Tumor suppressor miR-128-3p inhibits metastasis and epithelial–mesenchymal transition by targeting ZEB1 in esophageal squamous-cell cancer

Tumor suppressor miR-128-3p inhibits metastasis and epithelial–mesenchymal transition by... Abstract MicroRNAs (miRNAs) are some short RNAs that regulate multiple biological functions at post-transcriptional levels, such as tumorigenic processes, inflammatory lesions and cell apoptosis. Zinc finger E-box binding homeobox factor 1 (ZEB1) is a crucial mediator of epithelial–mesenchymal transition (EMT). It induces malignant progression of various cancers including human esophageal squamous-cell carcinoma (ESCC). In this study, we found that miR-128-3p was downregulated in ESCC tissues and cells by using PCR. Moreover, down-regulated expression of miR-128-3p was testified to be associated with poor prognosis of ESCC patients and might be regarded as an independent prognostic factor. Then, we examined the role of miR-128-3p in ESCC cells, and found that miR-128-3p could suppress the cell migration and invasion in vitro. Furthermore, ZEB1 was confirmed to be a direct target of miR-128-3p by luciferase reporter assay. Rescue experiments proved that EMT was regulated by miR-128-3p via suppression of ZEB1. Taken all together, we conclude that miR-128-3p suppresses EMT and metastasis via ZEB1, and miR-128-3p may be a critical mediator in ESCC. miR-128-3p, esophageal squamous-cell carcinoma, ZEB1, epithelial–mesenchymal transition, invasion and metastasis Introduction Esophageal cancer (EC) is one of the most serious health problems worldwide, which ranks eighth in human malignancy [1,2]. Esophageal squamous-cell carcinoma (ESCC) is the most prevalent histological type of EC and approximately 90% occurred in Southeast Asia countries, particularly in China [3–5]. Poor clinical outcome and high mortality rate are shown in ESCC patients, due to its high-aggressive ability, distant metastasis and the resistance to adjuvant therapy [6,7]. Therefore, it is imperative to find efficient targets for ESCC therapy. Zinc finger E-box binding homeobox 1 (ZEB1) has a conserved homeobox region and two zinc finger domains at each end of the regions, which belongs to the ZEB family of transcription factors [8,9]. ZEB1 can bind with target DNA sequences and repress cell adhesion molecules as well as cell polarity-associated genes to induce epithelial–mesenchymal transition (EMT) progress [10,11]. It is expressed at low level in the normal epithelium, and is upregulated in the malignant epithelium tumors [12–14]. Aberrant expression of ZEB1 in ESCC has been reported in recent years [15–18]. MicroRNAs (miRNAs) are some short non-coding endogenous RNAs (ncRNAs) which can bind to the 3′-untranslated regions (3′-UTRs) of target mRNAs, and a large number of them can modulate biological behavior of tumors [19–22]. Recently, it has been found that various miRNAs are aberrantly expressed in ESCC [23–31], which indicates that these miRNAs play critical roles in carcinogenesis. In this study, we compared the expression patterns of miR-128-3p in ESCC tissues and normal tissues, and explored the function of miR-128-3p in vitro. ZEB1 was confirmed to be the direct target of miR-128-3p. These results indicate that miR-128-3p may be able to serve as a potential therapeutic target for human ESCC. Material and Methods Cell culture ESCC cell lines TE1, TE10, Kyse-30, Kyse-70, Kyse-150, ECA109 and normal esophageal epithelial cell line (HEEC) were bought from Fudan IBS Cell Center (Shanghai, China). All cells were cultured in RPMI 1640 (Gibco, Gaithersburg, USA) with 10% fetal bovine serum (FBS; Gibco) at 37°C, 95% humidity and 5% CO2. Patients and specimens Forty-seven paired tumor tissues and normal tissues were obtained from patients who were diagnosed as ESCC by means of pathology and were not subject to chemotherapy and/or radiotherapy at Sichuan Cancer Hospital (Chengdu, China) between January 2008 and December 2016. The age of patients ranged from 41 to 78, randomly selected by Department of Pathology. Other details of patients were shown in Table 1. Diagnosis of ESCC was defined according to the tumor node metastasis stage and World Health Organization (WHO) criteria. The study was approved by the ethics committee of Sichuan Province Medical Association. The informed consent forms were signed by every patient. Tissues were stored in liquid nitrogen until use. Table 1. Correlation between miR-128-3p expression and clinical features (n = 47) Variable  miR-128-3p expression  P-value  Low  High  Age        <60  9  13  0.533  ≥60  11  14  Gender        Male  16  23  0.465  Female  4  4  Pathological grading        ≤G2  14  18  0.532  G3  6  9  Tumor range        T1  1  8  0.036*  ≥T2  19  19  Lymph nodes        Negative  3  13  0.018*  Positive  17  14  Pathological stage        <III  8  18  0.064  ≥III  12  9  Tumor location        Locussuperior  1  0  0.497  Locusmedilis  13  19  Locusinferior  6  8  Variable  miR-128-3p expression  P-value  Low  High  Age        <60  9  13  0.533  ≥60  11  14  Gender        Male  16  23  0.465  Female  4  4  Pathological grading        ≤G2  14  18  0.532  G3  6  9  Tumor range        T1  1  8  0.036*  ≥T2  19  19  Lymph nodes        Negative  3  13  0.018*  Positive  17  14  Pathological stage        <III  8  18  0.064  ≥III  12  9  Tumor location        Locussuperior  1  0  0.497  Locusmedilis  13  19  Locusinferior  6  8  Low/high by the sample median. Pearson χ2 test. *P < 0.05 was considered statistically significant. RNA extraction and quantitative real-time PCR Total RNA was extracted from tissue specimens or the cultured cells using TRIzol® reagent (TaKaRa, Dalian, China) following the manufacturer’s protocol. The RNA concentration was measured with a spectrophotometer. The relative fluorescence was collected with SYBR Green dyestuff using STEP ONE RT-qPCR apparatus (Applied Biosystems, Foster, USA). For miRNA, the reverse transcription was conducted by two steps at 37°C for 5 min and 42°C for 25 min in 0.2 ml reaction system without RNA enzymes in accordance with the miRNA reverse transcription kit (Abm, Chengdu, China). For the real-time quantitative PCR (qRT-PCR) reaction, the reagents were added in 48-well PCR plates according to miRNA SYBR Green qRT-PCR kit (Abm) instruction. The annealing temperature was 65°C, 40 cycles. For mRNA, the reverse transcription was conducted by two steps at 95°C for 5 min and 60°C for 15 min in 0.1 ml reaction system in accordance with the miRNA reverse transcription kit (Abm). qRT-PCR was performed at the annealing temperature of 60°C, 35 cycles. Relative gene expression levels were calculated by the ΔΔCt method. The primers used were listed in Table 2. Table 2. Sequence of primers used in qRT-PCR Name  Forward  Reverse  ZEB1  CAGCTTGATACCTGTGAATGGG  CAGCTTGATACCTGTGAATGGG  miR-128-3p  GGTCACAGTGAACCGGTC  GTGCAGGGTCCGAGGT  U6  GCGCGTCGTGAAGCGTTC  GTGCAGGGTCCGAGGT  GAPDH  GCACCGTCAAGGCTGAGAAC  TGGTGAAGACGCCAGTGGA  E-cadherin  TTGTGGCAGAGTGTAATGCTG  GTCCCTGGTCTTCTTGGTCA  B-catenin  GCTGGTGACAGGGAAGACAT  CCATAGTGAAGGCGAACTGC  N-cadherin  CAAACAAGGTGAGACGATGC  GCCAGGATGAGTAAGCGTGT  Vimentin  AGAGAACTTTGCCGTTGAAGC  ACGAAGGTGACGAGCCATT  Name  Forward  Reverse  ZEB1  CAGCTTGATACCTGTGAATGGG  CAGCTTGATACCTGTGAATGGG  miR-128-3p  GGTCACAGTGAACCGGTC  GTGCAGGGTCCGAGGT  U6  GCGCGTCGTGAAGCGTTC  GTGCAGGGTCCGAGGT  GAPDH  GCACCGTCAAGGCTGAGAAC  TGGTGAAGACGCCAGTGGA  E-cadherin  TTGTGGCAGAGTGTAATGCTG  GTCCCTGGTCTTCTTGGTCA  B-catenin  GCTGGTGACAGGGAAGACAT  CCATAGTGAAGGCGAACTGC  N-cadherin  CAAACAAGGTGAGACGATGC  GCCAGGATGAGTAAGCGTGT  Vimentin  AGAGAACTTTGCCGTTGAAGC  ACGAAGGTGACGAGCCATT  U6 and GAPDH were used as the internal references. All reactions were performed in triplicate. Cell transfection MiR-128-3p mimics (miR-128-3p), inhibitor (anti-miR-128-3p) and negative control were synthesized by Genechem Company (Shanghai, China). ZEB1 over-expression plasmid vector was purchased from the Genechem Company. All of these were confirmed by DNA sequence analysis. Cells were transfected using the reagent Lipofectamine 2000 (Invitrogen, Carlsbad, USA) in opti-RPMI 1640 (Gibco) according to manufacturer’s instructions. Luciferase reporter gene assay The luciferase reporter gene plasmid pMIR was used to construct the ZEB1 3′UTR luciferase reporter gene plasmid. The miR-128-3p specific stem-loop primer was 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAGAG-3′. The wild-type miR-128 binding site at 3′UTR of ZEB1 was synthesized with the following primers: forward, 5′-AATATAAAACTTAAATTTTGAAATTCACTGTGTGACTAATAGCATGATGCTCTGCAG-3′; reverse, 5′-TTAATAAAACTGCAGAGCATCATGCTATTAGTCACACAGTGAATTTCAAAATTTAAG-3′. The mutant binding site was synthesized with the following primers: forward, 5′-AATATAAAACTTAAATTTTGAAATTTACGTTGTGACTAATAGCATGATGCTCTGCAG-3′; reverse, 5′-TTAATAAAACTGCAGAGCATCATGCTATTAGTCACACAGTGAATTTCAAAATTTAAG-3′. These wild-type or mutant 3′UTRs were subcloned into pMIR plasmid at the CMV/SacI site at the downstream of the luciferase vector, and defined as pZEB1-wt or pZEB1-mut, respectively. Luciferase reporter gene assay was performed in 96-well plates using the Dual-Glo Luciferase Assay System (Promega, Madison, USA). Cells were co-transfected with miR-128-3p mimics and 10 μg of pZEB1-wt or pZEB1-mut by using Lipofectamine 2000 (Invitrogen, Carlsbad, USA). After 48 h, luciferase activity was measured using a Dual-Luciferase Reporter Assay kit (Promega) according to the manufacturer’s instructions. SpectraMax M5 instrument software (Molecular devices, San Francisco, USA) was used to analyze the results. Each experiment was repeated three times. Western blot analysis The total protein was extracted by ice-cold RIPA lysis buffer supplemented with phenylmethanesulfonyl fluoride (PMSF) and protease inhibitor cocktail. Cell lysates were mixed with loading buffer and subjected in 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by being transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skimmed milk for 2 h, followed by incubation with antibodies against E-cadherin, N-cadherin, Vimentin, β-catenin and ZEB1 (Abcam, Cambridge, UK) at 4°C overnight. Then the membranes were washed with TBST for three times and incubated with the corresponding horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology, Boston, USA) for another 1 h at 37°C. An enhanced ECL Chemiluminescence kit (UltraSignal, Beijing, China) was used to visualize the proteins according to the manufacturer’s protocol. The signals were exposed to X-ray films. GAPDH was used as the loading control. MTT assay Cell proliferation was analyzed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cells were seeded at the density of 5 × 103/well in 96-well plates, and cultured for 24–72 h. MTT solution (5 mg/ml; Sigma, St Louis, USA) was added into the medium and incubated for 4 h at 37°C. After removal of the medium, 100 μl of dimethyl sulfoxide (DMSO) was added into each well. The absorbance at 560 nm was measured with a microplate reader. All reactions were performed in triplicate. Wound healing assay Cells were seeded into 6-well plates with 5 × 105 cells/well and cultured in complete medium. When cell monolayer was formed, an artificial wound was scraped on the cells using a pipette tip. The ability of cells migrating from the confluent sides into the scratch area was observed. The width of the scratch gap was recorded under an inverted microscope and photographed at 6 h and 24 h. The difference between the original width of the wound and the width after cell migration was quantified. Three replicates of each condition were used. Transwell invasion assay For the transwell invasion assay, cells (5 × 103/well) were directly added into the upper chambers of matrigel-coated Transwell plates (Corning Co, Corning, USA) with serum-free medium. The lower chamber contained culture medium with 4% FBS as a chemoattractant. After 24 h, cells on the top of the membrane were scraped off and migrated cells stuck under the membrane were stained with crystal violet. The invaded cells in five random fields were counted under a microscope. Each experiment was conducted for three times. Immunofluorescence assay Cells were cultured on cover slips for 24 h, followed by being fixed with cold acetone for 20 min. Then cells were incubated with antibodies against E-cadherin, N-cadherin, Vimentin and β-catenin at 4°C overnight, followed by incubation with the FITC-conjugated goat anti-rabbit secondary antibodies (Cell Signaling Technology, Boston, USA) for another 1 h. 4′,6-Diamidino-2-phenylindole (DAPI) was used to stain the nuclei of the cells. Finally, cells were observed under a fluorescence microscope. Each experiment was conducted for three times. Statistical analysis Data were presented as the mean ± SD. All statistical analyses were performed using SPSS 17.0 statistical software. Categorical variables were compared by using Fisher’s exact test. Relationship between miR-128-3p expression and clinical features was analyzed by the Pearson χ2 tests. Kaplan–Meier method was used to compare the overall survival curve between high miR-128-3p and low miR-128-3p expression groups by log-rank test. Cox proportional hazards regression model was made to identify hazard factors with overall survival in multivariate survival analysis for ESCC. In vitro assays and luciferase activities assay were analyzed by the Student’s t-test. P < 0.05 was considered statistically significant. Results Down-regulated expression of miR-128-3p in ESCC tissues and ESCC cells To identify the biological function of miR-128-3p, we first used qRT-PCR assay to detect the expression of miR-128-3p in ESCC tissues and cells to speculate and identify the biological function of miR-128-3p. The results of qRT-PCR assay demonstrated that the expression of miR-128-3p was lower in ESCC tissues and cells than that in normal esophageal epithelial tissues and cells (Fig. 1A–C). These data indicated that miR-128-3p might function as a suppressor to hinder the tumorigenesis of ESCC. Figure 1. View largeDownload slide Down-regulated expression of miR-128-3p in ESCC tissues and ESCC cells (A) qRT-PCR analysis detected the relative expression of miR-128-3p in ESCC tissues. (B) miR-128-3p expression in tissue samples of ESCC and adjacent normal tissues. (C) qRT-PCR analysis assessed the relative expression of miR-128-3p in ESCC cells. (D) The overall survivals in 47 ESCC patients were represented by Kaplan–Meier curves. Each experiment was performed in triplicate. U6 was used as an internal control. *P < 0.05; **P < 0.01. Figure 1. View largeDownload slide Down-regulated expression of miR-128-3p in ESCC tissues and ESCC cells (A) qRT-PCR analysis detected the relative expression of miR-128-3p in ESCC tissues. (B) miR-128-3p expression in tissue samples of ESCC and adjacent normal tissues. (C) qRT-PCR analysis assessed the relative expression of miR-128-3p in ESCC cells. (D) The overall survivals in 47 ESCC patients were represented by Kaplan–Meier curves. Each experiment was performed in triplicate. U6 was used as an internal control. *P < 0.05; **P < 0.01. Low expression of miR-128-3p is correlated with poor prognosis of patients in ESCC To address the clinical significance of miR-128-3p in ESCC, 47 patients were employed to evaluate the correlations between miR-128-3p expression level and the clinicopathological features. Kaplan–Meier method analysis (log-rank test) was used to confirm that miR-128-3p expression was associated with overall survival rates of patients (P = 0.002; Fig. 1D). Correlation between miR-128-3p expression and clinical features analysis implied that miR-128-3p expression is correlated with tumor range and lymphatic metastasis (P = 0.036 and 0.018, respectively; Table 1). Proportional hazards method (Cox regression) analysis showed that low miR-128-3p expression (P = 0.042) was an adverse prognostic factor in addition to lymph nodes number (P = 0.013) and pathological stage (P = 0.001) (Table 3). Taken together, miR-128-3p has significant biological function and may be used as a specific biomarker for poor prognosis in ESCC. Table 3. Clinical data analysis by proportional hazards method Variable  Category  HR  P-value  Age  <60  0.293  0.588  ≥60  Gender  Male  0.212  0.645  Female  Pathological grading  <G2  3.325  0.068  ≥G2  Tumor location  Locussuperior  1.900  0.387  Locusmedilis  Locusinferior  Tumor range  T1  0.284  0.594  T2  T3  T4  Lymph nodes number  <7  6.166  0.013*  ≥7  Pathological stage  <III  11.958  0.001*  ≥III  miR-128-3p expression  Low  4.117  0.042*  High  Variable  Category  HR  P-value  Age  <60  0.293  0.588  ≥60  Gender  Male  0.212  0.645  Female  Pathological grading  <G2  3.325  0.068  ≥G2  Tumor location  Locussuperior  1.900  0.387  Locusmedilis  Locusinferior  Tumor range  T1  0.284  0.594  T2  T3  T4  Lymph nodes number  <7  6.166  0.013*  ≥7  Pathological stage  <III  11.958  0.001*  ≥III  miR-128-3p expression  Low  4.117  0.042*  High  A positive, independent prognostic importance of miR-128-3p expression (P = 0.042), in addition to the independent prognostic impact of lymph nodes number (P = 0.013) and pathological stage (P = 0.001). HR, hazard ratio. *P < 0.05 was considered statistically significant. MiR-128-3p suppresses invasion and metastasis in ESCC To further define the potential biological significance of miR-128-3p in ESCC, we used miR-128-3p mimics and inhibitor to perform the gain and loss function analysis. MTT assay showed that up-regulation of miR-128-3p diminished ESCC cells proliferation, while down-regulation of miR-128-3p enhanced ESCC cells proliferation (Fig. 2A). Meanwhile, the wound scratch healing assay revealed that the migratory ability of ESCC cells transfected with miR-128-3p was obviously lower than those transfected with miR-NC. The migratory ability of ESCC cells transfected with miR-128-3p inhibitor (anti-miR-128-3p) was higher than those transfected with the negative control (anti-miR-NC) (Fig. 2B). Furthermore, the effects of miR-128-3p on invasion of ESCC cells were further investigated. Transwell assay showed that ectogenic miR-128-3p repressed the invasive ability of ESCC cells and knockdown of miR-128-3p increased the invasive ability of ESCC cells (Fig. 2C). These results suggest that miR-128-3p may effectively suppress the growth, migration and invasion of ESCC cells in vitro. Figure 2. View largeDownload slide MiR-128-3p suppresses invasion and metastasis in ESCC (A) MTT assay was performed to detect cell proliferation ability. (B) Wound healing was photographed under a microscope at 100× magnification after 6 h and 24 h. (C) Transwell invasion assay was used to observe of invasion ability of ESCC cells after transfected with miR-NC, miR-128-3p, anti-miR-NC and anti-miR-128-3p. Cells were viewed in five random fields at 100× magnification and counted. Each experiment was performed in triplicate. **P < 0.01. Figure 2. View largeDownload slide MiR-128-3p suppresses invasion and metastasis in ESCC (A) MTT assay was performed to detect cell proliferation ability. (B) Wound healing was photographed under a microscope at 100× magnification after 6 h and 24 h. (C) Transwell invasion assay was used to observe of invasion ability of ESCC cells after transfected with miR-NC, miR-128-3p, anti-miR-NC and anti-miR-128-3p. Cells were viewed in five random fields at 100× magnification and counted. Each experiment was performed in triplicate. **P < 0.01. EMT is regulated by miR-128-3p To find out the underlying mechanism that miR-128-3p suppresses cell metastasis, qRT-PCR assay was conducted. It was found that miR-128-3p mimics could stimulate the expression of epithelial markers (E-cadherin and β-catenin), remarkably retard the expression of mesenchymal markers (Vimentin and N-cadherin). Knockdown of miR-128-3p could repress the expression of epithelial markers (E-cadherin and β-catenin), and prominently induce the expression of mesenchymal markers (Vimentin and N-cadherin) (Fig. 3A). Immunofluorescence assay showed that the expression of epithelial protein markers was increased in miR-128-3p-transfected ESCC cells, while the expression of mesenchymal protein markers was notably decreased. After transfection with anti-miR-128-3p, the expression of epithelial protein markers was significantly decreased in ESCC cells, while the expression of mesenchymal protein markers was strengthened (Fig. 3B). These data suggest that miR-128-3p may suppress the EMT of ESCC cells in vitro. Figure 3. View largeDownload slide EMT is regulated by miR-128-3p (A) qRT-PCR analyzed the relative expression of epithelial markers (E-cadherin and β-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. (B) Immunofluorescence staining assay of the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH served as the internal control. **P < 0.01. Figure 3. View largeDownload slide EMT is regulated by miR-128-3p (A) qRT-PCR analyzed the relative expression of epithelial markers (E-cadherin and β-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. (B) Immunofluorescence staining assay of the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH served as the internal control. **P < 0.01. ZEB1 is directly targeted by miR-128-3p in ESCC It is well known that ZEB1 belongs to the ZEB family of transcription factors that can stimulate invasion and metastasis [32,33]. This has also been confirmed in ESCC [34,35]. However, the underlying upstream factor was unknown. Therefore, luciferase reporter gene assay was performed to test whether ZEB1 was directly targeted by miR-128-3p in ESCC. It was found that miR-128-3p notably inhibited the luciferase activities when co-transfected with the wild-type ZEB1 3′UTR (Fig. 4A), while the suppressive effects of miR-128-3p on luciferase activity were attenuated when the binding sequences were mutated in two ESCC cell lines (Fig. 4B). Furthermore, qRT-PCR and western blot analysis results confirmed that ZEB1 is the direct target of miR-128-3p. qRT-PCR and western blot analysis results showed that the expression of ZEB1 was reduced by the over-expression of miR-128-3p, and the expression of ZEB1 was increased by knockdown of miR-128-3p (Fig. 4C–E). These data imply that ZEB1 directly and negatively regulates miR-128-3p. Figure 4. View largeDownload slide ZEB1 is directly targeted by miR-128-3p in ESCC (A) Mutation was generated on the ZEB1 3′UTR sequence in the complementary site of miR-128-3p. ZEB1 3′UTR fragment contained wild-type or mutant miR-128-3p. (B) The cells were co-transfected with negative control or miR-128-3p plasmids and wild-type or mutant ZEB1 3′UTR vectors. Luciferase activity was determined. (C) The relative expression of miR-128-3p in ESCC cells transfected with miR-128-3p mimics and inhibitor, which was tested by qRT-PCR. (D) The relative expression of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor by qRT-PCR. (E) Western blot analysis examined the expression level of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor. Each experiment was performed in triplicate. U6 and GAPDH were used as the internal control. **P < 0.01. Figure 4. View largeDownload slide ZEB1 is directly targeted by miR-128-3p in ESCC (A) Mutation was generated on the ZEB1 3′UTR sequence in the complementary site of miR-128-3p. ZEB1 3′UTR fragment contained wild-type or mutant miR-128-3p. (B) The cells were co-transfected with negative control or miR-128-3p plasmids and wild-type or mutant ZEB1 3′UTR vectors. Luciferase activity was determined. (C) The relative expression of miR-128-3p in ESCC cells transfected with miR-128-3p mimics and inhibitor, which was tested by qRT-PCR. (D) The relative expression of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor by qRT-PCR. (E) Western blot analysis examined the expression level of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor. Each experiment was performed in triplicate. U6 and GAPDH were used as the internal control. **P < 0.01. EMT is regulated by miR-128-3p via suppression of ZEB1 ZEB1 has been proved to induce cell EMT. However, the potential upstream target of ZEB1 to control EMT process in ESCC is still unknown. To explore whether the regulating effects of miR-128-3p on EMT are through suppressing ZEB1, rescue experiments were performed. It was found that the expression of epithelial markers (E-cadherin and β-catenin) and mesenchymal markers (Vimentin and N-cadherin) could be reversed by co-transfection with miR-128-3p mimics and ZEB1 (Fig. 5A,B). These results indicate that miR-128-3p/ZEB1 axis plays an important role in modulating EMT process in ESCC. Figure 5. View largeDownload slide EMT is regulated by miR-128-3p via suppression of ZEB1 (A) The relative expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells were evaluated by qRT-PCR. (B) Immunofluorescence staining analysis detected the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH was used as the internal control. **P < 0.01. Figure 5. View largeDownload slide EMT is regulated by miR-128-3p via suppression of ZEB1 (A) The relative expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells were evaluated by qRT-PCR. (B) Immunofluorescence staining analysis detected the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH was used as the internal control. **P < 0.01. Discussion ESCC is one of the most common cancers in China [32]. However, the prognosis of advanced ESCC patients remains poor [33]. EMT and MET have been viewed as regulatory mechanisms of invasion and metastasis in malignant tumors [34–37]. Therefore, EMT-related functions in malignancies have been considered as potential new therapeutic tool for cancers including ESCC. ZEB1 has been previously reported as a strong functional gene which contributes to distant metastasis in colorectal adenocarcinoma, breast cancer and lung adenocarcinoma [38–40]. Moreover, ZEB1 has been found to be associated with cancer progression and EMT induction [41,42]. Harazono et al. [43] found that EMT is inhibited by miR-655 via targeting ZEB1 and TGFBR2, which was regarded as potential prognostic markers and therapeutic agent for cancer. On the other hand, it has been reported that miR-150 is associated with poor prognosis in ESCC through targeting ZEB1 to induce EMT [44]. Over-expression of ZEB1 has been proved to induce ESCC invasiveness and generate unfavorable prognosis [45]. Zhang et al. [46] found that methylation of E-cadherin regulated by miR-200b-ZEB1/2 axis could promote invasion via activating the Kindlin-2/integrin β1/AKT signal pathway in ESCC. Recently, miRNAs have attracted much attention because of their biological roles in regulating gene expression in ESCC [47–49]. miRNAs are some tiny non-coding endogenous RNAs which take part in multiple tumorigenic processes of ESCC, including proliferation, invasion and metastasis [25,48,50]. Khan et al. [51] revealed that miR-128 regulates the progression of prostate cancer. In breast cancers, down-expression of miR-128 that releases Bmi-1 and over-expression of ABCC5 which is a feature of stem cell are involved in chemotherapeutic resistance [52]. It has also been found that miR-128 activates the PTEN-AKT pathway and miR-128 is down-expressed in pituitary tumors [53]. Similarly, miR-128-3p has been regarded as an inhibitor in the progression of HCC by regulating PIK3R1 and PI3K/AKT signal pathway, and has also been regarded as a prognostic marker for HCC patients [54]. In lung cancer, PFKL/miR-128 axis inhibits AKT signaling pathway, and leads to shorter survival time [55]. Jiang et al. [56] found that miR-128 could also reverse the gefitinib resistance of the lung cancer stem cells by blocking the c-met/PI3K/AKT pathway. In glioma, miR-128 was found to inhibit the growth of multiforme glioblastoma and stem-like cells by regulating BMI1 and E2F3 [57]. But in another study, miR-128-3p was identified as an oncogene through targeting PHF6 in T-cell acute lymphoblastic leukemia [58]. MiR-128-3p is also upregulated in HCC, and it may be used as a potential biomarker for diagnosis in combination with CYP2C9 [59]. The expression level of miR-128-3p was found to be obviously higher in gastric cancer tissues compared with that in adjacent non-tumor tissues, which was confirmed by PCR assay [60]. In summary, although miR-128-3p has been reported to be low-expressed in many cancers [61,62], its behavior in human ESCC remains unclear. In this study, we first tested the expression levels of miR-128-3p in ESCC tissues and ESCC cells, and found that miR-128-3p was markedly downregulated in ESCC tissues compared with that in adjacent normal esophageal tissues. Next, we found that low expression of miR-128-3p is correlated with poor prognosis of patients in ESCC, which indicated that MiR-128-3p might be a diagnostic indicator and prognostic factor. Then, we demonstrated that miR-128-3p is able to restrain proliferation, invasion, and metastasis in ESCC cells. Moreover, ZEB1 was confirmed to be the direct downstream target of miR-128-3p. Furthermore, miR-128-3p was found to target ZEB1 to block the EMT process. Taken together, our results indicate that miR-128-3p may reduce the proliferation, migration and metastasis of ESCC cells by targeting ZEB1 and inhibit the EMT process. miR-128-3p might be a sensitive prognostic factor and novel target therapy for ESCC treatment. Funding This work was supported by the grant from Foundation of Sichuan Province (No. JH2016030). References 1 Adenis A, Robb WB, Mariette C. Esophageal carcinoma. N Engl J Med  2015, 372: 1471. Google Scholar PubMed  2 Argyres MI. Esophageal cancer. N Engl J Med  2004, 350: 1363– 1364. Google Scholar CrossRef Search ADS PubMed  3 Chang AY. Treatment of esophageal cancer. N Engl J Med  1999, 340: 1686– 1687. Google Scholar PubMed  4 Baba Y, Watanabe M, Yoshida N, Baba H. Neoadjuvant treatment for esophageal squamous cell carcinoma. World J Gastrointest Oncol  2014, 6: 121– 128. Google Scholar CrossRef Search ADS PubMed  5 Chen HS, Hung WH, Ko JL, Hsu PK, Liu CC, Wu SC, Lin CH, et al.  . Impact of treatment modalities on survival of patients with locoregional esophageal squamous-cell carcinoma in Taiwan. Medicine  2016, 95: e3018. Google Scholar CrossRef Search ADS PubMed  6 Chen X, Zhang H, Zhu H, Yang X, Yang Y, Yang Y, Min H, et al.  . Endostatin combined with radiotherapy suppresses vasculogenic mimicry formation through inhibition of epithelial-mesenchymal transition in esophageal cancer. Tumour Biol  2015, 4: 4679– 4688. 7 Gao SG, Liu RM, Zhao YG, Wang P, Ward DG, Wang GC, Guo XQ, et al.  . Integrative topological analysis of mass spectrometry data reveals molecular features with clinical relevance in esophageal squamous cell carcinoma. Sci Rep  2016, 6: 21586. Google Scholar CrossRef Search ADS PubMed  8 Peinado H, Olmeda D, Cano A. Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer  2007, 7: 415– 428. Google Scholar CrossRef Search ADS PubMed  9 Postigo AA, Depp JL, Taylor JJ, Kroll KL. Regulation of Smad signaling through a differential recruitment of coactivators and corepressors by ZEB proteins. EMBO J  2003, 22: 2453– 2462. Google Scholar CrossRef Search ADS PubMed  10 Diaz VM, de Herreros AG. F-box proteins: keeping the epithelial-to-mesenchymal transition (EMT) in check. Semin Cancer Biol  2016, 36: 71– 79. Google Scholar CrossRef Search ADS PubMed  11 Cieply B, Farris J, Denvir J, Ford HL, Frisch SM. Epithelial-mesenchymal transition and tumor suppression are controlled by a reciprocal feedback loop between ZEB1 and Grainyhead-like-2. Cancer Res  2013, 73: 6299– 6309. Google Scholar CrossRef Search ADS PubMed  12 Ohashi S, Natsuizaka M, Naganuma S, Kagawa S, Kimura S, Itoh H, Kalman RA, et al.  . A NOTCH3-mediated squamous cell differentiation program limits expansion of EMT-competent cells that express the ZEB transcription factors. Cancer Res  2011, 71: 6836– 6847. Google Scholar CrossRef Search ADS PubMed  13 Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ. A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res  2008, 68: 7846– 7854. Google Scholar CrossRef Search ADS PubMed  14 Diaz-Lopez A, Diaz-Martin J, Moreno-Bueno G, Cuevas EP, Santos V, Olmeda D, Portillo F, et al.  . Zeb1 and Snail1 engage miR-200f transcriptional and epigenetic regulation during EMT. Int J Cancer  2015, 136: E62– E73. Google Scholar CrossRef Search ADS PubMed  15 Gheldof A, Hulpiau P, van Roy F, De Craene B, Berx G. Evolutionary functional analysis and molecular regulation of the ZEB transcription factors. Cell Mol Life Sci  2012, 69: 2527– 2541. Google Scholar CrossRef Search ADS PubMed  16 Vandewalle C, Van Roy F, Berx G. The role of the ZEB family of transcription factors in development and disease. Cell Mol Life Sci  2009, 66: 773– 787. Google Scholar CrossRef Search ADS PubMed  17 Senfter D, Holzner S, Kalipciyan M, Staribacher A, Walzl A, Huttary N, Krieger S, et al.  . Loss of miR-200 family in 5-fluorouracil resistant colon cancer drives lymphendothelial invasiveness in vitro. Hum Mol Genet  2015, 24: 3689– 3698. Google Scholar PubMed  18 Browne G, Sayan AE, Tulchinsky E. ZEB proteins link cell motility with cell cycle control and cell survival in cancer. Cell cycle  2010, 9: 886– 891. Google Scholar CrossRef Search ADS PubMed  19 Bakhshandeh B, Soleimani M, Paylakhi SH, Ghaemi N. A microRNA signature associated with chondrogenic lineage commitment. J Genet  2012, 91: 171– 182. Google Scholar CrossRef Search ADS PubMed  20 Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell  2004, 116: 281– 297. Google Scholar CrossRef Search ADS PubMed  21 Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer  2006, 6: 857– 866. Google Scholar CrossRef Search ADS PubMed  22 Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell  2005, 120: 15– 20. Google Scholar CrossRef Search ADS PubMed  23 Chen G, Peng J, Zhu W, Tao G, Song Y, Zhou X, Wang W. Combined downregulation of microRNA-133a and microRNA-133b predicts chemosensitivity of patients with esophageal squamous cell carcinoma undergoing paclitaxel-based chemotherapy. Med Oncol  2014, 31: 263. Google Scholar CrossRef Search ADS PubMed  24 Cui XB, Li S, Li TT, Peng H, Jin TT, Zhang SM, Liu CX, et al.  . Targeting oncogenic PLCE1 by miR-145 impairs tumor proliferation and metastasis of esophageal squamous cell carcinoma. Oncotarget  2016, 7: 1777– 1795. Google Scholar PubMed  25 Fong LY, Taccioli C, Jing R, Smalley KJ, Alder H, Jiang Y, Fadda P, et al.  . MicroRNA dysregulation and esophageal cancer development depend on the extent of zinc dietary deficiency. Oncotarget  2016, 10: 10723– 10738. 26 Qin Y, Zhang Y, Tang Q, Jin L, Chen Y. SQLE induces epithelial-to-mesenchymal transition by regulating of miR-133b in esophageal squamous cell carcinoma. Acta Biochim Biophys Sin  2017, 49: 138– 148. Google Scholar PubMed  27 Fu HL, Wu DP, Wang XF, Wang JG, Jiao F, Song LL, Xie H, et al.  . Altered miRNA expression is associated with differentiation, invasion, and metastasis of esophageal squamous cell carcinoma (ESCC) in patients from Huaian, China. Cell Biochem Biophys  2013, 67: 657– 668. Google Scholar CrossRef Search ADS PubMed  28 Fu W, Pang L, Chen Y, Yang L, Zhu J, Wei Y. The microRNAs as prognostic biomarkers for survival in esophageal cancer: a meta-analysis. SciWorld J  2014, 2014: 523979. 29 Gu J, Wang Y, Wu X. MicroRNA in the pathogenesis and prognosis of esophageal cancer. Curr Pharm Des  2013, 19: 1292– 1300. Google Scholar CrossRef Search ADS PubMed  30 Yi J, Jin L, Chen J, Feng B, He Z, Chen L, Song H. MiR-375 suppresses invasion and metastasis by direct targeting of SHOX2 in esophageal squamous cell carcinoma. Acta Biochim Biophys Sin  2017, 49: 159– 169. Google Scholar PubMed  31 Jin L, Yi J, Gao Y, Han S, He Z, Chen L, Song H. MiR-630 inhibits invasion and metastasis in esophageal squamous cell carcinoma. Acta Biochim Biophys Sin  2016, 48: 810– 819. Google Scholar CrossRef Search ADS PubMed  32 Wu C, Kraft P, Zhai K, Chang J, Wang Z, Li Y, Hu Z, et al.  . Genome-wide association analyses of esophageal squamous cell carcinoma in Chinese identify multiple susceptibility loci and gene-environment interactions. Nat Genet  2012, 44: 1090– 1097. Google Scholar CrossRef Search ADS PubMed  33 Wu C, Li D, Jia W, Hu Z, Zhou Y, Yu D, Tong T, et al.  . Genome-wide association study identifies common variants in SLC39A6 associated with length of survival in esophageal squamous-cell carcinoma. Nat Genet  2013, 45: 632– 638. Google Scholar CrossRef Search ADS PubMed  34 Cooke VG, LeBleu VS, Keskin D, Khan Z, O’Connell JT, Teng Y, Duncan MB, et al.  . Pericyte depletion results in hypoxia-associated epithelial-to-mesenchymal transition and metastasis mediated by met signaling pathway. Cancer Cell  2012, 21: 66– 81. Google Scholar CrossRef Search ADS PubMed  35 Brabletz T. EMT and MET in metastasis: where are the cancer stem cells? Cancer cell  2012, 22: 699– 701. Google Scholar CrossRef Search ADS PubMed  36 Thompson EW, Haviv I. The social aspects of EMT-MET plasticity. Nat Med  2011, 17: 1048– 1049. Google Scholar CrossRef Search ADS PubMed  37 Liu X, Sun H, Qi J, Wang L, He S, Liu J, Feng C, et al.  . Sequential introduction of reprogramming factors reveals a time-sensitive requirement for individual factors and a sequential EMT-MET mechanism for optimal reprogramming. Nat Cell Biol  2013, 15: 829– 838. Google Scholar CrossRef Search ADS PubMed  38 Singh AB, Sharma A, Smith JJ, Krishnan M, Chen X, Eschrich S, Washington MK, et al.  . Claudin-1 up-regulates the repressor ZEB-1 to inhibit E-cadherin expression in colon cancer cells. Gastroenterology  2011, 141: 2140– 2153. Google Scholar CrossRef Search ADS PubMed  39 Chaffer CL, Marjanovic ND, Lee T, Bell G, Kleer CG, Reinhardt F, D’Alessio AC, et al.  . Poised chromatin at the ZEB1 promoter enables breast cancer cell plasticity and enhances tumorigenicity. Cell  2013, 154: 61– 74. Google Scholar CrossRef Search ADS PubMed  40 Yang Y, Ahn YH, Chen Y, Tan X, Guo L, Gibbons DL, Ungewiss C, et al.  . ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest  2014, 124: 2696– 2708. Google Scholar CrossRef Search ADS PubMed  41 Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, Sonntag A, Waldvogel B, et al.  . The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs. Nat Cell Biol  2009, 11: 1487– 1495. Google Scholar CrossRef Search ADS PubMed  42 Krebs AM, Mitschke J, Lasierra Losada M, Schmalhofer O, Boerries M, Busch H, Boettcher M, et al.  . The EMT-activator Zeb1 is a key factor for cell plasticity and promotes metastasis in pancreatic cancer. Nat Cell Biol  2017, 19: 518– 529. Google Scholar CrossRef Search ADS PubMed  43 Harazono Y, Muramatsu T, Endo H, Uzawa N, Kawano T, Harada K, Inazawa J, et al.  . miR-655 is an EMT-suppressive microRNA targeting ZEB1 and TGFBR2. PLoS One  2013, 8: e62757. Google Scholar CrossRef Search ADS PubMed  44 Yokobori T, Suzuki S, Tanaka N, Inose T, Sohda M, Sano A, Sakai M, et al.  . MiR-150 is associated with poor prognosis in esophageal squamous cell carcinoma via targeting the EMT inducer ZEB1. Cancer Sci  2013, 104: 48– 54. Google Scholar CrossRef Search ADS PubMed  45 Ma J, Zhan Y, Xu Z, Li Y, Luo A, Ding F, Cao X, et al.  . ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma. Cancer Lett  2017, 398: 37– 45. Google Scholar CrossRef Search ADS PubMed  46 Zhang HF, Alshareef A, Wu C, Li S, Jiao JW, Cao HH, Lai R, et al.  . Loss of miR-200b promotes invasion via activating the Kindlin-2/integrin beta1/AKT pathway in esophageal squamous cell carcinoma: An E-cadherin-independent mechanism. Oncotarget  2015, 6: 28949– 28960. Google Scholar PubMed  47 Wen J, Luo K, Liu H, Liu S, Lin G, Hu Y, Zhang X, et al.  . MiRNA expression analysis of pretreatment biopsies predicts the pathological response of esophageal squamous cell carcinomas to neoadjuvant chemoradiotherapy. Ann Surg  2016, 263: 942– 948. Google Scholar CrossRef Search ADS PubMed  48 Zhang C, Wang C, Chen X, Yang C, Li K, Wang J, Dai J, et al.  . Expression profile of microRNAs in serum: a fingerprint for esophageal squamous cell carcinoma. Clin Chem  2010, 56: 1871– 1879. Google Scholar CrossRef Search ADS PubMed  49 Komatsu S, Ichikawa D, Takeshita H, Tsujiura M, Morimura R, Nagata H, Kosuga T, et al.  . Circulating microRNAs in plasma of patients with oesophageal squamous cell carcinoma. Br J Cancer  2011, 105: 104– 111. Google Scholar CrossRef Search ADS PubMed  50 Li BX, Yu Q, Shi ZL, Li P, Fu S. Circulating microRNAs in esophageal squamous cell carcinoma: association with locoregional staging and survival. Int J Clin Exp Med  2015, 8: 7241– 7250. Google Scholar PubMed  51 Khan AP, Poisson LM, Bhat VB, Fermin D, Zhao R, Kalyana-Sundaram S, Michailidis G, et al.  . Quantitative proteomic profiling of prostate cancer reveals a role for miR-128 in prostate cancer. Mol Cell Proteomics  2010, 9: 298– 312. Google Scholar CrossRef Search ADS PubMed  52 Zhu Y, Yu F, Jiao Y, Feng J, Tang W, Yao H, Gong C, et al.  . Reduced miR-128 in breast tumor-initiating cells induces chemotherapeutic resistance via Bmi-1 and ABCC5. Clin Cancer Res  2011, 17: 7105– 7115. Google Scholar CrossRef Search ADS PubMed  53 Palumbo T, Faucz FR, Azevedo M, Xekouki P, Iliopoulos D, Stratakis CA. Functional screen analysis reveals miR-26b and miR-128 as central regulators of pituitary somatomammotrophic tumor growth through activation of the PTEN-AKT pathway. Oncogene  2013, 32: 1651– 1659. Google Scholar CrossRef Search ADS PubMed  54 Huang CY, Huang XP, Zhu JY, Chen ZG, Li XJ, Zhang XH, Huang S, et al.  . miR-128-3p suppresses hepatocellular carcinoma proliferation by regulating PIK3R1 and is correlated with the prognosis of HCC patients. Oncol Rep  2015, 33: 2889– 2898. Google Scholar CrossRef Search ADS PubMed  55 Yang J, Li J, Le Y, Zhou C, Zhang S, Gong Z. PFKL/miR-128 axis regulates glycolysis by inhibiting AKT phosphorylation and predicts poor survival in lung cancer. Am J Cancer Res  2016, 6: 473– 485. Google Scholar PubMed  56 Jiang J, Feng X, Zhou W, Wu Y, Yang Y. MiR-128 reverses the gefitinib resistance of the lung cancer stem cells by inhibiting the c-met/PI3K/AKT pathway. Oncotarget  2016, 7: 73188– 73199. Google Scholar PubMed  57 Shan ZN, Tian R, Zhang M, Gui ZH, Wu J, Ding M, Zhou XF, et al.  . miR128-1 inhibits the growth of glioblastoma multiforme and glioma stem-like cells via targeting BMI1 and E2F3. Oncotarget  2016, 7: 78813– 78826. Google Scholar PubMed  58 Mets E, Van Peer G, Van der Meulen J, Boice M, Taghon T, Goossens S, Mestdagh P, et al.  . MicroRNA-128-3p is a novel oncomiR targeting PHF6 in T-cell acute lymphoblastic leukemia. Haematologica  2014, 99: 1326– 1333. Google Scholar CrossRef Search ADS PubMed  59 Yu D, Green B, Marrone A, Guo Y, Kadlubar S, Lin D, Fuscoe J, et al.  . Suppression of CYP2C9 by microRNA hsa-miR-128-3p in human liver cells and association with hepatocellular carcinoma. Sci Rep  2015, 5: 8534. Google Scholar CrossRef Search ADS PubMed  60 Ibarrola-Villava M, Llorca-Cardenosa MJ, Tarazona N, Mongort C, Fleitas T, Perez-Fidalgo JA, Rosello S, et al.  . Deregulation of ARID1A, CDH1, cMET and PIK3CA and target-related microRNA expression in gastric cancer. Oncotarget  2015, 6: 26935– 26945. Google Scholar CrossRef Search ADS PubMed  61 Mi S, Lu J, Sun M, Li Z, Zhang H, Neilly MB, Wang Y, et al.  . MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia. Proc Natl Acad Sci USA  2007, 104: 19971– 19976. Google Scholar CrossRef Search ADS PubMed  62 Xiaoli Z, Yawei W, Lianna L, Haifeng L, Hui Z. Screening of target genes and regulatory function of miRNAs as prognostic indicators for prostate cancer. Med Sci Monit  2015, 21: 3748– 3759. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Acta Biochimica et Biophysica Sinica Oxford University Press

Tumor suppressor miR-128-3p inhibits metastasis and epithelial–mesenchymal transition by targeting ZEB1 in esophageal squamous-cell cancer

Loading next page...
 
/lp/ou_press/tumor-suppressor-mir-128-3p-inhibits-metastasis-and-epithelial-6bUAJjUisJ
Publisher
Oxford University Press
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
1672-9145
eISSN
1745-7270
D.O.I.
10.1093/abbs/gmx132
Publisher site
See Article on Publisher Site

Abstract

Abstract MicroRNAs (miRNAs) are some short RNAs that regulate multiple biological functions at post-transcriptional levels, such as tumorigenic processes, inflammatory lesions and cell apoptosis. Zinc finger E-box binding homeobox factor 1 (ZEB1) is a crucial mediator of epithelial–mesenchymal transition (EMT). It induces malignant progression of various cancers including human esophageal squamous-cell carcinoma (ESCC). In this study, we found that miR-128-3p was downregulated in ESCC tissues and cells by using PCR. Moreover, down-regulated expression of miR-128-3p was testified to be associated with poor prognosis of ESCC patients and might be regarded as an independent prognostic factor. Then, we examined the role of miR-128-3p in ESCC cells, and found that miR-128-3p could suppress the cell migration and invasion in vitro. Furthermore, ZEB1 was confirmed to be a direct target of miR-128-3p by luciferase reporter assay. Rescue experiments proved that EMT was regulated by miR-128-3p via suppression of ZEB1. Taken all together, we conclude that miR-128-3p suppresses EMT and metastasis via ZEB1, and miR-128-3p may be a critical mediator in ESCC. miR-128-3p, esophageal squamous-cell carcinoma, ZEB1, epithelial–mesenchymal transition, invasion and metastasis Introduction Esophageal cancer (EC) is one of the most serious health problems worldwide, which ranks eighth in human malignancy [1,2]. Esophageal squamous-cell carcinoma (ESCC) is the most prevalent histological type of EC and approximately 90% occurred in Southeast Asia countries, particularly in China [3–5]. Poor clinical outcome and high mortality rate are shown in ESCC patients, due to its high-aggressive ability, distant metastasis and the resistance to adjuvant therapy [6,7]. Therefore, it is imperative to find efficient targets for ESCC therapy. Zinc finger E-box binding homeobox 1 (ZEB1) has a conserved homeobox region and two zinc finger domains at each end of the regions, which belongs to the ZEB family of transcription factors [8,9]. ZEB1 can bind with target DNA sequences and repress cell adhesion molecules as well as cell polarity-associated genes to induce epithelial–mesenchymal transition (EMT) progress [10,11]. It is expressed at low level in the normal epithelium, and is upregulated in the malignant epithelium tumors [12–14]. Aberrant expression of ZEB1 in ESCC has been reported in recent years [15–18]. MicroRNAs (miRNAs) are some short non-coding endogenous RNAs (ncRNAs) which can bind to the 3′-untranslated regions (3′-UTRs) of target mRNAs, and a large number of them can modulate biological behavior of tumors [19–22]. Recently, it has been found that various miRNAs are aberrantly expressed in ESCC [23–31], which indicates that these miRNAs play critical roles in carcinogenesis. In this study, we compared the expression patterns of miR-128-3p in ESCC tissues and normal tissues, and explored the function of miR-128-3p in vitro. ZEB1 was confirmed to be the direct target of miR-128-3p. These results indicate that miR-128-3p may be able to serve as a potential therapeutic target for human ESCC. Material and Methods Cell culture ESCC cell lines TE1, TE10, Kyse-30, Kyse-70, Kyse-150, ECA109 and normal esophageal epithelial cell line (HEEC) were bought from Fudan IBS Cell Center (Shanghai, China). All cells were cultured in RPMI 1640 (Gibco, Gaithersburg, USA) with 10% fetal bovine serum (FBS; Gibco) at 37°C, 95% humidity and 5% CO2. Patients and specimens Forty-seven paired tumor tissues and normal tissues were obtained from patients who were diagnosed as ESCC by means of pathology and were not subject to chemotherapy and/or radiotherapy at Sichuan Cancer Hospital (Chengdu, China) between January 2008 and December 2016. The age of patients ranged from 41 to 78, randomly selected by Department of Pathology. Other details of patients were shown in Table 1. Diagnosis of ESCC was defined according to the tumor node metastasis stage and World Health Organization (WHO) criteria. The study was approved by the ethics committee of Sichuan Province Medical Association. The informed consent forms were signed by every patient. Tissues were stored in liquid nitrogen until use. Table 1. Correlation between miR-128-3p expression and clinical features (n = 47) Variable  miR-128-3p expression  P-value  Low  High  Age        <60  9  13  0.533  ≥60  11  14  Gender        Male  16  23  0.465  Female  4  4  Pathological grading        ≤G2  14  18  0.532  G3  6  9  Tumor range        T1  1  8  0.036*  ≥T2  19  19  Lymph nodes        Negative  3  13  0.018*  Positive  17  14  Pathological stage        <III  8  18  0.064  ≥III  12  9  Tumor location        Locussuperior  1  0  0.497  Locusmedilis  13  19  Locusinferior  6  8  Variable  miR-128-3p expression  P-value  Low  High  Age        <60  9  13  0.533  ≥60  11  14  Gender        Male  16  23  0.465  Female  4  4  Pathological grading        ≤G2  14  18  0.532  G3  6  9  Tumor range        T1  1  8  0.036*  ≥T2  19  19  Lymph nodes        Negative  3  13  0.018*  Positive  17  14  Pathological stage        <III  8  18  0.064  ≥III  12  9  Tumor location        Locussuperior  1  0  0.497  Locusmedilis  13  19  Locusinferior  6  8  Low/high by the sample median. Pearson χ2 test. *P < 0.05 was considered statistically significant. RNA extraction and quantitative real-time PCR Total RNA was extracted from tissue specimens or the cultured cells using TRIzol® reagent (TaKaRa, Dalian, China) following the manufacturer’s protocol. The RNA concentration was measured with a spectrophotometer. The relative fluorescence was collected with SYBR Green dyestuff using STEP ONE RT-qPCR apparatus (Applied Biosystems, Foster, USA). For miRNA, the reverse transcription was conducted by two steps at 37°C for 5 min and 42°C for 25 min in 0.2 ml reaction system without RNA enzymes in accordance with the miRNA reverse transcription kit (Abm, Chengdu, China). For the real-time quantitative PCR (qRT-PCR) reaction, the reagents were added in 48-well PCR plates according to miRNA SYBR Green qRT-PCR kit (Abm) instruction. The annealing temperature was 65°C, 40 cycles. For mRNA, the reverse transcription was conducted by two steps at 95°C for 5 min and 60°C for 15 min in 0.1 ml reaction system in accordance with the miRNA reverse transcription kit (Abm). qRT-PCR was performed at the annealing temperature of 60°C, 35 cycles. Relative gene expression levels were calculated by the ΔΔCt method. The primers used were listed in Table 2. Table 2. Sequence of primers used in qRT-PCR Name  Forward  Reverse  ZEB1  CAGCTTGATACCTGTGAATGGG  CAGCTTGATACCTGTGAATGGG  miR-128-3p  GGTCACAGTGAACCGGTC  GTGCAGGGTCCGAGGT  U6  GCGCGTCGTGAAGCGTTC  GTGCAGGGTCCGAGGT  GAPDH  GCACCGTCAAGGCTGAGAAC  TGGTGAAGACGCCAGTGGA  E-cadherin  TTGTGGCAGAGTGTAATGCTG  GTCCCTGGTCTTCTTGGTCA  B-catenin  GCTGGTGACAGGGAAGACAT  CCATAGTGAAGGCGAACTGC  N-cadherin  CAAACAAGGTGAGACGATGC  GCCAGGATGAGTAAGCGTGT  Vimentin  AGAGAACTTTGCCGTTGAAGC  ACGAAGGTGACGAGCCATT  Name  Forward  Reverse  ZEB1  CAGCTTGATACCTGTGAATGGG  CAGCTTGATACCTGTGAATGGG  miR-128-3p  GGTCACAGTGAACCGGTC  GTGCAGGGTCCGAGGT  U6  GCGCGTCGTGAAGCGTTC  GTGCAGGGTCCGAGGT  GAPDH  GCACCGTCAAGGCTGAGAAC  TGGTGAAGACGCCAGTGGA  E-cadherin  TTGTGGCAGAGTGTAATGCTG  GTCCCTGGTCTTCTTGGTCA  B-catenin  GCTGGTGACAGGGAAGACAT  CCATAGTGAAGGCGAACTGC  N-cadherin  CAAACAAGGTGAGACGATGC  GCCAGGATGAGTAAGCGTGT  Vimentin  AGAGAACTTTGCCGTTGAAGC  ACGAAGGTGACGAGCCATT  U6 and GAPDH were used as the internal references. All reactions were performed in triplicate. Cell transfection MiR-128-3p mimics (miR-128-3p), inhibitor (anti-miR-128-3p) and negative control were synthesized by Genechem Company (Shanghai, China). ZEB1 over-expression plasmid vector was purchased from the Genechem Company. All of these were confirmed by DNA sequence analysis. Cells were transfected using the reagent Lipofectamine 2000 (Invitrogen, Carlsbad, USA) in opti-RPMI 1640 (Gibco) according to manufacturer’s instructions. Luciferase reporter gene assay The luciferase reporter gene plasmid pMIR was used to construct the ZEB1 3′UTR luciferase reporter gene plasmid. The miR-128-3p specific stem-loop primer was 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAGAG-3′. The wild-type miR-128 binding site at 3′UTR of ZEB1 was synthesized with the following primers: forward, 5′-AATATAAAACTTAAATTTTGAAATTCACTGTGTGACTAATAGCATGATGCTCTGCAG-3′; reverse, 5′-TTAATAAAACTGCAGAGCATCATGCTATTAGTCACACAGTGAATTTCAAAATTTAAG-3′. The mutant binding site was synthesized with the following primers: forward, 5′-AATATAAAACTTAAATTTTGAAATTTACGTTGTGACTAATAGCATGATGCTCTGCAG-3′; reverse, 5′-TTAATAAAACTGCAGAGCATCATGCTATTAGTCACACAGTGAATTTCAAAATTTAAG-3′. These wild-type or mutant 3′UTRs were subcloned into pMIR plasmid at the CMV/SacI site at the downstream of the luciferase vector, and defined as pZEB1-wt or pZEB1-mut, respectively. Luciferase reporter gene assay was performed in 96-well plates using the Dual-Glo Luciferase Assay System (Promega, Madison, USA). Cells were co-transfected with miR-128-3p mimics and 10 μg of pZEB1-wt or pZEB1-mut by using Lipofectamine 2000 (Invitrogen, Carlsbad, USA). After 48 h, luciferase activity was measured using a Dual-Luciferase Reporter Assay kit (Promega) according to the manufacturer’s instructions. SpectraMax M5 instrument software (Molecular devices, San Francisco, USA) was used to analyze the results. Each experiment was repeated three times. Western blot analysis The total protein was extracted by ice-cold RIPA lysis buffer supplemented with phenylmethanesulfonyl fluoride (PMSF) and protease inhibitor cocktail. Cell lysates were mixed with loading buffer and subjected in 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by being transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skimmed milk for 2 h, followed by incubation with antibodies against E-cadherin, N-cadherin, Vimentin, β-catenin and ZEB1 (Abcam, Cambridge, UK) at 4°C overnight. Then the membranes were washed with TBST for three times and incubated with the corresponding horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology, Boston, USA) for another 1 h at 37°C. An enhanced ECL Chemiluminescence kit (UltraSignal, Beijing, China) was used to visualize the proteins according to the manufacturer’s protocol. The signals were exposed to X-ray films. GAPDH was used as the loading control. MTT assay Cell proliferation was analyzed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cells were seeded at the density of 5 × 103/well in 96-well plates, and cultured for 24–72 h. MTT solution (5 mg/ml; Sigma, St Louis, USA) was added into the medium and incubated for 4 h at 37°C. After removal of the medium, 100 μl of dimethyl sulfoxide (DMSO) was added into each well. The absorbance at 560 nm was measured with a microplate reader. All reactions were performed in triplicate. Wound healing assay Cells were seeded into 6-well plates with 5 × 105 cells/well and cultured in complete medium. When cell monolayer was formed, an artificial wound was scraped on the cells using a pipette tip. The ability of cells migrating from the confluent sides into the scratch area was observed. The width of the scratch gap was recorded under an inverted microscope and photographed at 6 h and 24 h. The difference between the original width of the wound and the width after cell migration was quantified. Three replicates of each condition were used. Transwell invasion assay For the transwell invasion assay, cells (5 × 103/well) were directly added into the upper chambers of matrigel-coated Transwell plates (Corning Co, Corning, USA) with serum-free medium. The lower chamber contained culture medium with 4% FBS as a chemoattractant. After 24 h, cells on the top of the membrane were scraped off and migrated cells stuck under the membrane were stained with crystal violet. The invaded cells in five random fields were counted under a microscope. Each experiment was conducted for three times. Immunofluorescence assay Cells were cultured on cover slips for 24 h, followed by being fixed with cold acetone for 20 min. Then cells were incubated with antibodies against E-cadherin, N-cadherin, Vimentin and β-catenin at 4°C overnight, followed by incubation with the FITC-conjugated goat anti-rabbit secondary antibodies (Cell Signaling Technology, Boston, USA) for another 1 h. 4′,6-Diamidino-2-phenylindole (DAPI) was used to stain the nuclei of the cells. Finally, cells were observed under a fluorescence microscope. Each experiment was conducted for three times. Statistical analysis Data were presented as the mean ± SD. All statistical analyses were performed using SPSS 17.0 statistical software. Categorical variables were compared by using Fisher’s exact test. Relationship between miR-128-3p expression and clinical features was analyzed by the Pearson χ2 tests. Kaplan–Meier method was used to compare the overall survival curve between high miR-128-3p and low miR-128-3p expression groups by log-rank test. Cox proportional hazards regression model was made to identify hazard factors with overall survival in multivariate survival analysis for ESCC. In vitro assays and luciferase activities assay were analyzed by the Student’s t-test. P < 0.05 was considered statistically significant. Results Down-regulated expression of miR-128-3p in ESCC tissues and ESCC cells To identify the biological function of miR-128-3p, we first used qRT-PCR assay to detect the expression of miR-128-3p in ESCC tissues and cells to speculate and identify the biological function of miR-128-3p. The results of qRT-PCR assay demonstrated that the expression of miR-128-3p was lower in ESCC tissues and cells than that in normal esophageal epithelial tissues and cells (Fig. 1A–C). These data indicated that miR-128-3p might function as a suppressor to hinder the tumorigenesis of ESCC. Figure 1. View largeDownload slide Down-regulated expression of miR-128-3p in ESCC tissues and ESCC cells (A) qRT-PCR analysis detected the relative expression of miR-128-3p in ESCC tissues. (B) miR-128-3p expression in tissue samples of ESCC and adjacent normal tissues. (C) qRT-PCR analysis assessed the relative expression of miR-128-3p in ESCC cells. (D) The overall survivals in 47 ESCC patients were represented by Kaplan–Meier curves. Each experiment was performed in triplicate. U6 was used as an internal control. *P < 0.05; **P < 0.01. Figure 1. View largeDownload slide Down-regulated expression of miR-128-3p in ESCC tissues and ESCC cells (A) qRT-PCR analysis detected the relative expression of miR-128-3p in ESCC tissues. (B) miR-128-3p expression in tissue samples of ESCC and adjacent normal tissues. (C) qRT-PCR analysis assessed the relative expression of miR-128-3p in ESCC cells. (D) The overall survivals in 47 ESCC patients were represented by Kaplan–Meier curves. Each experiment was performed in triplicate. U6 was used as an internal control. *P < 0.05; **P < 0.01. Low expression of miR-128-3p is correlated with poor prognosis of patients in ESCC To address the clinical significance of miR-128-3p in ESCC, 47 patients were employed to evaluate the correlations between miR-128-3p expression level and the clinicopathological features. Kaplan–Meier method analysis (log-rank test) was used to confirm that miR-128-3p expression was associated with overall survival rates of patients (P = 0.002; Fig. 1D). Correlation between miR-128-3p expression and clinical features analysis implied that miR-128-3p expression is correlated with tumor range and lymphatic metastasis (P = 0.036 and 0.018, respectively; Table 1). Proportional hazards method (Cox regression) analysis showed that low miR-128-3p expression (P = 0.042) was an adverse prognostic factor in addition to lymph nodes number (P = 0.013) and pathological stage (P = 0.001) (Table 3). Taken together, miR-128-3p has significant biological function and may be used as a specific biomarker for poor prognosis in ESCC. Table 3. Clinical data analysis by proportional hazards method Variable  Category  HR  P-value  Age  <60  0.293  0.588  ≥60  Gender  Male  0.212  0.645  Female  Pathological grading  <G2  3.325  0.068  ≥G2  Tumor location  Locussuperior  1.900  0.387  Locusmedilis  Locusinferior  Tumor range  T1  0.284  0.594  T2  T3  T4  Lymph nodes number  <7  6.166  0.013*  ≥7  Pathological stage  <III  11.958  0.001*  ≥III  miR-128-3p expression  Low  4.117  0.042*  High  Variable  Category  HR  P-value  Age  <60  0.293  0.588  ≥60  Gender  Male  0.212  0.645  Female  Pathological grading  <G2  3.325  0.068  ≥G2  Tumor location  Locussuperior  1.900  0.387  Locusmedilis  Locusinferior  Tumor range  T1  0.284  0.594  T2  T3  T4  Lymph nodes number  <7  6.166  0.013*  ≥7  Pathological stage  <III  11.958  0.001*  ≥III  miR-128-3p expression  Low  4.117  0.042*  High  A positive, independent prognostic importance of miR-128-3p expression (P = 0.042), in addition to the independent prognostic impact of lymph nodes number (P = 0.013) and pathological stage (P = 0.001). HR, hazard ratio. *P < 0.05 was considered statistically significant. MiR-128-3p suppresses invasion and metastasis in ESCC To further define the potential biological significance of miR-128-3p in ESCC, we used miR-128-3p mimics and inhibitor to perform the gain and loss function analysis. MTT assay showed that up-regulation of miR-128-3p diminished ESCC cells proliferation, while down-regulation of miR-128-3p enhanced ESCC cells proliferation (Fig. 2A). Meanwhile, the wound scratch healing assay revealed that the migratory ability of ESCC cells transfected with miR-128-3p was obviously lower than those transfected with miR-NC. The migratory ability of ESCC cells transfected with miR-128-3p inhibitor (anti-miR-128-3p) was higher than those transfected with the negative control (anti-miR-NC) (Fig. 2B). Furthermore, the effects of miR-128-3p on invasion of ESCC cells were further investigated. Transwell assay showed that ectogenic miR-128-3p repressed the invasive ability of ESCC cells and knockdown of miR-128-3p increased the invasive ability of ESCC cells (Fig. 2C). These results suggest that miR-128-3p may effectively suppress the growth, migration and invasion of ESCC cells in vitro. Figure 2. View largeDownload slide MiR-128-3p suppresses invasion and metastasis in ESCC (A) MTT assay was performed to detect cell proliferation ability. (B) Wound healing was photographed under a microscope at 100× magnification after 6 h and 24 h. (C) Transwell invasion assay was used to observe of invasion ability of ESCC cells after transfected with miR-NC, miR-128-3p, anti-miR-NC and anti-miR-128-3p. Cells were viewed in five random fields at 100× magnification and counted. Each experiment was performed in triplicate. **P < 0.01. Figure 2. View largeDownload slide MiR-128-3p suppresses invasion and metastasis in ESCC (A) MTT assay was performed to detect cell proliferation ability. (B) Wound healing was photographed under a microscope at 100× magnification after 6 h and 24 h. (C) Transwell invasion assay was used to observe of invasion ability of ESCC cells after transfected with miR-NC, miR-128-3p, anti-miR-NC and anti-miR-128-3p. Cells were viewed in five random fields at 100× magnification and counted. Each experiment was performed in triplicate. **P < 0.01. EMT is regulated by miR-128-3p To find out the underlying mechanism that miR-128-3p suppresses cell metastasis, qRT-PCR assay was conducted. It was found that miR-128-3p mimics could stimulate the expression of epithelial markers (E-cadherin and β-catenin), remarkably retard the expression of mesenchymal markers (Vimentin and N-cadherin). Knockdown of miR-128-3p could repress the expression of epithelial markers (E-cadherin and β-catenin), and prominently induce the expression of mesenchymal markers (Vimentin and N-cadherin) (Fig. 3A). Immunofluorescence assay showed that the expression of epithelial protein markers was increased in miR-128-3p-transfected ESCC cells, while the expression of mesenchymal protein markers was notably decreased. After transfection with anti-miR-128-3p, the expression of epithelial protein markers was significantly decreased in ESCC cells, while the expression of mesenchymal protein markers was strengthened (Fig. 3B). These data suggest that miR-128-3p may suppress the EMT of ESCC cells in vitro. Figure 3. View largeDownload slide EMT is regulated by miR-128-3p (A) qRT-PCR analyzed the relative expression of epithelial markers (E-cadherin and β-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. (B) Immunofluorescence staining assay of the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH served as the internal control. **P < 0.01. Figure 3. View largeDownload slide EMT is regulated by miR-128-3p (A) qRT-PCR analyzed the relative expression of epithelial markers (E-cadherin and β-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. (B) Immunofluorescence staining assay of the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH served as the internal control. **P < 0.01. ZEB1 is directly targeted by miR-128-3p in ESCC It is well known that ZEB1 belongs to the ZEB family of transcription factors that can stimulate invasion and metastasis [32,33]. This has also been confirmed in ESCC [34,35]. However, the underlying upstream factor was unknown. Therefore, luciferase reporter gene assay was performed to test whether ZEB1 was directly targeted by miR-128-3p in ESCC. It was found that miR-128-3p notably inhibited the luciferase activities when co-transfected with the wild-type ZEB1 3′UTR (Fig. 4A), while the suppressive effects of miR-128-3p on luciferase activity were attenuated when the binding sequences were mutated in two ESCC cell lines (Fig. 4B). Furthermore, qRT-PCR and western blot analysis results confirmed that ZEB1 is the direct target of miR-128-3p. qRT-PCR and western blot analysis results showed that the expression of ZEB1 was reduced by the over-expression of miR-128-3p, and the expression of ZEB1 was increased by knockdown of miR-128-3p (Fig. 4C–E). These data imply that ZEB1 directly and negatively regulates miR-128-3p. Figure 4. View largeDownload slide ZEB1 is directly targeted by miR-128-3p in ESCC (A) Mutation was generated on the ZEB1 3′UTR sequence in the complementary site of miR-128-3p. ZEB1 3′UTR fragment contained wild-type or mutant miR-128-3p. (B) The cells were co-transfected with negative control or miR-128-3p plasmids and wild-type or mutant ZEB1 3′UTR vectors. Luciferase activity was determined. (C) The relative expression of miR-128-3p in ESCC cells transfected with miR-128-3p mimics and inhibitor, which was tested by qRT-PCR. (D) The relative expression of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor by qRT-PCR. (E) Western blot analysis examined the expression level of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor. Each experiment was performed in triplicate. U6 and GAPDH were used as the internal control. **P < 0.01. Figure 4. View largeDownload slide ZEB1 is directly targeted by miR-128-3p in ESCC (A) Mutation was generated on the ZEB1 3′UTR sequence in the complementary site of miR-128-3p. ZEB1 3′UTR fragment contained wild-type or mutant miR-128-3p. (B) The cells were co-transfected with negative control or miR-128-3p plasmids and wild-type or mutant ZEB1 3′UTR vectors. Luciferase activity was determined. (C) The relative expression of miR-128-3p in ESCC cells transfected with miR-128-3p mimics and inhibitor, which was tested by qRT-PCR. (D) The relative expression of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor by qRT-PCR. (E) Western blot analysis examined the expression level of ZEB1 in ESCC cells transfected with miR-128-3p mimics and inhibitor. Each experiment was performed in triplicate. U6 and GAPDH were used as the internal control. **P < 0.01. EMT is regulated by miR-128-3p via suppression of ZEB1 ZEB1 has been proved to induce cell EMT. However, the potential upstream target of ZEB1 to control EMT process in ESCC is still unknown. To explore whether the regulating effects of miR-128-3p on EMT are through suppressing ZEB1, rescue experiments were performed. It was found that the expression of epithelial markers (E-cadherin and β-catenin) and mesenchymal markers (Vimentin and N-cadherin) could be reversed by co-transfection with miR-128-3p mimics and ZEB1 (Fig. 5A,B). These results indicate that miR-128-3p/ZEB1 axis plays an important role in modulating EMT process in ESCC. Figure 5. View largeDownload slide EMT is regulated by miR-128-3p via suppression of ZEB1 (A) The relative expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells were evaluated by qRT-PCR. (B) Immunofluorescence staining analysis detected the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH was used as the internal control. **P < 0.01. Figure 5. View largeDownload slide EMT is regulated by miR-128-3p via suppression of ZEB1 (A) The relative expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells were evaluated by qRT-PCR. (B) Immunofluorescence staining analysis detected the expression of epithelial markers (E-cadherin and ß-catenin) and mesenchymal markers (N-cadherin and Vimentin) in ESCC cells. DAPI was used to visualize the nuclei. Each field of view was observed at 200× magnification. Each experiment was performed in triplicate. GAPDH was used as the internal control. **P < 0.01. Discussion ESCC is one of the most common cancers in China [32]. However, the prognosis of advanced ESCC patients remains poor [33]. EMT and MET have been viewed as regulatory mechanisms of invasion and metastasis in malignant tumors [34–37]. Therefore, EMT-related functions in malignancies have been considered as potential new therapeutic tool for cancers including ESCC. ZEB1 has been previously reported as a strong functional gene which contributes to distant metastasis in colorectal adenocarcinoma, breast cancer and lung adenocarcinoma [38–40]. Moreover, ZEB1 has been found to be associated with cancer progression and EMT induction [41,42]. Harazono et al. [43] found that EMT is inhibited by miR-655 via targeting ZEB1 and TGFBR2, which was regarded as potential prognostic markers and therapeutic agent for cancer. On the other hand, it has been reported that miR-150 is associated with poor prognosis in ESCC through targeting ZEB1 to induce EMT [44]. Over-expression of ZEB1 has been proved to induce ESCC invasiveness and generate unfavorable prognosis [45]. Zhang et al. [46] found that methylation of E-cadherin regulated by miR-200b-ZEB1/2 axis could promote invasion via activating the Kindlin-2/integrin β1/AKT signal pathway in ESCC. Recently, miRNAs have attracted much attention because of their biological roles in regulating gene expression in ESCC [47–49]. miRNAs are some tiny non-coding endogenous RNAs which take part in multiple tumorigenic processes of ESCC, including proliferation, invasion and metastasis [25,48,50]. Khan et al. [51] revealed that miR-128 regulates the progression of prostate cancer. In breast cancers, down-expression of miR-128 that releases Bmi-1 and over-expression of ABCC5 which is a feature of stem cell are involved in chemotherapeutic resistance [52]. It has also been found that miR-128 activates the PTEN-AKT pathway and miR-128 is down-expressed in pituitary tumors [53]. Similarly, miR-128-3p has been regarded as an inhibitor in the progression of HCC by regulating PIK3R1 and PI3K/AKT signal pathway, and has also been regarded as a prognostic marker for HCC patients [54]. In lung cancer, PFKL/miR-128 axis inhibits AKT signaling pathway, and leads to shorter survival time [55]. Jiang et al. [56] found that miR-128 could also reverse the gefitinib resistance of the lung cancer stem cells by blocking the c-met/PI3K/AKT pathway. In glioma, miR-128 was found to inhibit the growth of multiforme glioblastoma and stem-like cells by regulating BMI1 and E2F3 [57]. But in another study, miR-128-3p was identified as an oncogene through targeting PHF6 in T-cell acute lymphoblastic leukemia [58]. MiR-128-3p is also upregulated in HCC, and it may be used as a potential biomarker for diagnosis in combination with CYP2C9 [59]. The expression level of miR-128-3p was found to be obviously higher in gastric cancer tissues compared with that in adjacent non-tumor tissues, which was confirmed by PCR assay [60]. In summary, although miR-128-3p has been reported to be low-expressed in many cancers [61,62], its behavior in human ESCC remains unclear. In this study, we first tested the expression levels of miR-128-3p in ESCC tissues and ESCC cells, and found that miR-128-3p was markedly downregulated in ESCC tissues compared with that in adjacent normal esophageal tissues. Next, we found that low expression of miR-128-3p is correlated with poor prognosis of patients in ESCC, which indicated that MiR-128-3p might be a diagnostic indicator and prognostic factor. Then, we demonstrated that miR-128-3p is able to restrain proliferation, invasion, and metastasis in ESCC cells. Moreover, ZEB1 was confirmed to be the direct downstream target of miR-128-3p. Furthermore, miR-128-3p was found to target ZEB1 to block the EMT process. Taken together, our results indicate that miR-128-3p may reduce the proliferation, migration and metastasis of ESCC cells by targeting ZEB1 and inhibit the EMT process. miR-128-3p might be a sensitive prognostic factor and novel target therapy for ESCC treatment. Funding This work was supported by the grant from Foundation of Sichuan Province (No. JH2016030). References 1 Adenis A, Robb WB, Mariette C. Esophageal carcinoma. N Engl J Med  2015, 372: 1471. Google Scholar PubMed  2 Argyres MI. Esophageal cancer. N Engl J Med  2004, 350: 1363– 1364. Google Scholar CrossRef Search ADS PubMed  3 Chang AY. Treatment of esophageal cancer. N Engl J Med  1999, 340: 1686– 1687. Google Scholar PubMed  4 Baba Y, Watanabe M, Yoshida N, Baba H. Neoadjuvant treatment for esophageal squamous cell carcinoma. World J Gastrointest Oncol  2014, 6: 121– 128. Google Scholar CrossRef Search ADS PubMed  5 Chen HS, Hung WH, Ko JL, Hsu PK, Liu CC, Wu SC, Lin CH, et al.  . Impact of treatment modalities on survival of patients with locoregional esophageal squamous-cell carcinoma in Taiwan. Medicine  2016, 95: e3018. Google Scholar CrossRef Search ADS PubMed  6 Chen X, Zhang H, Zhu H, Yang X, Yang Y, Yang Y, Min H, et al.  . Endostatin combined with radiotherapy suppresses vasculogenic mimicry formation through inhibition of epithelial-mesenchymal transition in esophageal cancer. Tumour Biol  2015, 4: 4679– 4688. 7 Gao SG, Liu RM, Zhao YG, Wang P, Ward DG, Wang GC, Guo XQ, et al.  . Integrative topological analysis of mass spectrometry data reveals molecular features with clinical relevance in esophageal squamous cell carcinoma. Sci Rep  2016, 6: 21586. Google Scholar CrossRef Search ADS PubMed  8 Peinado H, Olmeda D, Cano A. Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer  2007, 7: 415– 428. Google Scholar CrossRef Search ADS PubMed  9 Postigo AA, Depp JL, Taylor JJ, Kroll KL. Regulation of Smad signaling through a differential recruitment of coactivators and corepressors by ZEB proteins. EMBO J  2003, 22: 2453– 2462. Google Scholar CrossRef Search ADS PubMed  10 Diaz VM, de Herreros AG. F-box proteins: keeping the epithelial-to-mesenchymal transition (EMT) in check. Semin Cancer Biol  2016, 36: 71– 79. Google Scholar CrossRef Search ADS PubMed  11 Cieply B, Farris J, Denvir J, Ford HL, Frisch SM. Epithelial-mesenchymal transition and tumor suppression are controlled by a reciprocal feedback loop between ZEB1 and Grainyhead-like-2. Cancer Res  2013, 73: 6299– 6309. Google Scholar CrossRef Search ADS PubMed  12 Ohashi S, Natsuizaka M, Naganuma S, Kagawa S, Kimura S, Itoh H, Kalman RA, et al.  . A NOTCH3-mediated squamous cell differentiation program limits expansion of EMT-competent cells that express the ZEB transcription factors. Cancer Res  2011, 71: 6836– 6847. Google Scholar CrossRef Search ADS PubMed  13 Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ. A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res  2008, 68: 7846– 7854. Google Scholar CrossRef Search ADS PubMed  14 Diaz-Lopez A, Diaz-Martin J, Moreno-Bueno G, Cuevas EP, Santos V, Olmeda D, Portillo F, et al.  . Zeb1 and Snail1 engage miR-200f transcriptional and epigenetic regulation during EMT. Int J Cancer  2015, 136: E62– E73. Google Scholar CrossRef Search ADS PubMed  15 Gheldof A, Hulpiau P, van Roy F, De Craene B, Berx G. Evolutionary functional analysis and molecular regulation of the ZEB transcription factors. Cell Mol Life Sci  2012, 69: 2527– 2541. Google Scholar CrossRef Search ADS PubMed  16 Vandewalle C, Van Roy F, Berx G. The role of the ZEB family of transcription factors in development and disease. Cell Mol Life Sci  2009, 66: 773– 787. Google Scholar CrossRef Search ADS PubMed  17 Senfter D, Holzner S, Kalipciyan M, Staribacher A, Walzl A, Huttary N, Krieger S, et al.  . Loss of miR-200 family in 5-fluorouracil resistant colon cancer drives lymphendothelial invasiveness in vitro. Hum Mol Genet  2015, 24: 3689– 3698. Google Scholar PubMed  18 Browne G, Sayan AE, Tulchinsky E. ZEB proteins link cell motility with cell cycle control and cell survival in cancer. Cell cycle  2010, 9: 886– 891. Google Scholar CrossRef Search ADS PubMed  19 Bakhshandeh B, Soleimani M, Paylakhi SH, Ghaemi N. A microRNA signature associated with chondrogenic lineage commitment. J Genet  2012, 91: 171– 182. Google Scholar CrossRef Search ADS PubMed  20 Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell  2004, 116: 281– 297. Google Scholar CrossRef Search ADS PubMed  21 Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer  2006, 6: 857– 866. Google Scholar CrossRef Search ADS PubMed  22 Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell  2005, 120: 15– 20. Google Scholar CrossRef Search ADS PubMed  23 Chen G, Peng J, Zhu W, Tao G, Song Y, Zhou X, Wang W. Combined downregulation of microRNA-133a and microRNA-133b predicts chemosensitivity of patients with esophageal squamous cell carcinoma undergoing paclitaxel-based chemotherapy. Med Oncol  2014, 31: 263. Google Scholar CrossRef Search ADS PubMed  24 Cui XB, Li S, Li TT, Peng H, Jin TT, Zhang SM, Liu CX, et al.  . Targeting oncogenic PLCE1 by miR-145 impairs tumor proliferation and metastasis of esophageal squamous cell carcinoma. Oncotarget  2016, 7: 1777– 1795. Google Scholar PubMed  25 Fong LY, Taccioli C, Jing R, Smalley KJ, Alder H, Jiang Y, Fadda P, et al.  . MicroRNA dysregulation and esophageal cancer development depend on the extent of zinc dietary deficiency. Oncotarget  2016, 10: 10723– 10738. 26 Qin Y, Zhang Y, Tang Q, Jin L, Chen Y. SQLE induces epithelial-to-mesenchymal transition by regulating of miR-133b in esophageal squamous cell carcinoma. Acta Biochim Biophys Sin  2017, 49: 138– 148. Google Scholar PubMed  27 Fu HL, Wu DP, Wang XF, Wang JG, Jiao F, Song LL, Xie H, et al.  . Altered miRNA expression is associated with differentiation, invasion, and metastasis of esophageal squamous cell carcinoma (ESCC) in patients from Huaian, China. Cell Biochem Biophys  2013, 67: 657– 668. Google Scholar CrossRef Search ADS PubMed  28 Fu W, Pang L, Chen Y, Yang L, Zhu J, Wei Y. The microRNAs as prognostic biomarkers for survival in esophageal cancer: a meta-analysis. SciWorld J  2014, 2014: 523979. 29 Gu J, Wang Y, Wu X. MicroRNA in the pathogenesis and prognosis of esophageal cancer. Curr Pharm Des  2013, 19: 1292– 1300. Google Scholar CrossRef Search ADS PubMed  30 Yi J, Jin L, Chen J, Feng B, He Z, Chen L, Song H. MiR-375 suppresses invasion and metastasis by direct targeting of SHOX2 in esophageal squamous cell carcinoma. Acta Biochim Biophys Sin  2017, 49: 159– 169. Google Scholar PubMed  31 Jin L, Yi J, Gao Y, Han S, He Z, Chen L, Song H. MiR-630 inhibits invasion and metastasis in esophageal squamous cell carcinoma. Acta Biochim Biophys Sin  2016, 48: 810– 819. Google Scholar CrossRef Search ADS PubMed  32 Wu C, Kraft P, Zhai K, Chang J, Wang Z, Li Y, Hu Z, et al.  . Genome-wide association analyses of esophageal squamous cell carcinoma in Chinese identify multiple susceptibility loci and gene-environment interactions. Nat Genet  2012, 44: 1090– 1097. Google Scholar CrossRef Search ADS PubMed  33 Wu C, Li D, Jia W, Hu Z, Zhou Y, Yu D, Tong T, et al.  . Genome-wide association study identifies common variants in SLC39A6 associated with length of survival in esophageal squamous-cell carcinoma. Nat Genet  2013, 45: 632– 638. Google Scholar CrossRef Search ADS PubMed  34 Cooke VG, LeBleu VS, Keskin D, Khan Z, O’Connell JT, Teng Y, Duncan MB, et al.  . Pericyte depletion results in hypoxia-associated epithelial-to-mesenchymal transition and metastasis mediated by met signaling pathway. Cancer Cell  2012, 21: 66– 81. Google Scholar CrossRef Search ADS PubMed  35 Brabletz T. EMT and MET in metastasis: where are the cancer stem cells? Cancer cell  2012, 22: 699– 701. Google Scholar CrossRef Search ADS PubMed  36 Thompson EW, Haviv I. The social aspects of EMT-MET plasticity. Nat Med  2011, 17: 1048– 1049. Google Scholar CrossRef Search ADS PubMed  37 Liu X, Sun H, Qi J, Wang L, He S, Liu J, Feng C, et al.  . Sequential introduction of reprogramming factors reveals a time-sensitive requirement for individual factors and a sequential EMT-MET mechanism for optimal reprogramming. Nat Cell Biol  2013, 15: 829– 838. Google Scholar CrossRef Search ADS PubMed  38 Singh AB, Sharma A, Smith JJ, Krishnan M, Chen X, Eschrich S, Washington MK, et al.  . Claudin-1 up-regulates the repressor ZEB-1 to inhibit E-cadherin expression in colon cancer cells. Gastroenterology  2011, 141: 2140– 2153. Google Scholar CrossRef Search ADS PubMed  39 Chaffer CL, Marjanovic ND, Lee T, Bell G, Kleer CG, Reinhardt F, D’Alessio AC, et al.  . Poised chromatin at the ZEB1 promoter enables breast cancer cell plasticity and enhances tumorigenicity. Cell  2013, 154: 61– 74. Google Scholar CrossRef Search ADS PubMed  40 Yang Y, Ahn YH, Chen Y, Tan X, Guo L, Gibbons DL, Ungewiss C, et al.  . ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest  2014, 124: 2696– 2708. Google Scholar CrossRef Search ADS PubMed  41 Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, Sonntag A, Waldvogel B, et al.  . The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs. Nat Cell Biol  2009, 11: 1487– 1495. Google Scholar CrossRef Search ADS PubMed  42 Krebs AM, Mitschke J, Lasierra Losada M, Schmalhofer O, Boerries M, Busch H, Boettcher M, et al.  . The EMT-activator Zeb1 is a key factor for cell plasticity and promotes metastasis in pancreatic cancer. Nat Cell Biol  2017, 19: 518– 529. Google Scholar CrossRef Search ADS PubMed  43 Harazono Y, Muramatsu T, Endo H, Uzawa N, Kawano T, Harada K, Inazawa J, et al.  . miR-655 is an EMT-suppressive microRNA targeting ZEB1 and TGFBR2. PLoS One  2013, 8: e62757. Google Scholar CrossRef Search ADS PubMed  44 Yokobori T, Suzuki S, Tanaka N, Inose T, Sohda M, Sano A, Sakai M, et al.  . MiR-150 is associated with poor prognosis in esophageal squamous cell carcinoma via targeting the EMT inducer ZEB1. Cancer Sci  2013, 104: 48– 54. Google Scholar CrossRef Search ADS PubMed  45 Ma J, Zhan Y, Xu Z, Li Y, Luo A, Ding F, Cao X, et al.  . ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma. Cancer Lett  2017, 398: 37– 45. Google Scholar CrossRef Search ADS PubMed  46 Zhang HF, Alshareef A, Wu C, Li S, Jiao JW, Cao HH, Lai R, et al.  . Loss of miR-200b promotes invasion via activating the Kindlin-2/integrin beta1/AKT pathway in esophageal squamous cell carcinoma: An E-cadherin-independent mechanism. Oncotarget  2015, 6: 28949– 28960. Google Scholar PubMed  47 Wen J, Luo K, Liu H, Liu S, Lin G, Hu Y, Zhang X, et al.  . MiRNA expression analysis of pretreatment biopsies predicts the pathological response of esophageal squamous cell carcinomas to neoadjuvant chemoradiotherapy. Ann Surg  2016, 263: 942– 948. Google Scholar CrossRef Search ADS PubMed  48 Zhang C, Wang C, Chen X, Yang C, Li K, Wang J, Dai J, et al.  . Expression profile of microRNAs in serum: a fingerprint for esophageal squamous cell carcinoma. Clin Chem  2010, 56: 1871– 1879. Google Scholar CrossRef Search ADS PubMed  49 Komatsu S, Ichikawa D, Takeshita H, Tsujiura M, Morimura R, Nagata H, Kosuga T, et al.  . Circulating microRNAs in plasma of patients with oesophageal squamous cell carcinoma. Br J Cancer  2011, 105: 104– 111. Google Scholar CrossRef Search ADS PubMed  50 Li BX, Yu Q, Shi ZL, Li P, Fu S. Circulating microRNAs in esophageal squamous cell carcinoma: association with locoregional staging and survival. Int J Clin Exp Med  2015, 8: 7241– 7250. Google Scholar PubMed  51 Khan AP, Poisson LM, Bhat VB, Fermin D, Zhao R, Kalyana-Sundaram S, Michailidis G, et al.  . Quantitative proteomic profiling of prostate cancer reveals a role for miR-128 in prostate cancer. Mol Cell Proteomics  2010, 9: 298– 312. Google Scholar CrossRef Search ADS PubMed  52 Zhu Y, Yu F, Jiao Y, Feng J, Tang W, Yao H, Gong C, et al.  . Reduced miR-128 in breast tumor-initiating cells induces chemotherapeutic resistance via Bmi-1 and ABCC5. Clin Cancer Res  2011, 17: 7105– 7115. Google Scholar CrossRef Search ADS PubMed  53 Palumbo T, Faucz FR, Azevedo M, Xekouki P, Iliopoulos D, Stratakis CA. Functional screen analysis reveals miR-26b and miR-128 as central regulators of pituitary somatomammotrophic tumor growth through activation of the PTEN-AKT pathway. Oncogene  2013, 32: 1651– 1659. Google Scholar CrossRef Search ADS PubMed  54 Huang CY, Huang XP, Zhu JY, Chen ZG, Li XJ, Zhang XH, Huang S, et al.  . miR-128-3p suppresses hepatocellular carcinoma proliferation by regulating PIK3R1 and is correlated with the prognosis of HCC patients. Oncol Rep  2015, 33: 2889– 2898. Google Scholar CrossRef Search ADS PubMed  55 Yang J, Li J, Le Y, Zhou C, Zhang S, Gong Z. PFKL/miR-128 axis regulates glycolysis by inhibiting AKT phosphorylation and predicts poor survival in lung cancer. Am J Cancer Res  2016, 6: 473– 485. Google Scholar PubMed  56 Jiang J, Feng X, Zhou W, Wu Y, Yang Y. MiR-128 reverses the gefitinib resistance of the lung cancer stem cells by inhibiting the c-met/PI3K/AKT pathway. Oncotarget  2016, 7: 73188– 73199. Google Scholar PubMed  57 Shan ZN, Tian R, Zhang M, Gui ZH, Wu J, Ding M, Zhou XF, et al.  . miR128-1 inhibits the growth of glioblastoma multiforme and glioma stem-like cells via targeting BMI1 and E2F3. Oncotarget  2016, 7: 78813– 78826. Google Scholar PubMed  58 Mets E, Van Peer G, Van der Meulen J, Boice M, Taghon T, Goossens S, Mestdagh P, et al.  . MicroRNA-128-3p is a novel oncomiR targeting PHF6 in T-cell acute lymphoblastic leukemia. Haematologica  2014, 99: 1326– 1333. Google Scholar CrossRef Search ADS PubMed  59 Yu D, Green B, Marrone A, Guo Y, Kadlubar S, Lin D, Fuscoe J, et al.  . Suppression of CYP2C9 by microRNA hsa-miR-128-3p in human liver cells and association with hepatocellular carcinoma. Sci Rep  2015, 5: 8534. Google Scholar CrossRef Search ADS PubMed  60 Ibarrola-Villava M, Llorca-Cardenosa MJ, Tarazona N, Mongort C, Fleitas T, Perez-Fidalgo JA, Rosello S, et al.  . Deregulation of ARID1A, CDH1, cMET and PIK3CA and target-related microRNA expression in gastric cancer. Oncotarget  2015, 6: 26935– 26945. Google Scholar CrossRef Search ADS PubMed  61 Mi S, Lu J, Sun M, Li Z, Zhang H, Neilly MB, Wang Y, et al.  . MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia. Proc Natl Acad Sci USA  2007, 104: 19971– 19976. Google Scholar CrossRef Search ADS PubMed  62 Xiaoli Z, Yawei W, Lianna L, Haifeng L, Hui Z. Screening of target genes and regulatory function of miRNAs as prognostic indicators for prostate cancer. Med Sci Monit  2015, 21: 3748– 3759. Google Scholar CrossRef Search ADS PubMed  © The Author(s) 2018. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

Acta Biochimica et Biophysica SinicaOxford University Press

Published: Feb 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off