protected RNA fragments corresponding in length to mature U3 RNA. Mapping of RNA Comparison of the PCR-derived U3 clones with the genes isolated from Arabidopsis with each of the gene-specific probes isolated from the genomic library demonstrates that PCR clone also resulted in protection of RNA fragments of identical length Ara-u3c is derived from the gene U3C; their sequences are (Fig. 5). We have verified that gene-specific probes have to be identical (Figs 2A and 3). On the other hand, PCR clone Ara- used in order to protect the U3 RNA-length fragments (data not u3a and the gene U3B have distinct sequences. They differ by shown). Both isolated genes are, therefore, transcribed in sixteen single nucleotide substitutions in the upstream non-coding transfected protoplasts and corresponding transcripts are region and by two substitutions within the sequenced part of the expressed in Arabidopsis plants. coding region (Fig. 3). Our experiments establish therefore the presence of at least three different U3 RNA genes in Arabidopsis. Southern blot analysis has indicated that Arabidopsis genome Structure of U3 snRNAs contains a total of 5- 6 DNA fragments which hybridize with U3 gene-specie probes (data not shown). A proposed secondary structure of Arabidopsis U3 snRNA is shown in Fig. 6. The 5' one-third of the RNA cannot be folded Expression of the Arabidopsis U3 genes in transfected into a single stable stem-loop as proposed for vertebrate U3 protoplasts snRNAs (31,33). However, this region can be folded into a two hairpin structure similar to that proposed for U3 RNAs from The expression of both isolated U3 genes was tested in transfected Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3464 Nucleic Acids Research, Vol. 18, No. 12 U ->C C 40 XpppA A C C N.tabacum U3RNA boxD A C A C A.thaliana U3RNA Fig. 6. Secondary structure models of Arabidopsis and tobacco U3 snRNAs. The Arabidopsis sequence is derived from the gene U3C. Substitutions found in U3B and Ara-u3a sequences are indicated with open-headed arrows and the insertion of a U residue is marked with filled arrow. G| — A substitution found in U3B 4 8 sequence is boxed and C| — U change in the Ara-u3a-derived sequence is circled. Sequences corresponding to the conserved regions A, B, C and D are boxed. 3 1 5'-terminal sequence of tobacco U3 RNA is derived from clone Tob-u3a. Differences in Tob-u3c sequence are indicated. Our preliminary experiments indicate that plant U3 RNA contains a cap but its structure is unknown. lower eukaryotes (30). The 5'-terminal portions of tobacco U3 few short sequences, indicated as boxes A, B, C and D, which RNAs, deduced from the sequences of the two PCR clones are also conserved, in similar locations, in U3 RNAs from other described in this work, can also be folded into a similar two species (26-31) . Sequence identity with tomato U3 RNA is 69% hairpin structure (Fig. 6). Although the genes corresponding to (T. K. and F . Solymosy, manuscript submitted) and with the the tobacco PCR clones have not been characterized, the sequenced 3'-terminal 164 nucleotides of broad bean, 63% (21). conservation of their upstream promoter regions and of the coding Sequence identity of Arabidopsis U3 RNA with vertebrate and sequences make it likely that they are expressed. The proposed yeast counterparts (26,27,29-30) is less than 50%. secondary structure of the 3'-terminal two thirds of Arabidopsis U3 RNA is similar to the models established for human (33) and DISCUSSION Xenopus (31) U3 RNAs. Comparison of the primary sequence of Arabidopsis U3 RNA The promoters of the U-snRNA genes in higher plants contain with U3 RNAs from other organisms reveals the presence of a in the -70/-6 0 region an upstream sequence element (USE) Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3465 with the consensus RTCCCACATCG, which is essential for lower eukaryotes more than from vertebrates. The 5' one-third transcription of both pol H-specific and pol Hi-specific U-snRNA of Arabidopsis RNA can form a two hairpin structure similar genes (10,14). The USE shows exceptionally high sequence to that proposed for U3 RNAs from S. cerevisiae, S. ponibe and conservation. For example, of the sixteen different U-snRNA D. discoideum (30). The structure suggested for tomato U3 RNA genes of Arabidopsis isolated to date, in only three cases does (T. K. and F. Solymosy, manuscript submitted) also contains the sequence of the element deviate from the consensus and then two hairpins in the 5' portion and a long branched 3'-proximal only by a single nucleotide substitution (10-12 , and this work). stem-loop similar to the one we propose for Arabidopsis U3 The integrity of the element is important for its function since RNA. The secondary structure of the 3'-terminal two thirds of most single point mutations introduced at different positions of plant U3 RNAs is similar to the models derived for U3 RNAs the USE have a strong inhibitory effect on U2 RNA gene from other organisms and supported by chemical modification transcription in transfected plant protoplasts (14). studies and by phylogenetic comparisons (30,31,33). We have exploited the high sequence conservation of the USE At the primary structure level, Arabidopsis U3 RNA and U3 to develope a rapid PCR-based procedure for the characterisation RNAs from other organisms share short sequence stretches with of plant U-snRNA genes. Using an oligodeoxynucleotide conserved locations, identified as boxes A, B, C and D (26,31). containing the USE sequence and oligonucleotides specific for Boxes C and D are also found in human U8 and U13 RNAs, the intragenic regions conserved in different U-snRNAs, we have and some other snRNAs which, like U3 RNA, are localized in characterized several sequences originating from U6 and U3 RNA the nucleolus" (36 and refs therein). It is likely that one or both genes in Arabidopsis and tobacco. In addition to yielding of these boxes interact with proteins specific for nucleolar snRNPs information about plant U-snRNA gene promoter organisation, (33). It has recently been demonstrated that U3 snRNP the PCR amplification provided us with homologous probes participates in the earliest cleavage event of pre-rRNA processing suitable for isolation of the U3 snRNA genes of Arabidopsis. in mammalian cells (37). Conservation of the primary and Low sequence conservation between U3 RNAs from different secondary structure elements in plant U3 RNA suggests that this organisms would have made the design of probes for library RNA has similar function in plant cells. screening difficult. The methodology discussed above could be of more general use. Genes encoding other U-snRNAs in plants ACKNOWLEDGMENTS could be isolated by this approach. Different classes of U-snRNAs frequently contain highly conserved sequence motifs (refs 15,26; We thank Susannah Gal, Greg Goodall and Karin Wiebauer for see also below) suitable for derivation of appropriate primers to critical reading of the manuscript, Franz Waibel for helpful be used in conjuntion with the USE-specific oligonucleotide. discussions, J. Jiricny and W. Zuercher for supply of Promoters of U-snRNA genes in Drosophila contain a relatively oligodeoxynucleotides, and Jirina Petruska for preparation of highly conserved sequence having a consensus plant protoplasts. TATAATTCYCAACTRYYTYT(G/T)(G/T)CY (reviewed in ref. 1) which could serve as one of the amplification primers. REFERENCES We have characterized two active genes encoding U3 RNA in Arabidopsis. Three additional U3 gene sequences originating 1. Dahlberg, J.E. and Lund, E. (1988) In Bimstiel, M.L.(ed.) Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles. from Arabidopsis and tobacco were also identified as PCR Springer Verlag, Berlin, pp 38-70. products. All these genes contain USE and TATA-like promoter 2. Parry, H.W., Scherly, D. and Mattaj, I.W. (1989) Trends Biochem. Sci., elements in the same positions as in U6 RNA genes of 14, 15-19. Arabidopsis (ref. 10 and this work). The U3 RNA gene isolated 3. Murphy, S., Moorefield, B. and Pieler, T. (1989) Trends Biochem. Sci. from tomato (T.K. and F. Solymosy, manuscript submitted) has 5, 122-126. 4. Filipowicz, W., Kiss, T., Marshallsay, C. and Waibel, F. (1990) Mol. Biol. these elements similarly located. We have recently established Reports 14, 125-129. that the spacing between the USE and TATA elements is a major 5. Kunkel, G.R., Maser, R.L., Calvet, J.P. and Pederson, T. (1986) Proc. determinant of RNA polymerase specificity during transcription Natl. Acad. Sci. USA 83, 8575-8579. of plant U-snRNA genes (10; F. Waibel and W.F., manuscript 6. Reddy, R., Henning, D. Das, G. Harless, M. and Wright, D. (1987) J. submitted). In pol fi-specific U-snRNA genes, such U2 or U5 Biol. Chem. 262, 75-81. 7. Krol, A., Carbon, P., Ebel, J.P. and Appel, B. (1987) Nucleic Acids Res. (11,12,14), these elements are centred approximately four helical 15, 2463-2478. DNA turns apart, while in pol Ill-specific U6 genes the USE 8. Murphy, S., Di Liegro, C. and Melli, M. (1987) Cell, 51, 81-87 . element is positioned one helical turn closer to the TATA box 9. Kleinert, H. and Benecke, B.J. (1988) Nucleic Acids Res. 16, 1319-1331. (refs 10,25 and this work). The observation that the USE and 10. Waibel, F. and Filipowicz, W. (1990) Nucleic Acids Res. 18, 3451 - TATA-like elements in plant U3 RNA genes are centred about three helical turns apart is rather unexpected since it suggests 11. Vankan, P. and Filipowicz, W. (1988) EMBO J. 7, 791-799. 12. Vankan, P., Edoh, D. and Filipowicz, W. (1988) Nucleic Acids Res. 16, that these genes may be transcribed in plants by pol i n and not 10425-10440. by pol II as in vertebrates (1,15,34,35). We have tested the effect 13. Abel, S., Kiss, T. and Solymosy, F. (1989) Nucleic Acids Res. 17, of a-amanitin on transcription of U3 RNA genes in protoplasts 6319-6337. and results are consistent with this possibility (unpublished 14. Vankan, P. and Filipowicz, W. (1989) EMBO J. 8, 3875-3882. 15. Reddy, R and Busch, H. (1988) In Bimstiel, M.L.(ed.) Structure and Function observation). We are presently carrying out additional of Major and Minor Small Nuclear Ribonucleoprotein Particles. Springer experiments in order to learn more about the mechanism of U3 Verlag, Berlin, pp 1 —37. RNA synthesis in plants. 16. Kiss, T. and Solymosy, F. (1987) Acta Biochem. Biophys. Hung. 22, 1 -5 . 17. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: The characterization of two active U3 RNA genes of A Laboratory Manual (2nd ed.), Cold Spring Harbor Laboratory Press, Cold Arabidopsis enabled us to deduce the sequence and propose a Spring Harbor, NY. secondary structure for a higher plant U3 RNA. This secondary 18. Feinberg, A.P. and Vogelstein, B. (1984) Anal. Biochem. 137, 266-267 . structure resembles the structures proposed for U3 RNAs from 19. Montzka, K.A. and Steitz, J.A. (1988) Proc. Natl. Acad. Sci. USA 85, Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3466 Nucleic Acids Research, Vol. 18, No. 12 8885-8889. 20. Goodall, C , Wiebauer, K. and Filipowicz, W. (1990) Meth. Enzym. 181, ^ in the press. 21. Kiss, T., Toth, M. and Solymosy, F. (1985) Eur. J. Biochem. 152, 259-266. 22. Van Santen, V.L., Swain, W. and Spritz, R.A. (1988) Nucleic Acids Res. , 16, 4176. 1 23. Hanley, B.A. and Schuler, M.A. (1989) Nucleic Acids Res. 17, 10106. 24. Brown.J.W.S. and Waugh.R. (1989) Nucleic Acids Res. 17,8991-9001. 25. Szkukalek, A., Kiss, T. and Solymosy, F. (1990) Nucleic Acids Res. 18, 26. Reddy, R. (1988) Nucleic Acids Res. 16, r71-r85. 27. Reddy, R., Henning, D. and Busch, H. (1979) J. Biol. Chem. 254, '"' 11097-11105. 28. Wise, J.A. and Weiner, A.M. (1980) Cell 22, 109-118. * 29. Hughes, J.M.X., Konings, D.A.M. and Cesareni, G. (1987) EMBO J. 6, 2145-2155 . * 30. Porter, G.L., Brennwald, P.J., Holm, K.A. and Wise, J.A. (1988) Nucleic Acids Res. 16, 10131-10152. •" 31. Jeppesen, C , Stebbins-Boaz, B. and Gerbi, S.A. (1988) Nucleic Acids Res. 16, 2127-2148. "* 32. Bogenhagen, D.F. and Brown, D.D. (1981) Cell 24, 261-270. 33. Parker, K.A. and Steitz, J.A. (1987) Mol. Cell. Biol. 7, 2899-2913. * 34. Gram-Jensen, E., Hellung-Larsen, P. and Frederiksen, S. (1979) Nucleic Acids Res. 6, 321-330. * 35. Hellung-Larsen, P., Kulamowicz, I. and Frederiksen, S. (1980) Biochim. Biophys. Acta 609, 201-204. 1 36. Tyc, K. and Steitz, J.A. (1989) EMBO J. 10, 3113-3119. 37. Kass, S., Tyc, K., Steitz, J.A. and Sollner-Webb, B. (1990) Cell 60, "* 897-908 . •4 •4 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

Amplification of plant U3 and U6 snRNA gene sequences using primers specific for an upstream promoter element and conserved intragenic regions

Loading next page...
 
/lp/oxford-university-press/amplification-of-plant-u3-and-u6-snrna-gene-sequences-using-primers-bq0KNTFpKt

References (11)

Publisher
Oxford University Press
Copyright
© Oxford University Press
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/18.12.3459
Publisher site
See Article on Publisher Site

Abstract

Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3459 © 7990 Oxford University Press Amplification of plant U3 and U6 snRNA gene sequences using primers specific for an upstream promoter element and conserved intragenic regions Christopher Marshallsay, Tamas Kiss and Witold Filipowicz* Friedrich Miescher-lnstitut, PO Box 2543, 4002 Basel, Switzerland Received April 20, 1990; Revised and Accepted May 23, 1990 EMBL accession nos X52629, X52630 ABSTRACT U-snRNA genes in higher plants contain two essential the promoters of these genes, in both vertebrates and plants, are promoter elements, the USE with sequence strikingly similar (reviewed in refs 1—4). RTCCCACATCG and the TATA-like box, positioned in The promoters of all plant pol Il-specific U-snRNA genes the -7 0 and -30 regions, respectively. Using an characterized to date contain two upstream signals which are oligodeoxynucleotide containing the USE motif and essential for transcription in vivo: the —70 Upstream Sequence oligodeoxynucleotides specific for the intragenic Element (USE, consensus RTCCCACATCG) and the TATA- regions conserved in U-snRNAs, several sequences like box located in the -3 0 region (4, 11 -14) . The USE is an encoding U6 and U3 snRNAs were determined by snRNA gene-specific element; it is not found in mRNA-coding polymerase chain reaction (PCR) amplification of genes in plants (11). On the other hand, the TATA box is Arabidopsis thaliana and tobacco genomic DNAs. This structurally and functionally indistinguishable from the TATA method provides a simple and rapid procedure for elements of mRNA genes. As in mRNA genes, the TATA box characterisation of plant U-snRNA genes and their in plant U2 genes is responsible for selection of the transcription promoters. It could also be used for the start site (14). In pol Il-specific U-snRNA genes the USE and characterisation of other genes containing conserved TATA are centred approximately four helical DNA turns apart, upstream promoter elements. PCR-derived fragments a property required for optimal promoter function (14). were used as probes for the isolation of the U3 snRNA We have recently characterized three genes which encode U6 genes from a genomic library of Arabidopsis. Two RNA in the higher plant Arabidopsis thaliana (10). These genes, isolated U3 genes were shown to be active when despite being transcribed by pol HI, contain the same two transfected into protoplasts of Nicotiana upstream promoter elements, the USE and TATA, found in pol plumbaginifolia. Both U3 genes contain the USE and Il-specific U-snRNA genes of plants. As in the case of class II TATA-like upstream elements located in similar genes, these elements appear to be the only promoter elements positions to the U6 genes of Arabidopsis. The encoded essential for transcription (10). However, in the U6 genes the Arabidopsis U3 snRNAs can be folded into a secondary USE element is positioned one helical turn closer to the TATA structure which is more similar to that of U3 RNAs from box than in the pol Il-specific genes. We have found that this lower eukaryotes rather than from metazoa. single helical turn difference in the spacing of the USE and TATA is a major determinant of RNA polymerase specificity. It is possible to convert a pol HI U-snRNA gene promoter into a pol INTRODUCTION II promoter, and vice versa, by manipulating the distance between the USE and TATA elements (F. Waibel and W.F., manuscript The promoters of genes encoding small nuclear RNAs (snRNAs) submitted). in vertebrates and plants have several interesting features which distinguish them from the promoters of other gene classes We wish to examine to what extent the upstream elements and (reviewed in refs 1 —4). Perhaps the most interesting aspect of their spacing are conserved in plant U-snRNA genes, and to better transcription of these genes is the relationship between the understand the relationship between promoter structure and RNA promoter structure and the choice of transcribing RNA polymerase specificity in these genes. In this work we describe polymerase (1 -4) . Some of the snRNA genes [for example, U6 a procedure, which is suitable for the rapid characterisation of and 7SK in vertebrates (5-9) and U6 in plants (10)] are U-snRNA gene promoter organisation and also for the isolation transcribed by RNA polymerase HI (pol HI) while most of the of new U-snRNA genes in plants. This procedure, involving the other genes of the U-snRNA class (for example, Ul , U2, U4 use of the polymerase chain reaction (PCR), relies upon the and U5; refs 1 —4) are transcribed by RNA polymerase II (pol unique occurence of the USE element in U-snRNA genes. Using II). Despite being transcribed by different RNA polymerases, this method we have determined additional U6 RNA gene : To whom correspondence should be addressed Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3460 Nucleic Acids Research, Vol. 18, No. 12 sequences from Arabidopsis and have characterized the genes vector (Stratagene) precut with Smal. Recombinant clones with encoding U3 RNA, a component of the nucleolar U3 snRNP inserts of the expected size were sequenced in both directions (reviewed in ref. 15), in Arabidopsis and tobacco. by the dideoxynucleotide method using double-stranded DNA templates and universal M13 primers. MATERIALS AND METHODS Construction and screening of the genomic library Isolation of plant DNA and PCR amplification Unless otherwise stated all techniques for DNA manipulation Nuclear DNAs from 4 week-old Arabidopsis thaliana (strain were as described by Sambrook et al. (17). A genomic library Landsberg) plants and from leaves of Nicotiana tabacum (var. of nuclear DNA (digested to completion with EcoFI) from Xanthi) were prepared according to Kiss and Solymosy (16). The Arabidopsis thaliana was constructed in the X-ZAPII vector following oligodeoxynucleotides were used for amplification of (Stratagene) according to the manufacturer's protocol. For U3 and U6 gene-specific sequences: the USE-specific 14-mer isolation of the U3 genes, a total of 40,000 plaques were screened, Oligo 1, 5'-NNRTCCCACATCGN-3'; the U3 RNA box C- using a 32P-labelled EcoRl-HindUl fragment derived from the specific 16-mer Oligo 2, 5'-GAACGATCATCTACTG-3' and pAra-u3c clone as a probe. The fragment was labelled by the U6 RNA-specific 34-mer Oligo 3, 5'-ATTTCTCGATTTATG- random priming method (18). Hybridization was performed in CGTGTCATCCTTGCGCAGG-3' (Fig. 1). PCR amplification a solution containing 6xSSC, 0.2% SDS, 5xDenhardt, 0.2 was carried out in 100 /tl reactions containing 67 mM Tris-HCl, mg/ml tRNA for 36 h at 42 °C. Filters were washed twice in pH 8.8, 2.5 mM MgCl , 16.6 mM (NH ) SO , 10 mM IX SSC,0.2% SDSandtwiceinO.lxSSC,O.2%SDSat65°C 2 4 2 4 2-mercaptoethanol, 0.25 mM each of four dNTPs, 200 fiM for 15 min. oligonucleotide primers, 50 ng of nuclear DNA and 0.7 U of Ampli-Taq polymerase (Cetus). Samples, under mineral oil, were Characterisation of Arabidopsis U3 genes subjected to 30 cycles of denaturation at 93 °C for 1 min, primer In vitro excision, from the X-ZAPII phages, of the pBScribe annealing at 50°C for 1 min, and primer extension at 72°C for SK(—) plasmids carrying the inserts was carried out according 1 min. Extension was continued for 10 min at 72°C before to the manufacturer's protocol. Two clones obtained, pU3B and terminating the reaction with 20 /A of 500 mM EDTA pH 8.0. pU3C, contained 5.5 and 2.5 kb inserts, respectively. They were Samples were electrophoresed on 2% agarose gels and the subjected to restriction analysis and a 1 kb BamHl subfragment amplified DNA product of the expected length was recovered from pU3C, hybridizing to the probe, was subcloned into from the gel. Amplified fragments were cloned into pBScribe pBScribe to yield pU3C-lK. The entire 1 kb insert of pU3C-lK (A) U6snRNA GENES -6 5 -3 0 + 1 + 56 I I 5' RTCCCACATCG -TATA -YR - -CCTGCGCAAGGATG GAAAT- 3>-GGACGCGTTCCTAC CTTTA-51 5>-NNRTCCCACATCGN-3I "USE" OLIGO (OLIGO #1. 14mer) U6 3'-TERMINAL OLIGO (OLIGO §2, 34mer) (B) U3snRNA GENES 5 ' RTCCCACATCG TATA YR- •CAGTAGATGATCGTTC- 3' 5'-NNRTCCCACATCGN-3' 31-GTCATCTACTAGCAAG-51 "USE" OLIGO (OLIGO #1, 14mer) C-BOX OLIGO (OLIGO #3, 16mer) Fig. 1. Strategy of PCR amplification of the U6 (A) and U3 (B) gene sequences from Arabidopsis and tobacco. Hatched boxes represent coding regions of U6 and U3 genes. The USE-specific oligonucleotide and oligonucleotides complementary to conserved sequences in U6 (ref. 10) and U3 (box C-containing region of bean U3 RNA; ref. 21) RNAs are shown. Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3461 -5 0 -4 0 -3 0 -2 Q -1 0 - 1 u6-22 [GTCCCACATCG]CTTATACAGTAAAACGAAACAGAG rTTATATAlGAGTTAGAGTCGAAGTAGTGCTT u6-26 [GTCCCACATCG]CTTAGATAAGAAAACGAAGCTGAG UTTATATA CAGCTAGAGTCGAAGTAGTGATT u6-25 [GTCCCACATCG]GTTATACAGTAGAAAGAGGAAGAA1ATATATS TAGTTAGAGTTGCTAAGATGGTT 20 30 40 50 GTCCCTTCGGGCACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGGC[CCT GTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCC[CCT. . . GTCCCTTCGT_GGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGGC[CCT B -4 0 -3 0 -2 0 -1 0 - 1 -5 0 Tob-u3c [ATCCCACATCG]GCAATACGCCGCAAAGAAAAGGCA TTTATAAG CACTGACTTCAAAGACAAGTTTC Tob-u3a [GTCCCACATCG]ACGCATTAACTTGTCAGTCTGCTG CTTATAC.fi 3CCATTCACTACAACAGAAGGGC Ara-u3c [GTCCCACATCG]GTGAGCTAGTGAAGAAACGTTTTC CTTATATA TGCAT.AGAAAGCATCAAGGGTC Ara-u3a [GTCCCACATCG]CTATTTTGAAAAACAATGTTGCCG 5ATATATA RCATTGAGAGAGCAGCAATGGTC 1 10 20 30 40 50 60 70 80 • •••• • • • *** * *********************************** * * * ****** * *** * * ****** * 90 100 110 120 130 140 150 ********** * * *********** * TGGTTGATGAGCCGTGGCCATTAGACC&GAGCGTGArTAACAGGCTCCCACGGCCCTCGGGT ATGGTG[CAG. TGGTTGATGAGGTGTGGCTTTGTGAC1AGAGCGTGA rTAATTGCTGCCTTCCATGGTCACTCGTGGGCTTG[GAG. TGGTTGATGAACCATGACCGTGCGGdRGAGCGTGfl rTGACGGCTACGATCGTCCTTGGATGCATCCGGTG[CAG. TGGTTGATGAACCATGACCGTGCGGC1AGAGCGTGA rTGACGGCTACGATTGTCCTCGGACGCATCCGGTG[CAG. Fig. 2. The sequences of the amplified U6 (A) and U3 (B) gene fragments (A). (A) Sequences derived from oligonucleotide primers are shown in brackets. The —30 TATA-like sequences are boxed. Nucleoddes in u6-22 and u6-25 which differ from the U6-26 gene encoding functional U6 RNA in Arabidopsis (10) are underlined. (B) The upstream TATA-like sequences, and the box A and B sequences conserved in U3 RNAs are boxed. Nucleotides conserved in the coding regions of all four DNAs are marked with asterisks. and 0.7 kb of pU3B were sequenced in both orientations using Arabidopsis RNA was extracted as reported (20) and B. napus internal and universal M13 primers. Oligonucleotides nuclear RNA was prepared according to Method I described by corresponding to 5' - and 3'-flanking non-coding sequences of Kiss et al. (21) each genomic clone, which also introduce restriction sites for use in the subsequent subcloning, were used for PCR Transient expression and RNase A/T, mapping amplification of the shorter gene-containing fragments from pU3C-lK and pU3B. PCR amplification was carried out as Protoplasts (6xl05), prepared from leaves of Nicotiana described above except that the annealing temperature was 55°C. plumbaginifolia, were transfected by the polyethylene glycol The U3C gene 556 bp HindTR-Smal fragment and the U3B gene method as described (20), using 10 /tg of plasmid per transfection. 351 bp EcoRI-Hindlll fragments were subcloned into RNA was isolated after 24 h by the guanidinium-phenol- chloroform method and treated with DNAse I to eliminate any appropriately digested pBScribe and their sequences verified. traces of remaining plasmid (20). These PCR subclones, designated pU3B-PCR and pU3C-PCR, were used for synthesis of antisense RNA probes. Probes for RNAse protection analysis were made from the appropriately linearised plasmids pU3B-PCR and pU3C-PCR by Determination of the RNA 5'-terminus using primer extension in vitro transcription with T3 or T7 polymerase using Primer extension was carried out essentially as described by [a-32P]CTP (sp. act. 100 Ci/mmol) as a label. The U3B gene- specific 357 nt-long probe is complementary to the coding region, Montzka and Steitz (19). An 18-mer oligonucleotide and to 73 nt and 51 nt of upstream and downstream non-coding 5'-CAGAGGTACGAGCCTATA-3\ complementary to sequence, respectively. Complementarity of the U3C-specific 607 positions 27-4 5 in U3 RNA (see Fig. 3), was 5'-32P-labeled nt-long probe extends 73 nt upstream and 254 nt downstream using polynucleotide kinase and used as a primer for reverse of the coding region. Approximately 1X105 cpm of gel-purified transcription of 3 fig of total RNA from Arabidopsis plants or antisense probe was hybridized to 2.5 /tg of RNA from transfected 0.1 ng of RNA isolated from nuclei of Brassica napus. Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3462 Nucleic Acids Research, Vol. 18, No. 12 -110 -190 -170 -150 -130 03B 03C -10 -70 -50 ********** * * ** **** ** **** C-AGAAAGCATCAAGGGTC Ara-u3a [ ] CTATTTTGAAAAACAATGTTGCCGGATATATAACATTGAGAGAGCAGCAATGGTC Vts So S© 7® 90 T.A liM IM 150 KW 190 T...T G - T T G. . . 210 230 250 mm 290 * *** ******* **** ** ****** * ** TTTCTTT—TTTTTTCCTTTTCAC-CCTGAAACTTTTAArrTCTTTTATTTTTCACCCTCTAACTTTGTATTATTCCCATCTG Fig. 3 . Sequences of the two Arabidopsis U3 genes, U3B and U3C, isolated from the genomic library. The sequence of the Ara-u3a done, obtained by PCR amplification (see Fig. 2B), is also shown. Numbering corresponds to the gene U3B. Gaps in the U3C, indicated with dashes, are included to accentuate sequence similarity. Asterisks indicate identity in the upstream and downstream non-coding regions. Apart from the short inverted repeats (underlined), no significant similarity is found upstream of the USE. The USE of Ara-u3a is shown in brackets. Dots indicate identical positions in the coding region. protoplasts. Samples were subjected to RNAse A/T[ digestion and RNA analysed by polyacrylamide gel electrophoresis as described (20). 1 2 RESULTS Strategy for the amplification of U-snRNA gene promoter sequences The strategy for the amplification of sequences positioned between the USE and the downstream half of the coding region of U6 genes, and between the USE and the region containing the conserved C box of U3 genes is summarized in Fig. 1. The USE- specific primer (Oligo 1) is a mixture of 128 oligonucleotides with a sequence 5'-NNRTCCCACATCGN-3'. The RTCCCACATCG segment of Oligo 1 corresponds to the USE sequence conserved in eleven out of thirteen different isolated Fig. 4. Analysis of the 5' end of Arabidopsis and Brassica napus U3 RNAs. Arabidopsis genes encoding U2, U4, U5 and U6 RNAs (10-12, Lanes A, C, G and T show the sequence of the coding strand of the gene U3C and F. Waibel and W.F, unpublished results); the USE sequence (plasmid pU3C-lK). Lanes 1 and 2 represent products of reverse transcription is also highly conserved in U-snRNA genes from other plants reactions performed with B. napus nuclear RNA and total Arabidopsis RNA, (13,22—25). Additional nucleotides are included into Oligo 1 respectively. B. napus and Arabidopsis are both the members o f Cntdferae family. The same 18-mer oligonucleotide complementary to positions 28—45 of in order to increase the stability of the hybrid. Oligo 2 is Arabidopsis U3 RNA was used as a primer. complementary to the phylogenetically highly conserved region in Arabidopsis U6 RNA (10). The U3-specific Oligo 3 is derived from the partial RNA sequence obtained for broad bean U3 snRNA (21); it contains the sequence complementary to the box U6 and U3 reactions, respectively (data not shown). Amplified C (consensus GAUGANCNNYY) conserved in U3 snRNAs fragments were cloned into the pBScribe vector and the inserts from different organisms (26-31). of recombinant clones sequenced. Polymerase chain reactions carried out using Arabidopsis and Amplification of U6 gene sequences tobacco genomic DNAs as templates and the appropriate oligonucleotides as primers resulted in the amplification of DNA Three different U6 gene sequences obtained by this methodology fragments of expected lengths, about 150 bp and 230 bp for the are shown in Fig. 2A. Each sequence contains the TATA box- Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3463 like element positioned about three helical DNA turns U3Bprobe U3C probe downstream of die USE, a characteristic feature of the U6 genes of Arabidopsis (10). About 30 bp further downstream start < < sequences identical or similar to that of Arabidopsis U6 RNA z z V C O ? . £ (10). The upstream and coding sequences of the clone u6-26 are Qtf ) .CO Do identical to the sequence of Arabidopsis gene U6-26, expression c Q-< a. o. c a< of which was demonstrated previously (10). [Throughout the -39 6 paper the PCR-derived sequences are denoted with small u while -34 4 the genomic clones are marked with capital letters.] The gene -29 8 corresponding to the PCR clone u6-25 has also been isolated by an independent approach involving direct screening of the genomic library (our unpublished results). The gene corresponding to the third PCR-generated sequence, u6-22, has not been isolated. However, conservation of the upstream -221 promoter elements at the appropriate spacing and the sequence of the coding region strongly suggest that this clone also originates from an authentic U6 gene or pseudogene present in the Arabidopsis genome. These and previous (10) experiments establish the presence of at least five different U6 gene-related sequences in Arabidopsis. -154 Characterisation of the IB gene sequences Two tobacco and two Arabidopsis U3 gene sequences were characterized by PCR amplification (Fig. 2B). In ail of them the TATA-like sequence is positioned about 30 bp downstream of the USE. Regions begining about 30 nt further downstream are very similar to each other and contain sequences, like boxes A (pos. 18—32) and B (pos. 108-116) known to be conserved in U3 RNAs from other organisms (26-31; see also below). Using a PCR-derived gene fragment as a probe, two different genes encoding U3 RNA were isolated from the genomic library of Arabidopsis (Fig. 3). The transcription start site in the U3 123 4 M5678 genes was determined by reverse transcription of Arabidopsis U3 RNA (Fig. 4). The 3' end of Arabidopsis U3 RNA was Fig. S. Expression of Arabidopsis U3 genes in transfected protoplasts of N. inferred from comparison with the 3' end of broad bean (21) plumbaginifolia. Gene-specific complementary RNA probes, indicated at the top, and tomato (T.K. and F. Solymosy, manuscript submitted) U3 were used for RNase mapping. Lanes 1,2,6 and 7, mapping of RNA extracted RNAs. The upstream regions of both genes contain USE and from nontransfected protoplasts or protoplasts transfected with the pBS vector. Lanes 4 and 5, RNA from protoplasts transfected with pU3C-lK and pU3B, TATA elements in positions similar to the pol m-specific U6 respectively. Lanes 3 and 8, mapping of RNA (2.5 /tg) extracted from Arabidopsis genes of Arabidopsis (10). The coding regions of the two U3 plants. Lane M, size markers (A/infl-digested pBR322). genes differ by six single nucleotide substitutions and a single nucleotide deletion. Downstream regions of the genes contain long stretches of T residues, which are known to function as terminators for transcription by pol III (32). These regions do protoplasts of Nicotiana plumbaginifolia. RNA was isolated 24 not contain sequences resembling the sequence h after transfection and analysed by RNase A/T, mapping using CAN _9AGTNNAA which is found immediately downstream 4 32P-labelled antisense RNA probes specific for each gene. RNA of the coding region in pol H-specific U-snRNA genes of plants isolated from protoplasts transfected with the U3B and U3C genes (11-13) . (but not from control protoplasts) protected RNA fragments corresponding in length to mature U3 RNA. Mapping of RNA Comparison of the PCR-derived U3 clones with the genes isolated from Arabidopsis with each of the gene-specific probes isolated from the genomic library demonstrates that PCR clone also resulted in protection of RNA fragments of identical length Ara-u3c is derived from the gene U3C; their sequences are (Fig. 5). We have verified that gene-specific probes have to be identical (Figs 2A and 3). On the other hand, PCR clone Ara- used in order to protect the U3 RNA-length fragments (data not u3a and the gene U3B have distinct sequences. They differ by shown). Both isolated genes are, therefore, transcribed in sixteen single nucleotide substitutions in the upstream non-coding transfected protoplasts and corresponding transcripts are region and by two substitutions within the sequenced part of the expressed in Arabidopsis plants. coding region (Fig. 3). Our experiments establish therefore the presence of at least three different U3 RNA genes in Arabidopsis. Southern blot analysis has indicated that Arabidopsis genome Structure of U3 snRNAs contains a total of 5- 6 DNA fragments which hybridize with U3 gene-specie probes (data not shown). A proposed secondary structure of Arabidopsis U3 snRNA is shown in Fig. 6. The 5' one-third of the RNA cannot be folded Expression of the Arabidopsis U3 genes in transfected into a single stable stem-loop as proposed for vertebrate U3 protoplasts snRNAs (31,33). However, this region can be folded into a two hairpin structure similar to that proposed for U3 RNAs from The expression of both isolated U3 genes was tested in transfected Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3464 Nucleic Acids Research, Vol. 18, No. 12 U ->C C 40 XpppA A C C N.tabacum U3RNA boxD A C A C A.thaliana U3RNA Fig. 6. Secondary structure models of Arabidopsis and tobacco U3 snRNAs. The Arabidopsis sequence is derived from the gene U3C. Substitutions found in U3B and Ara-u3a sequences are indicated with open-headed arrows and the insertion of a U residue is marked with filled arrow. G| — A substitution found in U3B 4 8 sequence is boxed and C| — U change in the Ara-u3a-derived sequence is circled. Sequences corresponding to the conserved regions A, B, C and D are boxed. 3 1 5'-terminal sequence of tobacco U3 RNA is derived from clone Tob-u3a. Differences in Tob-u3c sequence are indicated. Our preliminary experiments indicate that plant U3 RNA contains a cap but its structure is unknown. lower eukaryotes (30). The 5'-terminal portions of tobacco U3 few short sequences, indicated as boxes A, B, C and D, which RNAs, deduced from the sequences of the two PCR clones are also conserved, in similar locations, in U3 RNAs from other described in this work, can also be folded into a similar two species (26-31) . Sequence identity with tomato U3 RNA is 69% hairpin structure (Fig. 6). Although the genes corresponding to (T. K. and F . Solymosy, manuscript submitted) and with the the tobacco PCR clones have not been characterized, the sequenced 3'-terminal 164 nucleotides of broad bean, 63% (21). conservation of their upstream promoter regions and of the coding Sequence identity of Arabidopsis U3 RNA with vertebrate and sequences make it likely that they are expressed. The proposed yeast counterparts (26,27,29-30) is less than 50%. secondary structure of the 3'-terminal two thirds of Arabidopsis U3 RNA is similar to the models established for human (33) and DISCUSSION Xenopus (31) U3 RNAs. Comparison of the primary sequence of Arabidopsis U3 RNA The promoters of the U-snRNA genes in higher plants contain with U3 RNAs from other organisms reveals the presence of a in the -70/-6 0 region an upstream sequence element (USE) Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 Nucleic Acids Research, Vol. 18, No. 12 3465 with the consensus RTCCCACATCG, which is essential for lower eukaryotes more than from vertebrates. The 5' one-third transcription of both pol H-specific and pol Hi-specific U-snRNA of Arabidopsis RNA can form a two hairpin structure similar genes (10,14). The USE shows exceptionally high sequence to that proposed for U3 RNAs from S. cerevisiae, S. ponibe and conservation. For example, of the sixteen different U-snRNA D. discoideum (30). The structure suggested for tomato U3 RNA genes of Arabidopsis isolated to date, in only three cases does (T. K. and F. Solymosy, manuscript submitted) also contains the sequence of the element deviate from the consensus and then two hairpins in the 5' portion and a long branched 3'-proximal only by a single nucleotide substitution (10-12 , and this work). stem-loop similar to the one we propose for Arabidopsis U3 The integrity of the element is important for its function since RNA. The secondary structure of the 3'-terminal two thirds of most single point mutations introduced at different positions of plant U3 RNAs is similar to the models derived for U3 RNAs the USE have a strong inhibitory effect on U2 RNA gene from other organisms and supported by chemical modification transcription in transfected plant protoplasts (14). studies and by phylogenetic comparisons (30,31,33). We have exploited the high sequence conservation of the USE At the primary structure level, Arabidopsis U3 RNA and U3 to develope a rapid PCR-based procedure for the characterisation RNAs from other organisms share short sequence stretches with of plant U-snRNA genes. Using an oligodeoxynucleotide conserved locations, identified as boxes A, B, C and D (26,31). containing the USE sequence and oligonucleotides specific for Boxes C and D are also found in human U8 and U13 RNAs, the intragenic regions conserved in different U-snRNAs, we have and some other snRNAs which, like U3 RNA, are localized in characterized several sequences originating from U6 and U3 RNA the nucleolus" (36 and refs therein). It is likely that one or both genes in Arabidopsis and tobacco. In addition to yielding of these boxes interact with proteins specific for nucleolar snRNPs information about plant U-snRNA gene promoter organisation, (33). It has recently been demonstrated that U3 snRNP the PCR amplification provided us with homologous probes participates in the earliest cleavage event of pre-rRNA processing suitable for isolation of the U3 snRNA genes of Arabidopsis. in mammalian cells (37). Conservation of the primary and Low sequence conservation between U3 RNAs from different secondary structure elements in plant U3 RNA suggests that this organisms would have made the design of probes for library RNA has similar function in plant cells. screening difficult. The methodology discussed above could be of more general use. Genes encoding other U-snRNAs in plants ACKNOWLEDGMENTS could be isolated by this approach. Different classes of U-snRNAs frequently contain highly conserved sequence motifs (refs 15,26; We thank Susannah Gal, Greg Goodall and Karin Wiebauer for see also below) suitable for derivation of appropriate primers to critical reading of the manuscript, Franz Waibel for helpful be used in conjuntion with the USE-specific oligonucleotide. discussions, J. Jiricny and W. Zuercher for supply of Promoters of U-snRNA genes in Drosophila contain a relatively oligodeoxynucleotides, and Jirina Petruska for preparation of highly conserved sequence having a consensus plant protoplasts. TATAATTCYCAACTRYYTYT(G/T)(G/T)CY (reviewed in ref. 1) which could serve as one of the amplification primers. REFERENCES We have characterized two active genes encoding U3 RNA in Arabidopsis. Three additional U3 gene sequences originating 1. Dahlberg, J.E. and Lund, E. (1988) In Bimstiel, M.L.(ed.) Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles. from Arabidopsis and tobacco were also identified as PCR Springer Verlag, Berlin, pp 38-70. products. All these genes contain USE and TATA-like promoter 2. Parry, H.W., Scherly, D. and Mattaj, I.W. (1989) Trends Biochem. Sci., elements in the same positions as in U6 RNA genes of 14, 15-19. Arabidopsis (ref. 10 and this work). The U3 RNA gene isolated 3. Murphy, S., Moorefield, B. and Pieler, T. (1989) Trends Biochem. Sci. from tomato (T.K. and F. Solymosy, manuscript submitted) has 5, 122-126. 4. Filipowicz, W., Kiss, T., Marshallsay, C. and Waibel, F. (1990) Mol. Biol. these elements similarly located. We have recently established Reports 14, 125-129. that the spacing between the USE and TATA elements is a major 5. Kunkel, G.R., Maser, R.L., Calvet, J.P. and Pederson, T. (1986) Proc. determinant of RNA polymerase specificity during transcription Natl. Acad. Sci. USA 83, 8575-8579. of plant U-snRNA genes (10; F. Waibel and W.F., manuscript 6. Reddy, R., Henning, D. Das, G. Harless, M. and Wright, D. (1987) J. submitted). In pol fi-specific U-snRNA genes, such U2 or U5 Biol. Chem. 262, 75-81. 7. Krol, A., Carbon, P., Ebel, J.P. and Appel, B. (1987) Nucleic Acids Res. (11,12,14), these elements are centred approximately four helical 15, 2463-2478. DNA turns apart, while in pol Ill-specific U6 genes the USE 8. Murphy, S., Di Liegro, C. and Melli, M. (1987) Cell, 51, 81-87 . element is positioned one helical turn closer to the TATA box 9. Kleinert, H. and Benecke, B.J. (1988) Nucleic Acids Res. 16, 1319-1331. (refs 10,25 and this work). The observation that the USE and 10. Waibel, F. and Filipowicz, W. (1990) Nucleic Acids Res. 18, 3451 - TATA-like elements in plant U3 RNA genes are centred about three helical turns apart is rather unexpected since it suggests 11. Vankan, P. and Filipowicz, W. (1988) EMBO J. 7, 791-799. 12. Vankan, P., Edoh, D. and Filipowicz, W. (1988) Nucleic Acids Res. 16, that these genes may be transcribed in plants by pol i n and not 10425-10440. by pol II as in vertebrates (1,15,34,35). We have tested the effect 13. Abel, S., Kiss, T. and Solymosy, F. (1989) Nucleic Acids Res. 17, of a-amanitin on transcription of U3 RNA genes in protoplasts 6319-6337. and results are consistent with this possibility (unpublished 14. Vankan, P. and Filipowicz, W. (1989) EMBO J. 8, 3875-3882. 15. Reddy, R and Busch, H. (1988) In Bimstiel, M.L.(ed.) Structure and Function observation). We are presently carrying out additional of Major and Minor Small Nuclear Ribonucleoprotein Particles. Springer experiments in order to learn more about the mechanism of U3 Verlag, Berlin, pp 1 —37. RNA synthesis in plants. 16. Kiss, T. and Solymosy, F. (1987) Acta Biochem. Biophys. Hung. 22, 1 -5 . 17. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: The characterization of two active U3 RNA genes of A Laboratory Manual (2nd ed.), Cold Spring Harbor Laboratory Press, Cold Arabidopsis enabled us to deduce the sequence and propose a Spring Harbor, NY. secondary structure for a higher plant U3 RNA. This secondary 18. Feinberg, A.P. and Vogelstein, B. (1984) Anal. Biochem. 137, 266-267 . structure resembles the structures proposed for U3 RNAs from 19. Montzka, K.A. and Steitz, J.A. (1988) Proc. Natl. Acad. Sci. USA 85, Downloaded from https://academic.oup.com/nar/article/18/12/3459/1081554 by DeepDyve user on 14 August 2020 3466 Nucleic Acids Research, Vol. 18, No. 12 8885-8889. 20. Goodall, C , Wiebauer, K. and Filipowicz, W. (1990) Meth. Enzym. 181, ^ in the press. 21. Kiss, T., Toth, M. and Solymosy, F. (1985) Eur. J. Biochem. 152, 259-266. 22. Van Santen, V.L., Swain, W. and Spritz, R.A. (1988) Nucleic Acids Res. , 16, 4176. 1 23. Hanley, B.A. and Schuler, M.A. (1989) Nucleic Acids Res. 17, 10106. 24. Brown.J.W.S. and Waugh.R. (1989) Nucleic Acids Res. 17,8991-9001. 25. Szkukalek, A., Kiss, T. and Solymosy, F. (1990) Nucleic Acids Res. 18, 26. Reddy, R. (1988) Nucleic Acids Res. 16, r71-r85. 27. Reddy, R., Henning, D. and Busch, H. (1979) J. Biol. Chem. 254, '"' 11097-11105. 28. Wise, J.A. and Weiner, A.M. (1980) Cell 22, 109-118. * 29. Hughes, J.M.X., Konings, D.A.M. and Cesareni, G. (1987) EMBO J. 6, 2145-2155 . * 30. Porter, G.L., Brennwald, P.J., Holm, K.A. and Wise, J.A. (1988) Nucleic Acids Res. 16, 10131-10152. •" 31. Jeppesen, C , Stebbins-Boaz, B. and Gerbi, S.A. (1988) Nucleic Acids Res. 16, 2127-2148. "* 32. Bogenhagen, D.F. and Brown, D.D. (1981) Cell 24, 261-270. 33. Parker, K.A. and Steitz, J.A. (1987) Mol. Cell. Biol. 7, 2899-2913. * 34. Gram-Jensen, E., Hellung-Larsen, P. and Frederiksen, S. (1979) Nucleic Acids Res. 6, 321-330. * 35. Hellung-Larsen, P., Kulamowicz, I. and Frederiksen, S. (1980) Biochim. Biophys. Acta 609, 201-204. 1 36. Tyc, K. and Steitz, J.A. (1989) EMBO J. 10, 3113-3119. 37. Kass, S., Tyc, K., Steitz, J.A. and Sollner-Webb, B. (1990) Cell 60, "* 897-908 . •4 •4

Journal

Nucleic Acids ResearchOxford University Press

Published: Jun 25, 1990

There are no references for this article.