Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Activity of U-snRNA genes with modified placement of promoter elements in transfected protoplasts and stably transformed tobacco

Activity of U-snRNA genes with modified placement of promoter elements in transfected protoplasts... Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1533-1540 Activity of U-snRNA genes with modified placement of promoter elements in transfected protoplasts and stably transformed tobacco Dominic Edoh, Tamas Kiss and Witold Filipowicz* Friedrich Miescher-lnstitut, PO Box 2543, 4002 Basel, Switzerland Received January 29, 1993; Revised and Accepted March 1, 1992 ABSTRACT In higher plants the promoter elements of pol II- and accumulation of these U-snRNAs and the genes encoding them pol Ill-transcribed U-snRNA genes are Identical, usually contain characteristic transcriptional signals which are comprising a -30 TATA box and an upstream not found in other gene classes. Synthesis of most of the U- sequence element, USE. The USE and TATA are snRNAs is catalysed by RNA polymerase II (pol II) and some, centred approximately four and three helical DNA turns such as U6 RNA (and U3 RNA in plants), by RNA polymerase apart In pol II and pol III genes, respectively, and It Is III (pol HI) but both classes of genes frequently share identical this difference in the element spacing that determines promoter elements (2,3). Maturation and intra-cellular transport the RNA polymerase specificity of the gene. In this of U-snRNAs and U-snRNPs are also quite unique. U-snRNAs study we have analyzed the effect of spacing mutations contain unusual 5'-terminal cap structures such as m GpppN on activity of Arabldopsls U2 and U6 genes in (pol II products) or Me-pppN (pol HI products) and assembly transfected protoplasts of Nicotlana plumbaglnlfolla of U-snRNPs may involve many complex steps taking place both and in stably transformed tobacco. In the pol Ill- in the nucleus and the cytoplasm (reviewed in refs 3-5) . transcribed U6 gene the insertions and deletions of Transcription of U-snRNA genes has been most extensively either odd or even numbers of half helical turns studied in vertebrates (2,6). All pol II- and pol Hi-specific completely inactivate transcription In transfected vertebrate U-snRNA genes share two promoter elements: the protoplasts, consistent with the high conservation of Proximal (PSE) and Distal (DSE) Sequence Elements, positioned the element spacing found in all plant U-snRNA genes. at approximately -6O/-5O and -250/-200 , respectively. The Surprisingly, while insertions of 50 base pairs (bp) or PSE is an U-snRNA gene-specific element which is required for more Into the spacer of the pol ll-speclfic U2 gene selection of the transcription start site while the DSE has some inactivate transcription, a deletion of 5 bp or Insertions properties of an enhancer and is usually composed of several of as much as 20 bp decrease transcription by only 40 sequence motifs, such as octamer- or SPl-binding sites, which to 70%. This relaxed requirement for the conserved are also found in mRNA gene promoters. Despite this similarity, element spacing Is only seen in transfected protoplasts U-snRNA and mRNA gene enhancers are usually not since the same mutant U2 genes are not transcribed interchangeable (7,8) and octamer motifs within them are in stably transformed tobacco when transcription takes recognized by two different transcription factors, Oct-1 and Oct-2 place from the chromosome. The results provide some respectively (9-11). Pol Hi-specific U-snRNA genes in clues about possible factor Interactions at the vertebrates, in addition to the DSE and PSE elements, contain promoters of plant U-snRNA genes and also offer an a TATA-like box in the -3 0 region. It is the presence of this example of major differences in transcription between motif, recognized by the TATA binding protein TBP (12-16), transiently and stably transformed cells. which establishes that the U-snRNA gene is transcribed by pol HI and not by pol H (17,18). Promoter elements and determinants of RNA polymerase INTRODUCTION specificity in plant U-snRNA genes differ from vertebrates The U small nuclear RNAs (U-snRNAs) are components of (reviewed in ref. 3). Promoters of both pol H- and pol Hi-specific ribonucleoprotein particles (U-snRNPs) participating in various genes contain identical essential elements: a —30 TATA-like box RNA processing events in the nucleus (1). One of the most and a highly conserved Upstream Sequence Element (USE, interesting aspects of the metabolism and function of the major consensus RTCCCACATCG) positioned upstream of the TATA. U-snRNAs, represented by RNAs U1-U6, is their synthesis The USE is an snRNA gene-specific element and is not found (reviewed in refs 1 - 3). In most of the eukaryotes studied to date in other plant genes. On the other hand, the TATA-like box is special mechanisms have evolved to maintain co-ordinate structurally and, as demonstrated for the U2 gene, also * To whom correspondence should be addressed Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1534 Nucleic Acids Research, 1993, Vol. 21, No. 7 functionally indistinguishable from the TATA element of mRNA- Plasmids for tobacco transformations. To generate different pG- coding genes (19,20). As established for the U2 and U6 genes AU2 constructs (see Fig. 5), the BglE-EcoRl fragment in the of Arabidopsis, the USE and TATA elements are interchangeable binary vector pGA492 (24) was first replaced with BamtU-EcoRl between the two classes of genes and appear to be, in addition fragments containing wild type or mutant U2 genes excised from to the Y/R dinucleotide at positions -1/+1 , the only promoter plasmids pU2.MSPace-l through +2 (described above) and sequences essential for transcription (3, 19, 20; S. Connelly, D. pU2.2(WT), pU2.SP and pU2.SPAUSE (20). A reference Heard and W.F. , manuscript in preparation). What distinguishes Arabidopsis U5 gene was then inserted into the resulting plasmids, the pol II and pol III gene promoters is the position of the USE either in the same or opposite orientation, to generate pGAU2 with respect to the TATA element. In all pol n specific genes, plasmids of the A and B series, respectively. The U5 gene was the USE and TATA are centred approximately four helical DNA excised as a Sacl-HiruSQ fragment from either pATU5.1k [a turns apart whereas in the pol HI specific genes the spacing is derivative of the vector pTZ18U (25); for the A series] or from about 10 bp shorter (ref. 3; Fig. 1). We have recently shown an analogous construct containing the U5 gene in the vector that it is this one helical turn difference in the element spacing pTZ19U (for the B series). Excised fragments were cloned which determines the RNA polymerase specificity of the gene between the Hindfll and Sacl sites of the pGA492 vector. Both (21, 22). orientation plasmids were constructed for all U2 gene variants with exception of the wild type gene U2.2 for which only the We are interested in understanding how differences in the B series construct was made. topology of the USE and TATA elements determine the choice of RNA polymerase and how different transcription factors Transient expression in transfected protoplast contribute to this process. We have previously investigated the effect of changes in the spacer length between the USE and TATA Protoplasts prepared from leaves of N. plumbaginofolia were on transcription of the pol H-specific Arabidopsis U2 gene in transfected with plasmid DNA by the polyethylene glycol method transfected plant protoplasts. It was found that deletion of 10 bp (26). Unless indicated otherwise, 5X106 protoplasts were of DNA from the USE-TATA spacer decreases transcription by transfected with 10-20 /tg of each plasmid. The pU2.MSPace pol II by 10-fold and makes the promoter competent to initiate constructs were co-transfected with either pATU5.1kb (25) or transcription by pol HI (19, 21), consistent with the structure of pToU3 (27) as reference genes; the pU6.SPace constructs were all plant pol HI U-snRNA gene promoters (3). Surprisingly, co-transfected with pU2.SP (20) as a reference. despite high evolutionary conservation of the USE-TATA Transformation of Nicotiana tabacum distance, U2 genes with the USE-TATA spacer shortened by 5 bp or lengthened by up to 20 bp retained 35 - 60 % of the activity The pGAU2 plasmids were transformed into E.coli strain DH1 of the control U2 gene (19). In this study we have extended this and introduced into Agrobacterium tumefaciens strain EHA101 work by testing activity of pol II- and pol El-specific U-snRNA (28) either directly using the freeze-thaw method (29) or by genes with modified placement of the USE element in transiently triparental mating (30) using the E.coli helper strain 2013. The transfected protoplasts of Nicotiana plumbaginifolia and in E.coli transformants and A. tumefaciens EHA101 transconjugants transgenic tobacco. The results are discussed in terms of possible were controlled for the presence of the pGAU2 plasmids by mechanisms operating during transcription initiation of plant U- restriction analysis and Southern blotting of plasmid DNA. snRNA genes. N. tabacum (SRI) leaf pieces were cocultivated for 2 days with Agrobacterium EHA101 containing appropriate plasmids as described (31). The leaf discs were subsequently incubated on RMPkm, i.e. RMP medium (32) supplemented with 100 mg/1 MATERIALS AND METHODS kanamycin sulphate and 500 mg/1 cefotaxim (Claforan; Hoechst, Construction of plasmids Frankfurt). Transgenic plants were regenerated by selecting on Unless indicated otherwise, all techniques used for manipulating callus, shooting and rooting media (31). The resulting plantlets were first propagated in vitro on RMPkm medium and later DNA were as described by Sambrook et al. (23). Identity of all transferred to soil in the greenhouse. Ten primary transformants constructs was verified by sequence analysis using the dideoxynucleotide method and double stranded DNA. were regenerated for each construct. Leaves were collected from Oligonucleotides were kindly provided by W. Zurcher and F. about 10 cm high plants, frozen in liquid nitrogen and stored Fisher of this Institute. at -70°C. RNA and DNA isolation U2.MSPace mutants. Constructs pU2.MSPace-l through +2 were generated by replacing the Xhol-Ncol region in pU2.SP (19; RNA was prepared from protoplasts 24 h after transfection (26). see also Fig. 2 Q with appropriate synthetic DNA fragments. Frozen leaves from the transgenic plants were crushed in a mortar containing liquid N and RNA was isolated as described (26). U6.SPace mutants. Constructs pU6.SPace+0.5 through +2 were DNA was prepared from tobacco leaves according to Draper et generated by inserting appropriate synthetic DNA fragments into al. (33). Xhol- and Wcol-restricted pU6syn (20; see Fig. 4b). The RNase A/T, mapping pU6.SPace-l was obtained by digestion of pU6syn with Xhol and Ncol followed by filling in and religation. To generate RNase A/T] mapping was performed as described by Goodall pU6.SPace-0.5, a synthetic DNA fragment containing the USE et al. (26). The gene specific RNA probes, complementary to box was inserted into pU6syn predigested with BamHl and Ncol. the coding and flanking regions of the transfected genes were To obtain pU6.SPace-2, a synthetic DNA fragment containing synthesized in vitro by SP6 polymerase using [a-^PJCTP (sp. the USE and the TATA boxes was inserted into pU6syn digested act. 80Ci/mmol), and one of the following plasmids: with BamHl and Sail. pGEM2.U2.2 linearized with Hindm (19), pU6-26 linearized Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1535 with BstXl (20), pGEMl.U5 linearized with BstNl (25), or Immunoprecipitation pToU3 (27) digested with PvuII. 5 /ig of total RNA from RNA prepared from transfected protoplasts was protoplasts or leaves and 6—12 fmol of each probe was usually immunoprecipitated with the anti-m G cap polyclonal antibody used per mapping reaction. Protected fragments specific for (kindly provided by Dr R. Luhrmann, University of Marburg, transfected genes were quantitated by scintillation counting. The Germany) and control serum as described (22). RNA recovered values for test genes were normalized by taking into account from precipitated pellets and supernatants was analysed by RNAse expression of the reference genes. mapping. PCR amplification of the U2 transgenes RESULTS Two oligonucleotide primers, a 27-mer 5'-AGCATTAGTTA- Expression of the U2 gene mutants in transfected protoplast GTTGAACTACTTTGGG-3' corresponding to positions -155 to -128 upstream of the U2 coding region, and a 16-mer Promoters of all pol H-transcribed U-snRNA genes in plants have 5'-TGGCGGGTTGAGCCAG-3', specific for the 3' end of the the USE and TATA elements centred approximately four helical U2 coding region of the plasmid pGAU2.SP/B, were used to turns apart (3; see Fig. 1). Previous work has shown, however, PCR amplify U2 gene sequences from DNA isolated from that deletion of a half helical turn (5 bp) or insertion of as much as two helical turns of DNA (20 bp) in the USE-TATA spacer selected transgenic plants. The following conditions were used: decreased activity of the gene in tranfected protoplasts by only denaturan'on 94°C, 1'; annealing 65°C, 1'; polymerization 72°C, 40-65 % (19; see also Introduction). To eliminate the possibility 1'; 30 cycles. PCR products were analysed on a 1.5% agarose that the observed flexibility in the promoter element spacing is gel. due to the nature of the DNA sequences used for modification of the spacer length, we have constructed a set of mutant U2 genes having spacer sequences different from those used previously. All the mutants, called U2.MSPace, are derivatives Pol III of the gene U2.SP which contains a synthetic pol II promoter with the USE and TATA boxes centred approximately four helical DNA turns apart (19; see Fig. 2Q . Plasmids containing control or mutant U2 genes were transfected into protoplasts of N. Pol II- plumbaginifoUa, together with the reference wild-type U5 snRNA gene of Arabidopsis. Accumulation of U2 and U5 RNA Flgnre 1. Schematic structure of plant U-snRNA genes showing the length of the spacers separating the US E and TATA elements, and the TATA and the transcripts was measured by RNase A/Tl mapping using gene- transcription start site (Y/R) at positions -1/+1 . The S'-proximal sequences specific 32P-labeled antisense RNA probes. As shown in Figs. involved in 3 ' end formation (3, S. Connelly and W.F. , manuscript in preparation) 2A and B, the U2 genes having the spacer modified by a deletion are also indicated. The arrows represent coding regions of the pol m-specific of 5 bp (U2.MSPace-0.5) or insertion of up to 20 bp U6 , U3 and 7-2/MRP genes, and the pol II-specific U1 , U2, U 4 and U5 genes (3). l]2.MSPac e genes 201 • 190 • ^ • m 160 • 147 . Ned -33 -M n» U5 pUUCP«t+ l M l 2 ." 4 5 h 7 K V M pUIJCP«ai t UTGCAUCiCUACUTTUCUUTTCJUCTTCOUC~ Figure 2 . Activity of the U2.MSPace genes. (A) Autoradiogram of a gel from a representative experiment showing RNase mapping with U2 (upper panel) and U5 flower panel) gene probes. U2.MSPace mutants used for protoplast transfectkra are indicated at the top (lanes 3 -6 , 8 and 9). Lanes 2 and 7, transfectkms with control U2.2 (WT) and U2.SP genes. Lane 1, non-transfected protoplasts. Lane M, size markers (A/poII-digested pBR322). The positions of U2- and U5-specifk protected fragments are indicated by arrows. U2 endo, fragments protected by endogenous N. plumbaginifoUa U2 RNA. (B) Quantitation of the activity of the mutants. Activity is expressed relative to the activity of the gene U2.SP. Values represent means +/ - SEM from 5 independent experiments. ( Q Structure of different U2.MSPace mutants. Sequences inserted between the Xhol and Ncol sites of the synthetic promoter are shown. Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1536 Nucleic Acids Research, 1993, Vol. 21, No. 7 NONIM a. z a. tw c^ co cr r4 3 _ - d <o o *- c\i O + + _) S P P S P P s 1» P s s S 24 2 • U3 157' 21 7 • U3 1 1 < 201 > •mk to 19 0 •U 6 I2endo 7 8 M 1 2 3 4 10 11 12 M Figure 3. Immunoprecipitation of RNA transcripts with anu-n^G cap antibodies. •U2 Protoplasts were tiansfected with 10/ig of the U3 gene-containing plasmid pToU3 (27)andlOjigofeitherpU2.SP(lanes3,4, Hand 12), pU2.MSPace+2 (lanes 5 and 6), pU2.MSPace+0.5 (lanes 7 and 8), or pU2.MSPace-0.5 (lanes 9 and 10). Lanes 1 and 2, non-transfected protoplasts. RNA isolated from protoplasts M l 2345678 9 10 M was innnunoprecipitated with either anti-n^G polyclonal (a-m G) antibodies (lanes 1 — 10) or non-immune (NONIM) control serum (lanes 11 — 12). The precipitates (P) and supernatants (S) were analysed by RNase mapping using a mixture of U2 and U3 probes. Positions of U2 and U3 RNA-specific bands and B of U3 RNA precursor (U3*) are indicated. Ncol -31 -24 AACTCCACTTATCTACCATCCT*ClTATAMTAlATC*TaTCTCCtC*TATC(Un| AAAG (U2.MSPace+0.5 through U2.MSPace+2) retained 35-70% AACTCCACATCCTAC AACTCGACTTCCATCOTAC of the activity of the control gene U2.SP. Only when the distance AACTCCACAAACAATTCACTCCATGGTAC AACTCEACAAACAATTCACAACATTCCATGCTAC between the elements was shortened by one helical turn to AACTCCAl^UACAATTGACAAUTTCAACTCCATCCTAC AACTCOACAAAGAATTCACAAaTTCAACTTGCAACCATGCTAC resemble the pol Hi-specific promoter (U2.MSPace-l), was transcription of the gene reduced by approximately 15-fold. Relative activities of individual U2.MSPace mutants were similar Figure 4. Activity of U6syn genes with modified spacer. A) RNase A/T, to those of the mutants of the U2.SPace series studied before (19). mapping with U6 (upper panel) and U2 (lower panel) RNA probes. U6.SPace mutants used for protoplast transfection are indicated at the top (lanes 3- 6 and We have verified that transcription of the mutants 8-10). Lanes 2 and 7, transfections with control U6.26 and U6synTATAl genes. U2.MSPace-0.5 through U2.MSPace+2 is carried out by pol Lane 1, non-transfected protoplast. (B) Structure of different U6.SPace mutants II and not by pol III by demonstrating that U2 RNA synthesized with sequences of the USE/TATA spacers indicated. from them is precipitable with anti-trimethylguanosine (n^G) cap antibodies; the Me-pppA cap-containing U3 RNA transcribed from a co-transfected control gene was not immunoprecipitated (Fig. 3). The m G cap is found only in pol H-specific U- Experiments carried out previously have shown that insertion snRNAs (1) and we have demonstrated previously that, in of approximately five additional helical turns of DNA into the transfected plant protoplasts, U3 snRNA acquires m G cap USE-TATA spacer of the U2 gene decreases its transcription when its synthesis is catalysed by pol II in contrast to the Me- 15-2 0 fold, close to the level of activity of the gene from which pppN cap present in U3 snRNA produced by pol III (22). Our the USE element had been deleted (19). We have now tested previous observation that transcription from the pol Hi-specific activity of the U2 genes in which the distance between the USE U6 gene promoter fused to the coding region of the U2 gene and TATA elements has been increased even further. The purpose does not result in accumulation of U2 RNA transcripts (21) also of this was to test whether USE element can activate transcription argues against the possibility that U2 RNAs synthesized from under conditions which potentially allow looping out of the the U2.MSPace genes are pol HI transcripts. Taken together, intervening spacer DNA. Of eight different mutant U2.SP genes these results indicate that despite the strong evolutionary tested, containing insertions varying in length (from 136 to 294 conservation of the spacing of the USE and TATA elements it bp) and base composition (from 38 to 60% AT), none showed can be changed considerably without strongly affecting activity exceeding that of the gene from which the USE had been transcription by pol H in transfected protoplasts. deleted (data not shown). |U2. P+2 P+0.5 U2. P-0.5 1 Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1537 no major effect on transcription in transfected protoplasts was rather unexpected since the distance between the USE and TATA elements in the pol H-transcribed U-snRNA genes of plants is also highly conserved (3; Fig. 1). Therefore, we decided to investigate the effect of mutations in the USE-TATA spacing on U2 gene activity in stably transformed plants, where transcription of the transgene takes place from chromatin rather than from plasmid DNA. Constructs containing different mutants of the Arabidopsis U2 gene were made in the T-DNA binary vector pGA492 and used for transformation of Nicotiana tabacum by the Agrobacterium (pOAU2/A Miles) tumejaciens system (24). The constructs also contain, as a __.— TATAI— reference, the Arabidopsis wild-type U5 RNA gene cloned in the same (series A) or opposite (series B) orientation as the test 1J U2 gene (Fig. 5). The reference gene was included to facilitate -OJ quantitation of activity of different U2 genes and to eliminate U LJ" AUSI UUMUSE copy number and position of integration effects. We have (pQAU2/B seriea) previously shown that the Arabidopsis U5 gene is actively transcribed in transgenic tobacco (25). Before being used for plant transformation, the pGAU2 Figure 5. Construction of the pGAU2 plasmids used for transformation of plants. The pGA492 vector is shown at the top with important restriction sites (H, HintHS; constructs bearing different U2 gene mutants were tested for S, Sacl; Hp, HpaO.; Bg, BglH; E, £coRI) and the T DNA borders (BL and BR) activity in transfected protoplasts of N. plumbaginifolia. The indicated. Positions and orientations of the inserted reference (U5) and test (U2) activity of individual U2 spacing mutants, as compared to the genes are indicated below. Lengths (in bp) of the regions upstream of the USE control gene U2.SP, was similar to that found with the constructs element and downstream of the coding region are shown. of the pU2.MSPace series (see Fig. 2). The genes U2.MSPace-0.5 through U2.MSPace+1.5 retained over 50% of activity and the gene U2.MSPace+2 retained 40% activity of the gene U2.SP, while transcription of the genes U2.MSPace-l Expression of the U6 gene mutants in transfected protoplasts and U2.SPU UUSE was decreased by more than 10-fold. The We have investigated the importance of the spacing of the USE genes present in the A and B series of plasmids had comparable and TATA elements for transcription of the pol IE-specific U6 activities (data not shown). gene in transfected protoplasts. Previously, we have shown that The T-DNA of the pGAU2 vectors was introduced into N. insertion of 10 bp to the spacer of the Arabidopsis U6 gene tabacum by leaf-disc transformation (31). Ten primary completely abolishes U6 RNA accumulation in transfected independent transformants were isolated for each construct of protoplasts. However, this mutated U6 gene promoter became the A and B series. All of them, with exception of two plants competent to direct efficient synthesis of U2 RNA from the hybrid of the B/U2.MSP+1.5 series were found to express the U5 gene containing the U2 gene coding and 3' non-coding regions reference gene as demonstrated by RNase AfT^ mapping (21). analysis. The level of U5 expression varied among different plants We have now constructed mutants of the Arabidopsis U6 gene by up to 10-fold (see Fig. 6D and data not shown). The presence in which the USE-TATA spacer length is either decreased by of the U2 transgene was demonstrated in selected transformants 0.5, 1 or 2 helical DNA turns or increased by 0.5, 1, 1.5 or by PCR analysis of plant DNA using appropriate oligonucleotide 2 helical turns. All these mutants, called U6.SPace (Fig. 4B), primers (see below). are derivatives of the gene U6synTATAl which contains a synthetic pol IH promoter, with the USE and the TATA boxes centred approximately three helical DNA turns apart, fused to Activity of the U2 gene mutants in transgenic tobacco the coding region of the Arabidopsis gene U6.26. The gene The Arabidopsis wild-type U2.2 gene and its derivative containing U6synTATAl is transcribed with about 40% efficiency of the a synthetic promoter, the gene U2.SP, are transcribed with similar wild-type gene U6.26 (20; Fig. 4A). Activity of mutants was efficiency in transfected protoplasts of N. plumbaginifolia (19). tested in transfected protoplasts using a co-transfected Arabidopsis The same was found to be true when the activity of the U2.2 U2 gene as a reference. As shown in Fig. 4A, none of the and U2.SP genes expressed in transgenic tobacco was compared U6.SPace mutants has detectable activity indicating that, in (Fig. 6A, lanes 3—5; and data not shown). [Activity of all U2 contrast to the case of pol H-specific genes, the requirement for transgenes determined in this and all subsequent experiments was a proper spacing between the USE and TATA is very rigid for normalized for the activity of the reference gene U5; we have the pol IH promoter. found that the ratio of U2 to U5 gene expression is nearly constant when independent plants expressing the same U2 gene mutant Generation of transgenic tobacco plants expressing are analysed (Fig. 6D and data not shown)]. The U2.SP gene Arabidopsis U2 and U5 snRNA genes present in the construct of the A series was expressed at approximately 2-fold higher level than the B series gene, The strict requirement for proper positioning of the USE element indicating that orientation of the reference U5 gene may have for transcription by pol HI is consistent with the high evolutionary small effect on transcription of the test gene (Fig. 6A, lanes 4 conservation of the USE-TATA spacing in all pol Hi-specific and 5; Figs 6B and C, lanes 2). The U2.SPAUSE did not show U-snRNA genes in plants. However, the finding that even quite measurable activity in either orientation, indicating that the substantial changes in the spacer of the pol H-specific gene have Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1538 Nucleic Acids Research, 1993, Vol. 21, No. 7 <r, C a; S; ^ ri O ~ »J "5 < 3 U r* is (S a. g L2.iV!SPace mutants 3 3 3 190 r^j ••*• U2 ^ ^ •"' *** i-*- »*- IXfl g ^ "^- "1 ^ **7 «^ ^ 201 - 190 — U2 160 — 147 ~ 12.1 — * - LJ5 US 1 2 endo M l 2 3 4567S M M 12 3 4 5 r-, r* - Q ^ ^UZ-MSPafPiniita ??«?+ ? 201 — 201 — U2 180 . 160 ^ . 160 _ 147 — 147 mm U5 U5 lll l V2 U2 endo endo M1234 5 6 7 8M M l 4S6789 M Figure 6. Activity of the U2 gene mutants in transformed N. tabacum. AD four panels show RNase mapping, performed with a mixture of U2 and U5 gene probes, using RNA isolated from transgenic plants. The pGAU2 plasmids used for transformation are indicated at the top of autoradiograms, together with the orientation series (A or B) and a plant number. (A) Lane 1, mapping of RNA isolated from protoplast cotransfected with pU2.SP and pAtU5. Ik. Lane 2, control non-transformed plant. Lanes 3-6 , plants transformed with plasmids containing the U2.2 (WT), U2.SP and U2.SPAUSE genes. (B) Analysis of plants transformed with the A series of plasmids (lanes 2-8) ; plants showing similar levels of expression of the reference U5 gene were selected for analysis. Lane 1, control non-transformed plant. ( Q Same as panel (B) except that transgenic plants transformed with the B series of plasmids were analysed. (D) Mapping of three independent plants transformed with pGAU2.SP/A (lanes 1 -3) , pGAU2.MSPace-0.5/A (lanes 4-6 ) and pGAU2.MSPace+0.5/A (lanes 7-9) , showing different expression levels of the reference U5gene . presence of the USE element is essential for transcription of the preparations isolated from selected transgenic plants expressing gene in transgenic tobacco (Fig. 6A and data not shown). either similar (Figs. 6B and C) or different (Fig. 6D) levels of Representative experiments in which activity of the different U5 RNA transcribed from the reference U5 gene of Arabidopsis. While the control gene U2.SP was expressed in plants U2 gene spacing mutants has been assayed are shown in Figs transformed with plasmids of both the A and B series, no 6B and 6D (constructs of the A series) and in Fig. 6C (constructs accumulation of U2 RNA transcripts was detected in plants of the B series). RNase mapping was performed using RNA Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1539 is consistent with the high evolutionary conservation of the element spacing; in all pol II-transcribed U-snRNA genes sequenced to date, originating from many different plant species, 396bp this spacing is 32 +/— 2 bp (3; Fig. 1). In contrast to transgenic 344bp plants, transcription in transfected protoplasts is not strongly 298bp affected by shortening of the USE/TATA spacer by 5 bp or lengthening it by up to 20 bp. In a transient system, the mutant U2 genes retain as much as 35 -70 % activity of the control gene M l 234567 8 9 1011 M and this effect is independent of sequences used for modification of the spacer. The extent of inhibition is also independent of the USE and TATA being positioned on the same or opposite side Figure 7. Identification of the mutant U2 transgenes in transformed tobacco by of the DNA helix since insertions of a half or one and a half PCR analysis. DNA used for amplification was isolated from plants transformed turns do not affect transcription significantly more strongly than with the B series plasmids: pGAU2.SP (lane 5), pGAU2.SPace-l (lane 6), pG- insertions of one or two helical turns (Fig. 2; and ref. 20). It AU2.SPace-0.5 (lane 7), pGAU2.SPace+0.5 (lane 8), pGAU2.SPace+l (lane 9), pGAU2.SPace+1.5 (lane 10) and pGAU2.SPace+2 (lane 11). Lanes 3 and is likely that differences in the structure and composition of 4, PCR amplifications performed with plasmids pGAU2.SPace-l/B and pG- templates being utilized in transiently as opposed to stably AU2.SPace+2/B as templates, respectively. Lane 1, no DNA template, lane 2, transformed cells are responsible for observed diverse effects of DNA from non-transformed plant. Lane M, size marker (1 kb DNA ladder; spacing mutations on activity of the gene. In stably transformed GIBCO-BRL). plants, the transgene is integrated into the genome and is consequently packaged into nucleosomes and higher order chromatin structures. A need for appropriate configuration of promoter elements during gene transcription from such a template harbouring mutant genes with any changes in the length of the is not surprising; it probably reflects transcriptional requirements USE/TATA spacer. Similar results were observed with all of endogenous pol II U-snRNA genes. For example, in a DNA tobacco plants transformed with the mutant genes. wrapped around the histone octamer, proper spacing of the In order to verify that transformed plants which do not elements could be essential for availability of the USE and TATA accumulate Arabidopsis U2 RNA indeed contain the U2 for interaction with transcription factors; alternatively, the USE- transgenes, DNA isolated from transgenic plants of both the A TATA spacing could have an effect on nucleosome positioning and B series was analyzed by PCR using oligonucleotide primers at the gene (reviewed in refs 36—38). In contrast to stably specific for the sequences positioned upstream and downstream transformed plants, transcription in transiently transfected of the U2 transgene. Analysis of PCR products has revealed the protoplasts probably takes place from naked plasmid DNA as presence of amplified bands of the expected size (Fig. 7 and data there may be no excess of free histones to package DNA into not shown), indicating that mutant U2 genes were present in the nucleosomes in protoplasts. In mammalian cells, because of a tobacco genome but were not expressed. We conclude that the low free histone pool during interphase, efficient chromatin USE/TATA spacer requirement for the pol It-specific U2 gene formation with plasmid DNA is only possible after the recipient in stably transformed plants is much more stringent compared cells have entered the S phase (39 and refs therein). In this to that observed in transiently transfected protoplasts. context, it should be noted that very little DNA synthesis is observed in mesophyll plant protoplasts of tobacco (40) or N. DISCUSSION plumbaginifolia (P. King, personal communication) during the first 24 h of incubation, while most of the U-snRNA gene The characteristic spacing between the USE and TATA promoter transcription occurs between 10 and 24 h after transfection (D. elements, distinguishing pol II- and pol IE-specific U-snRNA Heard and W.F., unpublished results). genes and acting as a determinant of RNA polymerase specificity, is the most interesting feature of plant U-snRNA genes. This At least two possible mechanistic explanations of the relaxed property is unique to plant genes. Organisation of U-snRNA gene spacer length requirement in transfected protoplasts can be promoters and determinants of RNA polymerase specificity in envisaged, (i) Additional spacer DNA could loop out, thereby other organisms are entirely different (2, 3; see also Introduction). allowing interactions between factors binding to the USE and To better understand how the conserved placement of the TATA elements. However, observations that insertions of 50 bp elements contributes to transcription initiation, we have compared or longer into the element spacer decrease transcription quite activity of pol II and pol HI specific genes with modified USE- dramatically (19 and this work), speak against such a possibility; TATA spacers in transfected protoplasts and in transgenic these insertions would be expected to loop out more easily than tobacco. We have observed major differences in the effect of the insertions of 20 bp or shorter. Moreover, the observation similar spacing mutations on transcription by pol II and pol HI that promoters containing short insertions of either even or odd in protoplasts. We have also found that the requirements for numbers of half helical turns have comparable activities (Fig. 2), appropriate element spacing in the pol H-transcribed U2 gene also argues against a looping model. Placement of promoter are much more stringent in stably transformed plants than in elements on the same side of the helix is usually required for transfected protoplasts. The latter result provides one more looping out of short DNA spacers (41,42). (ii) Alternatively, it example of the differences one can encounter when activity of is possible that the interaction between factors bound at the USE a gene is compared in transiently and stably transformed cells and TATA in the pol II U-snRNA promoter is relatively flexible (e.g., see refs 34, 35). or is mediated by an accessory adaptor protein which can compensate for short changes in the USE-TATA distance when The finding that modification of the USE/TATA element transcription takes place from plasmid DNA as opposed to the spacing in the U2 gene by deletion or insertion of 5 or more bp chromatin. Additional work is required to identify such a putative of DNA completely inactivates transcription in transgenic tobacco Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1540 Nucleic Acids Research, 1993, Vol. 21, No. 7 adaptor. The relaxed requirement for the U2 gene USE-TATA 8. Dahlberg, J.E. and Schenbom, E. T. (1988) Nucleic Acids Res. 16, 5827-5840. element spacing in transfected protoplasts resembles the situation 9. Tanaka, M., Grossniklaus, U., Herr, W., and Hernandez, N., (1988) Genes observed for the adenovirus 2 E1B promoter in infected HeLa Dev. 2, 1764-1778. cells. The E1B promoter contains the TATA and Spl elements 10. Tanaka, M. and Herr, W. (1990) Cell 60, 375-386. separated by 8 bp. The distance between them can be increased 11. Tanaka, M. Lai, J.-S. and Herr, W. (1992) Cell 68, 755-767 to 18 bp without a large effect on transcription but further addition 12. Margottin, F., Dujardin, G., Gerard, M., Egly, J.M., Huet, J., and Sentenac, A. (1991) Science 251, 424-426. of 6 or 12 bp is strongly inhibitory (43). 13. Lobo, S.M., Lister, J., Sullivan, M.L., and Hernandez, N. (1991) Genes In contrast to the pol Il-specific U2 gene, deletion or insertion Dev. 5, 1477-1489. of 5 bp or more into the spacer of the pol IE-specific U6 gene 14. Simmen, K.A., Bemues, J., Parry, H.D., Sturmenberg, H.G., Berkenstam, completely eliminated transcription in transfected protoplasts. The A., Cavallini, B., Egly, J.-M., and Mattaj, I.W. (1991) EMBO J. 10, 1853-1862. strict requirement for a conserved spacing between the USE and 15. Cormack, B.P., and Struhl, K. (1992) Cell 69, 685-696 TATA elements in the U6 gene is reminiscent of vertebrate pol 16. Waldschmidt, R., Wanandi, I. and Seifart, K.H. (1991) EMBO J. 10, HI transcription. In vertebrate pol Hi-specific U-snRNA genes, 2595-2603. two of their three essential promoter elements, the PSE and 17. Mattaj, I.W., Dathan, N.A., Parry, H.D., Carbon, P., and Krol, A. (1988) TATA, are located at similar positions to the USE and TATA Cell 55, 435-442. 18. Lobo, S.M., and Hernandez, N. (1989) Cell 58, 55-67 . of plant genes. The distance between the PSE and TATA is very 19. Vankan, P., and Filipowicz, W. (1989) EMBO J. 8, 3875-3882. highly conserved (17 bp) and this property is essential both for 20. Waibel, F., and Filipowicz, W. (1990) Nucleic Acids Res. 18, 3459-3466. selection of the start site and efficiency of transcription 21 . Waibel, F. and Filipowicz, W. (1990) Nature 346, 199-202. (13,17,44,45) 22. Kiss, T., Marshallsay, C , Filipowicz, W. (1991) Cell 65, 517-526. 23. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: It has recently been found that the TATA binding protein TBP, A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring a component of the pol Il-specific factor THUD, is also involved Harbor, N.Y. in transcription of pol I- and pol IH-specific genes (reviewed in 24. An, G. (1986) Plant Physiol. 81, 86-91 . ref. 46), including genes encoding U6 RNA in yeast and 25. Vankan, P., Edoh, D. and Filipowicz, W. (1988) Nucleic Acids Res. 16, 10425-10439. mammals (12-16). Similarly, using genetically marked (47) 26. Goodall, G.J., Wiebauer, K. and Filipowicz, W. (1990) Meth. Enzym. 181, plant TBP protein, we have demonstrated that this factor 148-161 . participates in transcription in vivo of both pol II- and pol Ill- 27. Kiss, T. and Solymosy, F. (1990) Nucleic Acids Res. 18, 1941-1949. specific U-snRNA genes of plants (D. Heard, T. K. and W.F., 28. Hood, E.E., Helmer, G.L., Fraley, R.T. and Chilton, W.S. (1986) J. manuscript in preparation). The strict requirement for proper Bacteriol. 168, 1291-1301. 29. Holsters, M. de Waele, D., Dipicker, A., Messens, E., Van Montagu, M. positioning of the USE and TATA elements reported here for and Schell, J. (1978) Mol. Gen. Genet. 163, 181-187. transcription of the U6 gene in transfected protoplasts, suggests 30. Van Haute, E., Joos, H., Maes, S., Warren, G., Van Montagu, M. and that in pol Ill-transcribed U-snRNA genes the protein factors Schell, J. (1983) EMBO J. 2, 411-418. binding to the USE and TATA elements may interact directly 31. Horsch, R.B., Fry, J.E., Hoffman, NX., Neidermyer, J., Rogers, S.G. with each other. Characterization of transcription factor(s) and Fraley, R.T. (1988) In Gelvin, S.B. and Schilperoort, R.A. (eds) Plant Molecular Biology Manual. Kluwer Acad. Publishers, Dordrecht. Section interacting with the USE element will be essential to establish A5, pp 1-9. the details of protein interactions at the promoters of plant U- 32. Blonstein, A.D., Vahala, T., Frechebound Y., and King, P.J. (1988) Mol. snRNA genes and to understand, at the molecular level, what Gen. Genet. 211, 252-259. factors determine the RNA polymerase specificity of the gene. 33. Draper, J., Darey, M.R., and Freeman, J.P. (1988) In Yeoman, M.M. (ed) Plant Cell Culture Technology. Blackwdl Scientific Publications, pp 231- 301. 34. Berland, R. and Chasin, L.A. (1988) Nucleic Acids Res. 16, 11573-11589. 35. Beilmann, A., Pfhzner, A.J.P., Goodman, H.M. and Pfitzner, U.M. (1991) ACKNOWLEDGEMENTS Eur. J. Biochem. 196, 415-421. 36. Felsenfeld, G. (1992) Nature 355, 219-224. We thank Jirina Petruska for assistance in protoplasts 37. Hayes, J.J. and Wolffe, P. (1992) Bioessays 14, 597-603. transfections, all the members of our laboratory for helpful 38. Komberg, R.D. and Lorch, Y. (1992) Ann. Rev. Cell Biol., 8, 563-587. discussions and Drs B.Hohn, J.Paszkowski and H.Rothnie for 39. Buschhausen, B., Wittig, B., Graessmann, M. and Graessmann, A. (1987) critical reading of the manuscript. We also thank Dr R.Luhrmann Proc. Nad. Acad. Sci. USA 84, 1177-1181. 40. Zelcer, A. and Galun, E. (1976) Plant Sci. Lett. 7, 331-336. for anti-m G cap antibodies and Drs M.Czakcj and 41 . Mukherjee, S., Erickson, H. and Bastia, D. (1988) Proc. Natl. Acad. Sci. Z.Koukolikova"-Nicola for the bacterial strains. USA 85, 6287-6291. 42. Griffith, J., Hochschild, A. and Ptashne, M. (1986) Nature 322, 750-752. 43. Wu, 1., and Berk, A. (1988). Genes Dev. 2, 403-411. REFERENCES 44. Lescure, A., Carbon, P. and Krol, A. (1991) Nucleic Acids Res. 19, 435-441 . 1. Reddy, R. andBusch,H. (1988)toBirnstid, M.L.(ed)5in<cn</«WFuncrion 45. Gommer, R.S. and Kunkel, G.R. (1992) Nucleic Acids Res. 20, 4903-4912. of Major and Minor Small Nuclear Ribonucleoprouin Particles. Springer 46. Sharp, P.A. (1992) Cell 68, 819-812. Veriag, Heidelberg, pp 1 -70 . 47. Strubin, M. and Struhl, K. (1992) Cell 68, 721-730. 2. Hernandez, N. (1992) In McKnight, S. and Yamamoto, K.(eds) Transcription Regulation. Cold Spring Harbor Monograph Series. Cold Spring Harbor Laboratory Press. Cold Spring Habor, NY, in press. 3. Goodall, G.J., Kiss, T., and Filipowicz, W. (1991) In Miflin, B.J.(ed.), Oxford Surveys of Plant Molecular and Cell Biology. Oxford Univ. Press, vol 7, pp 255-296. 4. Parry, H.D., Scherly, D., and Mattaj, I.W. (1989) Trends Biochem. Sci. 5, 15-19. 5. Nigg, E.A., Baeuerle, P.A., Luhrmann, R. (1991) Cell 66, 15-22. 6. Kunkel, G.R. (1991) Biochim. Biophys. Acta. 1088, 1-9. 7. Ciliberto, G., Palla, F., Tebb, G., Mattaj, I.W. and Philipson, L. (1987) Nucleic Acids Res. 15, 2403-2416. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Nucleic Acids Research Oxford University Press

Activity of U-snRNA genes with modified placement of promoter elements in transfected protoplasts and stably transformed tobacco

Loading next page...
 
/lp/oxford-university-press/activity-of-u-snrna-genes-with-modified-placement-of-promoter-elements-6Cx4ZeVyv5

References (7)

Publisher
Oxford University Press
Copyright
© 1993 Oxford University Press
ISSN
0305-1048
eISSN
1362-4962
DOI
10.1093/nar/21.7.1533
Publisher site
See Article on Publisher Site

Abstract

Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1533-1540 Activity of U-snRNA genes with modified placement of promoter elements in transfected protoplasts and stably transformed tobacco Dominic Edoh, Tamas Kiss and Witold Filipowicz* Friedrich Miescher-lnstitut, PO Box 2543, 4002 Basel, Switzerland Received January 29, 1993; Revised and Accepted March 1, 1992 ABSTRACT In higher plants the promoter elements of pol II- and accumulation of these U-snRNAs and the genes encoding them pol Ill-transcribed U-snRNA genes are Identical, usually contain characteristic transcriptional signals which are comprising a -30 TATA box and an upstream not found in other gene classes. Synthesis of most of the U- sequence element, USE. The USE and TATA are snRNAs is catalysed by RNA polymerase II (pol II) and some, centred approximately four and three helical DNA turns such as U6 RNA (and U3 RNA in plants), by RNA polymerase apart In pol II and pol III genes, respectively, and It Is III (pol HI) but both classes of genes frequently share identical this difference in the element spacing that determines promoter elements (2,3). Maturation and intra-cellular transport the RNA polymerase specificity of the gene. In this of U-snRNAs and U-snRNPs are also quite unique. U-snRNAs study we have analyzed the effect of spacing mutations contain unusual 5'-terminal cap structures such as m GpppN on activity of Arabldopsls U2 and U6 genes in (pol II products) or Me-pppN (pol HI products) and assembly transfected protoplasts of Nicotlana plumbaglnlfolla of U-snRNPs may involve many complex steps taking place both and in stably transformed tobacco. In the pol Ill- in the nucleus and the cytoplasm (reviewed in refs 3-5) . transcribed U6 gene the insertions and deletions of Transcription of U-snRNA genes has been most extensively either odd or even numbers of half helical turns studied in vertebrates (2,6). All pol II- and pol Hi-specific completely inactivate transcription In transfected vertebrate U-snRNA genes share two promoter elements: the protoplasts, consistent with the high conservation of Proximal (PSE) and Distal (DSE) Sequence Elements, positioned the element spacing found in all plant U-snRNA genes. at approximately -6O/-5O and -250/-200 , respectively. The Surprisingly, while insertions of 50 base pairs (bp) or PSE is an U-snRNA gene-specific element which is required for more Into the spacer of the pol ll-speclfic U2 gene selection of the transcription start site while the DSE has some inactivate transcription, a deletion of 5 bp or Insertions properties of an enhancer and is usually composed of several of as much as 20 bp decrease transcription by only 40 sequence motifs, such as octamer- or SPl-binding sites, which to 70%. This relaxed requirement for the conserved are also found in mRNA gene promoters. Despite this similarity, element spacing Is only seen in transfected protoplasts U-snRNA and mRNA gene enhancers are usually not since the same mutant U2 genes are not transcribed interchangeable (7,8) and octamer motifs within them are in stably transformed tobacco when transcription takes recognized by two different transcription factors, Oct-1 and Oct-2 place from the chromosome. The results provide some respectively (9-11). Pol Hi-specific U-snRNA genes in clues about possible factor Interactions at the vertebrates, in addition to the DSE and PSE elements, contain promoters of plant U-snRNA genes and also offer an a TATA-like box in the -3 0 region. It is the presence of this example of major differences in transcription between motif, recognized by the TATA binding protein TBP (12-16), transiently and stably transformed cells. which establishes that the U-snRNA gene is transcribed by pol HI and not by pol H (17,18). Promoter elements and determinants of RNA polymerase INTRODUCTION specificity in plant U-snRNA genes differ from vertebrates The U small nuclear RNAs (U-snRNAs) are components of (reviewed in ref. 3). Promoters of both pol H- and pol Hi-specific ribonucleoprotein particles (U-snRNPs) participating in various genes contain identical essential elements: a —30 TATA-like box RNA processing events in the nucleus (1). One of the most and a highly conserved Upstream Sequence Element (USE, interesting aspects of the metabolism and function of the major consensus RTCCCACATCG) positioned upstream of the TATA. U-snRNAs, represented by RNAs U1-U6, is their synthesis The USE is an snRNA gene-specific element and is not found (reviewed in refs 1 - 3). In most of the eukaryotes studied to date in other plant genes. On the other hand, the TATA-like box is special mechanisms have evolved to maintain co-ordinate structurally and, as demonstrated for the U2 gene, also * To whom correspondence should be addressed Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1534 Nucleic Acids Research, 1993, Vol. 21, No. 7 functionally indistinguishable from the TATA element of mRNA- Plasmids for tobacco transformations. To generate different pG- coding genes (19,20). As established for the U2 and U6 genes AU2 constructs (see Fig. 5), the BglE-EcoRl fragment in the of Arabidopsis, the USE and TATA elements are interchangeable binary vector pGA492 (24) was first replaced with BamtU-EcoRl between the two classes of genes and appear to be, in addition fragments containing wild type or mutant U2 genes excised from to the Y/R dinucleotide at positions -1/+1 , the only promoter plasmids pU2.MSPace-l through +2 (described above) and sequences essential for transcription (3, 19, 20; S. Connelly, D. pU2.2(WT), pU2.SP and pU2.SPAUSE (20). A reference Heard and W.F. , manuscript in preparation). What distinguishes Arabidopsis U5 gene was then inserted into the resulting plasmids, the pol II and pol III gene promoters is the position of the USE either in the same or opposite orientation, to generate pGAU2 with respect to the TATA element. In all pol n specific genes, plasmids of the A and B series, respectively. The U5 gene was the USE and TATA are centred approximately four helical DNA excised as a Sacl-HiruSQ fragment from either pATU5.1k [a turns apart whereas in the pol HI specific genes the spacing is derivative of the vector pTZ18U (25); for the A series] or from about 10 bp shorter (ref. 3; Fig. 1). We have recently shown an analogous construct containing the U5 gene in the vector that it is this one helical turn difference in the element spacing pTZ19U (for the B series). Excised fragments were cloned which determines the RNA polymerase specificity of the gene between the Hindfll and Sacl sites of the pGA492 vector. Both (21, 22). orientation plasmids were constructed for all U2 gene variants with exception of the wild type gene U2.2 for which only the We are interested in understanding how differences in the B series construct was made. topology of the USE and TATA elements determine the choice of RNA polymerase and how different transcription factors Transient expression in transfected protoplast contribute to this process. We have previously investigated the effect of changes in the spacer length between the USE and TATA Protoplasts prepared from leaves of N. plumbaginofolia were on transcription of the pol H-specific Arabidopsis U2 gene in transfected with plasmid DNA by the polyethylene glycol method transfected plant protoplasts. It was found that deletion of 10 bp (26). Unless indicated otherwise, 5X106 protoplasts were of DNA from the USE-TATA spacer decreases transcription by transfected with 10-20 /tg of each plasmid. The pU2.MSPace pol II by 10-fold and makes the promoter competent to initiate constructs were co-transfected with either pATU5.1kb (25) or transcription by pol HI (19, 21), consistent with the structure of pToU3 (27) as reference genes; the pU6.SPace constructs were all plant pol HI U-snRNA gene promoters (3). Surprisingly, co-transfected with pU2.SP (20) as a reference. despite high evolutionary conservation of the USE-TATA Transformation of Nicotiana tabacum distance, U2 genes with the USE-TATA spacer shortened by 5 bp or lengthened by up to 20 bp retained 35 - 60 % of the activity The pGAU2 plasmids were transformed into E.coli strain DH1 of the control U2 gene (19). In this study we have extended this and introduced into Agrobacterium tumefaciens strain EHA101 work by testing activity of pol II- and pol El-specific U-snRNA (28) either directly using the freeze-thaw method (29) or by genes with modified placement of the USE element in transiently triparental mating (30) using the E.coli helper strain 2013. The transfected protoplasts of Nicotiana plumbaginifolia and in E.coli transformants and A. tumefaciens EHA101 transconjugants transgenic tobacco. The results are discussed in terms of possible were controlled for the presence of the pGAU2 plasmids by mechanisms operating during transcription initiation of plant U- restriction analysis and Southern blotting of plasmid DNA. snRNA genes. N. tabacum (SRI) leaf pieces were cocultivated for 2 days with Agrobacterium EHA101 containing appropriate plasmids as described (31). The leaf discs were subsequently incubated on RMPkm, i.e. RMP medium (32) supplemented with 100 mg/1 MATERIALS AND METHODS kanamycin sulphate and 500 mg/1 cefotaxim (Claforan; Hoechst, Construction of plasmids Frankfurt). Transgenic plants were regenerated by selecting on Unless indicated otherwise, all techniques used for manipulating callus, shooting and rooting media (31). The resulting plantlets were first propagated in vitro on RMPkm medium and later DNA were as described by Sambrook et al. (23). Identity of all transferred to soil in the greenhouse. Ten primary transformants constructs was verified by sequence analysis using the dideoxynucleotide method and double stranded DNA. were regenerated for each construct. Leaves were collected from Oligonucleotides were kindly provided by W. Zurcher and F. about 10 cm high plants, frozen in liquid nitrogen and stored Fisher of this Institute. at -70°C. RNA and DNA isolation U2.MSPace mutants. Constructs pU2.MSPace-l through +2 were generated by replacing the Xhol-Ncol region in pU2.SP (19; RNA was prepared from protoplasts 24 h after transfection (26). see also Fig. 2 Q with appropriate synthetic DNA fragments. Frozen leaves from the transgenic plants were crushed in a mortar containing liquid N and RNA was isolated as described (26). U6.SPace mutants. Constructs pU6.SPace+0.5 through +2 were DNA was prepared from tobacco leaves according to Draper et generated by inserting appropriate synthetic DNA fragments into al. (33). Xhol- and Wcol-restricted pU6syn (20; see Fig. 4b). The RNase A/T, mapping pU6.SPace-l was obtained by digestion of pU6syn with Xhol and Ncol followed by filling in and religation. To generate RNase A/T] mapping was performed as described by Goodall pU6.SPace-0.5, a synthetic DNA fragment containing the USE et al. (26). The gene specific RNA probes, complementary to box was inserted into pU6syn predigested with BamHl and Ncol. the coding and flanking regions of the transfected genes were To obtain pU6.SPace-2, a synthetic DNA fragment containing synthesized in vitro by SP6 polymerase using [a-^PJCTP (sp. the USE and the TATA boxes was inserted into pU6syn digested act. 80Ci/mmol), and one of the following plasmids: with BamHl and Sail. pGEM2.U2.2 linearized with Hindm (19), pU6-26 linearized Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1535 with BstXl (20), pGEMl.U5 linearized with BstNl (25), or Immunoprecipitation pToU3 (27) digested with PvuII. 5 /ig of total RNA from RNA prepared from transfected protoplasts was protoplasts or leaves and 6—12 fmol of each probe was usually immunoprecipitated with the anti-m G cap polyclonal antibody used per mapping reaction. Protected fragments specific for (kindly provided by Dr R. Luhrmann, University of Marburg, transfected genes were quantitated by scintillation counting. The Germany) and control serum as described (22). RNA recovered values for test genes were normalized by taking into account from precipitated pellets and supernatants was analysed by RNAse expression of the reference genes. mapping. PCR amplification of the U2 transgenes RESULTS Two oligonucleotide primers, a 27-mer 5'-AGCATTAGTTA- Expression of the U2 gene mutants in transfected protoplast GTTGAACTACTTTGGG-3' corresponding to positions -155 to -128 upstream of the U2 coding region, and a 16-mer Promoters of all pol H-transcribed U-snRNA genes in plants have 5'-TGGCGGGTTGAGCCAG-3', specific for the 3' end of the the USE and TATA elements centred approximately four helical U2 coding region of the plasmid pGAU2.SP/B, were used to turns apart (3; see Fig. 1). Previous work has shown, however, PCR amplify U2 gene sequences from DNA isolated from that deletion of a half helical turn (5 bp) or insertion of as much as two helical turns of DNA (20 bp) in the USE-TATA spacer selected transgenic plants. The following conditions were used: decreased activity of the gene in tranfected protoplasts by only denaturan'on 94°C, 1'; annealing 65°C, 1'; polymerization 72°C, 40-65 % (19; see also Introduction). To eliminate the possibility 1'; 30 cycles. PCR products were analysed on a 1.5% agarose that the observed flexibility in the promoter element spacing is gel. due to the nature of the DNA sequences used for modification of the spacer length, we have constructed a set of mutant U2 genes having spacer sequences different from those used previously. All the mutants, called U2.MSPace, are derivatives Pol III of the gene U2.SP which contains a synthetic pol II promoter with the USE and TATA boxes centred approximately four helical DNA turns apart (19; see Fig. 2Q . Plasmids containing control or mutant U2 genes were transfected into protoplasts of N. Pol II- plumbaginifoUa, together with the reference wild-type U5 snRNA gene of Arabidopsis. Accumulation of U2 and U5 RNA Flgnre 1. Schematic structure of plant U-snRNA genes showing the length of the spacers separating the US E and TATA elements, and the TATA and the transcripts was measured by RNase A/Tl mapping using gene- transcription start site (Y/R) at positions -1/+1 . The S'-proximal sequences specific 32P-labeled antisense RNA probes. As shown in Figs. involved in 3 ' end formation (3, S. Connelly and W.F. , manuscript in preparation) 2A and B, the U2 genes having the spacer modified by a deletion are also indicated. The arrows represent coding regions of the pol m-specific of 5 bp (U2.MSPace-0.5) or insertion of up to 20 bp U6 , U3 and 7-2/MRP genes, and the pol II-specific U1 , U2, U 4 and U5 genes (3). l]2.MSPac e genes 201 • 190 • ^ • m 160 • 147 . Ned -33 -M n» U5 pUUCP«t+ l M l 2 ." 4 5 h 7 K V M pUIJCP«ai t UTGCAUCiCUACUTTUCUUTTCJUCTTCOUC~ Figure 2 . Activity of the U2.MSPace genes. (A) Autoradiogram of a gel from a representative experiment showing RNase mapping with U2 (upper panel) and U5 flower panel) gene probes. U2.MSPace mutants used for protoplast transfectkra are indicated at the top (lanes 3 -6 , 8 and 9). Lanes 2 and 7, transfectkms with control U2.2 (WT) and U2.SP genes. Lane 1, non-transfected protoplasts. Lane M, size markers (A/poII-digested pBR322). The positions of U2- and U5-specifk protected fragments are indicated by arrows. U2 endo, fragments protected by endogenous N. plumbaginifoUa U2 RNA. (B) Quantitation of the activity of the mutants. Activity is expressed relative to the activity of the gene U2.SP. Values represent means +/ - SEM from 5 independent experiments. ( Q Structure of different U2.MSPace mutants. Sequences inserted between the Xhol and Ncol sites of the synthetic promoter are shown. Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1536 Nucleic Acids Research, 1993, Vol. 21, No. 7 NONIM a. z a. tw c^ co cr r4 3 _ - d <o o *- c\i O + + _) S P P S P P s 1» P s s S 24 2 • U3 157' 21 7 • U3 1 1 < 201 > •mk to 19 0 •U 6 I2endo 7 8 M 1 2 3 4 10 11 12 M Figure 3. Immunoprecipitation of RNA transcripts with anu-n^G cap antibodies. •U2 Protoplasts were tiansfected with 10/ig of the U3 gene-containing plasmid pToU3 (27)andlOjigofeitherpU2.SP(lanes3,4, Hand 12), pU2.MSPace+2 (lanes 5 and 6), pU2.MSPace+0.5 (lanes 7 and 8), or pU2.MSPace-0.5 (lanes 9 and 10). Lanes 1 and 2, non-transfected protoplasts. RNA isolated from protoplasts M l 2345678 9 10 M was innnunoprecipitated with either anti-n^G polyclonal (a-m G) antibodies (lanes 1 — 10) or non-immune (NONIM) control serum (lanes 11 — 12). The precipitates (P) and supernatants (S) were analysed by RNase mapping using a mixture of U2 and U3 probes. Positions of U2 and U3 RNA-specific bands and B of U3 RNA precursor (U3*) are indicated. Ncol -31 -24 AACTCCACTTATCTACCATCCT*ClTATAMTAlATC*TaTCTCCtC*TATC(Un| AAAG (U2.MSPace+0.5 through U2.MSPace+2) retained 35-70% AACTCCACATCCTAC AACTCGACTTCCATCOTAC of the activity of the control gene U2.SP. Only when the distance AACTCCACAAACAATTCACTCCATGGTAC AACTCEACAAACAATTCACAACATTCCATGCTAC between the elements was shortened by one helical turn to AACTCCAl^UACAATTGACAAUTTCAACTCCATCCTAC AACTCOACAAAGAATTCACAAaTTCAACTTGCAACCATGCTAC resemble the pol Hi-specific promoter (U2.MSPace-l), was transcription of the gene reduced by approximately 15-fold. Relative activities of individual U2.MSPace mutants were similar Figure 4. Activity of U6syn genes with modified spacer. A) RNase A/T, to those of the mutants of the U2.SPace series studied before (19). mapping with U6 (upper panel) and U2 (lower panel) RNA probes. U6.SPace mutants used for protoplast transfection are indicated at the top (lanes 3- 6 and We have verified that transcription of the mutants 8-10). Lanes 2 and 7, transfections with control U6.26 and U6synTATAl genes. U2.MSPace-0.5 through U2.MSPace+2 is carried out by pol Lane 1, non-transfected protoplast. (B) Structure of different U6.SPace mutants II and not by pol III by demonstrating that U2 RNA synthesized with sequences of the USE/TATA spacers indicated. from them is precipitable with anti-trimethylguanosine (n^G) cap antibodies; the Me-pppA cap-containing U3 RNA transcribed from a co-transfected control gene was not immunoprecipitated (Fig. 3). The m G cap is found only in pol H-specific U- Experiments carried out previously have shown that insertion snRNAs (1) and we have demonstrated previously that, in of approximately five additional helical turns of DNA into the transfected plant protoplasts, U3 snRNA acquires m G cap USE-TATA spacer of the U2 gene decreases its transcription when its synthesis is catalysed by pol II in contrast to the Me- 15-2 0 fold, close to the level of activity of the gene from which pppN cap present in U3 snRNA produced by pol III (22). Our the USE element had been deleted (19). We have now tested previous observation that transcription from the pol Hi-specific activity of the U2 genes in which the distance between the USE U6 gene promoter fused to the coding region of the U2 gene and TATA elements has been increased even further. The purpose does not result in accumulation of U2 RNA transcripts (21) also of this was to test whether USE element can activate transcription argues against the possibility that U2 RNAs synthesized from under conditions which potentially allow looping out of the the U2.MSPace genes are pol HI transcripts. Taken together, intervening spacer DNA. Of eight different mutant U2.SP genes these results indicate that despite the strong evolutionary tested, containing insertions varying in length (from 136 to 294 conservation of the spacing of the USE and TATA elements it bp) and base composition (from 38 to 60% AT), none showed can be changed considerably without strongly affecting activity exceeding that of the gene from which the USE had been transcription by pol H in transfected protoplasts. deleted (data not shown). |U2. P+2 P+0.5 U2. P-0.5 1 Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1537 no major effect on transcription in transfected protoplasts was rather unexpected since the distance between the USE and TATA elements in the pol H-transcribed U-snRNA genes of plants is also highly conserved (3; Fig. 1). Therefore, we decided to investigate the effect of mutations in the USE-TATA spacing on U2 gene activity in stably transformed plants, where transcription of the transgene takes place from chromatin rather than from plasmid DNA. Constructs containing different mutants of the Arabidopsis U2 gene were made in the T-DNA binary vector pGA492 and used for transformation of Nicotiana tabacum by the Agrobacterium (pOAU2/A Miles) tumejaciens system (24). The constructs also contain, as a __.— TATAI— reference, the Arabidopsis wild-type U5 RNA gene cloned in the same (series A) or opposite (series B) orientation as the test 1J U2 gene (Fig. 5). The reference gene was included to facilitate -OJ quantitation of activity of different U2 genes and to eliminate U LJ" AUSI UUMUSE copy number and position of integration effects. We have (pQAU2/B seriea) previously shown that the Arabidopsis U5 gene is actively transcribed in transgenic tobacco (25). Before being used for plant transformation, the pGAU2 Figure 5. Construction of the pGAU2 plasmids used for transformation of plants. The pGA492 vector is shown at the top with important restriction sites (H, HintHS; constructs bearing different U2 gene mutants were tested for S, Sacl; Hp, HpaO.; Bg, BglH; E, £coRI) and the T DNA borders (BL and BR) activity in transfected protoplasts of N. plumbaginifolia. The indicated. Positions and orientations of the inserted reference (U5) and test (U2) activity of individual U2 spacing mutants, as compared to the genes are indicated below. Lengths (in bp) of the regions upstream of the USE control gene U2.SP, was similar to that found with the constructs element and downstream of the coding region are shown. of the pU2.MSPace series (see Fig. 2). The genes U2.MSPace-0.5 through U2.MSPace+1.5 retained over 50% of activity and the gene U2.MSPace+2 retained 40% activity of the gene U2.SP, while transcription of the genes U2.MSPace-l Expression of the U6 gene mutants in transfected protoplasts and U2.SPU UUSE was decreased by more than 10-fold. The We have investigated the importance of the spacing of the USE genes present in the A and B series of plasmids had comparable and TATA elements for transcription of the pol IE-specific U6 activities (data not shown). gene in transfected protoplasts. Previously, we have shown that The T-DNA of the pGAU2 vectors was introduced into N. insertion of 10 bp to the spacer of the Arabidopsis U6 gene tabacum by leaf-disc transformation (31). Ten primary completely abolishes U6 RNA accumulation in transfected independent transformants were isolated for each construct of protoplasts. However, this mutated U6 gene promoter became the A and B series. All of them, with exception of two plants competent to direct efficient synthesis of U2 RNA from the hybrid of the B/U2.MSP+1.5 series were found to express the U5 gene containing the U2 gene coding and 3' non-coding regions reference gene as demonstrated by RNase AfT^ mapping (21). analysis. The level of U5 expression varied among different plants We have now constructed mutants of the Arabidopsis U6 gene by up to 10-fold (see Fig. 6D and data not shown). The presence in which the USE-TATA spacer length is either decreased by of the U2 transgene was demonstrated in selected transformants 0.5, 1 or 2 helical DNA turns or increased by 0.5, 1, 1.5 or by PCR analysis of plant DNA using appropriate oligonucleotide 2 helical turns. All these mutants, called U6.SPace (Fig. 4B), primers (see below). are derivatives of the gene U6synTATAl which contains a synthetic pol IH promoter, with the USE and the TATA boxes centred approximately three helical DNA turns apart, fused to Activity of the U2 gene mutants in transgenic tobacco the coding region of the Arabidopsis gene U6.26. The gene The Arabidopsis wild-type U2.2 gene and its derivative containing U6synTATAl is transcribed with about 40% efficiency of the a synthetic promoter, the gene U2.SP, are transcribed with similar wild-type gene U6.26 (20; Fig. 4A). Activity of mutants was efficiency in transfected protoplasts of N. plumbaginifolia (19). tested in transfected protoplasts using a co-transfected Arabidopsis The same was found to be true when the activity of the U2.2 U2 gene as a reference. As shown in Fig. 4A, none of the and U2.SP genes expressed in transgenic tobacco was compared U6.SPace mutants has detectable activity indicating that, in (Fig. 6A, lanes 3—5; and data not shown). [Activity of all U2 contrast to the case of pol H-specific genes, the requirement for transgenes determined in this and all subsequent experiments was a proper spacing between the USE and TATA is very rigid for normalized for the activity of the reference gene U5; we have the pol IH promoter. found that the ratio of U2 to U5 gene expression is nearly constant when independent plants expressing the same U2 gene mutant Generation of transgenic tobacco plants expressing are analysed (Fig. 6D and data not shown)]. The U2.SP gene Arabidopsis U2 and U5 snRNA genes present in the construct of the A series was expressed at approximately 2-fold higher level than the B series gene, The strict requirement for proper positioning of the USE element indicating that orientation of the reference U5 gene may have for transcription by pol HI is consistent with the high evolutionary small effect on transcription of the test gene (Fig. 6A, lanes 4 conservation of the USE-TATA spacing in all pol Hi-specific and 5; Figs 6B and C, lanes 2). The U2.SPAUSE did not show U-snRNA genes in plants. However, the finding that even quite measurable activity in either orientation, indicating that the substantial changes in the spacer of the pol H-specific gene have Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1538 Nucleic Acids Research, 1993, Vol. 21, No. 7 <r, C a; S; ^ ri O ~ »J "5 < 3 U r* is (S a. g L2.iV!SPace mutants 3 3 3 190 r^j ••*• U2 ^ ^ •"' *** i-*- »*- IXfl g ^ "^- "1 ^ **7 «^ ^ 201 - 190 — U2 160 — 147 ~ 12.1 — * - LJ5 US 1 2 endo M l 2 3 4567S M M 12 3 4 5 r-, r* - Q ^ ^UZ-MSPafPiniita ??«?+ ? 201 — 201 — U2 180 . 160 ^ . 160 _ 147 — 147 mm U5 U5 lll l V2 U2 endo endo M1234 5 6 7 8M M l 4S6789 M Figure 6. Activity of the U2 gene mutants in transformed N. tabacum. AD four panels show RNase mapping, performed with a mixture of U2 and U5 gene probes, using RNA isolated from transgenic plants. The pGAU2 plasmids used for transformation are indicated at the top of autoradiograms, together with the orientation series (A or B) and a plant number. (A) Lane 1, mapping of RNA isolated from protoplast cotransfected with pU2.SP and pAtU5. Ik. Lane 2, control non-transformed plant. Lanes 3-6 , plants transformed with plasmids containing the U2.2 (WT), U2.SP and U2.SPAUSE genes. (B) Analysis of plants transformed with the A series of plasmids (lanes 2-8) ; plants showing similar levels of expression of the reference U5 gene were selected for analysis. Lane 1, control non-transformed plant. ( Q Same as panel (B) except that transgenic plants transformed with the B series of plasmids were analysed. (D) Mapping of three independent plants transformed with pGAU2.SP/A (lanes 1 -3) , pGAU2.MSPace-0.5/A (lanes 4-6 ) and pGAU2.MSPace+0.5/A (lanes 7-9) , showing different expression levels of the reference U5gene . presence of the USE element is essential for transcription of the preparations isolated from selected transgenic plants expressing gene in transgenic tobacco (Fig. 6A and data not shown). either similar (Figs. 6B and C) or different (Fig. 6D) levels of Representative experiments in which activity of the different U5 RNA transcribed from the reference U5 gene of Arabidopsis. While the control gene U2.SP was expressed in plants U2 gene spacing mutants has been assayed are shown in Figs transformed with plasmids of both the A and B series, no 6B and 6D (constructs of the A series) and in Fig. 6C (constructs accumulation of U2 RNA transcripts was detected in plants of the B series). RNase mapping was performed using RNA Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 Nucleic Acids Research, 1993, Vol. 21, No. 7 1539 is consistent with the high evolutionary conservation of the element spacing; in all pol II-transcribed U-snRNA genes sequenced to date, originating from many different plant species, 396bp this spacing is 32 +/— 2 bp (3; Fig. 1). In contrast to transgenic 344bp plants, transcription in transfected protoplasts is not strongly 298bp affected by shortening of the USE/TATA spacer by 5 bp or lengthening it by up to 20 bp. In a transient system, the mutant U2 genes retain as much as 35 -70 % activity of the control gene M l 234567 8 9 1011 M and this effect is independent of sequences used for modification of the spacer. The extent of inhibition is also independent of the USE and TATA being positioned on the same or opposite side Figure 7. Identification of the mutant U2 transgenes in transformed tobacco by of the DNA helix since insertions of a half or one and a half PCR analysis. DNA used for amplification was isolated from plants transformed turns do not affect transcription significantly more strongly than with the B series plasmids: pGAU2.SP (lane 5), pGAU2.SPace-l (lane 6), pG- insertions of one or two helical turns (Fig. 2; and ref. 20). It AU2.SPace-0.5 (lane 7), pGAU2.SPace+0.5 (lane 8), pGAU2.SPace+l (lane 9), pGAU2.SPace+1.5 (lane 10) and pGAU2.SPace+2 (lane 11). Lanes 3 and is likely that differences in the structure and composition of 4, PCR amplifications performed with plasmids pGAU2.SPace-l/B and pG- templates being utilized in transiently as opposed to stably AU2.SPace+2/B as templates, respectively. Lane 1, no DNA template, lane 2, transformed cells are responsible for observed diverse effects of DNA from non-transformed plant. Lane M, size marker (1 kb DNA ladder; spacing mutations on activity of the gene. In stably transformed GIBCO-BRL). plants, the transgene is integrated into the genome and is consequently packaged into nucleosomes and higher order chromatin structures. A need for appropriate configuration of promoter elements during gene transcription from such a template harbouring mutant genes with any changes in the length of the is not surprising; it probably reflects transcriptional requirements USE/TATA spacer. Similar results were observed with all of endogenous pol II U-snRNA genes. For example, in a DNA tobacco plants transformed with the mutant genes. wrapped around the histone octamer, proper spacing of the In order to verify that transformed plants which do not elements could be essential for availability of the USE and TATA accumulate Arabidopsis U2 RNA indeed contain the U2 for interaction with transcription factors; alternatively, the USE- transgenes, DNA isolated from transgenic plants of both the A TATA spacing could have an effect on nucleosome positioning and B series was analyzed by PCR using oligonucleotide primers at the gene (reviewed in refs 36—38). In contrast to stably specific for the sequences positioned upstream and downstream transformed plants, transcription in transiently transfected of the U2 transgene. Analysis of PCR products has revealed the protoplasts probably takes place from naked plasmid DNA as presence of amplified bands of the expected size (Fig. 7 and data there may be no excess of free histones to package DNA into not shown), indicating that mutant U2 genes were present in the nucleosomes in protoplasts. In mammalian cells, because of a tobacco genome but were not expressed. We conclude that the low free histone pool during interphase, efficient chromatin USE/TATA spacer requirement for the pol It-specific U2 gene formation with plasmid DNA is only possible after the recipient in stably transformed plants is much more stringent compared cells have entered the S phase (39 and refs therein). In this to that observed in transiently transfected protoplasts. context, it should be noted that very little DNA synthesis is observed in mesophyll plant protoplasts of tobacco (40) or N. DISCUSSION plumbaginifolia (P. King, personal communication) during the first 24 h of incubation, while most of the U-snRNA gene The characteristic spacing between the USE and TATA promoter transcription occurs between 10 and 24 h after transfection (D. elements, distinguishing pol II- and pol IE-specific U-snRNA Heard and W.F., unpublished results). genes and acting as a determinant of RNA polymerase specificity, is the most interesting feature of plant U-snRNA genes. This At least two possible mechanistic explanations of the relaxed property is unique to plant genes. Organisation of U-snRNA gene spacer length requirement in transfected protoplasts can be promoters and determinants of RNA polymerase specificity in envisaged, (i) Additional spacer DNA could loop out, thereby other organisms are entirely different (2, 3; see also Introduction). allowing interactions between factors binding to the USE and To better understand how the conserved placement of the TATA elements. However, observations that insertions of 50 bp elements contributes to transcription initiation, we have compared or longer into the element spacer decrease transcription quite activity of pol II and pol HI specific genes with modified USE- dramatically (19 and this work), speak against such a possibility; TATA spacers in transfected protoplasts and in transgenic these insertions would be expected to loop out more easily than tobacco. We have observed major differences in the effect of the insertions of 20 bp or shorter. Moreover, the observation similar spacing mutations on transcription by pol II and pol HI that promoters containing short insertions of either even or odd in protoplasts. We have also found that the requirements for numbers of half helical turns have comparable activities (Fig. 2), appropriate element spacing in the pol H-transcribed U2 gene also argues against a looping model. Placement of promoter are much more stringent in stably transformed plants than in elements on the same side of the helix is usually required for transfected protoplasts. The latter result provides one more looping out of short DNA spacers (41,42). (ii) Alternatively, it example of the differences one can encounter when activity of is possible that the interaction between factors bound at the USE a gene is compared in transiently and stably transformed cells and TATA in the pol II U-snRNA promoter is relatively flexible (e.g., see refs 34, 35). or is mediated by an accessory adaptor protein which can compensate for short changes in the USE-TATA distance when The finding that modification of the USE/TATA element transcription takes place from plasmid DNA as opposed to the spacing in the U2 gene by deletion or insertion of 5 or more bp chromatin. Additional work is required to identify such a putative of DNA completely inactivates transcription in transgenic tobacco Downloaded from https://academic.oup.com/nar/article-abstract/21/7/1533/2385902 by DeepDyve user on 05 August 2020 1540 Nucleic Acids Research, 1993, Vol. 21, No. 7 adaptor. The relaxed requirement for the U2 gene USE-TATA 8. Dahlberg, J.E. and Schenbom, E. T. (1988) Nucleic Acids Res. 16, 5827-5840. element spacing in transfected protoplasts resembles the situation 9. Tanaka, M., Grossniklaus, U., Herr, W., and Hernandez, N., (1988) Genes observed for the adenovirus 2 E1B promoter in infected HeLa Dev. 2, 1764-1778. cells. The E1B promoter contains the TATA and Spl elements 10. Tanaka, M. and Herr, W. (1990) Cell 60, 375-386. separated by 8 bp. The distance between them can be increased 11. Tanaka, M. Lai, J.-S. and Herr, W. (1992) Cell 68, 755-767 to 18 bp without a large effect on transcription but further addition 12. Margottin, F., Dujardin, G., Gerard, M., Egly, J.M., Huet, J., and Sentenac, A. (1991) Science 251, 424-426. of 6 or 12 bp is strongly inhibitory (43). 13. Lobo, S.M., Lister, J., Sullivan, M.L., and Hernandez, N. (1991) Genes In contrast to the pol Il-specific U2 gene, deletion or insertion Dev. 5, 1477-1489. of 5 bp or more into the spacer of the pol IE-specific U6 gene 14. Simmen, K.A., Bemues, J., Parry, H.D., Sturmenberg, H.G., Berkenstam, completely eliminated transcription in transfected protoplasts. The A., Cavallini, B., Egly, J.-M., and Mattaj, I.W. (1991) EMBO J. 10, 1853-1862. strict requirement for a conserved spacing between the USE and 15. Cormack, B.P., and Struhl, K. (1992) Cell 69, 685-696 TATA elements in the U6 gene is reminiscent of vertebrate pol 16. Waldschmidt, R., Wanandi, I. and Seifart, K.H. (1991) EMBO J. 10, HI transcription. In vertebrate pol Hi-specific U-snRNA genes, 2595-2603. two of their three essential promoter elements, the PSE and 17. Mattaj, I.W., Dathan, N.A., Parry, H.D., Carbon, P., and Krol, A. (1988) TATA, are located at similar positions to the USE and TATA Cell 55, 435-442. 18. Lobo, S.M., and Hernandez, N. (1989) Cell 58, 55-67 . of plant genes. The distance between the PSE and TATA is very 19. Vankan, P., and Filipowicz, W. (1989) EMBO J. 8, 3875-3882. highly conserved (17 bp) and this property is essential both for 20. Waibel, F., and Filipowicz, W. (1990) Nucleic Acids Res. 18, 3459-3466. selection of the start site and efficiency of transcription 21 . Waibel, F. and Filipowicz, W. (1990) Nature 346, 199-202. (13,17,44,45) 22. Kiss, T., Marshallsay, C , Filipowicz, W. (1991) Cell 65, 517-526. 23. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: It has recently been found that the TATA binding protein TBP, A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring a component of the pol Il-specific factor THUD, is also involved Harbor, N.Y. in transcription of pol I- and pol IH-specific genes (reviewed in 24. An, G. (1986) Plant Physiol. 81, 86-91 . ref. 46), including genes encoding U6 RNA in yeast and 25. Vankan, P., Edoh, D. and Filipowicz, W. (1988) Nucleic Acids Res. 16, 10425-10439. mammals (12-16). Similarly, using genetically marked (47) 26. Goodall, G.J., Wiebauer, K. and Filipowicz, W. (1990) Meth. Enzym. 181, plant TBP protein, we have demonstrated that this factor 148-161 . participates in transcription in vivo of both pol II- and pol Ill- 27. Kiss, T. and Solymosy, F. (1990) Nucleic Acids Res. 18, 1941-1949. specific U-snRNA genes of plants (D. Heard, T. K. and W.F., 28. Hood, E.E., Helmer, G.L., Fraley, R.T. and Chilton, W.S. (1986) J. manuscript in preparation). The strict requirement for proper Bacteriol. 168, 1291-1301. 29. Holsters, M. de Waele, D., Dipicker, A., Messens, E., Van Montagu, M. positioning of the USE and TATA elements reported here for and Schell, J. (1978) Mol. Gen. Genet. 163, 181-187. transcription of the U6 gene in transfected protoplasts, suggests 30. Van Haute, E., Joos, H., Maes, S., Warren, G., Van Montagu, M. and that in pol Ill-transcribed U-snRNA genes the protein factors Schell, J. (1983) EMBO J. 2, 411-418. binding to the USE and TATA elements may interact directly 31. Horsch, R.B., Fry, J.E., Hoffman, NX., Neidermyer, J., Rogers, S.G. with each other. Characterization of transcription factor(s) and Fraley, R.T. (1988) In Gelvin, S.B. and Schilperoort, R.A. (eds) Plant Molecular Biology Manual. Kluwer Acad. Publishers, Dordrecht. Section interacting with the USE element will be essential to establish A5, pp 1-9. the details of protein interactions at the promoters of plant U- 32. Blonstein, A.D., Vahala, T., Frechebound Y., and King, P.J. (1988) Mol. snRNA genes and to understand, at the molecular level, what Gen. Genet. 211, 252-259. factors determine the RNA polymerase specificity of the gene. 33. Draper, J., Darey, M.R., and Freeman, J.P. (1988) In Yeoman, M.M. (ed) Plant Cell Culture Technology. Blackwdl Scientific Publications, pp 231- 301. 34. Berland, R. and Chasin, L.A. (1988) Nucleic Acids Res. 16, 11573-11589. 35. Beilmann, A., Pfhzner, A.J.P., Goodman, H.M. and Pfitzner, U.M. (1991) ACKNOWLEDGEMENTS Eur. J. Biochem. 196, 415-421. 36. Felsenfeld, G. (1992) Nature 355, 219-224. We thank Jirina Petruska for assistance in protoplasts 37. Hayes, J.J. and Wolffe, P. (1992) Bioessays 14, 597-603. transfections, all the members of our laboratory for helpful 38. Komberg, R.D. and Lorch, Y. (1992) Ann. Rev. Cell Biol., 8, 563-587. discussions and Drs B.Hohn, J.Paszkowski and H.Rothnie for 39. Buschhausen, B., Wittig, B., Graessmann, M. and Graessmann, A. (1987) critical reading of the manuscript. We also thank Dr R.Luhrmann Proc. Nad. Acad. Sci. USA 84, 1177-1181. 40. Zelcer, A. and Galun, E. (1976) Plant Sci. Lett. 7, 331-336. for anti-m G cap antibodies and Drs M.Czakcj and 41 . Mukherjee, S., Erickson, H. and Bastia, D. (1988) Proc. Natl. Acad. Sci. Z.Koukolikova"-Nicola for the bacterial strains. USA 85, 6287-6291. 42. Griffith, J., Hochschild, A. and Ptashne, M. (1986) Nature 322, 750-752. 43. Wu, 1., and Berk, A. (1988). Genes Dev. 2, 403-411. REFERENCES 44. Lescure, A., Carbon, P. and Krol, A. (1991) Nucleic Acids Res. 19, 435-441 . 1. Reddy, R. andBusch,H. (1988)toBirnstid, M.L.(ed)5in<cn</«WFuncrion 45. Gommer, R.S. and Kunkel, G.R. (1992) Nucleic Acids Res. 20, 4903-4912. of Major and Minor Small Nuclear Ribonucleoprouin Particles. Springer 46. Sharp, P.A. (1992) Cell 68, 819-812. Veriag, Heidelberg, pp 1 -70 . 47. Strubin, M. and Struhl, K. (1992) Cell 68, 721-730. 2. Hernandez, N. (1992) In McKnight, S. and Yamamoto, K.(eds) Transcription Regulation. Cold Spring Harbor Monograph Series. Cold Spring Harbor Laboratory Press. Cold Spring Habor, NY, in press. 3. Goodall, G.J., Kiss, T., and Filipowicz, W. (1991) In Miflin, B.J.(ed.), Oxford Surveys of Plant Molecular and Cell Biology. Oxford Univ. Press, vol 7, pp 255-296. 4. Parry, H.D., Scherly, D., and Mattaj, I.W. (1989) Trends Biochem. Sci. 5, 15-19. 5. Nigg, E.A., Baeuerle, P.A., Luhrmann, R. (1991) Cell 66, 15-22. 6. Kunkel, G.R. (1991) Biochim. Biophys. Acta. 1088, 1-9. 7. Ciliberto, G., Palla, F., Tebb, G., Mattaj, I.W. and Philipson, L. (1987) Nucleic Acids Res. 15, 2403-2416.

Journal

Nucleic Acids ResearchOxford University Press

Published: Apr 11, 1993

There are no references for this article.