Vitamin E and vitamin C supplementation improves antioxidant status and immune function in oxidative-stressed breeder roosters by up-regulating expression of GSH-Px gene

Vitamin E and vitamin C supplementation improves antioxidant status and immune function in... Abstract This study aimed to evaluate the effects of vitamin C and vitamin E on antioxidant capacity and immune function in oxidative-stressed breeder roosters. One hundred twenty 45-week-old Lveyang black-boned breeder roosters were randomly assigned to 5 dietary treatments, including negative control group (NC), positive control group (PC), and 3 trial groups, which were fed the diets containing 300 mg/kg VC, 200 mg/kg VE, or 300 mg/kg VC and 200 mg/kg VE (VC+VE). At 47 wk of age, the positive control and trial groups were subcutaneously injected 3 times every other d with dexamethasone (DEX) 4 mg/kg of body weight, the negative control group was injected with saline. The experiment lasted for 35 d. The results showed that at 50 wk of age, average daily feed intake of birds challenged with DEX significantly increased (P < 0.05). During post-stress recovery period (52 wk of age), dietary supplemental VE or VC+VE notably increased body weight under oxidative stress (P < 0.01). Oxidative stress induced by DEX could significantly decrease superoxide dismutase (SOD), IgM, antibody titer of ND and mRNA expression of SOD or glutathion peroxidase activity (GSH-Px), increase serous malondialdehyde (MDA) (P < 0.05). Supplementation of VC or VE significantly decreased serous MDA, and increased SOD under oxidative stress (P < 0.05). Supplementation of VC or VE, or their combination significantly increased the relative expression of GSH-Px mRNA when compared to the oxidative-stressed control treatment (P < 0.05), whereas did not alleviate the relative expression of SOD mRNA (P > 0.05). Therefore, the results suggest that addition of 300 mg/kg VC, 200 mg/kg VE or their combination could improve antioxidant ability and immune performance in oxidative-stressed breeder roosters through up-regulating the expression of GSH-Px gene. INTRODUCTION Oxidative stress is commonly defined as an imbalance between oxidants and antioxidants at the cellular or individual level. Oxidative damage is one result of such an imbalance and includes oxidative modification of cellular macromolecules, cell death by apoptosis or necrosis, as well as structural tissue damage (Lykkesfeldt and Svendsen, 2007). This process ultimately causes decreased performance, induces various diseases, and can even result in death. Under normal conditions, the reactive oxygen species (ROS) produced are tightly regulated by balancing systems consisting of antioxidants, antioxidant enzymes, and proteins (Maes et al., 2011). Once animals are subjected to stressors such as fasting (Siegel and Gross, 1980), elevated levels of free radicals (in particular ROS) tend to be formed. When the production of ROS exceeds the body's natural antioxidant defense mechanisms, it causes damage to the cell wall, mitochondria, DNA, and functional proteins, which may ultimately result in quality loss in meat (Falowo et al., 2013), down-regulation of immune responses (Stier et al., 2009), and infertility (Ognjanović et al., 2010). Among antioxidant systems, enzymes such as superoxide dismutases (SOD), glutathione peroxidases and catalase, as well as water and lipid-soluble antioxidants such as glutathione, ascorbate (vitamin C), α-tocopherol (vitamin E), ubiquinol, and β-carotene are of particular interest to limit oxidative damage in animals (Therond et al., 2000). Dietary supplements to enhance and maintain performance are routinely used in poultry. Vitamin E is a major chain-breaking lipid antioxidant and free radical scavenger in the membranes of cells and sub-cellular organs (Burton et al., 1983). It is well known that the appropriate addition of vitamin E would help to decrease thiobarbituric acid-reactive substances (TBARS) (Eid et al., 2006; Hatamoto et al., 2006), improve growth performance, tissue peroxidation, and meat stability (Guo et al., 2001), and regulate the immune effects on humoral and cell-mediated immunity (Singh et al., 2006). Cheng et al. (2017) also reported that natural vitamin E was superior to the synthetic form and enhanced α-tocopherol and total antioxidant capacity (T-AOC) levels, reduced malondialdehyde (MDA) concentration in the liver, and alleviated the immune damage of the bursa. L-ascorbic acid (AA) has an important metabolic role as a result of its reducing properties and function as an electron carrier. Vitamin C is also involved in the vitamin E antioxidant system. It re-exerts antioxidant effect of vitamin E by converting oxidized forms of α-tocopherol back to α-tocopherol, meanwhile, dietary supplementation with AA has been shown to enhance immunological responses, improving meat quality (Whitehead and Keller, 2003). Exposure to glucocorticoid is capable of inducing oxidative stress, as reflected in increased plasma TBARS levels resulting from lipid peroxidation broiler chickens (Lin et al., 2006). Dexamethasone (DEX) is a synthetic glucocorticoid that mimics the effects of the natural steroid cortisol (Lalone et al., 2012), which has been widely used to establish the stress model. The objective of the present work was to determine the effects of vitamin E and vitamin C on antioxidant ability, immune performance and antioxidant enzymes mRNA levels in oxidative-stressed breeder roosters. MATERIALS AND METHODS Experiment Design Healthy Lveyang black-bone breeder roosters (n = 120) were selected at 45 wk of age and randomly assigned to 5 treatments consisting of 6 replicates of 4 birds each pen. The positive control (PC, basal diet with DEX) and negative control (NC, basal diet with sham-injected saline) groups were fed a corn soybean meal basal diet (Table 1). The trial groups were fed the basal diet supplemented with 300 mg/kg VC, 200 mg/kg VE, or 300 mg/kg VC and 200 mg/kg VE (VC+VE). At 47 wk of age, the PC and trial groups were abdominal subcutaneous injection 3 times every other d for 1 wk with DEX 4 mg/kg BW (acute stress stage). The NC group was injected with saline. All roosters were given ad libitum access to feed and water. VC (L-ascorbate-2-monophosphate, VC ≥ 35.0%) was obtained from Beijing Enhalor Biotechnology Co., Ltd., Beijing, China. VE (VE ≥ 50%) was obtained from Hebao Biotechnology Co., Ltd., Shaoxing, China. DEX sodium phosphate injection was obtained from Tianjin Pharmaceutical Jiaozuo Co., Ltd., Jiaozuo, China. All birds were handled in accordance with methods approved by the Animal Care and Use Committee of Northwest A&F University, Yangling, China. Table 1. Basal dietary composition and nutrient level. Diet Ingredients  %  Nutrient level  %  Corn  69.15  ME (MJ/kg)  12.00  Soybean meal  15.50  CP  14.00  Wheat bran  8.71  Ca  1.10  Rapeseed meal  0.60  Total P  0.65  CaHPO4  1.45  Available P  0.45  Limestone  1.15  Met  0.35  Salt  0.40  Lys  0.72  Premix1  3.04  Met+Cys  0.74  Total  100.00  Arg  0.30  Diet Ingredients  %  Nutrient level  %  Corn  69.15  ME (MJ/kg)  12.00  Soybean meal  15.50  CP  14.00  Wheat bran  8.71  Ca  1.10  Rapeseed meal  0.60  Total P  0.65  CaHPO4  1.45  Available P  0.45  Limestone  1.15  Met  0.35  Salt  0.40  Lys  0.72  Premix1  3.04  Met+Cys  0.74  Total  100.00  Arg  0.30  1Supplied the following per kilogram of diet: Vitamin A, 15,000 IU; VD3, 5,000 IU; VK3 5 mg; VB1, 3 mg; VB2, 12 mg; nicotinic acid, 15 mg; calcium pantothenate, 60 mg; VB6, 5 mg; biotin 0.20 mg; folic acid, 2 mg; VB12, 0.03 mg; Fe (as ferrous sulfate), 60 mg; Cu (as copper sulfate), 10 mg; Mn (as manganese sulfate), 100 mg; Zn (as zinc sulfate), 100 mg; I (as potassium iodide), 2 mg; and Se (as sodium selenite), 0.40 mg. View Large Sample Collection At 50 and 52 wk of age (d 21 and 35 post DEX treatment), 1 rooster from each replicate was randomly selected. Blood samples were obtained from the wing vein using vacuum blood tubes and subjected to centrifugation at 5,900 × g for 10 min. Serum was collected and stored at −80°C for analysis. Body weight (BW) and average daily feed intake (ADFI) were measured every wk with re plicates. At 50 wk of age, 6 birds from each treatment were euthanized. Livers were removed, cooled in liquid nitrogen, and stored at −80°C for further analysis. The lipid peroxidation product of MDA generated in serum by free radical injury was measured by thiobarbituric acid reactivity using the commercial colorimetric assay kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). Plasma T-AOC, glutathion e peroxidase activity (GSH-Px) and SOD were assessed using an assay kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) according to the manufacturer's recommendations, using a microplate reader. IgA, IgG, and IgM level in serum were measured by enzyme-linked immunosorbent assay using an enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Jianglai Biotechnology Co, Ltd., China). Antibody titer against Newcastle disease virus (NDV) in serum was measured by hemagglutination-inhibition test on d 21 and 35 using 4 hemagglutinin units of the NDV antigen (China Institute of Veterinary Drug Control, Beijing, China). The contents of VC and VE in serum were determined by Microplate Reader with ferric ion reduction method under the action of phenanthroline. Total RNAs from liver were prepared using RNAiso Reagent (TaKaRa, Dalian, China). Total RNA was isolated from these frozen tissues according to the manufacturer's instructions. The concentration of RNA was determined using NanoDrop® ND-1000 (Thermo, Pittsburgh PA). RNA (500 ng) was transcribed into single-stranded cDNA using the PrimerScriptTM RT reagent (TaKaRa, Tokyo, Japan), and used for polymerase chain reaction (PCR) amplification. Quantitative PCR (qPCR) was performed using the SYBR premix ExTaq II (TaKaRa, Tokyo, Japan) and the IQ5 real-time PCR detection system (Bio-Rad, Hercules, CA). The sequences of the primers were listed in Table 2. Table 2. Nucleotide primer sequences of PCR primers of superoxide dismutase and glutathione peroxidase. Gene  Primer (5΄-3΄)  SOD1  F:CAGATAGGCACGTGGGTGAC R:CCCCTCTACCCAGGTCATCA  GSH-Px  F:GCATCCGCTTCCACGACTTCCT R:CCGCTCATCCGGGTCCAACAT  β-actin  F:TCTTGGGTATGGAGTCCTG R:TAGAAGCATTTGCGGTGG  Gene  Primer (5΄-3΄)  SOD1  F:CAGATAGGCACGTGGGTGAC R:CCCCTCTACCCAGGTCATCA  GSH-Px  F:GCATCCGCTTCCACGACTTCCT R:CCGCTCATCCGGGTCCAACAT  β-actin  F:TCTTGGGTATGGAGTCCTG R:TAGAAGCATTTGCGGTGG  View Large Statistical Analysis Data were analyzed by analysis of variance (ANOVA) with procedures appropriate for a completely randomized design using GLM procedure of SAS (SAS Institute Inc., Cary, NC). The significance level was set at P < 0.05. RESULTS Growth Performance As presented in Table 3, at 50 wk of age, the BW of DEX-treated birds was lower (P < 0.05) than that of the NC group. Dietary supplementation of VE or VC+VE increased (P < 0.01) BW of DEX-treated birds at 52 wk of age, while dietary supplementation of VC did not significantly affect BW (P > 0.05). In all DEX-treated groups, BW only declined 4 wk after being treated. At 50 wk of age, there was a significant increase (P < 0.05) in ADFI in birds exposed to DEX. There were no significant differences in ADFI between the DEX-treated groups during the acute stress period (wk 50), or among any groups during the post-stress recovery period (wk 52) (P > 0.05). Table 3. Effects of vitamin C and E alone and in combination on BW and ADFI in 21 and 35 d post treatment with DEX breeder roosters. Item  NC1  PC1  VC1  VE1  VC+VE1  BW (kg)  49 wk  2.44± 0.04  2.44 ± 0.05  2.42 ± 0.02  2.49 ± 0.01  2.51 ± 0.01  50 wk  2.51± 0.01a  2.36 ± 0.02b  2.38 ± 0.04b  2.40 ± 0.03a,b  2.40 ± 0.06a,b  52 wk  2.61± 0.02A  2.42 ± 0.04B  2.40 ± 0.03B  2.56 ± 0.03A  2.63 ± 0.02A  ADFI (g/d)  49 wk  101.29 ± 2.85  107.50 ± 1.86  95.98 ± 1.22  107.23 ± 1.05  107.86 ± 3.40  50 wk  99.06± 2.30b  114.28 ± 3.08a  108.13 ± 4.17a,b  109.07 ± 3.08a  113.96 ± 2.30a  52 wk  120.14 ± 4.13  109.59 ± 4.50  111.93 ± 4.98  123.33 ± 5.08  121.81 ± 4.94  Item  NC1  PC1  VC1  VE1  VC+VE1  BW (kg)  49 wk  2.44± 0.04  2.44 ± 0.05  2.42 ± 0.02  2.49 ± 0.01  2.51 ± 0.01  50 wk  2.51± 0.01a  2.36 ± 0.02b  2.38 ± 0.04b  2.40 ± 0.03a,b  2.40 ± 0.06a,b  52 wk  2.61± 0.02A  2.42 ± 0.04B  2.40 ± 0.03B  2.56 ± 0.03A  2.63 ± 0.02A  ADFI (g/d)  49 wk  101.29 ± 2.85  107.50 ± 1.86  95.98 ± 1.22  107.23 ± 1.05  107.86 ± 3.40  50 wk  99.06± 2.30b  114.28 ± 3.08a  108.13 ± 4.17a,b  109.07 ± 3.08a  113.96 ± 2.30a  52 wk  120.14 ± 4.13  109.59 ± 4.50  111.93 ± 4.98  123.33 ± 5.08  121.81 ± 4.94  Values with different lowercase superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large Antioxidant Capability To determine the effects of experimental diet on antioxidant level of birds, we measured the MDA and several antioxidant enzymes in serum on different phase (Table 4). At 50 wk, there was no significant difference in MDA, T-AOC, GSH-Px, and SOD among 5 treatments (P > 0.05). Table 4. Effects of vitamin C and vitamin E on antioxidant capability of serum in 21 and 35 d post treatment with DEX roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  MDA (nmol/mL)             50 wk  1.74 ± 0.14  2.59 ± 0.23  2.66 ± 0.19  2.43 ± 0.13  2.46 ± 0.39   52 wk  2.90 ± 0.17b  3.50 ± 0.16a  2.92 ± 0.17a,b  2.25 ± 0.21b  2.24 ± 0.26c  T-AOC (U/mL)             50 wk  9.08 ± 1.13  8.10 ± 0.26  10.00 ± 0.92  9.27 ± 0.13  10.48 ± 0.50   52 wk  9.40 ± 0.26  8.02 ± 0.46  8.73 ± 0.66  8.31 ± 0.41  10.00 ± 0.74  GSH-Px (U/mL)             50 wk  3384.71 ± 160.48  2828.82 ± 166.43  3157.06 ± 175.33  3433.24 ± 154.02  2993.82 ± 196.88   52 wk  2352.03 ± 264.95  2402.62 ± 59.53  2441.86 ± 110.28  2633.72 ± 288.12  2529.94 ± 229.38  SOD (U/ mL)             50 wk  417.43 ± 16.23  385.63 ± 12.07  425.50 ± 9.90  432.02 ± 13.91  432.48 ± 15.95   52 wk  311.72 ± 27.16b  301.70 ± 12.76c  353.07 ± 28.01b,c  345.36 ± 11.88b,c  419.09 ± 22.10a  Items  NC1  PC1  VC1  VE1  VC+VE1  MDA (nmol/mL)             50 wk  1.74 ± 0.14  2.59 ± 0.23  2.66 ± 0.19  2.43 ± 0.13  2.46 ± 0.39   52 wk  2.90 ± 0.17b  3.50 ± 0.16a  2.92 ± 0.17a,b  2.25 ± 0.21b  2.24 ± 0.26c  T-AOC (U/mL)             50 wk  9.08 ± 1.13  8.10 ± 0.26  10.00 ± 0.92  9.27 ± 0.13  10.48 ± 0.50   52 wk  9.40 ± 0.26  8.02 ± 0.46  8.73 ± 0.66  8.31 ± 0.41  10.00 ± 0.74  GSH-Px (U/mL)             50 wk  3384.71 ± 160.48  2828.82 ± 166.43  3157.06 ± 175.33  3433.24 ± 154.02  2993.82 ± 196.88   52 wk  2352.03 ± 264.95  2402.62 ± 59.53  2441.86 ± 110.28  2633.72 ± 288.12  2529.94 ± 229.38  SOD (U/ mL)             50 wk  417.43 ± 16.23  385.63 ± 12.07  425.50 ± 9.90  432.02 ± 13.91  432.48 ± 15.95   52 wk  311.72 ± 27.16b  301.70 ± 12.76c  353.07 ± 28.01b,c  345.36 ± 11.88b,c  419.09 ± 22.10a  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large At 52 wk, when DEX injection was accompanied by supplemental VC and VE, a significant decrease in serum MDA occurred compared to the positive control (P < 0.05). It is interesting that they were even under the values recorded for negative control birds significantly. Meanwhile, A significant increase also took place in serum SOD when VC and VE were incorporated in the diet of DEX-injected breeder roosters (P < 0.05). Immune Responses The results obtained from the preliminary analysis of immune globulins and NDV of serum are presented in Table 5. At 50 wk, there was no significant difference in IgA, IgG, IgM, and antibody titer of ND among 5 treatments (P > 0.05). At 52 wk, when DEX injection significantly decreased IgM and antibody titer of ND, supplementation VE or VC and VE combination significantly improve antibody titer of ND (log2) (P < 0.05). Table 5. Effects of vitamin C and vitamin E on immune globulins and antibody titer against Newcastle disease virus of serum in 21 and 35 d post treatment with DEX roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  IgA (μg/mL)             50 wk  3.64 ± 0.27  2.92 ± 0.14  3.28 ± 0.08  3.20 ± 0.18  3.32 ± 0.22   52 wk  4.03 ± 0.21  3.48 ± 0.26  3.49 ± 0.18  3.44 ± 0.08  3.51 ± 0.26  IgG (μg/mL)             50 wk  143.38 ± 3.99  138.42 ± 3.16  138.76 ± 1.27  139.76 ± 5.79  140.21 ± 2.72   52 wk  126.96 ± 9.42  132.13 ± 3.23  136.29 ± 1.87  132.18 ± 3.14  133.07 ± 4.72  IgM (μg/mL)             50 wk  35.68 ± 0.90  34.73 ± 0.93  34.79 ± 1.93  34.71 ± 0.72  35.34 ± 1.13   52 wk  40.30 ± 1.80a  35.27 ± 0.74b  34.70 ± 1.06b  36.60 ± 0.47b  37.83 ± 0.27a  Antibody titer of ND (log2)             50 wk  10.75 ± 0.25  9.75 ± 0.25  10.50 ± 0.29  10.50 ± 0.50  10.50 ± 0.29   52 wk  10.75 ± 0.48b  10.25 ± 0.25b  10.25 ± 0.75b  11.75 ± 0.25a  11.00 ± 0.41a  Items  NC1  PC1  VC1  VE1  VC+VE1  IgA (μg/mL)             50 wk  3.64 ± 0.27  2.92 ± 0.14  3.28 ± 0.08  3.20 ± 0.18  3.32 ± 0.22   52 wk  4.03 ± 0.21  3.48 ± 0.26  3.49 ± 0.18  3.44 ± 0.08  3.51 ± 0.26  IgG (μg/mL)             50 wk  143.38 ± 3.99  138.42 ± 3.16  138.76 ± 1.27  139.76 ± 5.79  140.21 ± 2.72   52 wk  126.96 ± 9.42  132.13 ± 3.23  136.29 ± 1.87  132.18 ± 3.14  133.07 ± 4.72  IgM (μg/mL)             50 wk  35.68 ± 0.90  34.73 ± 0.93  34.79 ± 1.93  34.71 ± 0.72  35.34 ± 1.13   52 wk  40.30 ± 1.80a  35.27 ± 0.74b  34.70 ± 1.06b  36.60 ± 0.47b  37.83 ± 0.27a  Antibody titer of ND (log2)             50 wk  10.75 ± 0.25  9.75 ± 0.25  10.50 ± 0.29  10.50 ± 0.50  10.50 ± 0.29   52 wk  10.75 ± 0.48b  10.25 ± 0.25b  10.25 ± 0.75b  11.75 ± 0.25a  11.00 ± 0.41a  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large At 50 wk, the IgA, IgG, and IgM level in treatment PC tended to be lower than group NC (P > 0.05). At 52 wk, IgM in the serum of oxidative stressed roosters from groups PC, VC, and VE were significantly lower than in the negative control group (P < 0.05), although the IgM in group VC+VE was lower, but no significant differences were found between them. Compared to negative control treatment or positive control treatment, the antibody titer against NDV in the birds fed diet with 200 mg/kg VE, or 300 mg/kg VC and 200 mg/kg VE was significantly increased (P < 0.05), while supplementation of 300 mg/kg VC had no significant effect on the antibody titer against NDV (P > 0.05) . Levels of Serous VC and VE As presented in Table 6, VC had no significant effects on serous VC contents. However, birds supplemented with dietary VE or their combination showed significantly higher serous VE level than the other 3 groups (P < 0.01). Table 6. Effects of vitamin C and vitamin E on the levels of serous VC and VE in 21 and 35 d post treatment with DEX roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  VC (μg/ mL)             50 wk  36.93 ± 3.68  33.69 ± 4.14  44.88 ± 4.27  39.09 ± 1.38  45.87 ± 1.30   52 wk  43.57 ± 2.10  43.49 ± 1.75  49.29 ± 3.79  42.15 ± 3.62  47.12 ± 5.46  VE (μg/ mL)             50 wk  1.74 ± 0.05B  1.72 ± 0.33B  2.01 ± 0.24B  3.48 ± 0.29A  4.03 ± 0.26A   52 wk  1.12 ± 0.13B  1.27 ± 0.16B  1.28 ± 0.17B  2.38 ± 0.08A  2.83 ± 0.40A  Items  NC1  PC1  VC1  VE1  VC+VE1  VC (μg/ mL)             50 wk  36.93 ± 3.68  33.69 ± 4.14  44.88 ± 4.27  39.09 ± 1.38  45.87 ± 1.30   52 wk  43.57 ± 2.10  43.49 ± 1.75  49.29 ± 3.79  42.15 ± 3.62  47.12 ± 5.46  VE (μg/ mL)             50 wk  1.74 ± 0.05B  1.72 ± 0.33B  2.01 ± 0.24B  3.48 ± 0.29A  4.03 ± 0.26A   52 wk  1.12 ± 0.13B  1.27 ± 0.16B  1.28 ± 0.17B  2.38 ± 0.08A  2.83 ± 0.40A  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large mRNA Expressions As shown in in Table 7, there was a decline in mRNA expression of SOD when the birds were exposed to DEX (P < 0.05). However, supplementation of VC, VE, or their combination had no remarkable alleviation effect on mRNA expression of SOD compared with that in the oxidative-stressed control treatment. According to our results, mRNA expression of GSH-Px in treatment PC was lower when compared with group NC (P < 0.05), supplementation of VC or VE, or their combination significantly increased the relative expression of GSH-Px mRNA when compared to the oxidative-stressed control treatment (P < 0.05). Table 7. Effects of vitamin C and vitamin E on mRNA expression of SOD and GSH-Px in oxidative stressed roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  SOD  0.960 ± 0.250a  0.470 ± 0.120b  0.420 ± 0.030b  0.40 ± 0.040b  0.50 ± 0.140b  GSH-Px  0.015 ± 0.001a,b  0.001 ± 0.001c  0.008 ± 0.001b  0.028 ± 0.009a  0.022 ± 0.002a  Items  NC1  PC1  VC1  VE1  VC+VE1  SOD  0.960 ± 0.250a  0.470 ± 0.120b  0.420 ± 0.030b  0.40 ± 0.040b  0.50 ± 0.140b  GSH-Px  0.015 ± 0.001a,b  0.001 ± 0.001c  0.008 ± 0.001b  0.028 ± 0.009a  0.022 ± 0.002a  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large DISCUSSION This study indicated that despite increased feed intake compared to the NC group, BW declined when roosters were challenged with DEX. It may be due to glucocorticoids improving energy consumption and the redistribution of energy toward lipid deposition (Yuan et al., 2008). Furthermore, 200 mg/kg VE suppressed BW loss in breeder roosters under oxidative stress, which agrees with Gao et al. (2010), who reported that higher level of VE supplementation improved BW in broilers exposed to DEX. Prior studies have noted that glucocorticoids can increase oxidative stress and cause different levels of oxidative stress among tissues and body fluid (Eid et al., 2006; Virden et al., 2007; Costantini et al., 2011). In the present study, a significant increase took place in serum SOD, and the MDA was significantly suppressed when VC and VE were incorporated in the diet of DEX-injected cocks, which is consistent with Cheng et al. (2017). SOD is one family of antioxidant enzymes, function to remove damaging ROS from the cellular environment by catalyzing the dismutation of 2 superoxide radicals to hydrogen peroxide and oxygen (Fattman et al., 2003). Ascorbic acid has been shown to scavenge superoxide, hydroxyl and peroxyl radicals efficiently. VE reacts with lipid peroxyl radicals at high rates and interrupts the radical chain, thereby preventing further lipid peroxidation (LPO) (Wefers and Sies, 1988). Interactive effects between vitamins C and E in preventing lipid peroxidation have been investigated (Niki et al., 1982). VC has an interaction with VE, by regenerating active VE from its oxidized forms. Co-administration of ascorbic acid and α-tocopherol to arsenic-exposed rats resulted in a reduction in the levels of lipid peroxidation, protein carbonyls, and hydrogen peroxide and an elevation in the levels of reduced glutathione, ascorbic acid and α-tocopherol (Ramanathan et al., 2002; 2003). That is why combined supplementation of VC and VE was sometimes superior to its single function in our present study. Previous studies showed that a variety of stressors affect defense mechanisms of animals, usually leading to a down-regulation of immune responses (Huff et al., 1999; El-Lethey et al., 2003; Stier et al., 2009; Huff et al., 2013). The result of the present study found that the immune response of roosters received DEX treatment showed the descent tendency. DEX could selectively inhibited serous immune globulins. For example, in cattle, serum concentrations of IgM, but not IgA or IgG, were suppressed by DEX treatment (Anderson et al., 1999); DEX administered orally inhibited IgE and IgA but did not influence IgG or IgM levels in mice (Puignero et al., 1995). However, the effect of oxidative stress on immune performance in serum is controversial. It has been demonstrated in mammals under stressare able to selectively suppress only certain parts of the immune system. There is much evidence that vitamins could enhance immune ability. VE could improve antibody levels to sheep red blood cells (SRBC) in birds (Leshchinsky and Klasing, 2001), and promote IgG and IgM production in serum (Niu et al., 2009). Under conditions of heat stress, dietary supplementation with VC has been shown to enhance immunological responses (Whitehead and Keller, 2003). Dietary tocopherols appear to be similarly absorbed along with dietary fat and are secreted in chylomicron particles. The chylomicron-bound vitamin E forms are transported via the lymphatic system to the peripheral tissues, including muscle, bone marrow, adipose tissue, skin, and possibly brain (Jiang, 2014). So appropriate dietary supplementation of VE could increase the vitamin E levels of plasma and muscle tissues (Nam et al., 2003) liver, and heart (Hidiroglou et al., 2004) in animals, which is in agreement with our study. Modulation of transcriptional factor activity such as activator protein-1 (AP-1) and nuclear factor-κB (NF-κB) is related to vitamin E antioxidant potency. Furthermore, AP-1 and NF-κB DNA binding sites have been located to regulatory regions of inflammatory genes such as adhesive molecules, cytokines, and antioxidant enzyme (AOE). Thus, it could be postulated that vitamin E could modulate AOE expression and activity by altering the cell redox status (Maggi-Capeyron et al., 2002). In our study, oxidative stress induced by DEX down-regulated mRNA expression of SOD or GSH-Px, birds supplemented with VE or VE+VC improved antioxidant capability and immune function through up-regulating the relative expression of GSH-Px mRNA under oxidative stress. Administration of vitamin E to hypothyroid rats resulted in elevated CAT mRNA level (Jena et al., 2012). VE treatments resulted in significant increases of Cu/Zn SOD and catalase mRNA levels of human umbilical vein endothelial cell (Nakamura and Omaye, 2008). These findings indicate that VE may play a role not only in preventing against oxidative damage as an exogenous antioxidant by scavenging free radicals and superoxide but also in modulating the expression of the endogenous antioxidant enzymes as a gene regulator. The results of present study indicated that to some extent dietary supplementation of VC, VE, or their combination relieve the adverse effects of oxidative stress in breeder roosters, also which is possibly related to the strength, sustained time when birds exposed to stress. Therefore, further studies are need on the relationship between the strength or sustained time of stress and the efficacy of antioxidants supplementation. Our findings also indicated that oxidative stress could affect antioxidant enzyme-related genes expression, and supplementation of the antioxidants could regulate some antioxidant enzyme-related gene. Although these results are useful to understand the molecular mechanism involved in birds subjected to stress, the information provided by current research is limited. In future, further studies are needed on the related molecular mechanism when birds exposed to oxidative stress: 1) genome-wide gene differentially expression of breeder roosters in response to oxidative stress or supplementation of the antioxidants using RNA-seq technique; 2) proteomic analysis of differentially expressed proteins of breeder roosters in response to oxidative stress or supplementation of the antioxidants; 3) differential expression of microRNAs of breeder roosters in response to oxidative stress or supplementation of the antioxidants. CONCLUSION In summary, the results suggest that oxidative stress could cause oxidative damage, and decline antioxidant capability and immune response of breeder roosters. Dietary supplementation of VC (300 mg/kg), VE (200 mg/kg) or their combination could eliminate the negative impact. Oxidative stress induced by DEX down-regulated mRNA expression of SOD or GSH-Px, however, antioxidant capability and immune function was improved when birds supplemented with VE or VE+VC through up-regulating the relative expression of GSH-Px mRNA under oxidative stress. Acknowledgements This research was supported by China Agriculture Research System (CARS-40-S20) and Shaanxi Province Agriculture Projects (2015NY175). REFERENCES Anderson B. H., Watson D. L., Colditz I. G.. 1999. The effect of dexamethasone on some immunological parameters in cattle. Vet. Res. Commun.  23: 399– 413. Burton G. W., Joyce A., Ingold K. U.. 1983. Is vitamin E the only lipid-soluble, chain-breaking antioxidant in human blood plasma and erythrocyte membranes? Arch. Biochem. Biophys.  221: 281– 290. Google Scholar CrossRef Search ADS PubMed  Cheng K., Zheng X. C., Zhang H., Zhang J. F., Zhang L. L., Zhang L. L., Zhou Y. M., Wang T.. 2017. Effects of dietary vitamin E type on the growth performance and antioxidant capacity in cyclophosphamide immunosuppressed broilers. Poult. Sci.  96:1159–1166. Costantini D., Marasco V., Møller A.. 2011. A meta-analysis of glucocorticoids as modulators of oxidative stress in vertebrates. J. Comp. Physiol. B.  181: 447– 456. Google Scholar PubMed  Eid Y., Ebeid T., Younis H.. 2006. Vitamin E supplementation reduces dexamethasone-induced oxidative stress in chicken semen. Br. Poult. Sci.  47: 350– 356. Google Scholar CrossRef Search ADS PubMed  El-Lethey H., Huber-Eicher B., Jungi T. W.. 2003. Exploration of stress-induced immunosuppression in chickens reveals both stress-resistant and stress-susceptible antigen responses. Vet. Immunol. Immunopathol.  95: 91– 101. Google Scholar CrossRef Search ADS PubMed  Falowo A. B., Fayemi P. O., Muchenje V.. 2013. Natural antioxidants against lipid–protein oxidative deterioration in meat and meat products: A review. Food Res. Int.  64: 171– 181. Google Scholar CrossRef Search ADS   Fattman C. L., Schaefer L. M., Oury T. D.. 2003. Extracellular superoxide dismutase in biology and medicine. Free Radical Bio. Med.  35: 236– 256. Google Scholar CrossRef Search ADS   Guo Y., Tang Q., Yuan J., Jiang Z.. 2001. Effects of supplementation with vitamin E on the performance and the tissue peroxidation of broiler chicks and the stability of thigh meat against oxidative deterioration. Anim. Feed Sci. Tech.  89: 165– 173. Google Scholar CrossRef Search ADS   Gao J., Lin H., Wang X. J., Song Z. G., Jiao H. C.. 2010. Vitamin E supplementation alleviates the oxidative stress induced by dexamethasone treatment and improves meat quality in broiler chickens. Poult. Sci.  89: 318– 327. Google Scholar CrossRef Search ADS PubMed  Hatamoto L. K., Sobrinho C. A. B., Nichi M., Barnabe V. H., Barnabe R. C., Cortada C. N. M.. 2006. Effects of dexamethasone treatment (to mimic stress) and Vitamin E oral supplementation on the spermiogram and on seminal plasma spontaneous lipid peroxidation and antioxidant enzyme activities in dogs. Theriogenology . 66: 1610– 1614. Google Scholar CrossRef Search ADS PubMed  Hidiroglou N., Gilani G. S., Long L., Zhao X., Madere R., Cockell K., Belonge B., Ratnayake W. M. N., Peace R.. 2004. The influence of dietary vitamin E, fat, and methionine on blood cholesterol profile, homocysteine levels, and oxidizability of low density lipoprotein in the gerbil. J. Nutr. Biochem.  15: 730– 740. Google Scholar CrossRef Search ADS PubMed  Huff G. R., Huff W. E., Balog J. M., Rath N. C.. 1999. Sex differences in the resistance of turkeys to Escherichia coli challenge after immunosuppression with dexamethasone. Poult. Sci.  78: 38– 44. Google Scholar CrossRef Search ADS PubMed  Huff G. R., Huff W. E., Rath N. C.. 2013. Dexamethasone immunosuppression resulting in turkey clostridial dermatitis: a retrospective analysis of 7 studies, 1998–2009. Avian Dis.  57: 730– 736 Google Scholar CrossRef Search ADS PubMed  Jena S., Chainy G. B. N., Dandapat J.. 2012. Expression of antioxidant genes in renal cortex of PTU-induced hypothyroid rats: effect of vitamin E and curcumin. Mol. Biol. Rep.  39: 1193– 1203. Google Scholar CrossRef Search ADS PubMed  Jiang Q. 2014. Natural forms of vitamin E: metabolism, antioxidant, and anti-inflammatory activities and their role in disease prevention and therapy. Free Radical Biol. Med.  72: 76– 90. Google Scholar CrossRef Search ADS   LaLone C. A., Villeneuve D. L., Olmstead A. W., Medlock E. K., Kahl M. D., Jensen K. M., Durhan E. J., Makynen E. A., Blanksma C. A., Cavallin J. E., Thomas L. M., m. Seidl S., Skolness S. Y., Wehmas L. C., Johnson R. D., Ankley G. T.. 2012. Effects of a glucocorticoid receptor agonist, dexamethasone, on fathead minnow reproduction, growth, and development. Environ. Toxicol. Chem.  31: 611– 622. Google Scholar CrossRef Search ADS PubMed  Leshchinsky T. V., Klasing K. C.. 2001. Relationship between the level of dietary vitamin E and the immune response of broiler chickens. Poult. Sci.  80: 1590– 1599. Google Scholar CrossRef Search ADS PubMed  Lin H., Sui S. J., Jiao H. C., Buyse J., Decuypere E.. 2006. Impaired development of broiler chickens by stress mimicked by corticosterone exposure. Comp. Biochem. Physiol. Pt A Mol. Integr. Physiol.  143: 400– 405. Google Scholar CrossRef Search ADS   Lykkesfeldt J., Svendsen O.. 2007. Oxidants and antioxidants in disease: Oxidative stress in farm animals. J. Vet.  173: 502– 511. Google Scholar CrossRef Search ADS   Maes M., Galecki P., Chang Y. S., Berk M.. 2011. A review on the oxidative and nitrosative stress (O&NS) pathways in major depression and their possible contribution to the (neuro)degenerative processes in that illness. Prog. Neuro-Psychopharmacol. Biol. Psychiatry.  35: 676– 692. Google Scholar CrossRef Search ADS   Maggi-Capeyron M., Cases J., Badia E., Cristol J., Rouanet J., Besançon P., Leger C. L., Descomps B.. 2002. A diet high in cholesterol and deficient in vitamin E induces lipid peroxidation but does not enhance antioxidant enzyme expression in rat liver. J. Nutr. Biochem.  13: 296– 301. Google Scholar CrossRef Search ADS PubMed  Nakamura Y. K., Omaye S. T.. 2008. α-Tocopherol modulates human umbilical vein endothelial cell expression of Cu/Zn superoxide dismutase and catalase and lipid peroxidation. Nutr. Res.  28: 671– 680. Google Scholar CrossRef Search ADS PubMed  Nam K. C., Min B. R., Yan H., Lee E. J., Mendonca A., Wesley I., Ahn D. U.. 2003. Effect of dietary vitamin E and irradiation on lipid oxidation, color, and volatiles of fresh and previously frozen turkey breast patties. Meat Sci . 65: 513– 521. Google Scholar CrossRef Search ADS PubMed  Niki K., Namiki H., Kikuyama S., Yoshizato K. 1982. Epidermal tissue requirement for tadpole tail regression induced by thyroid hormone. Dev. Biol.  94: 116– 120. Google Scholar CrossRef Search ADS PubMed  Niu Z. Y., Liu F. Z., Yan Q. L., Li W. C.. 2009. Effects of different levels of vitamin E on growth performance and immune responses of broilers under heat stress. Poult. Sci.  88: 2101– 2107. Google Scholar CrossRef Search ADS PubMed  Ognjanović B. I., Marković S. D, Đorđević N. Z., Trbojević I. S., Štajn A. Š., Saičić Z. S. 2010. Cadmium-induced lipid peroxidation and changes in antioxidant defense system in the rat testes: Protective role of coenzyme Q10 and Vitamin E. Reprod. Toxicol . 29: 191– 197. Google Scholar CrossRef Search ADS PubMed  Puignero V., Salgado J., Queralt J.. 1995. Effects of cyclosporine and dexamethasone on IgE antibody response in mice, and on passive cutaneous anaphylaxis in the rat. Int. Arch. Allergy Immunol.  108: 142– 147. Google Scholar CrossRef Search ADS PubMed  Ramanathan K., Balakumar B. S., Panneerselvam C.. 2002. Effects of ascorbic acid and α-tocopherol on arsenic-induced oxidative stress. Hum. Exp. Toxicol.  21: 675– 680. Google Scholar CrossRef Search ADS PubMed  Ramanathan K., Shila S., Kumaran S., Panneerselvam C.. 2003. Protective role of ascorbic acid and α-tocopherol on arsenic-induced microsomal dysfunctions. Hum. Exp. Toxicol.  22: 129– 136. Google Scholar CrossRef Search ADS PubMed  Siegel P. B., Gross W. B.. 1980. Production and persistence of antibodies in chickens to sheep erythrocytes.1. directional selection. Poult. Sci.  59: 1– 5. Google Scholar CrossRef Search ADS   Singh H., Sodhi S., Kaur R.. 2006. Effects of dietary supplements of selenium, vitamin E or combinations of the two on antibody responses of broilers. Br. Poult. Sci.  47: 714– 719. Google Scholar CrossRef Search ADS PubMed  Stier K. S., Almasi B., Gasparini J., Piault R., Roulin A., Jenni L.. 2009. Effects of corticosterone on innate and humoral immune functions and oxidative stress in barn owl nestlings. J. Exp. Biol.  212: 2085– 2091. Google Scholar CrossRef Search ADS PubMed  Therond P., Bonnefont-Rousselot D., Davit-Spraul A., Conti M., Legrand A. 2000. Biomarkers of oxidative stress: an analytical approach. Curr. Opin. Clin. Nutr. Metab. Care.  3: 373– 384. Google Scholar CrossRef Search ADS PubMed  Virden W. S., Thaxton J. P., Corzo A., Dozier W. A., Kidd M. T.. 2007. Evaluation of models using corticosterone and adrenocorticotropin to induce conditions mimicking physiological stress in commercial broilers. Poult. Sci.  86: 2485– 2491. Google Scholar CrossRef Search ADS PubMed  Wefers H., Sies H.. 1988. The protection by ascorbate and glutathione against microsomal lipid peroxidation is dependent on vitamin E. Eur. J. Biochem.  174: 353– 357. Google Scholar CrossRef Search ADS PubMed  Whitehead C. C, Keller T.. 2003. An update on ascorbic acid in poultry. World's Poult. Sci. J.  59: 161– 184. Google Scholar CrossRef Search ADS   Yuan L., Jiang K. J., Lin H., Jiao H. C.. 2008. Corticosterone administration and high-energy feed results in enhanced fat accumulation and insulin resistance in broiler chickens. Br. Poult. Sci.  49: 487– 495. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

Vitamin E and vitamin C supplementation improves antioxidant status and immune function in oxidative-stressed breeder roosters by up-regulating expression of GSH-Px gene

Loading next page...
 
/lp/ou_press/vitamin-e-and-vitamin-c-supplementation-improves-antioxidant-status-I4kKsz8guY
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pex417
Publisher site
See Article on Publisher Site

Abstract

Abstract This study aimed to evaluate the effects of vitamin C and vitamin E on antioxidant capacity and immune function in oxidative-stressed breeder roosters. One hundred twenty 45-week-old Lveyang black-boned breeder roosters were randomly assigned to 5 dietary treatments, including negative control group (NC), positive control group (PC), and 3 trial groups, which were fed the diets containing 300 mg/kg VC, 200 mg/kg VE, or 300 mg/kg VC and 200 mg/kg VE (VC+VE). At 47 wk of age, the positive control and trial groups were subcutaneously injected 3 times every other d with dexamethasone (DEX) 4 mg/kg of body weight, the negative control group was injected with saline. The experiment lasted for 35 d. The results showed that at 50 wk of age, average daily feed intake of birds challenged with DEX significantly increased (P < 0.05). During post-stress recovery period (52 wk of age), dietary supplemental VE or VC+VE notably increased body weight under oxidative stress (P < 0.01). Oxidative stress induced by DEX could significantly decrease superoxide dismutase (SOD), IgM, antibody titer of ND and mRNA expression of SOD or glutathion peroxidase activity (GSH-Px), increase serous malondialdehyde (MDA) (P < 0.05). Supplementation of VC or VE significantly decreased serous MDA, and increased SOD under oxidative stress (P < 0.05). Supplementation of VC or VE, or their combination significantly increased the relative expression of GSH-Px mRNA when compared to the oxidative-stressed control treatment (P < 0.05), whereas did not alleviate the relative expression of SOD mRNA (P > 0.05). Therefore, the results suggest that addition of 300 mg/kg VC, 200 mg/kg VE or their combination could improve antioxidant ability and immune performance in oxidative-stressed breeder roosters through up-regulating the expression of GSH-Px gene. INTRODUCTION Oxidative stress is commonly defined as an imbalance between oxidants and antioxidants at the cellular or individual level. Oxidative damage is one result of such an imbalance and includes oxidative modification of cellular macromolecules, cell death by apoptosis or necrosis, as well as structural tissue damage (Lykkesfeldt and Svendsen, 2007). This process ultimately causes decreased performance, induces various diseases, and can even result in death. Under normal conditions, the reactive oxygen species (ROS) produced are tightly regulated by balancing systems consisting of antioxidants, antioxidant enzymes, and proteins (Maes et al., 2011). Once animals are subjected to stressors such as fasting (Siegel and Gross, 1980), elevated levels of free radicals (in particular ROS) tend to be formed. When the production of ROS exceeds the body's natural antioxidant defense mechanisms, it causes damage to the cell wall, mitochondria, DNA, and functional proteins, which may ultimately result in quality loss in meat (Falowo et al., 2013), down-regulation of immune responses (Stier et al., 2009), and infertility (Ognjanović et al., 2010). Among antioxidant systems, enzymes such as superoxide dismutases (SOD), glutathione peroxidases and catalase, as well as water and lipid-soluble antioxidants such as glutathione, ascorbate (vitamin C), α-tocopherol (vitamin E), ubiquinol, and β-carotene are of particular interest to limit oxidative damage in animals (Therond et al., 2000). Dietary supplements to enhance and maintain performance are routinely used in poultry. Vitamin E is a major chain-breaking lipid antioxidant and free radical scavenger in the membranes of cells and sub-cellular organs (Burton et al., 1983). It is well known that the appropriate addition of vitamin E would help to decrease thiobarbituric acid-reactive substances (TBARS) (Eid et al., 2006; Hatamoto et al., 2006), improve growth performance, tissue peroxidation, and meat stability (Guo et al., 2001), and regulate the immune effects on humoral and cell-mediated immunity (Singh et al., 2006). Cheng et al. (2017) also reported that natural vitamin E was superior to the synthetic form and enhanced α-tocopherol and total antioxidant capacity (T-AOC) levels, reduced malondialdehyde (MDA) concentration in the liver, and alleviated the immune damage of the bursa. L-ascorbic acid (AA) has an important metabolic role as a result of its reducing properties and function as an electron carrier. Vitamin C is also involved in the vitamin E antioxidant system. It re-exerts antioxidant effect of vitamin E by converting oxidized forms of α-tocopherol back to α-tocopherol, meanwhile, dietary supplementation with AA has been shown to enhance immunological responses, improving meat quality (Whitehead and Keller, 2003). Exposure to glucocorticoid is capable of inducing oxidative stress, as reflected in increased plasma TBARS levels resulting from lipid peroxidation broiler chickens (Lin et al., 2006). Dexamethasone (DEX) is a synthetic glucocorticoid that mimics the effects of the natural steroid cortisol (Lalone et al., 2012), which has been widely used to establish the stress model. The objective of the present work was to determine the effects of vitamin E and vitamin C on antioxidant ability, immune performance and antioxidant enzymes mRNA levels in oxidative-stressed breeder roosters. MATERIALS AND METHODS Experiment Design Healthy Lveyang black-bone breeder roosters (n = 120) were selected at 45 wk of age and randomly assigned to 5 treatments consisting of 6 replicates of 4 birds each pen. The positive control (PC, basal diet with DEX) and negative control (NC, basal diet with sham-injected saline) groups were fed a corn soybean meal basal diet (Table 1). The trial groups were fed the basal diet supplemented with 300 mg/kg VC, 200 mg/kg VE, or 300 mg/kg VC and 200 mg/kg VE (VC+VE). At 47 wk of age, the PC and trial groups were abdominal subcutaneous injection 3 times every other d for 1 wk with DEX 4 mg/kg BW (acute stress stage). The NC group was injected with saline. All roosters were given ad libitum access to feed and water. VC (L-ascorbate-2-monophosphate, VC ≥ 35.0%) was obtained from Beijing Enhalor Biotechnology Co., Ltd., Beijing, China. VE (VE ≥ 50%) was obtained from Hebao Biotechnology Co., Ltd., Shaoxing, China. DEX sodium phosphate injection was obtained from Tianjin Pharmaceutical Jiaozuo Co., Ltd., Jiaozuo, China. All birds were handled in accordance with methods approved by the Animal Care and Use Committee of Northwest A&F University, Yangling, China. Table 1. Basal dietary composition and nutrient level. Diet Ingredients  %  Nutrient level  %  Corn  69.15  ME (MJ/kg)  12.00  Soybean meal  15.50  CP  14.00  Wheat bran  8.71  Ca  1.10  Rapeseed meal  0.60  Total P  0.65  CaHPO4  1.45  Available P  0.45  Limestone  1.15  Met  0.35  Salt  0.40  Lys  0.72  Premix1  3.04  Met+Cys  0.74  Total  100.00  Arg  0.30  Diet Ingredients  %  Nutrient level  %  Corn  69.15  ME (MJ/kg)  12.00  Soybean meal  15.50  CP  14.00  Wheat bran  8.71  Ca  1.10  Rapeseed meal  0.60  Total P  0.65  CaHPO4  1.45  Available P  0.45  Limestone  1.15  Met  0.35  Salt  0.40  Lys  0.72  Premix1  3.04  Met+Cys  0.74  Total  100.00  Arg  0.30  1Supplied the following per kilogram of diet: Vitamin A, 15,000 IU; VD3, 5,000 IU; VK3 5 mg; VB1, 3 mg; VB2, 12 mg; nicotinic acid, 15 mg; calcium pantothenate, 60 mg; VB6, 5 mg; biotin 0.20 mg; folic acid, 2 mg; VB12, 0.03 mg; Fe (as ferrous sulfate), 60 mg; Cu (as copper sulfate), 10 mg; Mn (as manganese sulfate), 100 mg; Zn (as zinc sulfate), 100 mg; I (as potassium iodide), 2 mg; and Se (as sodium selenite), 0.40 mg. View Large Sample Collection At 50 and 52 wk of age (d 21 and 35 post DEX treatment), 1 rooster from each replicate was randomly selected. Blood samples were obtained from the wing vein using vacuum blood tubes and subjected to centrifugation at 5,900 × g for 10 min. Serum was collected and stored at −80°C for analysis. Body weight (BW) and average daily feed intake (ADFI) were measured every wk with re plicates. At 50 wk of age, 6 birds from each treatment were euthanized. Livers were removed, cooled in liquid nitrogen, and stored at −80°C for further analysis. The lipid peroxidation product of MDA generated in serum by free radical injury was measured by thiobarbituric acid reactivity using the commercial colorimetric assay kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). Plasma T-AOC, glutathion e peroxidase activity (GSH-Px) and SOD were assessed using an assay kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) according to the manufacturer's recommendations, using a microplate reader. IgA, IgG, and IgM level in serum were measured by enzyme-linked immunosorbent assay using an enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Jianglai Biotechnology Co, Ltd., China). Antibody titer against Newcastle disease virus (NDV) in serum was measured by hemagglutination-inhibition test on d 21 and 35 using 4 hemagglutinin units of the NDV antigen (China Institute of Veterinary Drug Control, Beijing, China). The contents of VC and VE in serum were determined by Microplate Reader with ferric ion reduction method under the action of phenanthroline. Total RNAs from liver were prepared using RNAiso Reagent (TaKaRa, Dalian, China). Total RNA was isolated from these frozen tissues according to the manufacturer's instructions. The concentration of RNA was determined using NanoDrop® ND-1000 (Thermo, Pittsburgh PA). RNA (500 ng) was transcribed into single-stranded cDNA using the PrimerScriptTM RT reagent (TaKaRa, Tokyo, Japan), and used for polymerase chain reaction (PCR) amplification. Quantitative PCR (qPCR) was performed using the SYBR premix ExTaq II (TaKaRa, Tokyo, Japan) and the IQ5 real-time PCR detection system (Bio-Rad, Hercules, CA). The sequences of the primers were listed in Table 2. Table 2. Nucleotide primer sequences of PCR primers of superoxide dismutase and glutathione peroxidase. Gene  Primer (5΄-3΄)  SOD1  F:CAGATAGGCACGTGGGTGAC R:CCCCTCTACCCAGGTCATCA  GSH-Px  F:GCATCCGCTTCCACGACTTCCT R:CCGCTCATCCGGGTCCAACAT  β-actin  F:TCTTGGGTATGGAGTCCTG R:TAGAAGCATTTGCGGTGG  Gene  Primer (5΄-3΄)  SOD1  F:CAGATAGGCACGTGGGTGAC R:CCCCTCTACCCAGGTCATCA  GSH-Px  F:GCATCCGCTTCCACGACTTCCT R:CCGCTCATCCGGGTCCAACAT  β-actin  F:TCTTGGGTATGGAGTCCTG R:TAGAAGCATTTGCGGTGG  View Large Statistical Analysis Data were analyzed by analysis of variance (ANOVA) with procedures appropriate for a completely randomized design using GLM procedure of SAS (SAS Institute Inc., Cary, NC). The significance level was set at P < 0.05. RESULTS Growth Performance As presented in Table 3, at 50 wk of age, the BW of DEX-treated birds was lower (P < 0.05) than that of the NC group. Dietary supplementation of VE or VC+VE increased (P < 0.01) BW of DEX-treated birds at 52 wk of age, while dietary supplementation of VC did not significantly affect BW (P > 0.05). In all DEX-treated groups, BW only declined 4 wk after being treated. At 50 wk of age, there was a significant increase (P < 0.05) in ADFI in birds exposed to DEX. There were no significant differences in ADFI between the DEX-treated groups during the acute stress period (wk 50), or among any groups during the post-stress recovery period (wk 52) (P > 0.05). Table 3. Effects of vitamin C and E alone and in combination on BW and ADFI in 21 and 35 d post treatment with DEX breeder roosters. Item  NC1  PC1  VC1  VE1  VC+VE1  BW (kg)  49 wk  2.44± 0.04  2.44 ± 0.05  2.42 ± 0.02  2.49 ± 0.01  2.51 ± 0.01  50 wk  2.51± 0.01a  2.36 ± 0.02b  2.38 ± 0.04b  2.40 ± 0.03a,b  2.40 ± 0.06a,b  52 wk  2.61± 0.02A  2.42 ± 0.04B  2.40 ± 0.03B  2.56 ± 0.03A  2.63 ± 0.02A  ADFI (g/d)  49 wk  101.29 ± 2.85  107.50 ± 1.86  95.98 ± 1.22  107.23 ± 1.05  107.86 ± 3.40  50 wk  99.06± 2.30b  114.28 ± 3.08a  108.13 ± 4.17a,b  109.07 ± 3.08a  113.96 ± 2.30a  52 wk  120.14 ± 4.13  109.59 ± 4.50  111.93 ± 4.98  123.33 ± 5.08  121.81 ± 4.94  Item  NC1  PC1  VC1  VE1  VC+VE1  BW (kg)  49 wk  2.44± 0.04  2.44 ± 0.05  2.42 ± 0.02  2.49 ± 0.01  2.51 ± 0.01  50 wk  2.51± 0.01a  2.36 ± 0.02b  2.38 ± 0.04b  2.40 ± 0.03a,b  2.40 ± 0.06a,b  52 wk  2.61± 0.02A  2.42 ± 0.04B  2.40 ± 0.03B  2.56 ± 0.03A  2.63 ± 0.02A  ADFI (g/d)  49 wk  101.29 ± 2.85  107.50 ± 1.86  95.98 ± 1.22  107.23 ± 1.05  107.86 ± 3.40  50 wk  99.06± 2.30b  114.28 ± 3.08a  108.13 ± 4.17a,b  109.07 ± 3.08a  113.96 ± 2.30a  52 wk  120.14 ± 4.13  109.59 ± 4.50  111.93 ± 4.98  123.33 ± 5.08  121.81 ± 4.94  Values with different lowercase superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large Antioxidant Capability To determine the effects of experimental diet on antioxidant level of birds, we measured the MDA and several antioxidant enzymes in serum on different phase (Table 4). At 50 wk, there was no significant difference in MDA, T-AOC, GSH-Px, and SOD among 5 treatments (P > 0.05). Table 4. Effects of vitamin C and vitamin E on antioxidant capability of serum in 21 and 35 d post treatment with DEX roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  MDA (nmol/mL)             50 wk  1.74 ± 0.14  2.59 ± 0.23  2.66 ± 0.19  2.43 ± 0.13  2.46 ± 0.39   52 wk  2.90 ± 0.17b  3.50 ± 0.16a  2.92 ± 0.17a,b  2.25 ± 0.21b  2.24 ± 0.26c  T-AOC (U/mL)             50 wk  9.08 ± 1.13  8.10 ± 0.26  10.00 ± 0.92  9.27 ± 0.13  10.48 ± 0.50   52 wk  9.40 ± 0.26  8.02 ± 0.46  8.73 ± 0.66  8.31 ± 0.41  10.00 ± 0.74  GSH-Px (U/mL)             50 wk  3384.71 ± 160.48  2828.82 ± 166.43  3157.06 ± 175.33  3433.24 ± 154.02  2993.82 ± 196.88   52 wk  2352.03 ± 264.95  2402.62 ± 59.53  2441.86 ± 110.28  2633.72 ± 288.12  2529.94 ± 229.38  SOD (U/ mL)             50 wk  417.43 ± 16.23  385.63 ± 12.07  425.50 ± 9.90  432.02 ± 13.91  432.48 ± 15.95   52 wk  311.72 ± 27.16b  301.70 ± 12.76c  353.07 ± 28.01b,c  345.36 ± 11.88b,c  419.09 ± 22.10a  Items  NC1  PC1  VC1  VE1  VC+VE1  MDA (nmol/mL)             50 wk  1.74 ± 0.14  2.59 ± 0.23  2.66 ± 0.19  2.43 ± 0.13  2.46 ± 0.39   52 wk  2.90 ± 0.17b  3.50 ± 0.16a  2.92 ± 0.17a,b  2.25 ± 0.21b  2.24 ± 0.26c  T-AOC (U/mL)             50 wk  9.08 ± 1.13  8.10 ± 0.26  10.00 ± 0.92  9.27 ± 0.13  10.48 ± 0.50   52 wk  9.40 ± 0.26  8.02 ± 0.46  8.73 ± 0.66  8.31 ± 0.41  10.00 ± 0.74  GSH-Px (U/mL)             50 wk  3384.71 ± 160.48  2828.82 ± 166.43  3157.06 ± 175.33  3433.24 ± 154.02  2993.82 ± 196.88   52 wk  2352.03 ± 264.95  2402.62 ± 59.53  2441.86 ± 110.28  2633.72 ± 288.12  2529.94 ± 229.38  SOD (U/ mL)             50 wk  417.43 ± 16.23  385.63 ± 12.07  425.50 ± 9.90  432.02 ± 13.91  432.48 ± 15.95   52 wk  311.72 ± 27.16b  301.70 ± 12.76c  353.07 ± 28.01b,c  345.36 ± 11.88b,c  419.09 ± 22.10a  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large At 52 wk, when DEX injection was accompanied by supplemental VC and VE, a significant decrease in serum MDA occurred compared to the positive control (P < 0.05). It is interesting that they were even under the values recorded for negative control birds significantly. Meanwhile, A significant increase also took place in serum SOD when VC and VE were incorporated in the diet of DEX-injected breeder roosters (P < 0.05). Immune Responses The results obtained from the preliminary analysis of immune globulins and NDV of serum are presented in Table 5. At 50 wk, there was no significant difference in IgA, IgG, IgM, and antibody titer of ND among 5 treatments (P > 0.05). At 52 wk, when DEX injection significantly decreased IgM and antibody titer of ND, supplementation VE or VC and VE combination significantly improve antibody titer of ND (log2) (P < 0.05). Table 5. Effects of vitamin C and vitamin E on immune globulins and antibody titer against Newcastle disease virus of serum in 21 and 35 d post treatment with DEX roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  IgA (μg/mL)             50 wk  3.64 ± 0.27  2.92 ± 0.14  3.28 ± 0.08  3.20 ± 0.18  3.32 ± 0.22   52 wk  4.03 ± 0.21  3.48 ± 0.26  3.49 ± 0.18  3.44 ± 0.08  3.51 ± 0.26  IgG (μg/mL)             50 wk  143.38 ± 3.99  138.42 ± 3.16  138.76 ± 1.27  139.76 ± 5.79  140.21 ± 2.72   52 wk  126.96 ± 9.42  132.13 ± 3.23  136.29 ± 1.87  132.18 ± 3.14  133.07 ± 4.72  IgM (μg/mL)             50 wk  35.68 ± 0.90  34.73 ± 0.93  34.79 ± 1.93  34.71 ± 0.72  35.34 ± 1.13   52 wk  40.30 ± 1.80a  35.27 ± 0.74b  34.70 ± 1.06b  36.60 ± 0.47b  37.83 ± 0.27a  Antibody titer of ND (log2)             50 wk  10.75 ± 0.25  9.75 ± 0.25  10.50 ± 0.29  10.50 ± 0.50  10.50 ± 0.29   52 wk  10.75 ± 0.48b  10.25 ± 0.25b  10.25 ± 0.75b  11.75 ± 0.25a  11.00 ± 0.41a  Items  NC1  PC1  VC1  VE1  VC+VE1  IgA (μg/mL)             50 wk  3.64 ± 0.27  2.92 ± 0.14  3.28 ± 0.08  3.20 ± 0.18  3.32 ± 0.22   52 wk  4.03 ± 0.21  3.48 ± 0.26  3.49 ± 0.18  3.44 ± 0.08  3.51 ± 0.26  IgG (μg/mL)             50 wk  143.38 ± 3.99  138.42 ± 3.16  138.76 ± 1.27  139.76 ± 5.79  140.21 ± 2.72   52 wk  126.96 ± 9.42  132.13 ± 3.23  136.29 ± 1.87  132.18 ± 3.14  133.07 ± 4.72  IgM (μg/mL)             50 wk  35.68 ± 0.90  34.73 ± 0.93  34.79 ± 1.93  34.71 ± 0.72  35.34 ± 1.13   52 wk  40.30 ± 1.80a  35.27 ± 0.74b  34.70 ± 1.06b  36.60 ± 0.47b  37.83 ± 0.27a  Antibody titer of ND (log2)             50 wk  10.75 ± 0.25  9.75 ± 0.25  10.50 ± 0.29  10.50 ± 0.50  10.50 ± 0.29   52 wk  10.75 ± 0.48b  10.25 ± 0.25b  10.25 ± 0.75b  11.75 ± 0.25a  11.00 ± 0.41a  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large At 50 wk, the IgA, IgG, and IgM level in treatment PC tended to be lower than group NC (P > 0.05). At 52 wk, IgM in the serum of oxidative stressed roosters from groups PC, VC, and VE were significantly lower than in the negative control group (P < 0.05), although the IgM in group VC+VE was lower, but no significant differences were found between them. Compared to negative control treatment or positive control treatment, the antibody titer against NDV in the birds fed diet with 200 mg/kg VE, or 300 mg/kg VC and 200 mg/kg VE was significantly increased (P < 0.05), while supplementation of 300 mg/kg VC had no significant effect on the antibody titer against NDV (P > 0.05) . Levels of Serous VC and VE As presented in Table 6, VC had no significant effects on serous VC contents. However, birds supplemented with dietary VE or their combination showed significantly higher serous VE level than the other 3 groups (P < 0.01). Table 6. Effects of vitamin C and vitamin E on the levels of serous VC and VE in 21 and 35 d post treatment with DEX roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  VC (μg/ mL)             50 wk  36.93 ± 3.68  33.69 ± 4.14  44.88 ± 4.27  39.09 ± 1.38  45.87 ± 1.30   52 wk  43.57 ± 2.10  43.49 ± 1.75  49.29 ± 3.79  42.15 ± 3.62  47.12 ± 5.46  VE (μg/ mL)             50 wk  1.74 ± 0.05B  1.72 ± 0.33B  2.01 ± 0.24B  3.48 ± 0.29A  4.03 ± 0.26A   52 wk  1.12 ± 0.13B  1.27 ± 0.16B  1.28 ± 0.17B  2.38 ± 0.08A  2.83 ± 0.40A  Items  NC1  PC1  VC1  VE1  VC+VE1  VC (μg/ mL)             50 wk  36.93 ± 3.68  33.69 ± 4.14  44.88 ± 4.27  39.09 ± 1.38  45.87 ± 1.30   52 wk  43.57 ± 2.10  43.49 ± 1.75  49.29 ± 3.79  42.15 ± 3.62  47.12 ± 5.46  VE (μg/ mL)             50 wk  1.74 ± 0.05B  1.72 ± 0.33B  2.01 ± 0.24B  3.48 ± 0.29A  4.03 ± 0.26A   52 wk  1.12 ± 0.13B  1.27 ± 0.16B  1.28 ± 0.17B  2.38 ± 0.08A  2.83 ± 0.40A  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large mRNA Expressions As shown in in Table 7, there was a decline in mRNA expression of SOD when the birds were exposed to DEX (P < 0.05). However, supplementation of VC, VE, or their combination had no remarkable alleviation effect on mRNA expression of SOD compared with that in the oxidative-stressed control treatment. According to our results, mRNA expression of GSH-Px in treatment PC was lower when compared with group NC (P < 0.05), supplementation of VC or VE, or their combination significantly increased the relative expression of GSH-Px mRNA when compared to the oxidative-stressed control treatment (P < 0.05). Table 7. Effects of vitamin C and vitamin E on mRNA expression of SOD and GSH-Px in oxidative stressed roosters. Items  NC1  PC1  VC1  VE1  VC+VE1  SOD  0.960 ± 0.250a  0.470 ± 0.120b  0.420 ± 0.030b  0.40 ± 0.040b  0.50 ± 0.140b  GSH-Px  0.015 ± 0.001a,b  0.001 ± 0.001c  0.008 ± 0.001b  0.028 ± 0.009a  0.022 ± 0.002a  Items  NC1  PC1  VC1  VE1  VC+VE1  SOD  0.960 ± 0.250a  0.470 ± 0.120b  0.420 ± 0.030b  0.40 ± 0.040b  0.50 ± 0.140b  GSH-Px  0.015 ± 0.001a,b  0.001 ± 0.001c  0.008 ± 0.001b  0.028 ± 0.009a  0.022 ± 0.002a  Values with different lower-case superscripts in the same row indicate a significant difference (P < 0.05), values with different upper-case superscripts indicate a highly significant difference (P < 0.01), and no superscripts indicate no significant difference (P > 0.05). 1NC, basal diet with sham-injected saline; PC, basal diet with DEX; VC, basal diet supplemented with 300 mg/kg VC; VE, basal diet supplemented with 200 mg/kg VE; VC+VE, basal diet supplemented with 300 mg/kg VC and 200 mg/kg VE; groups PC, VC, VE, and VC+VE all received subcutaneous injections of dexamethasone (4 mg/kg of body weight 3 times every other d). View Large DISCUSSION This study indicated that despite increased feed intake compared to the NC group, BW declined when roosters were challenged with DEX. It may be due to glucocorticoids improving energy consumption and the redistribution of energy toward lipid deposition (Yuan et al., 2008). Furthermore, 200 mg/kg VE suppressed BW loss in breeder roosters under oxidative stress, which agrees with Gao et al. (2010), who reported that higher level of VE supplementation improved BW in broilers exposed to DEX. Prior studies have noted that glucocorticoids can increase oxidative stress and cause different levels of oxidative stress among tissues and body fluid (Eid et al., 2006; Virden et al., 2007; Costantini et al., 2011). In the present study, a significant increase took place in serum SOD, and the MDA was significantly suppressed when VC and VE were incorporated in the diet of DEX-injected cocks, which is consistent with Cheng et al. (2017). SOD is one family of antioxidant enzymes, function to remove damaging ROS from the cellular environment by catalyzing the dismutation of 2 superoxide radicals to hydrogen peroxide and oxygen (Fattman et al., 2003). Ascorbic acid has been shown to scavenge superoxide, hydroxyl and peroxyl radicals efficiently. VE reacts with lipid peroxyl radicals at high rates and interrupts the radical chain, thereby preventing further lipid peroxidation (LPO) (Wefers and Sies, 1988). Interactive effects between vitamins C and E in preventing lipid peroxidation have been investigated (Niki et al., 1982). VC has an interaction with VE, by regenerating active VE from its oxidized forms. Co-administration of ascorbic acid and α-tocopherol to arsenic-exposed rats resulted in a reduction in the levels of lipid peroxidation, protein carbonyls, and hydrogen peroxide and an elevation in the levels of reduced glutathione, ascorbic acid and α-tocopherol (Ramanathan et al., 2002; 2003). That is why combined supplementation of VC and VE was sometimes superior to its single function in our present study. Previous studies showed that a variety of stressors affect defense mechanisms of animals, usually leading to a down-regulation of immune responses (Huff et al., 1999; El-Lethey et al., 2003; Stier et al., 2009; Huff et al., 2013). The result of the present study found that the immune response of roosters received DEX treatment showed the descent tendency. DEX could selectively inhibited serous immune globulins. For example, in cattle, serum concentrations of IgM, but not IgA or IgG, were suppressed by DEX treatment (Anderson et al., 1999); DEX administered orally inhibited IgE and IgA but did not influence IgG or IgM levels in mice (Puignero et al., 1995). However, the effect of oxidative stress on immune performance in serum is controversial. It has been demonstrated in mammals under stressare able to selectively suppress only certain parts of the immune system. There is much evidence that vitamins could enhance immune ability. VE could improve antibody levels to sheep red blood cells (SRBC) in birds (Leshchinsky and Klasing, 2001), and promote IgG and IgM production in serum (Niu et al., 2009). Under conditions of heat stress, dietary supplementation with VC has been shown to enhance immunological responses (Whitehead and Keller, 2003). Dietary tocopherols appear to be similarly absorbed along with dietary fat and are secreted in chylomicron particles. The chylomicron-bound vitamin E forms are transported via the lymphatic system to the peripheral tissues, including muscle, bone marrow, adipose tissue, skin, and possibly brain (Jiang, 2014). So appropriate dietary supplementation of VE could increase the vitamin E levels of plasma and muscle tissues (Nam et al., 2003) liver, and heart (Hidiroglou et al., 2004) in animals, which is in agreement with our study. Modulation of transcriptional factor activity such as activator protein-1 (AP-1) and nuclear factor-κB (NF-κB) is related to vitamin E antioxidant potency. Furthermore, AP-1 and NF-κB DNA binding sites have been located to regulatory regions of inflammatory genes such as adhesive molecules, cytokines, and antioxidant enzyme (AOE). Thus, it could be postulated that vitamin E could modulate AOE expression and activity by altering the cell redox status (Maggi-Capeyron et al., 2002). In our study, oxidative stress induced by DEX down-regulated mRNA expression of SOD or GSH-Px, birds supplemented with VE or VE+VC improved antioxidant capability and immune function through up-regulating the relative expression of GSH-Px mRNA under oxidative stress. Administration of vitamin E to hypothyroid rats resulted in elevated CAT mRNA level (Jena et al., 2012). VE treatments resulted in significant increases of Cu/Zn SOD and catalase mRNA levels of human umbilical vein endothelial cell (Nakamura and Omaye, 2008). These findings indicate that VE may play a role not only in preventing against oxidative damage as an exogenous antioxidant by scavenging free radicals and superoxide but also in modulating the expression of the endogenous antioxidant enzymes as a gene regulator. The results of present study indicated that to some extent dietary supplementation of VC, VE, or their combination relieve the adverse effects of oxidative stress in breeder roosters, also which is possibly related to the strength, sustained time when birds exposed to stress. Therefore, further studies are need on the relationship between the strength or sustained time of stress and the efficacy of antioxidants supplementation. Our findings also indicated that oxidative stress could affect antioxidant enzyme-related genes expression, and supplementation of the antioxidants could regulate some antioxidant enzyme-related gene. Although these results are useful to understand the molecular mechanism involved in birds subjected to stress, the information provided by current research is limited. In future, further studies are needed on the related molecular mechanism when birds exposed to oxidative stress: 1) genome-wide gene differentially expression of breeder roosters in response to oxidative stress or supplementation of the antioxidants using RNA-seq technique; 2) proteomic analysis of differentially expressed proteins of breeder roosters in response to oxidative stress or supplementation of the antioxidants; 3) differential expression of microRNAs of breeder roosters in response to oxidative stress or supplementation of the antioxidants. CONCLUSION In summary, the results suggest that oxidative stress could cause oxidative damage, and decline antioxidant capability and immune response of breeder roosters. Dietary supplementation of VC (300 mg/kg), VE (200 mg/kg) or their combination could eliminate the negative impact. Oxidative stress induced by DEX down-regulated mRNA expression of SOD or GSH-Px, however, antioxidant capability and immune function was improved when birds supplemented with VE or VE+VC through up-regulating the relative expression of GSH-Px mRNA under oxidative stress. Acknowledgements This research was supported by China Agriculture Research System (CARS-40-S20) and Shaanxi Province Agriculture Projects (2015NY175). REFERENCES Anderson B. H., Watson D. L., Colditz I. G.. 1999. The effect of dexamethasone on some immunological parameters in cattle. Vet. Res. Commun.  23: 399– 413. Burton G. W., Joyce A., Ingold K. U.. 1983. Is vitamin E the only lipid-soluble, chain-breaking antioxidant in human blood plasma and erythrocyte membranes? Arch. Biochem. Biophys.  221: 281– 290. Google Scholar CrossRef Search ADS PubMed  Cheng K., Zheng X. C., Zhang H., Zhang J. F., Zhang L. L., Zhang L. L., Zhou Y. M., Wang T.. 2017. Effects of dietary vitamin E type on the growth performance and antioxidant capacity in cyclophosphamide immunosuppressed broilers. Poult. Sci.  96:1159–1166. Costantini D., Marasco V., Møller A.. 2011. A meta-analysis of glucocorticoids as modulators of oxidative stress in vertebrates. J. Comp. Physiol. B.  181: 447– 456. Google Scholar PubMed  Eid Y., Ebeid T., Younis H.. 2006. Vitamin E supplementation reduces dexamethasone-induced oxidative stress in chicken semen. Br. Poult. Sci.  47: 350– 356. Google Scholar CrossRef Search ADS PubMed  El-Lethey H., Huber-Eicher B., Jungi T. W.. 2003. Exploration of stress-induced immunosuppression in chickens reveals both stress-resistant and stress-susceptible antigen responses. Vet. Immunol. Immunopathol.  95: 91– 101. Google Scholar CrossRef Search ADS PubMed  Falowo A. B., Fayemi P. O., Muchenje V.. 2013. Natural antioxidants against lipid–protein oxidative deterioration in meat and meat products: A review. Food Res. Int.  64: 171– 181. Google Scholar CrossRef Search ADS   Fattman C. L., Schaefer L. M., Oury T. D.. 2003. Extracellular superoxide dismutase in biology and medicine. Free Radical Bio. Med.  35: 236– 256. Google Scholar CrossRef Search ADS   Guo Y., Tang Q., Yuan J., Jiang Z.. 2001. Effects of supplementation with vitamin E on the performance and the tissue peroxidation of broiler chicks and the stability of thigh meat against oxidative deterioration. Anim. Feed Sci. Tech.  89: 165– 173. Google Scholar CrossRef Search ADS   Gao J., Lin H., Wang X. J., Song Z. G., Jiao H. C.. 2010. Vitamin E supplementation alleviates the oxidative stress induced by dexamethasone treatment and improves meat quality in broiler chickens. Poult. Sci.  89: 318– 327. Google Scholar CrossRef Search ADS PubMed  Hatamoto L. K., Sobrinho C. A. B., Nichi M., Barnabe V. H., Barnabe R. C., Cortada C. N. M.. 2006. Effects of dexamethasone treatment (to mimic stress) and Vitamin E oral supplementation on the spermiogram and on seminal plasma spontaneous lipid peroxidation and antioxidant enzyme activities in dogs. Theriogenology . 66: 1610– 1614. Google Scholar CrossRef Search ADS PubMed  Hidiroglou N., Gilani G. S., Long L., Zhao X., Madere R., Cockell K., Belonge B., Ratnayake W. M. N., Peace R.. 2004. The influence of dietary vitamin E, fat, and methionine on blood cholesterol profile, homocysteine levels, and oxidizability of low density lipoprotein in the gerbil. J. Nutr. Biochem.  15: 730– 740. Google Scholar CrossRef Search ADS PubMed  Huff G. R., Huff W. E., Balog J. M., Rath N. C.. 1999. Sex differences in the resistance of turkeys to Escherichia coli challenge after immunosuppression with dexamethasone. Poult. Sci.  78: 38– 44. Google Scholar CrossRef Search ADS PubMed  Huff G. R., Huff W. E., Rath N. C.. 2013. Dexamethasone immunosuppression resulting in turkey clostridial dermatitis: a retrospective analysis of 7 studies, 1998–2009. Avian Dis.  57: 730– 736 Google Scholar CrossRef Search ADS PubMed  Jena S., Chainy G. B. N., Dandapat J.. 2012. Expression of antioxidant genes in renal cortex of PTU-induced hypothyroid rats: effect of vitamin E and curcumin. Mol. Biol. Rep.  39: 1193– 1203. Google Scholar CrossRef Search ADS PubMed  Jiang Q. 2014. Natural forms of vitamin E: metabolism, antioxidant, and anti-inflammatory activities and their role in disease prevention and therapy. Free Radical Biol. Med.  72: 76– 90. Google Scholar CrossRef Search ADS   LaLone C. A., Villeneuve D. L., Olmstead A. W., Medlock E. K., Kahl M. D., Jensen K. M., Durhan E. J., Makynen E. A., Blanksma C. A., Cavallin J. E., Thomas L. M., m. Seidl S., Skolness S. Y., Wehmas L. C., Johnson R. D., Ankley G. T.. 2012. Effects of a glucocorticoid receptor agonist, dexamethasone, on fathead minnow reproduction, growth, and development. Environ. Toxicol. Chem.  31: 611– 622. Google Scholar CrossRef Search ADS PubMed  Leshchinsky T. V., Klasing K. C.. 2001. Relationship between the level of dietary vitamin E and the immune response of broiler chickens. Poult. Sci.  80: 1590– 1599. Google Scholar CrossRef Search ADS PubMed  Lin H., Sui S. J., Jiao H. C., Buyse J., Decuypere E.. 2006. Impaired development of broiler chickens by stress mimicked by corticosterone exposure. Comp. Biochem. Physiol. Pt A Mol. Integr. Physiol.  143: 400– 405. Google Scholar CrossRef Search ADS   Lykkesfeldt J., Svendsen O.. 2007. Oxidants and antioxidants in disease: Oxidative stress in farm animals. J. Vet.  173: 502– 511. Google Scholar CrossRef Search ADS   Maes M., Galecki P., Chang Y. S., Berk M.. 2011. A review on the oxidative and nitrosative stress (O&NS) pathways in major depression and their possible contribution to the (neuro)degenerative processes in that illness. Prog. Neuro-Psychopharmacol. Biol. Psychiatry.  35: 676– 692. Google Scholar CrossRef Search ADS   Maggi-Capeyron M., Cases J., Badia E., Cristol J., Rouanet J., Besançon P., Leger C. L., Descomps B.. 2002. A diet high in cholesterol and deficient in vitamin E induces lipid peroxidation but does not enhance antioxidant enzyme expression in rat liver. J. Nutr. Biochem.  13: 296– 301. Google Scholar CrossRef Search ADS PubMed  Nakamura Y. K., Omaye S. T.. 2008. α-Tocopherol modulates human umbilical vein endothelial cell expression of Cu/Zn superoxide dismutase and catalase and lipid peroxidation. Nutr. Res.  28: 671– 680. Google Scholar CrossRef Search ADS PubMed  Nam K. C., Min B. R., Yan H., Lee E. J., Mendonca A., Wesley I., Ahn D. U.. 2003. Effect of dietary vitamin E and irradiation on lipid oxidation, color, and volatiles of fresh and previously frozen turkey breast patties. Meat Sci . 65: 513– 521. Google Scholar CrossRef Search ADS PubMed  Niki K., Namiki H., Kikuyama S., Yoshizato K. 1982. Epidermal tissue requirement for tadpole tail regression induced by thyroid hormone. Dev. Biol.  94: 116– 120. Google Scholar CrossRef Search ADS PubMed  Niu Z. Y., Liu F. Z., Yan Q. L., Li W. C.. 2009. Effects of different levels of vitamin E on growth performance and immune responses of broilers under heat stress. Poult. Sci.  88: 2101– 2107. Google Scholar CrossRef Search ADS PubMed  Ognjanović B. I., Marković S. D, Đorđević N. Z., Trbojević I. S., Štajn A. Š., Saičić Z. S. 2010. Cadmium-induced lipid peroxidation and changes in antioxidant defense system in the rat testes: Protective role of coenzyme Q10 and Vitamin E. Reprod. Toxicol . 29: 191– 197. Google Scholar CrossRef Search ADS PubMed  Puignero V., Salgado J., Queralt J.. 1995. Effects of cyclosporine and dexamethasone on IgE antibody response in mice, and on passive cutaneous anaphylaxis in the rat. Int. Arch. Allergy Immunol.  108: 142– 147. Google Scholar CrossRef Search ADS PubMed  Ramanathan K., Balakumar B. S., Panneerselvam C.. 2002. Effects of ascorbic acid and α-tocopherol on arsenic-induced oxidative stress. Hum. Exp. Toxicol.  21: 675– 680. Google Scholar CrossRef Search ADS PubMed  Ramanathan K., Shila S., Kumaran S., Panneerselvam C.. 2003. Protective role of ascorbic acid and α-tocopherol on arsenic-induced microsomal dysfunctions. Hum. Exp. Toxicol.  22: 129– 136. Google Scholar CrossRef Search ADS PubMed  Siegel P. B., Gross W. B.. 1980. Production and persistence of antibodies in chickens to sheep erythrocytes.1. directional selection. Poult. Sci.  59: 1– 5. Google Scholar CrossRef Search ADS   Singh H., Sodhi S., Kaur R.. 2006. Effects of dietary supplements of selenium, vitamin E or combinations of the two on antibody responses of broilers. Br. Poult. Sci.  47: 714– 719. Google Scholar CrossRef Search ADS PubMed  Stier K. S., Almasi B., Gasparini J., Piault R., Roulin A., Jenni L.. 2009. Effects of corticosterone on innate and humoral immune functions and oxidative stress in barn owl nestlings. J. Exp. Biol.  212: 2085– 2091. Google Scholar CrossRef Search ADS PubMed  Therond P., Bonnefont-Rousselot D., Davit-Spraul A., Conti M., Legrand A. 2000. Biomarkers of oxidative stress: an analytical approach. Curr. Opin. Clin. Nutr. Metab. Care.  3: 373– 384. Google Scholar CrossRef Search ADS PubMed  Virden W. S., Thaxton J. P., Corzo A., Dozier W. A., Kidd M. T.. 2007. Evaluation of models using corticosterone and adrenocorticotropin to induce conditions mimicking physiological stress in commercial broilers. Poult. Sci.  86: 2485– 2491. Google Scholar CrossRef Search ADS PubMed  Wefers H., Sies H.. 1988. The protection by ascorbate and glutathione against microsomal lipid peroxidation is dependent on vitamin E. Eur. J. Biochem.  174: 353– 357. Google Scholar CrossRef Search ADS PubMed  Whitehead C. C, Keller T.. 2003. An update on ascorbic acid in poultry. World's Poult. Sci. J.  59: 161– 184. Google Scholar CrossRef Search ADS   Yuan L., Jiang K. J., Lin H., Jiao H. C.. 2008. Corticosterone administration and high-energy feed results in enhanced fat accumulation and insulin resistance in broiler chickens. Br. Poult. Sci.  49: 487– 495. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc.

Journal

Poultry ScienceOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

Monthly Plan

  • Read unlimited articles
  • Personalized recommendations
  • No expiration
  • Print 20 pages per month
  • 20% off on PDF purchases
  • Organize your research
  • Get updates on your journals and topic searches

$49/month

Start Free Trial

14-day Free Trial

Best Deal — 39% off

Annual Plan

  • All the features of the Professional Plan, but for 39% off!
  • Billed annually
  • No expiration
  • For the normal price of 10 articles elsewhere, you get one full year of unlimited access to articles.

$588

$360/year

billed annually
Start Free Trial

14-day Free Trial