Tight interaction of eEF2 in the presence of Stm1 on ribosome

Tight interaction of eEF2 in the presence of Stm1 on ribosome Abstract The stress-related protein Stm1 interacts with ribosomes, and is implicated in repressing translation. Stm1 was previously studied both in vivo and in vitro by cell-free translation systems using crude yeast lysates, but its precise functional mechanism remains obscure. Using an in vitro reconstituted translation system, we now show that Stm1 severely inhibits translation through its N-terminal region, aa 1 to 107, and this inhibition is antagonized by eEF3. We found that Stm1 stabilizes eEF2 on the 80 S ribosome in the GTP-bound form, independently of eEF2’s diphthamide modification, a conserved post-translational modification at the tip of domain IV. Systematic analyses of N- or C-terminal truncated mutants revealed that the core region of Stm1, aa 47 to 143, is crucial for its ribosome binding and eEF2 stabilization. Stm1 does not inhibit the 80 S-dependent GTPase activity of eEF2, at least during the first round of GTP-hydrolysis. The mechanism and the role of the stable association of eEF2 with the ribosome in the presence of Stm1 are discussed in relation to the translation repression by Stm1. diphthamide, eEF2, GTPase, ribosome, Stm1 Stm1 is a moderately abundant (46, 800–123, 605 molecules/cell) (1, 2), approximately 30 kDa Saccharomyces cerevisiae protein. Stm1 was originally identified as one of the G4-DNA binding proteins in yeast extracts (3). Thereafter, its corresponding gene was identified as a multicopy suppressor of temperature-sensitive tom1, a HECT domain E3 ligase required for G2/M cell cycle progression and named STM1; suppressor of tom1 (4). Stm1 has been genetically linked with mRNA decapping and degradation. Stm1 is a high-copy suppressor of the temperature-sensitive pat1Δ strain, inhibits the growth of a dhh1Δ strain when overexpressed and is also a multicopy suppressor of a pop2Δstrain (5, 6). Indeed, Stm1 is required for the decay of a subset of yeast mRNAs (6). Stm1 binds ribosomes (7–11), and is known to modulate translation. In vitro translation experiments using yeast extract demonstrated that Stm1 represses translation (12). Since the mRNA accumulates in the 80 S initiation complex during Stm1-mediated repression, Stm1 has been suggested to repress translation elongation after 80 S initiation complex formation (12). Stm1 also reportedly perturbs the association of the elongation factor eEF3 with ribosomes, and affects optimal translation elongation (10). The in vivo evidence supporting a role of Stm1 in translation elongation is that the stm1Δstrain is hypersensitive to the translation inhibitor anisomycin, which affects the peptidyl transferase reaction in translation elongation, but shows little hypersensitivity to other inhibitors such as paromomycin and hygromycin B, which affect translational fidelity (10). Stm1 has also been suggested to function as a ribosome preservation factor, which plays an important role under nutrient stress conditions. Disruption of the STM1 gene results in a defect in recovery after nitrogen starvation and replenishment (9). Stm1 greatly increases the amount of 80 S ribosomes present in quiescent yeast cells, and these ribosomes facilitate enhanced protein synthesis rates once nutrients are restored (13). Stm1 is thought to stabilize ribosomes and prevent their degradation during quiescence. Dom34-Hbs1, together with Rli1, dissociates the preserved ribosomes, thereby facilitating translation resumption in yeast recovering from stress (14). A crystal structure of Stm1 on the vacant 80 S ribosome (15) revealed that Stm1 binds to the head domain of the 40 S ribosomal subunit. Stm1 seems to prevent mRNA binding by inserting its α-helix domain towards the mRNA entry tunnel at the decoding site, where it would effectively block the binding of tRNA and mRNA at the A- and P-sites. The following regions of Stm1 then extend to the gap region between the 5 S rRNA and protein L5 of the 60 S subunit. By interacting with the ribosome in this manner, Stm1 may prevent subunit dissociation and stabilize the 80 S particle (11). The cryo-EM structures of the human and Drosophila homologs of Stm1 (SERBP1 and VIG2, respectively), in complex with the 80 S particle, eEF2 and the E-site tRNA, are also available (16). Overall, the structures of these Stm1 homologs are similar to that of yeast Stm1, and they are located across the mRNA path on the ribosome. These structures suggest that Stm1 prevents the formation of translating ribosome complexes, which is compatible with the function of Stm1 as a ribosome preservation factor. However, the mechanical details underlying the translational repression by Stm1 remain unclear. In the present study, as a step toward understanding the function of Stm1 in translation, and the linkage between mRNA metabolism and translation through Stm1, we dissected the nature and the role of the interactions of Stm1 with the ribosome. Using an in vitro reconstituted translation system, we determined that Stm1 represses translation, and this repression is antagonized by eEF3. We detected the tight interaction of eEF2 in the presence of Stm1 on the ribosome. While part of the C-terminal region of Stm1 is reportedly required for translation repression and the in vivo function of Stm1 (12), we found that the very C-terminal region of Stm1, at least after aa 144, is entirely unnecessary for ribosome binding and eEF2 stabilization and for repression of poly(Phe) synthesis as well. The functional mechanism of Stm1 in translation is discussed. Material and Methods Preparation of ribosomes The yeast ΔStm1_80 S ribosomes were purified from the stm1Δ strain (BY4741 stm1Δ:: kanMX: MAT a his3Δ1 leu2Δ0 met15Δ0 ura3Δ stm1Δ:: kanMX) (17), according to the previously described procedure (18). The properties of the ΔStm1_80 S ribosomes for the assays, such as poly(Phe) synthesis, ribosome binding and the ribosome-dependent GTPase assay, do not differ from those of the 80 S ribosomes purified from the W303 and YPH499 strains. Expression and purification of Stm1 mutants Nhis-Stm1/pET15b and Chis-Stm1/pET29b, the E. coli expression vectors encoding the N- and C-terminal histidine-tagged Stm1 proteins, respectively, were constructed as follows. The DNA fragment encoding Stm1 was obtained by PCR, using genomic DNA from the YPH499 strain. The primers for PCR were: 5’- GCATACACATTTTATTCCATATGTCCAACCCATTTGATTTGTTAG -3’ and 5’- TCATATAGTCGACTTAAGCCAAAGATGGCAAGTTAGAA -3’ for Nhis-Stm1, and 5’- TCATATAGTCGACAGCCAAAGATGGCAAGTTAGAA -3’ and 5’- GCATACACATTTTATTCCATATGTCCAACCCATTTGATTTGTTAG -3’ for Chis-Stm1. The obtained fragments were cloned into the modified pET15b vector (between the Nde I and Sal I sites) (Novagen) and the pET29b vector (between the Nde I and Sal I sites) (Novagen), with the original multi-cloning sites modified in our laboratory. The plasmids were transformed into E. coli BL21-Gold(DE3) cells (Stratagene). Protein expression was induced with 0.1 mM isopropyl-1-thio-D-galactopyranoside (IPTG) at 18 °C overnight. Proteins were purified by Ni-NTA (QIAGEN) column chromatography. The N-terminal histidine-tag of Nhis-Stm1 was removed with thrombin protease (GE Healthcare). The proteins were further purified by Mono S 4.6/100 PE column chromatography (GE Healthcare). The proteins were dialyzed against Stm1 buffer (20 mM HEPES-KOH [pH 7.5], 200 mM KCl, 50% glycerol, 1 mM DTT), concentrated to 5 mg/ml and stored at –80 °C. Expression vectors for Stm1 mutants were constructed with a QuickChange Site-Directed Mutagenesis Kit (Stratagene), using Nhis-Stm1/pET15b (for C-terminally truncated mutants) and Chis-Stm1/pET29b (for N-terminally truncated mutants) as the template DNAs. Mutant proteins were expressed and purified to near homogeneity according to the procedure for wild-type proteins. Primers used to generate the Stm1 mutants are summarized in Table I. Table I. Primers used for the construction of the expression plasmids for Stm1 mutants Stm1 mutant  FOR  REV  [1–89]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CCTTCTGGTGTTGGACTTCTTGGTG-3'  [1–107]  5’-TAAGTCGACGGATCCGGCTGCTAAC-3’  5’-GTTAACCTTCTTCTTGGTGTCAGTC-3’  [1–143]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CTTACCAGCGTCTTCAGCTTCTGC-3'  [1–180]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-TGAATTAGACGCTGAAAGAATTGAA -3'  [47–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [66–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [90–273]  5'-GCCACTGACCGCCACTCTAGAACTGGTAAG-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  Stm1 mutant  FOR  REV  [1–89]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CCTTCTGGTGTTGGACTTCTTGGTG-3'  [1–107]  5’-TAAGTCGACGGATCCGGCTGCTAAC-3’  5’-GTTAACCTTCTTCTTGGTGTCAGTC-3’  [1–143]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CTTACCAGCGTCTTCAGCTTCTGC-3'  [1–180]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-TGAATTAGACGCTGAAAGAATTGAA -3'  [47–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [66–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [90–273]  5'-GCCACTGACCGCCACTCTAGAACTGGTAAG-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  Poly(U)-dependent poly(Phe) synthesis system Assays (25 μl), containing 1 pmol ΔStm1_80 S ribosomes and 25 pmol precharged yeast [14 C]Phe-tRNAPhe, were incubated for 30 min at 30 °C in a mixture of 20 mM HEPES-KOH (pH 7.5), 150 mM KOAc, 2.5 mM Mg(OAc)2, 0.05 mM spermine, 7.5 mM creatine phosphate, 1.25 μg creatine kinase, 0.1 mM GTP, 5 μg poly(U), 12.5 U of SUPERNaseIn (Life Technologies), 1.0% (w/v) PEG6000, 2.5 pmol of eEF1A, 2.5 pmol of eEF2 and the indicated amount of Stm1 or truncated Stm1 mutants. Where indicated, 10 pmol of eEF3 was included. Reactions were terminated by the addition of 50 μl 1 N NaOH and incubated at 30 °C for 10 min. After the addition of 100 μl of 25% trichloroacetic acid, the samples were further incubated on ice for 5 min. The precipitate was collected on glass filter membranes (Whatman, GF/C), and the amount of incorporated [14 C]Phenylalanine was quantified using a liquid scintillation counter. Phenylalanine-specific tRNAs from S. cerevisiae (Chemical Block) were charged using a yeast S100 extract, as described (19). Native eEF1A was purified from the yeast strain YPH499, as reported (20). Yeast eEF2-6xHis was purified from the yeast strain TKY675, as described (21). The C-terminally histidine-tagged S. cerevisiae eEF3 was cloned into the pET21a vector (Novagen), overexpressed in E. coli BL21-Gold(DE3) cells (Stratagene) and purified by Ni-NTA affinity chromatography (QIAGEN) and MonoQ anion exchange chromatography (GE Healthcare). It is not necessary to add eEF3 in the above poly(Phe) synthesis system. The eEF3 contamination levels in the purified ΔStm1_ 80 S ribosomes and eEF2 are negligible, and that in the purified eEF1A is less than 1%. Ribosome binding assay The reactions (100 μl), containing 20 pmol Stm1, 20 pmol eEF2 and 20 pmol ΔStm1_ 80 S, were incubated in binding buffer (20 mM HEPES-KOH [pH 7.5], 100 mM KCl, 2.5 mM Mg(OAc)2, 0.25 mM spermidine, 2 mM DTT and 0.3 mM GTP) for 30 min at room temperature. After the addition of 200 μl of ice-cold dilution buffer (20 mM HEPES-KOH [pH 7.5], 100 mM KOAc, 12 mM Mg(OAc)2, 0.25 mM spermidine, 4 mM 2-mercaptoethanol), the mixtures were layered onto a sucrose cushion (20 mM HEPES-KOH [pH 7.5], 100 mM KOAc, 5 mM Mg(OAc)2, 0.25 mM spermidine, 4 mM 2-mercaptoethanol and 1 M sucrose), and centrifuged at 100,000 rpm for 60 min at 4 °C in the TLA100.3 rotor (Beckman Coulter). The ribosomal pellet fractions were recovered and re-suspended in 20 μl of buffer (20 mM HEPES-KOH [pH 7.5], 100 mM KOAc, 2.5 mM Mg(OAc)2, 0.25 mM spermidine, 4 mM 2-mercaptoethanol). Equal amount of samples were separated by SDS-PAGE, and subjected to immunoblot analyses using an anti-His antibody (for eEF2 and N-terminally truncated Stm1 mutants) or an anti-Stm1 antibody (C-terminally truncated Stm1 mutants). The relative ribosome binding of C-terminally truncated Stm1mutant was normalized by the reactivity of each mutant to the anti-Stm1 antibody. The relative reactivities to anti-Stm1: WT, 1; [1–180], 1.1 ± 0.055; [1–143], 1.0 ± 0.090; [1–107], 0.7 ± 0.157; [1–89] and 1.1 ± 0.330. Where indicated, 0.3 mM GDP or GDPNP was included in the binding buffer, instead of GTP. The yeast His-tagged H699N eEF2 mutant expression vector was constructed by inserting the wild type EFT2 PCR fragment, generated using 5'- GGGAATTCTTAGTGATGGTGATGGTGATGCAATTTGTCGTAATATTCTTGCCAG-3' and 5'- GGGGATCCATATGGTTGCTTTCACTGTTG-3', into the BamHI/EcoRI sites of the yeast expression shuttle vector p416GPD (22), followed by site-directed PCR mutagenesis using 5'- CATGCCGATGCTATCAACAGAGGTGGTGGTCAAATC -3' and 5'- GATTTGACCACCACCTCTGTTGATAGCATCGGCATG -3'. The eEF2 mutants H699N and Δdph2 were purified from the TKY675 derivative strains S21-F04 [the His-tagged wild type eEF2 expression vector, LEU2 marker, in which TKY675 was replaced with p416GPD-EFT2 (H699N)-6xHis, URA3 marker, by plasmid shuffling] and S21-E05 (TKY675 dph2Δ:: kanMX), respectively. Measurement of GTPase activity The ribosome-dependent GTPase activities of S. cerevisiae eEF2 were measured according to the previous reports (23, 24). Briefly, assays were performed in 25 μl of GTPase assay buffer (20 mM HEPES-KOH [pH 7.5], 150 mM KCl, 2.5 mM Mg(OAc)2, 1 mM DTT) containing 1 pmol (f.c. 0.04 μM) of ΔStm1_80 S ribosomes, 1 pmol (f.c. 0.04 μM) of His-Stm1 and 1 pmol (f.c. 0.04 μM) of eEF2. Reactions were started by adding 0.5 μl of 7.5 mM γ-[32 P]GTP (∼100 cpm/pmol). After 5, 10 or 20 min incubation at 30 °C, the reactions were terminated by adding 100 μl of 0.1 N H2SO4-1.5 mM NaH2PO4 and 25 μl of 5% sodium molybdate. Phosphomolybdate complexes were extracted with 250 μl n-butanol. Aliquots of 250 μl of the butanol layer were counted with a scintillation counter. The apparent Kcat value was calculated at the reaction time of 5 min. Alternatively, the ribosome-dependent GTPase activities of eEF2 were measured by a GTP/NADH-coupled assay, as described (25). The assay measures the rate of NADH absorbance decrease at 340 nm, which is proportional to the rate of steady-state GTP hydrolysis. Each 120 μl assay contained 20 mM HEPES-KOH (pH 7.5), 150 mM KCl, 2.5 mM MgCl2, 0.5 mM GTP (Sigma), 0.5 mM NADH (Roche), 5 mM phosphoenol pyruvate (Roche), 3.6 μg of pyruvate kinase (PK) (Roche), 6 μg of L-LDH (Sigma), 0.5 μM eEF2, 0.5 μM Stm1 and 0.5 μM ΔStm1_80 S. All measurements were obtained with a JASCO V-550 UV/VIS spectrophotometer. The Kcat value was estimated at the 10 s reaction time. Antibodies The anti-Stm1 antibody was produced in our laboratory, by injecting rabbits with the purified recombinant protein. The anti-His antibody was purchased from Sigma. Results Stm1 represses translation in the in vitro reconstituted poly(Phe) synthesis system, and the repression is antagonized by eEF3 Previous in vitro translation experiments using yeast extract demonstrated that the addition of recombinant Stm1 represses translation (12). Here, we confirmed the inhibitory effect of Stm1 on translation with the reconstituted poly(Phe) synthesis system. The system is composed of purified yeast translational elongation factors and pre-charged yeast [14 C]Phe-tRNA. The 80 S ribosomes were purified from the Stm1-deletion mutant strain BY4741 stm1Δ (Stm1Δ_80 S), to eliminate the effect of endogenous Stm1. Stm1 inhibited poly(Phe) synthesis in a dose-dependent manner in the absence of additional eEF3: a molar amount of Stm1 equivalent to that of the ribosomes almost completely repressed poly(Phe) synthesis (Fig. 1A). Notably, we also observed that an excessive amount of eEF3 (approx. 10-fold) antagonizes the translation repression by Stm1 (Fig. 1B), highlighting the previous report that Stm1 perturbs the association of eEF3 with the ribosome (10). Fig. 1 View largeDownload slide Stm1 inhibits translation in the in vitro reconstituted poly(Phe) synthesis system, and the inhibition is antagonized by eEF3. (A) Poly(U)-dependent poly(Phe) synthesis. Assays included ribosomes (0.04 μM), precharged [14 C]Phe-tRNA, eEF1A, eEF2 and the indicated concentration of Stm1. (B) Poly(Phe) synthesis as in (A), but in the presence (open circles) and absence (closed circles) of eEF3 (0.4 μM). Fig. 1 View largeDownload slide Stm1 inhibits translation in the in vitro reconstituted poly(Phe) synthesis system, and the inhibition is antagonized by eEF3. (A) Poly(U)-dependent poly(Phe) synthesis. Assays included ribosomes (0.04 μM), precharged [14 C]Phe-tRNA, eEF1A, eEF2 and the indicated concentration of Stm1. (B) Poly(Phe) synthesis as in (A), but in the presence (open circles) and absence (closed circles) of eEF3 (0.4 μM). Stm1 stabilizes 80 S ribosome binding of eEF2 in the GTP-bound form, independently of its diphthamide modification The cryo-EM structures of the human and Drosophila 80 S ribosomes has been reported, both of which carry Stm1-like proteins: SERBP1 and VIG2 for human and Drosophila, respectively, (16). It is notable that eEF2, together with the Stm1-like protein, is complexed with these ribosomes.eEF2 is composed of five domains, I-V (26) and the conserved histidine residue at the tip of domain IV reaches into the ribosomal decoding centre (27). This conserved histidine residue of eEF2 (His699 for yeast eEF2) is post-translationally modified to diphthamide, and the lack of the diphthamide modification decreases the translocation efficiency (28, 29). Two alternative conformations of the diphthamide residue have been observed in the human eEF2 structure on the ribosome complexed with SERBP1. The diphthamide residue contacts either nucleotide A1825 (A1493 in Escherichia coli numbering) in h44, or SERBP1 within the mRNA path (16). We wondered if Stm1 stabilizes eEF2 on the ribosome, and if the diphthamide affects the Stm1-eEF2 interaction there. To test this hypothesis, the association of wild type and variant eEF2s with the ribosome was investigated by a ribosome binding assay. Ribosomes and eEF2 were incubated with or without Stm1 (Chis-Stm1), in the presence of various guanine nucleotides. The association of Stm1 or eEF2 with ribosomes was visualized and quantified by a western blot analysis, after pelleting the ribosomes through a sucrose cushion (Fig. 2A and B). Fig. 2 View largeDownload slide Stm1 stabilizes eEF2 in GTP-bound form on the 80 S ribosome. (A) Ribosome binding assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of various guanine nucleotides (f.c. 0.3 mM). The association of Stm1 or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Relative ribosome binding of eEF2 observed in (A). eEF2 binding in the presence of Stm1 and GDPNP is expressed as 100%, and corresponds to 1 : 1 binding of eEF2 to the ribosome. Fig. 2 View largeDownload slide Stm1 stabilizes eEF2 in GTP-bound form on the 80 S ribosome. (A) Ribosome binding assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of various guanine nucleotides (f.c. 0.3 mM). The association of Stm1 or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Relative ribosome binding of eEF2 observed in (A). eEF2 binding in the presence of Stm1 and GDPNP is expressed as 100%, and corresponds to 1 : 1 binding of eEF2 to the ribosome. Stm1 stably bound to ribosomes in a 1 : 1 stoichiometry, regardless of the type of guanine nucleotide present. In the presence of GDPNP, the non-hydrolyzable GTP analog eEF2 stably bound to ribosomes in nearly 1 : 1 stoichiometry, in either the presence or absence of Stm1. In the presence of GTP, and also of GDP, Stm1 enhanced the ribosome binding of eEF2 by approximately 2-fold. Considering that human eEF2 on the SERBP1-bound ribosome adopts the GTP-bound conformation (16), these results suggested that Stm1 stabilizes eEF2 on the ribosome in the GTP-bound form. Although eEF2 is known to interact with the ribosome transiently in the GDP-bound form, Stm1 stabilized the ribosome binding of eEF2 even in the presence of GDP. The conformational change of eEF2 from the GDP- to GTP-bound form is probably induced by the direct interaction with Stm1 on the ribosome. Subsequently, eEF2•GDP would be trapped on the ribosome in the GTP-bound form, which stably interacts with the ribosome. Two eEF2 mutants, eEF2-Δdph2 and -H699N, which both lack the diphthamide modification, were also tested for ribosome binding. eEF2-Δdph2 was purified from a yeast strain lacking the DPH2 diphthamide modification enzyme, and carries an unmodified His-699 (30). Ribosomes and eEF2 mutants were incubated with or without Stm1 in the presence of GTP, and the association of eEF2 and Stm1 with the ribosomes was analysed as described in Fig. 2 (Fig. 3A and B). No significant association with ribosomes was observed with both eEF2 mutants in the absence of Stm1. However, both of these eEF2 mutants exhibited marked interactions with ribosomes in the presence of Stm1, at roughly the same level as wild type eEF2. These results suggested that Stm1 stabilizes eEF2, independently of the diphthamide modification. Fig. 3 View largeDownload slide Stm1 stabilizes eEF2 independently of its diphthamide modification on the 80 S ribosome. (A) Ribosome binding assay using diphthamide-deficient eEF2 mutants. Equal amount of 80 S ribosomes and eEF2 mutants (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of GTP (f.c. 0.3 mM). The association of Stm1 or eEF2 mutants with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Amounts of ribosome-bound eEF2 observed in (A). WT, wild type eEF2; Δdph2, eEF2 with an unmodified His-699 purified from a yeast strain lacking DPH2; H699N, H699N mutant form of eEF2. Fig. 3 View largeDownload slide Stm1 stabilizes eEF2 independently of its diphthamide modification on the 80 S ribosome. (A) Ribosome binding assay using diphthamide-deficient eEF2 mutants. Equal amount of 80 S ribosomes and eEF2 mutants (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of GTP (f.c. 0.3 mM). The association of Stm1 or eEF2 mutants with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Amounts of ribosome-bound eEF2 observed in (A). WT, wild type eEF2; Δdph2, eEF2 with an unmodified His-699 purified from a yeast strain lacking DPH2; H699N, H699N mutant form of eEF2. The C-terminal region of Stm1, after aa 144, is entirely unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis To identify the functional regions of Stm1, we prepared a series of Stm1 variants with systematic truncations of the N- or C-terminal region (Fig. 4A). Full-length Stm1 contains 273 amino acid residues, and the region from aa 74 to 140 crosses the small ribosomal subunit, with aa 90 to 100 passing over the decoding centre (15). The variants were designed by reference to this structural information. We tested these variants for poly(Phe) synthesis (Fig. 4B) and for ribosome binding in the presence of eEF2 (Fig. 4C). Fig. 4 View largeDownload slide The C-terminal region of Stm1, after amino acid residue 144, is entirely unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis. (A) Schematics of the N- or C-terminally truncated Stm1 mutant proteins used in the analysis. (B) Poly(Phe) synthesis using 80 S ribosomes (f.c. 0.04 μM) and Stm1 mutants (f.c. 0.04 μM). The poly(Phe) synthesis in the absence of Stm1 is expressed as 100%. (C) Ribosome binding of eEF2 in the presence of Stm1 mutants. Upper panel, 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with Stm1 mutants (f.c. 0.2 μM) in the presence of GTP (f.c. 0.3 mM). The association of Stm1 mutants or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. The band indicated with an asterisk represents an unknown signal. Lower panel, relative ribosome binding of eEF2 (black bars) and Stm1 (white bars). The amount of ribosome-bound eEF2 and Stm1 in the presence of WT Stm1 are expressed as 100%. Representative multiple analysis results, which showed similar tendencies, are shown. Fig. 4 View largeDownload slide The C-terminal region of Stm1, after amino acid residue 144, is entirely unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis. (A) Schematics of the N- or C-terminally truncated Stm1 mutant proteins used in the analysis. (B) Poly(Phe) synthesis using 80 S ribosomes (f.c. 0.04 μM) and Stm1 mutants (f.c. 0.04 μM). The poly(Phe) synthesis in the absence of Stm1 is expressed as 100%. (C) Ribosome binding of eEF2 in the presence of Stm1 mutants. Upper panel, 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with Stm1 mutants (f.c. 0.2 μM) in the presence of GTP (f.c. 0.3 mM). The association of Stm1 mutants or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. The band indicated with an asterisk represents an unknown signal. Lower panel, relative ribosome binding of eEF2 (black bars) and Stm1 (white bars). The amount of ribosome-bound eEF2 and Stm1 in the presence of WT Stm1 are expressed as 100%. Representative multiple analysis results, which showed similar tendencies, are shown. In the poly(Phe) synthesis assay, the Stm1 variant with the N-terminal region of aa 1 to 107 severely repressed translation (Fig. 4B, WT, [1–180], [1–143], [1–107]). Stm1[1–89] and [47–273] still repressed the poly(Phe) synthesis, to approximately 50% of the efficiency of wild type Stm1. Stm1[66–273] and [90–273] almost completely lost the ability to repress poly(Phe) synthesis. The ribosome binding assay revealed that the Stm1 variant bearing the core region of aa 47 to 143 bound to ribosomes with similar efficiency to wild type Stm1 (Fig. 4C, white bars, WT, [1–180], [1–143], [47–273]). The association of eEF2 with the ribosome in the presence of Stm1 variants was nearly proportional to the efficiency of the ribosome binding of Stm1 variants (Fig. 4C, black bars). In summary, our results showed that Stm1 inhibits translation through its N-terminal region, aa 1 to 107, and that the core region of Stm1, aa 47 to 143, is crucial for ribosome binding and eEF2 stabilization; i.e. the C-terminal region of Stm1, at least after aa 144, is unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis. Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round of GTP-hydrolysis We finally investigated the effect of Stm1 on the ribosome-dependent GTPase activity of eEF2. In vitro GTPase assays were initially performed with [γ-32 P]GTP, and the GTPase activity was measured by quantifying the amount of hydrolyzed 32Pi extracted from the reaction using molybdate, as a function of time (Fig. 5A). The apparent Kcat values of the ribosome-dependent GTPase activity of eEF2 at the 5 min reaction time, in the presence and absence of Stm1, were estimated as 1.5 (min−1) and 3.5 (min−1), respectively. Although Stm1 slightly reduced the ribosome-dependent GTPase activity of eEF2, it was not very clear if the effect was significant, especially during the early period of the reaction. Thus, for a more detailed time-resolved measurement, we next employed the GTP/NADH-coupled assay that measures the rate of NADH absorbance decrease at 340 nm as a function of time, which is proportional to the rate of GTP hydrolysis (Fig. 5B). Comparisons within the linear range of kinetic alteration (< 60 s) affirmed that there is no significant difference between the rates of GTP hydrolysis in the presence and absence of Stm1. Within this range, the Kcat values of the ribosome-dependent GTPase activity of eEF2 in the presence and absence of Stm1 were estimated as 8.9 (min−1) and 11.1 (min−1), respectively. These values are comparable to the reported Kcat value of the GTPase activity of the eEF2/ribosome complex (9.6 min−1) (31). Notably, a single round of GTP-hydrolysis by the eEF2/ribosome complex is completed within 10 s, according to the obtained kinetic rates. Our results suggest that Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round of GTP-hydrolysis. The slight slowdown of GTP-hydrolysis during the late period of reaction might reflect the delay of GDP•GTP exchange in eEF2 on the ribosome in the presence of Stm1. Further study is required to verify this hypothesis. Fig. 5 View largeDownload slide Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round. (A) GTPase assay utilizing γ-[32 P]GTP. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.04 μM each) were incubated with γ-[32 P]GTP for the indicated time period with or without Stm1 (f.c. 0.04 μM), and the release of [32 P]Pi was measured. The apparent Kcat values of the ribosome-dependent GTPase activity of eEF2 at the 5 min reaction time, in the presence and absence of Stm1, were estimated as 1.5 (min−1) and 3.5 (min−1), respectively. (B) GTP/NADH-coupled GTPase assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.5 μM each) were incubated in buffer, containing 0.5 mM GTP, 0.5 mM NADH, 5 mM phosphoenol pyruvate, 3.6 μg of PK and 6 μg of L-lactate dehydrogenase (LDH), for the indicated time period in the presence or absence of Stm1 (f.c. 0.5 μM). The rate of GTP hydrolysis was measured by the decrease of NADH absorbance at 340 nm. Based on the experimental points from the linear region of the curve, the Kcat values of the ribosome-dependent GTPase activity of eEF2 in the presence and absence of Stm1 were estimated as 8.9±3.3 (min−1) and 11.1±4.5 (min−1), respectively. Fig. 5 View largeDownload slide Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round. (A) GTPase assay utilizing γ-[32 P]GTP. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.04 μM each) were incubated with γ-[32 P]GTP for the indicated time period with or without Stm1 (f.c. 0.04 μM), and the release of [32 P]Pi was measured. The apparent Kcat values of the ribosome-dependent GTPase activity of eEF2 at the 5 min reaction time, in the presence and absence of Stm1, were estimated as 1.5 (min−1) and 3.5 (min−1), respectively. (B) GTP/NADH-coupled GTPase assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.5 μM each) were incubated in buffer, containing 0.5 mM GTP, 0.5 mM NADH, 5 mM phosphoenol pyruvate, 3.6 μg of PK and 6 μg of L-lactate dehydrogenase (LDH), for the indicated time period in the presence or absence of Stm1 (f.c. 0.5 μM). The rate of GTP hydrolysis was measured by the decrease of NADH absorbance at 340 nm. Based on the experimental points from the linear region of the curve, the Kcat values of the ribosome-dependent GTPase activity of eEF2 in the presence and absence of Stm1 were estimated as 8.9±3.3 (min−1) and 11.1±4.5 (min−1), respectively. Discussion In the present study, using an in vitro reconstituted translation system, we confirmed that Stm1 inhibits poly(Phe) synthesis, and showed that this inhibition is antagonized by eEF3. We found that eEF2, presumably in its GTP-bound form, is stabilized on the 80 S ribosome in the presence of Stm1. An analysis with truncated Stm1 variants revealed that the C-terminal region of Stm1, after aa 144, is not required for translation inhibition, ribosome binding, or eEF2 trapping. Mechanism of poly(Phe) synthesis inhibition by Stm1 At present, it is unclear whether Stm1 targets the elongating ribosomes during poly(Phe) synthesis. Stm1 is a multi-copy suppressor of the pat1Δ strain, and promotes the function of Dhh1 (6). The Pat1 and Dhh1 proteins, which promote decapping in vivo, inhibit 48 S initiation complex formation and repress translation initiation (32, 33). Thus, it is reasonable to think that Stm1 also inhibits translation initiation, rather than translation elongation. Stm1 might repress poly(Phe) synthesis by inhibiting the multi-round translation; Stm1 might bind to the ribosome during ribosomal subunit association, and act on the initiating ribosomes. Nevertheless, Stm1 might inhibit ‘early translation elongation’ after mRNA and tRNA binding, which would also be beneficial for mRNA decapping. It remains to be investigated whether mRNA is excluded from the ribosome by Stm1 during the inhibition of poly(Phe) synthesis. We also observed that eEF3 antagonizes the translation repression by Stm1 (Fig. 1). Together with the previous report that Stm1 perturbs the association of the elongation factor eEF3 with the ribosome (10), this observation implies the mechanism of translation regulation through Stm1 and eEF3 in yeast. It is noteworthy that eEF3, but not Stm1, is sequestered from the cytosol into stress granules under certain stress conditions (34). It is fascinating to think that the translation elongation proceeds in the presence of eEF3 and Stm1, but is inhibited by Stm1 in the absence of eEF3. Further studies are required to verify this hypothesis. Mechanism and role of Stm1-mediated eEF2 stabilization on the ribosome We demonstrated that Stm1 stabilizes eEF2 binding on the ribosome in the GTP-bound conformation (Fig. 2), and allows for a first round of GTP hydrolysis by eEF2 on the ribosome (Fig. 5). These observations are reminiscent of the action of the antibiotics fusidic acid (FA) and sordarin, translation elongation inhibitors that target EF-G or eEF2 (FA for both EF-G and eEF2, and sordarin for eEF2). It has been suggested that FA locks EF-G in the GTP conformation after GTP hydrolysis, and thereby prevents the factor from dissociating from the ribosome (35). FA binds to EF-G in the vicinity of switch loop I in domain I. FA stabilizes EF-G by mimicking the structure of switch loop I in the GTP state, thereby indirectly inducing the orientation of domain IV in the GTP-bound conformation (36). In contrast, the core region of Stm1, aa 47 through 143, which passes over the decoding centre of the 40 S ribosomal small subunit, is responsible for eEF2 stabilization (Fig. 4). Stm1 would fix eEF2 in its GTP-bound conformation through the direct interaction with the tip of domain IV of eEF2. Despite the similarity between the activities of FA/sordarin and Stm1, the eEF2•Stm1 interaction is probably not involved in the inhibition of translation elongation. This idea may explain why the ability of Stm1 for translation repression (Fig. 4B) and for eEF2-stabilization on ribosome (Fig. 4C) does not fully correlate. The eEF2•Stm1 interaction may be implicated in the preservation of empty ribosomes during stress conditions, rather than in the repression of translation elongation (16). Perhaps in agreement with this, in human cells, the prominent association of eEF2 with non-translating ribosomes; i.e. empty ribosomes without mRNA, is observed, and such eEF2-bound ribosomes accumulate under stress conditions (37). Role of the C-terminal region of Stm1 We demonstrated that the truncation of the C-terminal region of Stm1, the region after aa 144, has absolutely no effect on either its ribosome binding or repression of poly(Phe) synthesis (Fig. 4). This finding is consistent with the observation that this C-terminal region of Stm1 is situated outside of the ribosome (15). In contrast, the recombinant Stm1Δ240–244 protein reportedly showed reduced ability to repress the translation of capped mRNA when added to an in vitro translation system using yeast extract (12). Stm1Δ240–244 failed to rescue the temperature-sensitive phenotype of the pat1Δ strain, and to inhibit the growth defect of the dhh1Δ strain (12). Thus, it is plausible to think that this region is involved in specific interactions with Pat1 and Dhh1. Stm1 might partly repress the translation of capped mRNA through decapping mRNAs in the in vitro translation system using yeast extract. The genetic link between Stm1 and mRNA decapping and degradation underlines its pivotal role in the coordination of translation and mRNA metabolism. Further studies are awaited concerning the mechanism of translation inhibition by Stm1, and the role of the tight interaction between eEF2 and the ribosome in the presence of Stm1. Acknowledgements The authors sincerely thank Dr. Akira Kaji and Dr. Hideko Kaji for the TKY675 strain, and Dr. Takuya Ueda for valuable discussions and continuous support. Funding This work was supported by a Grant-in-Aid for Young Scientists (B) from the Japan Society for the Promotion of Science (JSPS), a Grant-in-Aid for Scientific Research on Innovative Areas from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (MEXT), Grants-in-Aid from the Takeda Science Foundation, and the Uehara Memorial Foundation to N.T. Conflict of Interest None declared. References 1 Ghaemmaghami S., Huh W.K., Bower K., Howson R.W., Belle A., Dephoure N., O'Shea E.K., Weissman J.S. ( 2003) Global analysis of protein expression in yeast. Nature  425, 737– 741 Google Scholar CrossRef Search ADS PubMed  2 Kulak N.A., Pichler G., Paron I., Nagaraj N., Mann M. ( 2014) Minimal, encapsulated proteomic-sample processing applied to copy-number estimation in eukaryotic cells. Nat. Methods  11, 319– 324 Google Scholar CrossRef Search ADS PubMed  3 Frantz J.D., Gilbert W. ( 1995) A yeast gene product, G4p2, with a specific affinity for quadruplex nucleic acids. J. Biol. Chem.  270, 9413– 9419 Google Scholar CrossRef Search ADS PubMed  4 Utsugi T., Toh-e A., Kikuchi Y. ( 1995) A high dose of the STM1 gene suppresses the temperature sensitivity of the tom1 and htr1 mutants in Saccharomyces cerevisiae. Biochim. Biophys. Acta  1263, 285– 288 Google Scholar CrossRef Search ADS PubMed  5 Hata H., Mitsui H., Liu H., Bai Y., Denis C.L., Shimizu Y., Sakai A. ( 1998) Dhh1p, a putative RNA helicase, associates with the general transcription factors Pop2p and Ccr4p from Saccharomyces cerevisiae. Genetics  148, 571– 579 Google Scholar PubMed  6 Balagopal V., Parker R. ( 2009) Stm1 modulates mRNA decay and Dhh1 function in Saccharomyces cerevisiae. Genetics  181, 93– 103 Google Scholar CrossRef Search ADS PubMed  7 Inada T., Winstall E., Tarun S.Z.Jr., Yates J.R.III, Schieltz D., Sachs A.B. ( 2002) One-step affinity purification of the yeast ribosome and its associated proteins and mRNAs. RNA  8, 948– 958 Google Scholar CrossRef Search ADS PubMed  8 Van Dyke M.W., Nelson L.D., Weilbaecher R.G., Mehta D.V. ( 2004) Stm1p, a G4 quadruplex and purine motif triplex nucleic acid-binding protein, interacts with ribosomes and subtelomeric Y' DNA in Saccharomyces cerevisiae. J. Biol. Chem.  279, 24323– 24333 Google Scholar CrossRef Search ADS PubMed  9 Van Dyke N., Baby J., Van Dyke M.W. ( 2006) Stm1p, a ribosome-associated protein, is important for protein synthesis in Saccharomyces cerevisiae under nutritional stress conditions. J. Mol. Biol.  358, 1023– 1031 Google Scholar CrossRef Search ADS PubMed  10 Van Dyke N., Pickering B.F., Van Dyke M.W. ( 2009) Stm1p alters the ribosome association of eukaryotic elongation factor 3 and affects translation elongation. Nucleic Acids Res.  37, 6116– 6125 Google Scholar CrossRef Search ADS PubMed  11 Correia H., Medina R., Hernandez A., Bustamante E., Chakraburtty K., Herrera F. ( 2004) Similarity between the association factor of ribosomal subunits and the protein Stm1p from Saccharomyces cerevisiae. Mem. Inst. Oswaldo Cruz  99, 733– 737 Google Scholar CrossRef Search ADS PubMed  12 Balagopal V., Parker R. ( 2011) Stm1 modulates translation after 80S formation in Saccharomyces cerevisiae. RNA  17, 835– 842 Google Scholar CrossRef Search ADS PubMed  13 Van Dyke N., Chanchorn E., Van Dyke M.W. ( 2013) The Saccharomyces cerevisiae protein Stm1p facilitates ribosome preservation during quiescence. Biochem. Biophys. Res. Commun.  430, 745– 750 Google Scholar CrossRef Search ADS PubMed  14 van den Elzen A.M., Schuller A., Green R., Seraphin B. ( 2014) Dom34-Hbs1 mediated dissociation of inactive 80S ribosomes promotes restart of translation after stress. Embo J.  33, 265– 276 Google Scholar PubMed  15 Ben-Shem A., Garreau de Loubresse N., Melnikov S., Jenner L., Yusupova G., Yusupov M. ( 2011) The structure of the eukaryotic ribosome at 3.0 A resolution. Science  334, 1524– 1529 Google Scholar CrossRef Search ADS PubMed  16 Anger A.M., Armache J.P., Berninghausen O., Habeck M., Subklewe M., Wilson D.N., Beckmann R. ( 2013) Structures of the human and Drosophila 80S ribosome. Nature  497, 80– 85 Google Scholar CrossRef Search ADS PubMed  17 Winzeler E.A., Shoemaker D.D., Astromoff A., Liang H., Anderson K., Andre B., Bangham R., Benito R., Boeke J.D., Bussey H., Chu A.M., Connelly C., Davis K., Dietrich F., Dow S.W., El Bakkoury M., Foury F., Friend S.H., Gentalen E., Giaever G., Hegemann J.H., Jones T., Laub M., Liao H., Liebundguth N., Lockhart D.J., Lucau-Danila A., Lussier M., M'Rabet N., Menard P., Mittmann M., Pai C., Rebischung C., Revuelta J.L., Riles L., Roberts C.J., Ross-MacDonald P., Scherens B., Snyder M., Sookhai-Mahadeo S., Storms R.K., Veronneau S., Voet M., Volckaert G., Ward T.R., Wysocki R., Yen G.S., Yu K., Zimmermann K., Philippsen P., Johnston M., Davis R.W. ( 1999) Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science  285, 901– 906 Google Scholar CrossRef Search ADS PubMed  18 Leshin J.A., Rakauskaitė R., Dinman J., Meskauskas A. ( 2010) Enhanced purity, activity and structural integrity of yeast ribosomes purified using a general chromatographic method. RNA Biol.  7, 354– 360 Google Scholar CrossRef Search ADS PubMed  19 Eyler D.E., Green R. ( 2011) Distinct response of yeast ribosomes to a miscoding event during translation. RNA  17, 925– 932 Google Scholar CrossRef Search ADS PubMed  20 Gutierrez E., Shin B.S., Woolstenhulme C.J., Kim J.R., Saini P., Buskirk A.R., Dever T.E. ( 2013) eIF5A promotes translation of polyproline motifs. Mol. Cell  51, 35– 45 Google Scholar CrossRef Search ADS PubMed  21 Kurata S., Nielsen K.H., Mitchell S.F., Lorsch J.R., Kaji A., Kaji H. ( 2010) Ribosome recycling step in yeast cytoplasmic protein synthesis is catalyzed by eEF3 and ATP. Proc. Natl. Acad. Sci. USA  107, 10854– 10859 Google Scholar CrossRef Search ADS   22 Mumberg D., Muller R., Funk M. ( 1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene  156, 119– 122 Google Scholar CrossRef Search ADS PubMed  23 Kambampati R., Chakraburtty K. ( 1997) Overexpression and purification of elongation factor 3 from Saccharomyces cerevisiae. Protein Expr. Purif.  10, 209– 213 Google Scholar CrossRef Search ADS PubMed  24 Sandbaken M.G., Lupisella J.A., DiDomenico B., Chakraburtty K. ( 1990) Protein synthesis in yeast. Structural and functional analysis of the gene encoding elongation factor 3. J. Biol. Chem.  265, 15838– 15844 Google Scholar PubMed  25 Panaretou B., Prodromou C., Roe S.M., O'Brien R., Ladbury J.E., Piper P.W., Pearl L.H. ( 1998) ATP binding and hydrolysis are essential to the function of the Hsp90 molecular chaperone in vivo. Embo J.  17, 4829– 4836 Google Scholar CrossRef Search ADS PubMed  26 Jorgensen R., Ortiz P.A., Carr-Schmid A., Nissen P., Kinzy T.G., Andersen G.R. ( 2003) Two crystal structures demonstrate large conformational changes in the eukaryotic ribosomal translocase. Nat. Struct. Biol.  10, 379– 385 Google Scholar CrossRef Search ADS PubMed  27 Spahn C.M., Gomez-Lorenzo M.G., Grassucci R.A., Jorgensen R., Andersen G.R., Beckmann R., Penczek P.A., Ballesta J.P., Frank J. ( 2004) Domain movements of elongation factor eEF2 and the eukaryotic 80S ribosome facilitate tRNA translocation. Embo J.  23, 1008– 1019 Google Scholar CrossRef Search ADS PubMed  28 Phan L.D., Perentesis J.P., Bodley J.W. ( 1993) Saccharomyces cerevisiae elongation factor 2. Mutagenesis of the histidine precursor of diphthamide yields a functional protein that is resistant to diphtheria toxin. J. Biol. Chem.  268, 8665– 8668 Google Scholar PubMed  29 Kimata Y., Kohno K. ( 1994) Elongation factor 2 mutants deficient in diphthamide formation show temperature-sensitive cell growth. J. Biol. Chem.  269, 13497– 13501 Google Scholar PubMed  30 Ortiz P.A., Ulloque R., Kihara G.K., Zheng H., Kinzy T.G. ( 2006) Translation elongation factor 2 anticodon mimicry domain mutants affect fidelity and diphtheria toxin resistance. J. Biol. Chem.  281, 32639– 32648 Google Scholar CrossRef Search ADS PubMed  31 Nygard O., Nilsson L. ( 1990) Kinetic determination of the effects of ADP-ribosylation on the interaction of eukaryotic elongation factor 2 with ribosomes. J. Biol. Chem.  265, 6030– 6034 Google Scholar PubMed  32 Coller J., Parker R. ( 2005) General translational repression by activators of mRNA decapping. Cell  122, 875– 886 Google Scholar CrossRef Search ADS PubMed  33 Nissan T., Rajyaguru P., She M., Song H., Parker R. ( 2010) Decapping activators in Saccharomyces cerevisiae act by multiple mechanisms. Mol. Cell  39, 773– 783 Google Scholar CrossRef Search ADS PubMed  34 Grousl T., Ivanov P., Malcova I., Pompach P., Frydlova I., Slaba R., Senohrabkova L., Novakova L., Hasek J., Tuite M.F. ( 2013) Heat shock-induced accumulation of translation elongation and termination factors precedes assembly of stress granules in S. cerevisiae. PLoS One  8, e57083 Google Scholar CrossRef Search ADS PubMed  35 Gao Y.G., Selmer M., Dunham C.M., Weixlbaumer A., Kelley A.C., Ramakrishnan V. ( 2009) The structure of the ribosome with elongation factor G trapped in the posttranslocational state. Science  326, 694– 699 Google Scholar CrossRef Search ADS PubMed  36 Zhou J., Lancaster L., Donohue J.P., Noller H.F. ( 2013) Crystal structures of EF-G-ribosome complexes trapped in intermediate states of translocation. Science  340, 1236086 Google Scholar CrossRef Search ADS PubMed  37 Liu B., Qian S.B. ( 2016) Characterizing inactive ribosomes in translational profiling. Translation (Austin)  4, e1138018 Google Scholar PubMed  Abbreviations Abbreviations eEF1A eukaryotic translational elongation factor 1A eEF2 eukaryotic translational elongation factor 2 eEF3 eukaryotic translational elongation factor 3 FA fusidic acid NADH nicotinamide adenine dinucleotide (reduced form) Pi inorganic phosphate © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png The Journal of Biochemistry Oxford University Press

Tight interaction of eEF2 in the presence of Stm1 on ribosome

Loading next page...
 
/lp/ou_press/tight-interaction-of-eef2-in-the-presence-of-stm1-on-ribosome-01gCkrhJKP
Publisher
Oxford University Press
Copyright
© The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved
ISSN
0021-924X
eISSN
1756-2651
D.O.I.
10.1093/jb/mvx070
Publisher site
See Article on Publisher Site

Abstract

Abstract The stress-related protein Stm1 interacts with ribosomes, and is implicated in repressing translation. Stm1 was previously studied both in vivo and in vitro by cell-free translation systems using crude yeast lysates, but its precise functional mechanism remains obscure. Using an in vitro reconstituted translation system, we now show that Stm1 severely inhibits translation through its N-terminal region, aa 1 to 107, and this inhibition is antagonized by eEF3. We found that Stm1 stabilizes eEF2 on the 80 S ribosome in the GTP-bound form, independently of eEF2’s diphthamide modification, a conserved post-translational modification at the tip of domain IV. Systematic analyses of N- or C-terminal truncated mutants revealed that the core region of Stm1, aa 47 to 143, is crucial for its ribosome binding and eEF2 stabilization. Stm1 does not inhibit the 80 S-dependent GTPase activity of eEF2, at least during the first round of GTP-hydrolysis. The mechanism and the role of the stable association of eEF2 with the ribosome in the presence of Stm1 are discussed in relation to the translation repression by Stm1. diphthamide, eEF2, GTPase, ribosome, Stm1 Stm1 is a moderately abundant (46, 800–123, 605 molecules/cell) (1, 2), approximately 30 kDa Saccharomyces cerevisiae protein. Stm1 was originally identified as one of the G4-DNA binding proteins in yeast extracts (3). Thereafter, its corresponding gene was identified as a multicopy suppressor of temperature-sensitive tom1, a HECT domain E3 ligase required for G2/M cell cycle progression and named STM1; suppressor of tom1 (4). Stm1 has been genetically linked with mRNA decapping and degradation. Stm1 is a high-copy suppressor of the temperature-sensitive pat1Δ strain, inhibits the growth of a dhh1Δ strain when overexpressed and is also a multicopy suppressor of a pop2Δstrain (5, 6). Indeed, Stm1 is required for the decay of a subset of yeast mRNAs (6). Stm1 binds ribosomes (7–11), and is known to modulate translation. In vitro translation experiments using yeast extract demonstrated that Stm1 represses translation (12). Since the mRNA accumulates in the 80 S initiation complex during Stm1-mediated repression, Stm1 has been suggested to repress translation elongation after 80 S initiation complex formation (12). Stm1 also reportedly perturbs the association of the elongation factor eEF3 with ribosomes, and affects optimal translation elongation (10). The in vivo evidence supporting a role of Stm1 in translation elongation is that the stm1Δstrain is hypersensitive to the translation inhibitor anisomycin, which affects the peptidyl transferase reaction in translation elongation, but shows little hypersensitivity to other inhibitors such as paromomycin and hygromycin B, which affect translational fidelity (10). Stm1 has also been suggested to function as a ribosome preservation factor, which plays an important role under nutrient stress conditions. Disruption of the STM1 gene results in a defect in recovery after nitrogen starvation and replenishment (9). Stm1 greatly increases the amount of 80 S ribosomes present in quiescent yeast cells, and these ribosomes facilitate enhanced protein synthesis rates once nutrients are restored (13). Stm1 is thought to stabilize ribosomes and prevent their degradation during quiescence. Dom34-Hbs1, together with Rli1, dissociates the preserved ribosomes, thereby facilitating translation resumption in yeast recovering from stress (14). A crystal structure of Stm1 on the vacant 80 S ribosome (15) revealed that Stm1 binds to the head domain of the 40 S ribosomal subunit. Stm1 seems to prevent mRNA binding by inserting its α-helix domain towards the mRNA entry tunnel at the decoding site, where it would effectively block the binding of tRNA and mRNA at the A- and P-sites. The following regions of Stm1 then extend to the gap region between the 5 S rRNA and protein L5 of the 60 S subunit. By interacting with the ribosome in this manner, Stm1 may prevent subunit dissociation and stabilize the 80 S particle (11). The cryo-EM structures of the human and Drosophila homologs of Stm1 (SERBP1 and VIG2, respectively), in complex with the 80 S particle, eEF2 and the E-site tRNA, are also available (16). Overall, the structures of these Stm1 homologs are similar to that of yeast Stm1, and they are located across the mRNA path on the ribosome. These structures suggest that Stm1 prevents the formation of translating ribosome complexes, which is compatible with the function of Stm1 as a ribosome preservation factor. However, the mechanical details underlying the translational repression by Stm1 remain unclear. In the present study, as a step toward understanding the function of Stm1 in translation, and the linkage between mRNA metabolism and translation through Stm1, we dissected the nature and the role of the interactions of Stm1 with the ribosome. Using an in vitro reconstituted translation system, we determined that Stm1 represses translation, and this repression is antagonized by eEF3. We detected the tight interaction of eEF2 in the presence of Stm1 on the ribosome. While part of the C-terminal region of Stm1 is reportedly required for translation repression and the in vivo function of Stm1 (12), we found that the very C-terminal region of Stm1, at least after aa 144, is entirely unnecessary for ribosome binding and eEF2 stabilization and for repression of poly(Phe) synthesis as well. The functional mechanism of Stm1 in translation is discussed. Material and Methods Preparation of ribosomes The yeast ΔStm1_80 S ribosomes were purified from the stm1Δ strain (BY4741 stm1Δ:: kanMX: MAT a his3Δ1 leu2Δ0 met15Δ0 ura3Δ stm1Δ:: kanMX) (17), according to the previously described procedure (18). The properties of the ΔStm1_80 S ribosomes for the assays, such as poly(Phe) synthesis, ribosome binding and the ribosome-dependent GTPase assay, do not differ from those of the 80 S ribosomes purified from the W303 and YPH499 strains. Expression and purification of Stm1 mutants Nhis-Stm1/pET15b and Chis-Stm1/pET29b, the E. coli expression vectors encoding the N- and C-terminal histidine-tagged Stm1 proteins, respectively, were constructed as follows. The DNA fragment encoding Stm1 was obtained by PCR, using genomic DNA from the YPH499 strain. The primers for PCR were: 5’- GCATACACATTTTATTCCATATGTCCAACCCATTTGATTTGTTAG -3’ and 5’- TCATATAGTCGACTTAAGCCAAAGATGGCAAGTTAGAA -3’ for Nhis-Stm1, and 5’- TCATATAGTCGACAGCCAAAGATGGCAAGTTAGAA -3’ and 5’- GCATACACATTTTATTCCATATGTCCAACCCATTTGATTTGTTAG -3’ for Chis-Stm1. The obtained fragments were cloned into the modified pET15b vector (between the Nde I and Sal I sites) (Novagen) and the pET29b vector (between the Nde I and Sal I sites) (Novagen), with the original multi-cloning sites modified in our laboratory. The plasmids were transformed into E. coli BL21-Gold(DE3) cells (Stratagene). Protein expression was induced with 0.1 mM isopropyl-1-thio-D-galactopyranoside (IPTG) at 18 °C overnight. Proteins were purified by Ni-NTA (QIAGEN) column chromatography. The N-terminal histidine-tag of Nhis-Stm1 was removed with thrombin protease (GE Healthcare). The proteins were further purified by Mono S 4.6/100 PE column chromatography (GE Healthcare). The proteins were dialyzed against Stm1 buffer (20 mM HEPES-KOH [pH 7.5], 200 mM KCl, 50% glycerol, 1 mM DTT), concentrated to 5 mg/ml and stored at –80 °C. Expression vectors for Stm1 mutants were constructed with a QuickChange Site-Directed Mutagenesis Kit (Stratagene), using Nhis-Stm1/pET15b (for C-terminally truncated mutants) and Chis-Stm1/pET29b (for N-terminally truncated mutants) as the template DNAs. Mutant proteins were expressed and purified to near homogeneity according to the procedure for wild-type proteins. Primers used to generate the Stm1 mutants are summarized in Table I. Table I. Primers used for the construction of the expression plasmids for Stm1 mutants Stm1 mutant  FOR  REV  [1–89]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CCTTCTGGTGTTGGACTTCTTGGTG-3'  [1–107]  5’-TAAGTCGACGGATCCGGCTGCTAAC-3’  5’-GTTAACCTTCTTCTTGGTGTCAGTC-3’  [1–143]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CTTACCAGCGTCTTCAGCTTCTGC-3'  [1–180]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-TGAATTAGACGCTGAAAGAATTGAA -3'  [47–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [66–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [90–273]  5'-GCCACTGACCGCCACTCTAGAACTGGTAAG-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  Stm1 mutant  FOR  REV  [1–89]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CCTTCTGGTGTTGGACTTCTTGGTG-3'  [1–107]  5’-TAAGTCGACGGATCCGGCTGCTAAC-3’  5’-GTTAACCTTCTTCTTGGTGTCAGTC-3’  [1–143]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-CTTACCAGCGTCTTCAGCTTCTGC-3'  [1–180]  5'-TAAGTCGACGGATCCGGCTGCTAAC-3'  5'-TGAATTAGACGCTGAAAGAATTGAA -3'  [47–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [66–273]  5'-GCTAGAAAGAACAGACCAAGACCTTCTGGT-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  [90–273]  5'-GCCACTGACCGCCACTCTAGAACTGGTAAG-3'  5’-CATATGTATATCTCCTTCTTAAAGT-3’  Poly(U)-dependent poly(Phe) synthesis system Assays (25 μl), containing 1 pmol ΔStm1_80 S ribosomes and 25 pmol precharged yeast [14 C]Phe-tRNAPhe, were incubated for 30 min at 30 °C in a mixture of 20 mM HEPES-KOH (pH 7.5), 150 mM KOAc, 2.5 mM Mg(OAc)2, 0.05 mM spermine, 7.5 mM creatine phosphate, 1.25 μg creatine kinase, 0.1 mM GTP, 5 μg poly(U), 12.5 U of SUPERNaseIn (Life Technologies), 1.0% (w/v) PEG6000, 2.5 pmol of eEF1A, 2.5 pmol of eEF2 and the indicated amount of Stm1 or truncated Stm1 mutants. Where indicated, 10 pmol of eEF3 was included. Reactions were terminated by the addition of 50 μl 1 N NaOH and incubated at 30 °C for 10 min. After the addition of 100 μl of 25% trichloroacetic acid, the samples were further incubated on ice for 5 min. The precipitate was collected on glass filter membranes (Whatman, GF/C), and the amount of incorporated [14 C]Phenylalanine was quantified using a liquid scintillation counter. Phenylalanine-specific tRNAs from S. cerevisiae (Chemical Block) were charged using a yeast S100 extract, as described (19). Native eEF1A was purified from the yeast strain YPH499, as reported (20). Yeast eEF2-6xHis was purified from the yeast strain TKY675, as described (21). The C-terminally histidine-tagged S. cerevisiae eEF3 was cloned into the pET21a vector (Novagen), overexpressed in E. coli BL21-Gold(DE3) cells (Stratagene) and purified by Ni-NTA affinity chromatography (QIAGEN) and MonoQ anion exchange chromatography (GE Healthcare). It is not necessary to add eEF3 in the above poly(Phe) synthesis system. The eEF3 contamination levels in the purified ΔStm1_ 80 S ribosomes and eEF2 are negligible, and that in the purified eEF1A is less than 1%. Ribosome binding assay The reactions (100 μl), containing 20 pmol Stm1, 20 pmol eEF2 and 20 pmol ΔStm1_ 80 S, were incubated in binding buffer (20 mM HEPES-KOH [pH 7.5], 100 mM KCl, 2.5 mM Mg(OAc)2, 0.25 mM spermidine, 2 mM DTT and 0.3 mM GTP) for 30 min at room temperature. After the addition of 200 μl of ice-cold dilution buffer (20 mM HEPES-KOH [pH 7.5], 100 mM KOAc, 12 mM Mg(OAc)2, 0.25 mM spermidine, 4 mM 2-mercaptoethanol), the mixtures were layered onto a sucrose cushion (20 mM HEPES-KOH [pH 7.5], 100 mM KOAc, 5 mM Mg(OAc)2, 0.25 mM spermidine, 4 mM 2-mercaptoethanol and 1 M sucrose), and centrifuged at 100,000 rpm for 60 min at 4 °C in the TLA100.3 rotor (Beckman Coulter). The ribosomal pellet fractions were recovered and re-suspended in 20 μl of buffer (20 mM HEPES-KOH [pH 7.5], 100 mM KOAc, 2.5 mM Mg(OAc)2, 0.25 mM spermidine, 4 mM 2-mercaptoethanol). Equal amount of samples were separated by SDS-PAGE, and subjected to immunoblot analyses using an anti-His antibody (for eEF2 and N-terminally truncated Stm1 mutants) or an anti-Stm1 antibody (C-terminally truncated Stm1 mutants). The relative ribosome binding of C-terminally truncated Stm1mutant was normalized by the reactivity of each mutant to the anti-Stm1 antibody. The relative reactivities to anti-Stm1: WT, 1; [1–180], 1.1 ± 0.055; [1–143], 1.0 ± 0.090; [1–107], 0.7 ± 0.157; [1–89] and 1.1 ± 0.330. Where indicated, 0.3 mM GDP or GDPNP was included in the binding buffer, instead of GTP. The yeast His-tagged H699N eEF2 mutant expression vector was constructed by inserting the wild type EFT2 PCR fragment, generated using 5'- GGGAATTCTTAGTGATGGTGATGGTGATGCAATTTGTCGTAATATTCTTGCCAG-3' and 5'- GGGGATCCATATGGTTGCTTTCACTGTTG-3', into the BamHI/EcoRI sites of the yeast expression shuttle vector p416GPD (22), followed by site-directed PCR mutagenesis using 5'- CATGCCGATGCTATCAACAGAGGTGGTGGTCAAATC -3' and 5'- GATTTGACCACCACCTCTGTTGATAGCATCGGCATG -3'. The eEF2 mutants H699N and Δdph2 were purified from the TKY675 derivative strains S21-F04 [the His-tagged wild type eEF2 expression vector, LEU2 marker, in which TKY675 was replaced with p416GPD-EFT2 (H699N)-6xHis, URA3 marker, by plasmid shuffling] and S21-E05 (TKY675 dph2Δ:: kanMX), respectively. Measurement of GTPase activity The ribosome-dependent GTPase activities of S. cerevisiae eEF2 were measured according to the previous reports (23, 24). Briefly, assays were performed in 25 μl of GTPase assay buffer (20 mM HEPES-KOH [pH 7.5], 150 mM KCl, 2.5 mM Mg(OAc)2, 1 mM DTT) containing 1 pmol (f.c. 0.04 μM) of ΔStm1_80 S ribosomes, 1 pmol (f.c. 0.04 μM) of His-Stm1 and 1 pmol (f.c. 0.04 μM) of eEF2. Reactions were started by adding 0.5 μl of 7.5 mM γ-[32 P]GTP (∼100 cpm/pmol). After 5, 10 or 20 min incubation at 30 °C, the reactions were terminated by adding 100 μl of 0.1 N H2SO4-1.5 mM NaH2PO4 and 25 μl of 5% sodium molybdate. Phosphomolybdate complexes were extracted with 250 μl n-butanol. Aliquots of 250 μl of the butanol layer were counted with a scintillation counter. The apparent Kcat value was calculated at the reaction time of 5 min. Alternatively, the ribosome-dependent GTPase activities of eEF2 were measured by a GTP/NADH-coupled assay, as described (25). The assay measures the rate of NADH absorbance decrease at 340 nm, which is proportional to the rate of steady-state GTP hydrolysis. Each 120 μl assay contained 20 mM HEPES-KOH (pH 7.5), 150 mM KCl, 2.5 mM MgCl2, 0.5 mM GTP (Sigma), 0.5 mM NADH (Roche), 5 mM phosphoenol pyruvate (Roche), 3.6 μg of pyruvate kinase (PK) (Roche), 6 μg of L-LDH (Sigma), 0.5 μM eEF2, 0.5 μM Stm1 and 0.5 μM ΔStm1_80 S. All measurements were obtained with a JASCO V-550 UV/VIS spectrophotometer. The Kcat value was estimated at the 10 s reaction time. Antibodies The anti-Stm1 antibody was produced in our laboratory, by injecting rabbits with the purified recombinant protein. The anti-His antibody was purchased from Sigma. Results Stm1 represses translation in the in vitro reconstituted poly(Phe) synthesis system, and the repression is antagonized by eEF3 Previous in vitro translation experiments using yeast extract demonstrated that the addition of recombinant Stm1 represses translation (12). Here, we confirmed the inhibitory effect of Stm1 on translation with the reconstituted poly(Phe) synthesis system. The system is composed of purified yeast translational elongation factors and pre-charged yeast [14 C]Phe-tRNA. The 80 S ribosomes were purified from the Stm1-deletion mutant strain BY4741 stm1Δ (Stm1Δ_80 S), to eliminate the effect of endogenous Stm1. Stm1 inhibited poly(Phe) synthesis in a dose-dependent manner in the absence of additional eEF3: a molar amount of Stm1 equivalent to that of the ribosomes almost completely repressed poly(Phe) synthesis (Fig. 1A). Notably, we also observed that an excessive amount of eEF3 (approx. 10-fold) antagonizes the translation repression by Stm1 (Fig. 1B), highlighting the previous report that Stm1 perturbs the association of eEF3 with the ribosome (10). Fig. 1 View largeDownload slide Stm1 inhibits translation in the in vitro reconstituted poly(Phe) synthesis system, and the inhibition is antagonized by eEF3. (A) Poly(U)-dependent poly(Phe) synthesis. Assays included ribosomes (0.04 μM), precharged [14 C]Phe-tRNA, eEF1A, eEF2 and the indicated concentration of Stm1. (B) Poly(Phe) synthesis as in (A), but in the presence (open circles) and absence (closed circles) of eEF3 (0.4 μM). Fig. 1 View largeDownload slide Stm1 inhibits translation in the in vitro reconstituted poly(Phe) synthesis system, and the inhibition is antagonized by eEF3. (A) Poly(U)-dependent poly(Phe) synthesis. Assays included ribosomes (0.04 μM), precharged [14 C]Phe-tRNA, eEF1A, eEF2 and the indicated concentration of Stm1. (B) Poly(Phe) synthesis as in (A), but in the presence (open circles) and absence (closed circles) of eEF3 (0.4 μM). Stm1 stabilizes 80 S ribosome binding of eEF2 in the GTP-bound form, independently of its diphthamide modification The cryo-EM structures of the human and Drosophila 80 S ribosomes has been reported, both of which carry Stm1-like proteins: SERBP1 and VIG2 for human and Drosophila, respectively, (16). It is notable that eEF2, together with the Stm1-like protein, is complexed with these ribosomes.eEF2 is composed of five domains, I-V (26) and the conserved histidine residue at the tip of domain IV reaches into the ribosomal decoding centre (27). This conserved histidine residue of eEF2 (His699 for yeast eEF2) is post-translationally modified to diphthamide, and the lack of the diphthamide modification decreases the translocation efficiency (28, 29). Two alternative conformations of the diphthamide residue have been observed in the human eEF2 structure on the ribosome complexed with SERBP1. The diphthamide residue contacts either nucleotide A1825 (A1493 in Escherichia coli numbering) in h44, or SERBP1 within the mRNA path (16). We wondered if Stm1 stabilizes eEF2 on the ribosome, and if the diphthamide affects the Stm1-eEF2 interaction there. To test this hypothesis, the association of wild type and variant eEF2s with the ribosome was investigated by a ribosome binding assay. Ribosomes and eEF2 were incubated with or without Stm1 (Chis-Stm1), in the presence of various guanine nucleotides. The association of Stm1 or eEF2 with ribosomes was visualized and quantified by a western blot analysis, after pelleting the ribosomes through a sucrose cushion (Fig. 2A and B). Fig. 2 View largeDownload slide Stm1 stabilizes eEF2 in GTP-bound form on the 80 S ribosome. (A) Ribosome binding assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of various guanine nucleotides (f.c. 0.3 mM). The association of Stm1 or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Relative ribosome binding of eEF2 observed in (A). eEF2 binding in the presence of Stm1 and GDPNP is expressed as 100%, and corresponds to 1 : 1 binding of eEF2 to the ribosome. Fig. 2 View largeDownload slide Stm1 stabilizes eEF2 in GTP-bound form on the 80 S ribosome. (A) Ribosome binding assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of various guanine nucleotides (f.c. 0.3 mM). The association of Stm1 or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Relative ribosome binding of eEF2 observed in (A). eEF2 binding in the presence of Stm1 and GDPNP is expressed as 100%, and corresponds to 1 : 1 binding of eEF2 to the ribosome. Stm1 stably bound to ribosomes in a 1 : 1 stoichiometry, regardless of the type of guanine nucleotide present. In the presence of GDPNP, the non-hydrolyzable GTP analog eEF2 stably bound to ribosomes in nearly 1 : 1 stoichiometry, in either the presence or absence of Stm1. In the presence of GTP, and also of GDP, Stm1 enhanced the ribosome binding of eEF2 by approximately 2-fold. Considering that human eEF2 on the SERBP1-bound ribosome adopts the GTP-bound conformation (16), these results suggested that Stm1 stabilizes eEF2 on the ribosome in the GTP-bound form. Although eEF2 is known to interact with the ribosome transiently in the GDP-bound form, Stm1 stabilized the ribosome binding of eEF2 even in the presence of GDP. The conformational change of eEF2 from the GDP- to GTP-bound form is probably induced by the direct interaction with Stm1 on the ribosome. Subsequently, eEF2•GDP would be trapped on the ribosome in the GTP-bound form, which stably interacts with the ribosome. Two eEF2 mutants, eEF2-Δdph2 and -H699N, which both lack the diphthamide modification, were also tested for ribosome binding. eEF2-Δdph2 was purified from a yeast strain lacking the DPH2 diphthamide modification enzyme, and carries an unmodified His-699 (30). Ribosomes and eEF2 mutants were incubated with or without Stm1 in the presence of GTP, and the association of eEF2 and Stm1 with the ribosomes was analysed as described in Fig. 2 (Fig. 3A and B). No significant association with ribosomes was observed with both eEF2 mutants in the absence of Stm1. However, both of these eEF2 mutants exhibited marked interactions with ribosomes in the presence of Stm1, at roughly the same level as wild type eEF2. These results suggested that Stm1 stabilizes eEF2, independently of the diphthamide modification. Fig. 3 View largeDownload slide Stm1 stabilizes eEF2 independently of its diphthamide modification on the 80 S ribosome. (A) Ribosome binding assay using diphthamide-deficient eEF2 mutants. Equal amount of 80 S ribosomes and eEF2 mutants (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of GTP (f.c. 0.3 mM). The association of Stm1 or eEF2 mutants with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Amounts of ribosome-bound eEF2 observed in (A). WT, wild type eEF2; Δdph2, eEF2 with an unmodified His-699 purified from a yeast strain lacking DPH2; H699N, H699N mutant form of eEF2. Fig. 3 View largeDownload slide Stm1 stabilizes eEF2 independently of its diphthamide modification on the 80 S ribosome. (A) Ribosome binding assay using diphthamide-deficient eEF2 mutants. Equal amount of 80 S ribosomes and eEF2 mutants (f.c. 0.2 μM each) were incubated with or without Stm1 in the presence of GTP (f.c. 0.3 mM). The association of Stm1 or eEF2 mutants with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. C-terminal histidine-tagged Stm1 (Chis-Stm1) proteins were used. (B) Amounts of ribosome-bound eEF2 observed in (A). WT, wild type eEF2; Δdph2, eEF2 with an unmodified His-699 purified from a yeast strain lacking DPH2; H699N, H699N mutant form of eEF2. The C-terminal region of Stm1, after aa 144, is entirely unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis To identify the functional regions of Stm1, we prepared a series of Stm1 variants with systematic truncations of the N- or C-terminal region (Fig. 4A). Full-length Stm1 contains 273 amino acid residues, and the region from aa 74 to 140 crosses the small ribosomal subunit, with aa 90 to 100 passing over the decoding centre (15). The variants were designed by reference to this structural information. We tested these variants for poly(Phe) synthesis (Fig. 4B) and for ribosome binding in the presence of eEF2 (Fig. 4C). Fig. 4 View largeDownload slide The C-terminal region of Stm1, after amino acid residue 144, is entirely unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis. (A) Schematics of the N- or C-terminally truncated Stm1 mutant proteins used in the analysis. (B) Poly(Phe) synthesis using 80 S ribosomes (f.c. 0.04 μM) and Stm1 mutants (f.c. 0.04 μM). The poly(Phe) synthesis in the absence of Stm1 is expressed as 100%. (C) Ribosome binding of eEF2 in the presence of Stm1 mutants. Upper panel, 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with Stm1 mutants (f.c. 0.2 μM) in the presence of GTP (f.c. 0.3 mM). The association of Stm1 mutants or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. The band indicated with an asterisk represents an unknown signal. Lower panel, relative ribosome binding of eEF2 (black bars) and Stm1 (white bars). The amount of ribosome-bound eEF2 and Stm1 in the presence of WT Stm1 are expressed as 100%. Representative multiple analysis results, which showed similar tendencies, are shown. Fig. 4 View largeDownload slide The C-terminal region of Stm1, after amino acid residue 144, is entirely unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis. (A) Schematics of the N- or C-terminally truncated Stm1 mutant proteins used in the analysis. (B) Poly(Phe) synthesis using 80 S ribosomes (f.c. 0.04 μM) and Stm1 mutants (f.c. 0.04 μM). The poly(Phe) synthesis in the absence of Stm1 is expressed as 100%. (C) Ribosome binding of eEF2 in the presence of Stm1 mutants. Upper panel, 80 S ribosomes and eEF2 (f.c. 0.2 μM each) were incubated with Stm1 mutants (f.c. 0.2 μM) in the presence of GTP (f.c. 0.3 mM). The association of Stm1 mutants or eEF2 with ribosomes was visualized by a western blot analysis, following pelleting of ribosomes through a sucrose cushion. The band indicated with an asterisk represents an unknown signal. Lower panel, relative ribosome binding of eEF2 (black bars) and Stm1 (white bars). The amount of ribosome-bound eEF2 and Stm1 in the presence of WT Stm1 are expressed as 100%. Representative multiple analysis results, which showed similar tendencies, are shown. In the poly(Phe) synthesis assay, the Stm1 variant with the N-terminal region of aa 1 to 107 severely repressed translation (Fig. 4B, WT, [1–180], [1–143], [1–107]). Stm1[1–89] and [47–273] still repressed the poly(Phe) synthesis, to approximately 50% of the efficiency of wild type Stm1. Stm1[66–273] and [90–273] almost completely lost the ability to repress poly(Phe) synthesis. The ribosome binding assay revealed that the Stm1 variant bearing the core region of aa 47 to 143 bound to ribosomes with similar efficiency to wild type Stm1 (Fig. 4C, white bars, WT, [1–180], [1–143], [47–273]). The association of eEF2 with the ribosome in the presence of Stm1 variants was nearly proportional to the efficiency of the ribosome binding of Stm1 variants (Fig. 4C, black bars). In summary, our results showed that Stm1 inhibits translation through its N-terminal region, aa 1 to 107, and that the core region of Stm1, aa 47 to 143, is crucial for ribosome binding and eEF2 stabilization; i.e. the C-terminal region of Stm1, at least after aa 144, is unnecessary for ribosome binding, eEF2 trapping and repression of poly(Phe) synthesis. Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round of GTP-hydrolysis We finally investigated the effect of Stm1 on the ribosome-dependent GTPase activity of eEF2. In vitro GTPase assays were initially performed with [γ-32 P]GTP, and the GTPase activity was measured by quantifying the amount of hydrolyzed 32Pi extracted from the reaction using molybdate, as a function of time (Fig. 5A). The apparent Kcat values of the ribosome-dependent GTPase activity of eEF2 at the 5 min reaction time, in the presence and absence of Stm1, were estimated as 1.5 (min−1) and 3.5 (min−1), respectively. Although Stm1 slightly reduced the ribosome-dependent GTPase activity of eEF2, it was not very clear if the effect was significant, especially during the early period of the reaction. Thus, for a more detailed time-resolved measurement, we next employed the GTP/NADH-coupled assay that measures the rate of NADH absorbance decrease at 340 nm as a function of time, which is proportional to the rate of GTP hydrolysis (Fig. 5B). Comparisons within the linear range of kinetic alteration (< 60 s) affirmed that there is no significant difference between the rates of GTP hydrolysis in the presence and absence of Stm1. Within this range, the Kcat values of the ribosome-dependent GTPase activity of eEF2 in the presence and absence of Stm1 were estimated as 8.9 (min−1) and 11.1 (min−1), respectively. These values are comparable to the reported Kcat value of the GTPase activity of the eEF2/ribosome complex (9.6 min−1) (31). Notably, a single round of GTP-hydrolysis by the eEF2/ribosome complex is completed within 10 s, according to the obtained kinetic rates. Our results suggest that Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round of GTP-hydrolysis. The slight slowdown of GTP-hydrolysis during the late period of reaction might reflect the delay of GDP•GTP exchange in eEF2 on the ribosome in the presence of Stm1. Further study is required to verify this hypothesis. Fig. 5 View largeDownload slide Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round. (A) GTPase assay utilizing γ-[32 P]GTP. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.04 μM each) were incubated with γ-[32 P]GTP for the indicated time period with or without Stm1 (f.c. 0.04 μM), and the release of [32 P]Pi was measured. The apparent Kcat values of the ribosome-dependent GTPase activity of eEF2 at the 5 min reaction time, in the presence and absence of Stm1, were estimated as 1.5 (min−1) and 3.5 (min−1), respectively. (B) GTP/NADH-coupled GTPase assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.5 μM each) were incubated in buffer, containing 0.5 mM GTP, 0.5 mM NADH, 5 mM phosphoenol pyruvate, 3.6 μg of PK and 6 μg of L-lactate dehydrogenase (LDH), for the indicated time period in the presence or absence of Stm1 (f.c. 0.5 μM). The rate of GTP hydrolysis was measured by the decrease of NADH absorbance at 340 nm. Based on the experimental points from the linear region of the curve, the Kcat values of the ribosome-dependent GTPase activity of eEF2 in the presence and absence of Stm1 were estimated as 8.9±3.3 (min−1) and 11.1±4.5 (min−1), respectively. Fig. 5 View largeDownload slide Stm1 does not inhibit the ribosome-dependent GTPase activity of eEF2, at least during the first round. (A) GTPase assay utilizing γ-[32 P]GTP. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.04 μM each) were incubated with γ-[32 P]GTP for the indicated time period with or without Stm1 (f.c. 0.04 μM), and the release of [32 P]Pi was measured. The apparent Kcat values of the ribosome-dependent GTPase activity of eEF2 at the 5 min reaction time, in the presence and absence of Stm1, were estimated as 1.5 (min−1) and 3.5 (min−1), respectively. (B) GTP/NADH-coupled GTPase assay. Equal amount of 80 S ribosomes and eEF2 (f.c. 0.5 μM each) were incubated in buffer, containing 0.5 mM GTP, 0.5 mM NADH, 5 mM phosphoenol pyruvate, 3.6 μg of PK and 6 μg of L-lactate dehydrogenase (LDH), for the indicated time period in the presence or absence of Stm1 (f.c. 0.5 μM). The rate of GTP hydrolysis was measured by the decrease of NADH absorbance at 340 nm. Based on the experimental points from the linear region of the curve, the Kcat values of the ribosome-dependent GTPase activity of eEF2 in the presence and absence of Stm1 were estimated as 8.9±3.3 (min−1) and 11.1±4.5 (min−1), respectively. Discussion In the present study, using an in vitro reconstituted translation system, we confirmed that Stm1 inhibits poly(Phe) synthesis, and showed that this inhibition is antagonized by eEF3. We found that eEF2, presumably in its GTP-bound form, is stabilized on the 80 S ribosome in the presence of Stm1. An analysis with truncated Stm1 variants revealed that the C-terminal region of Stm1, after aa 144, is not required for translation inhibition, ribosome binding, or eEF2 trapping. Mechanism of poly(Phe) synthesis inhibition by Stm1 At present, it is unclear whether Stm1 targets the elongating ribosomes during poly(Phe) synthesis. Stm1 is a multi-copy suppressor of the pat1Δ strain, and promotes the function of Dhh1 (6). The Pat1 and Dhh1 proteins, which promote decapping in vivo, inhibit 48 S initiation complex formation and repress translation initiation (32, 33). Thus, it is reasonable to think that Stm1 also inhibits translation initiation, rather than translation elongation. Stm1 might repress poly(Phe) synthesis by inhibiting the multi-round translation; Stm1 might bind to the ribosome during ribosomal subunit association, and act on the initiating ribosomes. Nevertheless, Stm1 might inhibit ‘early translation elongation’ after mRNA and tRNA binding, which would also be beneficial for mRNA decapping. It remains to be investigated whether mRNA is excluded from the ribosome by Stm1 during the inhibition of poly(Phe) synthesis. We also observed that eEF3 antagonizes the translation repression by Stm1 (Fig. 1). Together with the previous report that Stm1 perturbs the association of the elongation factor eEF3 with the ribosome (10), this observation implies the mechanism of translation regulation through Stm1 and eEF3 in yeast. It is noteworthy that eEF3, but not Stm1, is sequestered from the cytosol into stress granules under certain stress conditions (34). It is fascinating to think that the translation elongation proceeds in the presence of eEF3 and Stm1, but is inhibited by Stm1 in the absence of eEF3. Further studies are required to verify this hypothesis. Mechanism and role of Stm1-mediated eEF2 stabilization on the ribosome We demonstrated that Stm1 stabilizes eEF2 binding on the ribosome in the GTP-bound conformation (Fig. 2), and allows for a first round of GTP hydrolysis by eEF2 on the ribosome (Fig. 5). These observations are reminiscent of the action of the antibiotics fusidic acid (FA) and sordarin, translation elongation inhibitors that target EF-G or eEF2 (FA for both EF-G and eEF2, and sordarin for eEF2). It has been suggested that FA locks EF-G in the GTP conformation after GTP hydrolysis, and thereby prevents the factor from dissociating from the ribosome (35). FA binds to EF-G in the vicinity of switch loop I in domain I. FA stabilizes EF-G by mimicking the structure of switch loop I in the GTP state, thereby indirectly inducing the orientation of domain IV in the GTP-bound conformation (36). In contrast, the core region of Stm1, aa 47 through 143, which passes over the decoding centre of the 40 S ribosomal small subunit, is responsible for eEF2 stabilization (Fig. 4). Stm1 would fix eEF2 in its GTP-bound conformation through the direct interaction with the tip of domain IV of eEF2. Despite the similarity between the activities of FA/sordarin and Stm1, the eEF2•Stm1 interaction is probably not involved in the inhibition of translation elongation. This idea may explain why the ability of Stm1 for translation repression (Fig. 4B) and for eEF2-stabilization on ribosome (Fig. 4C) does not fully correlate. The eEF2•Stm1 interaction may be implicated in the preservation of empty ribosomes during stress conditions, rather than in the repression of translation elongation (16). Perhaps in agreement with this, in human cells, the prominent association of eEF2 with non-translating ribosomes; i.e. empty ribosomes without mRNA, is observed, and such eEF2-bound ribosomes accumulate under stress conditions (37). Role of the C-terminal region of Stm1 We demonstrated that the truncation of the C-terminal region of Stm1, the region after aa 144, has absolutely no effect on either its ribosome binding or repression of poly(Phe) synthesis (Fig. 4). This finding is consistent with the observation that this C-terminal region of Stm1 is situated outside of the ribosome (15). In contrast, the recombinant Stm1Δ240–244 protein reportedly showed reduced ability to repress the translation of capped mRNA when added to an in vitro translation system using yeast extract (12). Stm1Δ240–244 failed to rescue the temperature-sensitive phenotype of the pat1Δ strain, and to inhibit the growth defect of the dhh1Δ strain (12). Thus, it is plausible to think that this region is involved in specific interactions with Pat1 and Dhh1. Stm1 might partly repress the translation of capped mRNA through decapping mRNAs in the in vitro translation system using yeast extract. The genetic link between Stm1 and mRNA decapping and degradation underlines its pivotal role in the coordination of translation and mRNA metabolism. Further studies are awaited concerning the mechanism of translation inhibition by Stm1, and the role of the tight interaction between eEF2 and the ribosome in the presence of Stm1. Acknowledgements The authors sincerely thank Dr. Akira Kaji and Dr. Hideko Kaji for the TKY675 strain, and Dr. Takuya Ueda for valuable discussions and continuous support. Funding This work was supported by a Grant-in-Aid for Young Scientists (B) from the Japan Society for the Promotion of Science (JSPS), a Grant-in-Aid for Scientific Research on Innovative Areas from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (MEXT), Grants-in-Aid from the Takeda Science Foundation, and the Uehara Memorial Foundation to N.T. Conflict of Interest None declared. References 1 Ghaemmaghami S., Huh W.K., Bower K., Howson R.W., Belle A., Dephoure N., O'Shea E.K., Weissman J.S. ( 2003) Global analysis of protein expression in yeast. Nature  425, 737– 741 Google Scholar CrossRef Search ADS PubMed  2 Kulak N.A., Pichler G., Paron I., Nagaraj N., Mann M. ( 2014) Minimal, encapsulated proteomic-sample processing applied to copy-number estimation in eukaryotic cells. Nat. Methods  11, 319– 324 Google Scholar CrossRef Search ADS PubMed  3 Frantz J.D., Gilbert W. ( 1995) A yeast gene product, G4p2, with a specific affinity for quadruplex nucleic acids. J. Biol. Chem.  270, 9413– 9419 Google Scholar CrossRef Search ADS PubMed  4 Utsugi T., Toh-e A., Kikuchi Y. ( 1995) A high dose of the STM1 gene suppresses the temperature sensitivity of the tom1 and htr1 mutants in Saccharomyces cerevisiae. Biochim. Biophys. Acta  1263, 285– 288 Google Scholar CrossRef Search ADS PubMed  5 Hata H., Mitsui H., Liu H., Bai Y., Denis C.L., Shimizu Y., Sakai A. ( 1998) Dhh1p, a putative RNA helicase, associates with the general transcription factors Pop2p and Ccr4p from Saccharomyces cerevisiae. Genetics  148, 571– 579 Google Scholar PubMed  6 Balagopal V., Parker R. ( 2009) Stm1 modulates mRNA decay and Dhh1 function in Saccharomyces cerevisiae. Genetics  181, 93– 103 Google Scholar CrossRef Search ADS PubMed  7 Inada T., Winstall E., Tarun S.Z.Jr., Yates J.R.III, Schieltz D., Sachs A.B. ( 2002) One-step affinity purification of the yeast ribosome and its associated proteins and mRNAs. RNA  8, 948– 958 Google Scholar CrossRef Search ADS PubMed  8 Van Dyke M.W., Nelson L.D., Weilbaecher R.G., Mehta D.V. ( 2004) Stm1p, a G4 quadruplex and purine motif triplex nucleic acid-binding protein, interacts with ribosomes and subtelomeric Y' DNA in Saccharomyces cerevisiae. J. Biol. Chem.  279, 24323– 24333 Google Scholar CrossRef Search ADS PubMed  9 Van Dyke N., Baby J., Van Dyke M.W. ( 2006) Stm1p, a ribosome-associated protein, is important for protein synthesis in Saccharomyces cerevisiae under nutritional stress conditions. J. Mol. Biol.  358, 1023– 1031 Google Scholar CrossRef Search ADS PubMed  10 Van Dyke N., Pickering B.F., Van Dyke M.W. ( 2009) Stm1p alters the ribosome association of eukaryotic elongation factor 3 and affects translation elongation. Nucleic Acids Res.  37, 6116– 6125 Google Scholar CrossRef Search ADS PubMed  11 Correia H., Medina R., Hernandez A., Bustamante E., Chakraburtty K., Herrera F. ( 2004) Similarity between the association factor of ribosomal subunits and the protein Stm1p from Saccharomyces cerevisiae. Mem. Inst. Oswaldo Cruz  99, 733– 737 Google Scholar CrossRef Search ADS PubMed  12 Balagopal V., Parker R. ( 2011) Stm1 modulates translation after 80S formation in Saccharomyces cerevisiae. RNA  17, 835– 842 Google Scholar CrossRef Search ADS PubMed  13 Van Dyke N., Chanchorn E., Van Dyke M.W. ( 2013) The Saccharomyces cerevisiae protein Stm1p facilitates ribosome preservation during quiescence. Biochem. Biophys. Res. Commun.  430, 745– 750 Google Scholar CrossRef Search ADS PubMed  14 van den Elzen A.M., Schuller A., Green R., Seraphin B. ( 2014) Dom34-Hbs1 mediated dissociation of inactive 80S ribosomes promotes restart of translation after stress. Embo J.  33, 265– 276 Google Scholar PubMed  15 Ben-Shem A., Garreau de Loubresse N., Melnikov S., Jenner L., Yusupova G., Yusupov M. ( 2011) The structure of the eukaryotic ribosome at 3.0 A resolution. Science  334, 1524– 1529 Google Scholar CrossRef Search ADS PubMed  16 Anger A.M., Armache J.P., Berninghausen O., Habeck M., Subklewe M., Wilson D.N., Beckmann R. ( 2013) Structures of the human and Drosophila 80S ribosome. Nature  497, 80– 85 Google Scholar CrossRef Search ADS PubMed  17 Winzeler E.A., Shoemaker D.D., Astromoff A., Liang H., Anderson K., Andre B., Bangham R., Benito R., Boeke J.D., Bussey H., Chu A.M., Connelly C., Davis K., Dietrich F., Dow S.W., El Bakkoury M., Foury F., Friend S.H., Gentalen E., Giaever G., Hegemann J.H., Jones T., Laub M., Liao H., Liebundguth N., Lockhart D.J., Lucau-Danila A., Lussier M., M'Rabet N., Menard P., Mittmann M., Pai C., Rebischung C., Revuelta J.L., Riles L., Roberts C.J., Ross-MacDonald P., Scherens B., Snyder M., Sookhai-Mahadeo S., Storms R.K., Veronneau S., Voet M., Volckaert G., Ward T.R., Wysocki R., Yen G.S., Yu K., Zimmermann K., Philippsen P., Johnston M., Davis R.W. ( 1999) Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science  285, 901– 906 Google Scholar CrossRef Search ADS PubMed  18 Leshin J.A., Rakauskaitė R., Dinman J., Meskauskas A. ( 2010) Enhanced purity, activity and structural integrity of yeast ribosomes purified using a general chromatographic method. RNA Biol.  7, 354– 360 Google Scholar CrossRef Search ADS PubMed  19 Eyler D.E., Green R. ( 2011) Distinct response of yeast ribosomes to a miscoding event during translation. RNA  17, 925– 932 Google Scholar CrossRef Search ADS PubMed  20 Gutierrez E., Shin B.S., Woolstenhulme C.J., Kim J.R., Saini P., Buskirk A.R., Dever T.E. ( 2013) eIF5A promotes translation of polyproline motifs. Mol. Cell  51, 35– 45 Google Scholar CrossRef Search ADS PubMed  21 Kurata S., Nielsen K.H., Mitchell S.F., Lorsch J.R., Kaji A., Kaji H. ( 2010) Ribosome recycling step in yeast cytoplasmic protein synthesis is catalyzed by eEF3 and ATP. Proc. Natl. Acad. Sci. USA  107, 10854– 10859 Google Scholar CrossRef Search ADS   22 Mumberg D., Muller R., Funk M. ( 1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene  156, 119– 122 Google Scholar CrossRef Search ADS PubMed  23 Kambampati R., Chakraburtty K. ( 1997) Overexpression and purification of elongation factor 3 from Saccharomyces cerevisiae. Protein Expr. Purif.  10, 209– 213 Google Scholar CrossRef Search ADS PubMed  24 Sandbaken M.G., Lupisella J.A., DiDomenico B., Chakraburtty K. ( 1990) Protein synthesis in yeast. Structural and functional analysis of the gene encoding elongation factor 3. J. Biol. Chem.  265, 15838– 15844 Google Scholar PubMed  25 Panaretou B., Prodromou C., Roe S.M., O'Brien R., Ladbury J.E., Piper P.W., Pearl L.H. ( 1998) ATP binding and hydrolysis are essential to the function of the Hsp90 molecular chaperone in vivo. Embo J.  17, 4829– 4836 Google Scholar CrossRef Search ADS PubMed  26 Jorgensen R., Ortiz P.A., Carr-Schmid A., Nissen P., Kinzy T.G., Andersen G.R. ( 2003) Two crystal structures demonstrate large conformational changes in the eukaryotic ribosomal translocase. Nat. Struct. Biol.  10, 379– 385 Google Scholar CrossRef Search ADS PubMed  27 Spahn C.M., Gomez-Lorenzo M.G., Grassucci R.A., Jorgensen R., Andersen G.R., Beckmann R., Penczek P.A., Ballesta J.P., Frank J. ( 2004) Domain movements of elongation factor eEF2 and the eukaryotic 80S ribosome facilitate tRNA translocation. Embo J.  23, 1008– 1019 Google Scholar CrossRef Search ADS PubMed  28 Phan L.D., Perentesis J.P., Bodley J.W. ( 1993) Saccharomyces cerevisiae elongation factor 2. Mutagenesis of the histidine precursor of diphthamide yields a functional protein that is resistant to diphtheria toxin. J. Biol. Chem.  268, 8665– 8668 Google Scholar PubMed  29 Kimata Y., Kohno K. ( 1994) Elongation factor 2 mutants deficient in diphthamide formation show temperature-sensitive cell growth. J. Biol. Chem.  269, 13497– 13501 Google Scholar PubMed  30 Ortiz P.A., Ulloque R., Kihara G.K., Zheng H., Kinzy T.G. ( 2006) Translation elongation factor 2 anticodon mimicry domain mutants affect fidelity and diphtheria toxin resistance. J. Biol. Chem.  281, 32639– 32648 Google Scholar CrossRef Search ADS PubMed  31 Nygard O., Nilsson L. ( 1990) Kinetic determination of the effects of ADP-ribosylation on the interaction of eukaryotic elongation factor 2 with ribosomes. J. Biol. Chem.  265, 6030– 6034 Google Scholar PubMed  32 Coller J., Parker R. ( 2005) General translational repression by activators of mRNA decapping. Cell  122, 875– 886 Google Scholar CrossRef Search ADS PubMed  33 Nissan T., Rajyaguru P., She M., Song H., Parker R. ( 2010) Decapping activators in Saccharomyces cerevisiae act by multiple mechanisms. Mol. Cell  39, 773– 783 Google Scholar CrossRef Search ADS PubMed  34 Grousl T., Ivanov P., Malcova I., Pompach P., Frydlova I., Slaba R., Senohrabkova L., Novakova L., Hasek J., Tuite M.F. ( 2013) Heat shock-induced accumulation of translation elongation and termination factors precedes assembly of stress granules in S. cerevisiae. PLoS One  8, e57083 Google Scholar CrossRef Search ADS PubMed  35 Gao Y.G., Selmer M., Dunham C.M., Weixlbaumer A., Kelley A.C., Ramakrishnan V. ( 2009) The structure of the ribosome with elongation factor G trapped in the posttranslocational state. Science  326, 694– 699 Google Scholar CrossRef Search ADS PubMed  36 Zhou J., Lancaster L., Donohue J.P., Noller H.F. ( 2013) Crystal structures of EF-G-ribosome complexes trapped in intermediate states of translocation. Science  340, 1236086 Google Scholar CrossRef Search ADS PubMed  37 Liu B., Qian S.B. ( 2016) Characterizing inactive ribosomes in translational profiling. Translation (Austin)  4, e1138018 Google Scholar PubMed  Abbreviations Abbreviations eEF1A eukaryotic translational elongation factor 1A eEF2 eukaryotic translational elongation factor 2 eEF3 eukaryotic translational elongation factor 3 FA fusidic acid NADH nicotinamide adenine dinucleotide (reduced form) Pi inorganic phosphate © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved

Journal

The Journal of BiochemistryOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 12 million articles from more than
10,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Unlimited reading

Read as many articles as you need. Full articles with original layout, charts and figures. Read online, from anywhere.

Stay up to date

Keep up with your field with Personalized Recommendations and Follow Journals to get automatic updates.

Organize your research

It’s easy to organize your research with our built-in tools.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve Freelancer

DeepDyve Pro

Price
FREE
$49/month

$360/year
Save searches from
Google Scholar,
PubMed
Create lists to
organize your research
Export lists, citations
Read DeepDyve articles
Abstract access only
Unlimited access to over
18 million full-text articles
Print
20 pages/month
PDF Discount
20% off