Thyroid-Specific PPARγ Deletion Is Benign in the Mouse

Thyroid-Specific PPARγ Deletion Is Benign in the Mouse Abstract Peroxisome proliferator–activated receptor γ (PPARγ) is widely expressed at low levels and regulates many physiological processes. In mice and humans, there is evidence that PPARγ can function as a tumor suppressor. A PAX8-PPARγ fusion protein (PPFP) is oncogenic in a subset of thyroid cancers, suggesting that inhibition of endogenous PPARγ function by the fusion protein could contribute to thyroid oncogenesis. However, the function of PPARγ within thyrocytes has never been directly tested. Therefore, we have created a thyroid-specific genetic knockout of murine Pparg and have studied thyroid biology in these mice. Thyroid size and histology, the expression of thyroid-specific genes, and serum T4 levels all are unaffected by loss of thyroidal PPARγ expression. PPFP thyroid cancers have increased activation of AKT, and mice with thyroid-specific expression of PPFP combined with thyroid-specific loss of PTEN (a negative regulator of AKT) develop thyroid cancer. Therefore we created mice with combined thyroid-specific deletions of Pparg and Pten to test if there is oncogenic synergy between these deletions. Pten deletion alone results in benign thyroid hyperplasia, and this is unchanged when combined with deletion of Pparg. We conclude that, at least in the contexts studied, thyrocyte PPARγ does not play a significant role in the development or function of the thyroid and does not function as a tumor suppressor. Peroxisome proliferator–activated receptor γ (PPARγ) is a nuclear receptor transcription factor that regulates adipogenesis, insulin sensitivity, and immune function, but it is widely expressed at low levels and has been shown to regulate numerous other physiological processes. For example, there is evidence in mice and humans that PPARγ can function as a tumor suppressor in colon and other cancers (1–5). In fact, in a mouse model of thyroid cancer due to mutation of thyroid hormone receptor β, whole-animal deletion of one Pparg allele results in more aggressive disease (6). A chromosomal translocation results in expression of a PAX8-PPARγ fusion protein (PPFP) in a subset of human thyroid cancers, raising the possibility that inhibition of endogenous PPARγ may underlie the oncogenic nature of PPFP (7). However, PPARγ is expressed at very low levels in the normal thyroid, and its function in that organ has never been directly examined. Therefore, we have created mice with thyroid-specific, homozygous deletion of Pparg, as well as mice with combined thyroid-specific homozygous deletions of Pparg and Pten. Pten encodes a critical negative regulator of AKT signaling, and increased AKT signaling by loss of PTEN expression or other mechanisms is associated with an increased risk of thyroid cancer (8–10). In the contexts studied, we were unable to identify a role for thyrocyte PPARγ in the development or function of the mouse thyroid, and PPARγ did not function as a tumor suppressor. Materials and Methods Mouse breeding and genotyping All protocols were approved by the University of Michigan Institutional Animal Care and Use Committee. Floxed Pparg mice were obtained from the Jackson Laboratory (Bar Harbor, ME) (Ppargtm2Rev/J; stock no. 004584). Floxed Pten mice (8, 11) and transgenic mice in which Cre recombinase expression is driven by the human thyroid peroxidase (TPO) promoter are as described (12, 13). All mice were bred on a pure FVB/N background. Breeding between these mice yielded progeny that were hemizygous for TPO-Cre and homozygous for floxed Pparg, resulting in homozygous thyroid-specific deletion of Pparg (hereafter denoted PpargThy−/−). Littermate homozygous floxed Pparg mice lacking Cre (PpargF/F) were used as controls. Additional breedings yielded progeny with combined homozygous thyroid-specific deletions of Pparg and Pten (PpargThy−/−;PtenThy−/−), as well as combined homozygous floxed mice (PpargF/F;PtenF/F) and mice with homozygous thyroid-specific deletion of just Pten (PtenThy−/−) that served as controls. Both male and female mice were studied. Genotyping was performed on tail DNA for Cre and the floxed Pten allele as previously described (8, 13) and for the floxed Pparg allele as described on the Jackson Laboratory website (https://www.jax.org/strain/004584). Thyroid gland genomic DNA was isolated using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) and was used to confirm Cre-mediated deletion of Pparg. We have previously confirmed the excision of floxed Pten by TPO promoter-Cre expression in mouse thyroid glands (8). Polymerase chain reaction (PCR) primers are listed in Table 1. Table 1. PCR Primers Target  Forward Primer  Reverse Primer  Pparg, tail genotyping  TGTAATGGAAGGGCAAAAGG  TGGCTTCCAGTGCATAAGTT  Pten, tail genotyping  TCCCAGAGTTCATACCAGGA  AATCTGTGCATGAAGGGAAC  TPO-Cre, tail genotypinga  TCATTGGTGGGCTTTGAGTCT  CTGCCGGCTCGGGGAT and TGCCACATACACTAACTGTGAGA  Pparg, thyroid DNA Cre-mediated excision  GCATGGTGGCACACACTTTA  TGGCTTCCAGTGCATAAGTT  Angptl4, real-time PCRb  AGCTCATTGGCTTGACTCCC  GCTCCCCTTCTTGGAAGAGT  Ccnd1, real-time PCRb  CTACCGCACAACGCACTTTC  CAGGCTTGACTCCAGAAGGG  Cd36, real-time PCRb  AGGCATTCTCATGCCAGTCG  TGTACACAGTGGTGCCTGTT  Duox2, real-time PCRb  AGATCAGTGTGGTGAAGGCG  CACCCACTGCCCTGATTTGT  Fabp4, real-time PCRb  GAGAAAACGAGATGGTGACAAGC  TCTTCCTTTGGCTCATGCCCT  Gpd1, real-time PCRb  CACAGTGGAGATCTGTGGGG  GTGTTGTCACCGAAGCCAAG  Nkx2-1 (TTF-1), real-time PCRb  TCGGAAAGACAGCATCAGCTT  GACTCATCGACATGATTCGGC  Pgk1, real-time PCRb  TGGTATACCTGCTGGCTGGA  ATCTGCTTAGCTCGACCCAC  Slc5a5 (NIS), real-time PCRb  TTGCTCAATTCGCTGCTCAC  CGGCTGAAGCGCAGTTCTA  Tg, real-time PCRb  TGTACCATGTCCCCGAAAGC  GCAGAGTAGAAGGGCAGTCC  Tpo, real-time PCRb  GGAGGGGGATTTCACCACAC  GAGGACCCTGGATCCACTTG  Target  Forward Primer  Reverse Primer  Pparg, tail genotyping  TGTAATGGAAGGGCAAAAGG  TGGCTTCCAGTGCATAAGTT  Pten, tail genotyping  TCCCAGAGTTCATACCAGGA  AATCTGTGCATGAAGGGAAC  TPO-Cre, tail genotypinga  TCATTGGTGGGCTTTGAGTCT  CTGCCGGCTCGGGGAT and TGCCACATACACTAACTGTGAGA  Pparg, thyroid DNA Cre-mediated excision  GCATGGTGGCACACACTTTA  TGGCTTCCAGTGCATAAGTT  Angptl4, real-time PCRb  AGCTCATTGGCTTGACTCCC  GCTCCCCTTCTTGGAAGAGT  Ccnd1, real-time PCRb  CTACCGCACAACGCACTTTC  CAGGCTTGACTCCAGAAGGG  Cd36, real-time PCRb  AGGCATTCTCATGCCAGTCG  TGTACACAGTGGTGCCTGTT  Duox2, real-time PCRb  AGATCAGTGTGGTGAAGGCG  CACCCACTGCCCTGATTTGT  Fabp4, real-time PCRb  GAGAAAACGAGATGGTGACAAGC  TCTTCCTTTGGCTCATGCCCT  Gpd1, real-time PCRb  CACAGTGGAGATCTGTGGGG  GTGTTGTCACCGAAGCCAAG  Nkx2-1 (TTF-1), real-time PCRb  TCGGAAAGACAGCATCAGCTT  GACTCATCGACATGATTCGGC  Pgk1, real-time PCRb  TGGTATACCTGCTGGCTGGA  ATCTGCTTAGCTCGACCCAC  Slc5a5 (NIS), real-time PCRb  TTGCTCAATTCGCTGCTCAC  CGGCTGAAGCGCAGTTCTA  Tg, real-time PCRb  TGTACCATGTCCCCGAAAGC  GCAGAGTAGAAGGGCAGTCC  Tpo, real-time PCRb  GGAGGGGGATTTCACCACAC  GAGGACCCTGGATCCACTTG  Abbreviations: NIS, sodium iodide symporter; TTF-1, thyroid transcription factor 1. a TPO-Cre genotyping utilizes a three-primer PCR so that the wild-type and transgene alleles are both detected (379 and 332 bp, respectively) (13). b All real-time PCR amplicons are intron spanning. View Large Thyroid histology and real-time reverse transcription PCR The right lobes of the mouse thyroid glands were removed en bloc with the trachea and fixed in 10% formalin, and 5-μ sections were stained with hematoxylin and eosin. The left lobes of the thyroid glands were isolated, weighed, and used to prepare total RNA with a Qiagen RNeasy mini kit (Qiagen, Inc., Germantown, MD). The RNA was reverse transcribed using random hexamer primers and Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA). The complementary DNA was analyzed by real-time PCR on an Applied Biosystems (Foster City, CA) Step One Plus instrument using PowerUp SYBR® Green Master Mix (ThermoFisher Scientific, Waltham, MA). Each 20-μL PCR reaction used the complementary DNA from 75 ng total RNA, except the reactions for thyroglobulin and thyroid peroxidase used 1% of that amount. PCR primers are listed in Table 1. Thyroid ultrasound Ultrasound images were recorded using a VisualSonics Vevo 2100 high-resolution microimaging system with a MS 550D transducer (VisualSonics, Toronto, Canada). The largest cross-sectional area of each thyroid lobe was estimated using the formula for the area of an ellipse and the long and short axes dimensions of the lobe. Serum thyroxine Serum thyroxine levels were measured using the AccuDiag T4 ELISA Kit (catalog no. 3149-16) from Diagnostic Automation/Cortex Diagnostics, Inc. (Woodland Hills, CA). Statistical analysis Comparisons were by analysis of variance followed by the Newman-Keuls test, with P < 0.05 considered significant. Because there were no differences between males and females, both sexes were combined for comparisons between genotypes. Twelve mice were studied for each genotype (six male, six female). Results Successful excision of Pparg in the mouse thyroid Genomic DNA was isolated from the thyroid glands of PpargThy−/− and PpargF/F mice. Analysis by PCR demonstrated essentially complete Cre-mediated excision of Pparg in PpargThy−/− mice (Fig. 1). Figure 1. View largeDownload slide Cre-mediated deletion of Pparg in the mouse thyroid. Thyroid DNA was isolated from PpargThy−/− and PpargF/F mice and subjected to PCR to detect Cre-mediated excision of the first two coding exons of PPARγ1. The expected band is 0.8 kb after Cre-mediated excision and 4 kb in the absence of excision. Figure 1. View largeDownload slide Cre-mediated deletion of Pparg in the mouse thyroid. Thyroid DNA was isolated from PpargThy−/− and PpargF/F mice and subjected to PCR to detect Cre-mediated excision of the first two coding exons of PPARγ1. The expected band is 0.8 kb after Cre-mediated excision and 4 kb in the absence of excision. Thyroid biology in the absence of PPARγ As shown in Fig. 2A (left two bars), there was no difference in the cross-sectional areas of the thyroid glands in PpargThy−/− mice compared with PpargF/F mice, and this similarity was confirmed by finding no difference in the weights of the left thyroid lobes (Fig. 2B, left two bars) (the right lobes were fixed in formalin en bloc with the tracheas and therefore were not weighed). Histologically, the thyroid glands of PpargThy−/− and PpargF/F mice also were similar (Fig. 2C, left two panels). To further evaluate potential effects of loss of PPARγ on thyroid function, we used real-time reverse transcription–PCR to measure the expression of five genes that are critical to normal thyroid function: Tg, Tpo, Duox2, Nkx2-1 (thyroid transcription factor 1), and Slc5a5 (sodium iodide symporter), as well as Pgk1 as a housekeeping gene. None of these genes differed in expression between PpargThy−/− and PpargF/F mice (Fig. 2D, left two bars for each gene). Previous RNA-seq and chromatin immunoprecipitation–seq studies of a transgenic mouse model of PPFP thyroid cancer identified genes that are induced by PPFP and that contain PPFP chromatin immunoprecipitation–seq peaks with PPARγ motifs (14), suggesting these genes also might be regulated by endogenous PPARγ in the normal thyroid. We tested the expression of five such genes: the cell cycle gene Ccnd1 and the lipid metabolism genes Angptl4, Cd36, Fabp4, and Gpd1. However, none of these differed in expression between PpargThy−/− and PpargF/F mice (Fig. 2E, left two bars for each gene). Furthermore, the serum T4 levels were not statistically different in PpargThy−/− and PpargF/F mice (Fig. 2F, left two bars). Thus, at least based on these criteria, loss of PPARγ expression within the thyroid gland has no discernable effect on thyroid development or function. Figure 2. View large Download slide Comparison of thyroid glands and thyroid function in mice of the following five genotypes: (1) PpargF/F; (2) PpargThy−/−; (3) PpargF/F;PtenF/F; (4) PtenThy−/−, and (5) PpargThy−/−;PtenThy−/−. Measurements were performed with mice 6 to 7 months of age, 12 mice per genotype, except in panel (E) (6 mice per genotype). (A) Maximal cross-sectional thyroid area measured by ultrasound (mean ± standard deviation). (B) Weight of the left thyroid lobe (mean ± standard deviation). (C) Representative hematoxylin and eosin–stained sections through the thyroid glands. Scale bar, 50 μm. (D, E) Gene expression measured by real-time reverse transcription PCR. The y-axis shows the cycle threshold (mean ± standard deviation). (F) Serum T4 levels (mean ± standard deviation). Statistical analyses are by analysis of variance followed by Newman-Keuls test; brackets with asterisks over bars indicate P < 0.05. To avoid clutter, we show significance in only the biologically important comparisons of PpargF/F vs PpargThy−/− (no comparisons were significant) and PpargF/F;PtenF/F vs PpargThy−/−;PtenThy−/− vs PtenThy−/− mice. All pairwise comparisons are presented in Supplemental Tables 1–14. Figure 2. View large Download slide Comparison of thyroid glands and thyroid function in mice of the following five genotypes: (1) PpargF/F; (2) PpargThy−/−; (3) PpargF/F;PtenF/F; (4) PtenThy−/−, and (5) PpargThy−/−;PtenThy−/−. Measurements were performed with mice 6 to 7 months of age, 12 mice per genotype, except in panel (E) (6 mice per genotype). (A) Maximal cross-sectional thyroid area measured by ultrasound (mean ± standard deviation). (B) Weight of the left thyroid lobe (mean ± standard deviation). (C) Representative hematoxylin and eosin–stained sections through the thyroid glands. Scale bar, 50 μm. (D, E) Gene expression measured by real-time reverse transcription PCR. The y-axis shows the cycle threshold (mean ± standard deviation). (F) Serum T4 levels (mean ± standard deviation). Statistical analyses are by analysis of variance followed by Newman-Keuls test; brackets with asterisks over bars indicate P < 0.05. To avoid clutter, we show significance in only the biologically important comparisons of PpargF/F vs PpargThy−/− (no comparisons were significant) and PpargF/F;PtenF/F vs PpargThy−/−;PtenThy−/− vs PtenThy−/− mice. All pairwise comparisons are presented in Supplemental Tables 1–14. Lack of synergy between deletion of Pparg and deletion of Pten There is evidence that Pparg can function as a tumor suppressor gene (1–6). Although we found there was no thyroid neoplasia with simple deletion of Pparg within the thyroid, the potential exists that loss of PPARγ may synergize with other factors in thyroid neoplasia. We decided to test for an interaction between thyroid-specific deletions of Pparg and Pten for several reasons. In humans, loss-of-function mutations in PTEN cause Cowden syndrome, which is associated with an increased risk of thyroid cancer (9). In FVB/N mice, homozygous deletion of Pten causes benign hyperplasia without neoplasia (8). However, Pten deletion synergizes with thyroid-specific expression of PPFP to cause metastatic thyroid cancer in mice (8). This is consistent with data from patients with PPFP thyroid cancer because they also manifest increased activation (phosphorylation) of AKT (15), and PTEN is a negative regulator of AKT signaling. Thus, a reasonable hypothesis is that the combined deletions of Pparg and Pten might phenocopy the oncogenic effect of PPFP expression combined with Pten deletion. Based on the above considerations, we compared mice with combined thyroid deletions of Pparg and Pten (PpargThy−/−;PtenThy−/−) vs PpargF/F;PtenF/F mice and mice with just Pten deletion (PtenThy−/−) as controls. Relative to PpargF/F;PtenF/F mice, PtenThy−/− mice and PpargThy−/−;PtenThy−/−mice both had an increase in thyroid area (Fig. 2A, right three bars) and weight (Fig. 2B, right three bars). Although the increase in thyroid weight was statistically slightly greater in PpargThy−/−;PtenThy−/− mice than PtenThy−/− mice, this is unlikely to be biologically important because there was no difference in thyroid area between these genotypes or in the other parameters described below. As reported previously (8), PtenThy−/− thyroids have benign hyperplasia, and here we show that there were no further histological changes in the PpargThy−/−;PtenThy−/− mice (Fig. 2C, right two images). Compared with PpargF/F;PtenF/F mice, Pten deletion was associated with decreased thyroidal expression (increased cycle threshold) of Tpo, Duox2, and Slc5a5, but there were no differences between PtenThy−/− and PpargThy−/−;PtenThy−/− mice (Fig. 2D, right three bars for each gene). Similarly, Pten deletion was associated with decreased thyroidal expression of Angptl4, Cd36, Fabp4, and Gpd1, but there were no differences between PtenThy−/− and PpargThy−/−;PtenThy−/− mice (Fig. 2E, right three bars for each gene). Finally, Pten deletion was associated with increased serum T4, but there were no further differences between PtenThy−/− and PpargThy−/−;PtenThy−/− mice (Fig. 2F, right three bars). We conclude that PtenThy−/− and PpargThy−/−;PtenThy−/− mice have essentially identical phenotypes, and the genetic deletions of Pparg and Pten do not synergize to cause thyroid neoplasia. Discussion PPARγ is the master regulator of adipogenesis (16) and was subsequently found to regulate insulin sensitivity when it was discovered to be the target of thiazolidinediones, which are used to treat type 2 diabetes (17). Over time, there has been increased appreciation of low-level PPARγ expression in many cell types, and genetic deletion experiments in mice have revealed roles for PPARγ in, for example, vascular smooth muscle cells (18), macrophages (19), T cells (20), hair follicle stem cells (21), neurons (22, 23), and hepatocytes (24). Furthermore, several lines of evidence suggest PPARγ may have tumor-suppressive properties (1–5). For example, in a mouse model of thyroid cancer due to mutation of thyroid hormone receptor β, the cancer is more aggressive when combined with single-allele whole-mouse deletion of Pparg (6). A subset of thyroid cancers is caused by a chromosomal translocation that results in production of PPFP, suggesting that disruption of endogenous PPARγ function could be part of the oncogenic mechanism (7). However, the function of PPARγ within the thyroid gland has not previously been directly studied. Here, we show that thyroid-specific genetic deletion of Pparg in mice has no effect on thyroid development or function in the basal state. Thyroid size and histology, the expression of thyroid differentiation genes, and serum T4 levels all are unaffected by deletion of Pparg (Fig. 2). Even genes that are likely induced by PPFP via PPARγ binding sites in a mouse model of thyroid cancer (14) have unaltered expression in mice lacking thyroidal PPARγ (Fig. 2E). This is probably due to the fact that PPFP is expressed at high levels in thyroid cancer, but PPARγ is expressed at very low levels in the normal thyroid. It should be noted that the TPO promoter that drives Cre expression becomes active at embryonic day 14.5 (12), and therefore the current studies do not address whether PPARγ could play a role earlier in thyroid development. We also found no evidence for a role for endogenous PPARγ as a thyroid tumor suppressor, either by itself or in concert with loss of PTEN. How can one square these findings with the observation that single-allele deletion of Pparg in mice enhances the oncogenic action of the “PV” mutation in thyroid hormone receptor β (6)? One possibility is that endogenous PPARγ is relevant only in certain types of thyroid cancer. It should be noted that the PV mutation results in severe thyroid hormone resistance with high levels of thyrotropin, thus activating cyclic adenosine monophosphate and potentially other pathways not activated in our mice. Alternatively, it should be noted that the previously described synergy is in the context of a whole-mouse deletion of Pparg, and it may be that the critical cell type for loss of PPARγ expression is not the thyrocyte but, for example, could be immune cells, vascular cells, or other cell types. In addition, differences in genetic background or age of the mice could play a role. The consequences of Pten deletion in the mouse thyroid are strain dependent (25). Furthermore, thyroid cancer due to Pten deletion by itself may take 1 to 2 years to manifest, whereas our mice were studied at 6 to 7 months of age (26). In conclusion, we found no evidence of a role for PPARγ in the development or function of the mouse thyroid gland or evidence that thyroidal PPARγ functions as a tumor suppressor. However, it remains possible that PPARγ could play an important role early in thyroid development (prior to mouse embryonic day 14.5), in other models of thyroid cancer, or under stressful circumstances such as iodine deficiency. Abbreviations: Abbreviations: PCR polymerase chain reaction PPARγ peroxisome proliferator–activated receptor γ PPFP PAX8-PPARγ fusion protein TPO thyroid peroxidase Acknowledgments Financial Support: National Cancer Institute Grant R01CA166033. Disclosure Summary: The authors have nothing to disclose. References 1. Bonofiglio D, Cione E, Qi H, Pingitore A, Perri M, Catalano S, Vizza D, Panno ML, Genchi G, Fuqua SA, Andò S. Combined low doses of PPARgamma and RXR ligands trigger an intrinsic apoptotic pathway in human breast cancer cells. Am J Pathol . 2009; 175( 3): 1270– 1280. Google Scholar CrossRef Search ADS PubMed  2. Fujisawa T, Sugiyama M, Tomimoto A, Wada K, Endo H, Takahashi H, Yoneda K, Yoneda M, Inamori M, Saito S, Terauchi Y, Kadowaki T, Tsuchiya N, Nakagama H, Nakajima A. Inhibition of peroxisome proliferator-activated receptor gamma promotes tumorigenesis through activation of the beta-catenin/T cell factor (TCF) pathway in the mouse intestine. J Pharmacol Sci . 2008; 108( 4): 535– 544. Google Scholar CrossRef Search ADS PubMed  3. McAlpine CA, Barak Y, Matise I, Cormier RT. Intestinal-specific PPARgamma deficiency enhances tumorigenesis in ApcMin/+ mice. Int J Cancer . 2006; 119( 10): 2339– 2346. Google Scholar CrossRef Search ADS PubMed  4. Sarraf P, Mueller E, Smith WM, Wright HM, Kum JB, Aaltonen LA, de la Chapelle A, Spiegelman BM, Eng C. Loss-of-function mutations in PPAR gamma associated with human colon cancer. Mol Cell . 1999; 3( 6): 799– 804. Google Scholar CrossRef Search ADS PubMed  5. Shankaranarayanan P, Rossin A, Khanwalkar H, Alvarez S, Alvarez R, Jacobson A, Nebbioso A, de Lera AR, Altucci L, Gronemeyer H. Growth factor–antagonized rexinoid apoptosis involves permissive PPARgamma/RXR heterodimers to activate the intrinsic death pathway by NO. Cancer Cell . 2009; 16( 3): 220– 231. Google Scholar CrossRef Search ADS PubMed  6. Kato Y, Ying H, Zhao L, Furuya F, Araki O, Willingham MC, Cheng SY. PPARgamma insufficiency promotes follicular thyroid carcinogenesis via activation of the nuclear factor–kappaB signaling pathway. Oncogene . 2005; 25( 19): 2736– 2747. Google Scholar CrossRef Search ADS   7. Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM, Fletcher JA. PAX8-PPARgamma1 fusion oncogene in human thyroid carcinoma [corrected]. Science . 2000; 289( 5483): 1357– 1360. Google Scholar CrossRef Search ADS PubMed  8. Dobson ME, Diallo-Krou E, Grachtchouk V, Yu J, Colby LA, Wilkinson JE, Giordano TJ, Koenig RJ. Pioglitazone induces a proadipogenic antitumor response in mice with PAX8-PPARgamma fusion protein thyroid carcinoma. Endocrinology . 2011; 152( 11): 4455– 4465. Google Scholar CrossRef Search ADS PubMed  9. Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, Tsou HC, Peacocke M, Eng C, Parsons R. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet . 1997; 16( 1): 64– 67. Google Scholar CrossRef Search ADS PubMed  10. Yeager N, Klein-Szanto A, Kimura S, Di Cristofano A. Pten loss in the mouse thyroid causes goiter and follicular adenomas: insights into thyroid function and Cowden disease pathogenesis. Cancer Res . 2007; 67( 3): 959– 966. Google Scholar CrossRef Search ADS PubMed  11. Lesche R, Groszer M, Gao J, Wang Y, Messing A, Sun H, Liu X, Wu H. Cre/loxP-mediated inactivation of the murine Pten tumor suppressor gene. Genesis . 2002; 32( 2): 148– 149. Google Scholar CrossRef Search ADS PubMed  12. Kusakabe T, Kawaguchi A, Kawaguchi R, Feigenbaum L, Kimura S. Thyrocyte-specific expression of Cre recombinase in transgenic mice. Genesis . 2004; 39( 3): 212– 216. Google Scholar CrossRef Search ADS PubMed  13. Raman P, Grachtchouk V, Lyons RH Jr, Koenig RJ. Identification of the genomic insertion site of the thyroid peroxidase promoter-Cre recombinase transgene using a novel, efficient, next-generation DNA sequencing method. Thyroid . 2015; 25: 1162– 1166. Google Scholar CrossRef Search ADS PubMed  14. Zhang Y, Yu J, Grachtchouk V, Qin T, Lumeng CN, Sartor MA, Koenig RJ. Genomic binding of PAX8-PPARG fusion protein regulates cancer-related pathways and alters the immune landscape of thyroid cancer. Oncotarget . 2016; 8( 4): 5761– 5773. 15. Diallo-Krou E, Yu J, Colby LA, Inoki K, Wilkinson JE, Thomas DG, Giordano TJ, Koenig RJ. Paired box gene 8-peroxisome proliferator-activated receptor-gamma fusion protein and loss of phosphatase and tensin homolog synergistically cause thyroid hyperplasia in transgenic mice. Endocrinology . 2009; 150( 11): 5181– 5190. Google Scholar CrossRef Search ADS PubMed  16. Tontonoz P, Hu E, Spiegelman BM. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell . 1994; 79( 7): 1147– 1156. Google Scholar CrossRef Search ADS PubMed  17. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem . 1995; 270( 22): 12953– 12956. Google Scholar CrossRef Search ADS PubMed  18. Chang L, Villacorta L, Zhang J, Garcia-Barrio MT, Yang K, Hamblin M, Whitesall SE, D’Alecy LG, Chen YE. Vascular smooth muscle cell-selective peroxisome proliferator-activated receptor-gamma deletion leads to hypotension. Circulation . 2009; 119( 16): 2161– 2169. Google Scholar CrossRef Search ADS PubMed  19. Cheng WY, Huynh H, Chen P, Peña-Llopis S, Wan Y. Macrophage PPARγ inhibits Gpr132 to mediate the anti-tumor effects of rosiglitazone. eLife . 2016; 5: 5. 20. Huang X, Ren L, Ye P, Cheng C, Wu J, Wang S, Sun Y, Liu Z, Xie A, Xia J. Peroxisome proliferator-activated receptor γ deficiency in T cells accelerates chronic rejection by influencing the differentiation of CD4+ T cells and alternatively activated macrophages. PLoS One . 2014; 9( 11): e112953. Google Scholar CrossRef Search ADS PubMed  21. Karnik P, Tekeste Z, McCormick TS, Gilliam AC, Price VH, Cooper KD, Mirmirani P. Hair follicle stem cell-specific PPARgamma deletion causes scarring alopecia. J Invest Dermatol . 2009; 129( 5): 1243– 1257. Google Scholar CrossRef Search ADS PubMed  22. Liu C, Bookout AL, Lee S, Sun K, Jia L, Lee C, Udit S, Deng Y, Scherer PE, Mangelsdorf DJ, Gautron L, Elmquist JK. PPARγ in vagal neurons regulates high-fat diet induced thermogenesis. Cell Metab . 2014; 19( 4): 722– 730. Google Scholar CrossRef Search ADS PubMed  23. Long L, Toda C, Jeong JK, Horvath TL, Diano S. PPARγ ablation sensitizes proopiomelanocortin neurons to leptin during high-fat feeding. J Clin Invest . 2014; 124( 9): 4017– 4027. Google Scholar CrossRef Search ADS PubMed  24. Morán-Salvador E, López-Parra M, García-Alonso V, Titos E, Martínez-Clemente M, González-Périz A, López-Vicario C, Barak Y, Arroyo V, Clària J. Role for PPARγ in obesity-induced hepatic steatosis as determined by hepatocyte- and macrophage-specific conditional knockouts. FASEB J . 2011; 25( 8): 2538– 2550. Google Scholar CrossRef Search ADS PubMed  25. Tiozzo C, Danopoulos S, Lavarreda-Pearce M, Baptista S, Varimezova R, Al Alam D, Warburton D, Virender R, De Langhe S, Di Cristofano A, Bellusci S, Minoo P. Embryonic epithelial Pten deletion through Nkx2.1-cre leads to thyroid tumorigenesis in a strain-dependent manner. Endocr Relat Cancer . 2011; 19( 2): 111– 122. Google Scholar CrossRef Search ADS   26. Antico-Arciuch VG, Dima M, Liao XH, Refetoff S, Di Cristofano A. Cross-talk between PI3K and estrogen in the mouse thyroid predisposes to the development of follicular carcinomas with a higher incidence in females. Oncogene . 2010; 29( 42): 5678– 5686. Google Scholar CrossRef Search ADS PubMed  Copyright © 2018 Endocrine Society http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Endocrinology Oxford University Press

Thyroid-Specific PPARγ Deletion Is Benign in the Mouse

Loading next page...
 
/lp/ou_press/thyroid-specific-ppar-deletion-is-benign-in-the-mouse-1ez3APvikS
Publisher
Endocrine Society
Copyright
Copyright © 2018 Endocrine Society
ISSN
0013-7227
eISSN
1945-7170
D.O.I.
10.1210/en.2017-03163
Publisher site
See Article on Publisher Site

Abstract

Abstract Peroxisome proliferator–activated receptor γ (PPARγ) is widely expressed at low levels and regulates many physiological processes. In mice and humans, there is evidence that PPARγ can function as a tumor suppressor. A PAX8-PPARγ fusion protein (PPFP) is oncogenic in a subset of thyroid cancers, suggesting that inhibition of endogenous PPARγ function by the fusion protein could contribute to thyroid oncogenesis. However, the function of PPARγ within thyrocytes has never been directly tested. Therefore, we have created a thyroid-specific genetic knockout of murine Pparg and have studied thyroid biology in these mice. Thyroid size and histology, the expression of thyroid-specific genes, and serum T4 levels all are unaffected by loss of thyroidal PPARγ expression. PPFP thyroid cancers have increased activation of AKT, and mice with thyroid-specific expression of PPFP combined with thyroid-specific loss of PTEN (a negative regulator of AKT) develop thyroid cancer. Therefore we created mice with combined thyroid-specific deletions of Pparg and Pten to test if there is oncogenic synergy between these deletions. Pten deletion alone results in benign thyroid hyperplasia, and this is unchanged when combined with deletion of Pparg. We conclude that, at least in the contexts studied, thyrocyte PPARγ does not play a significant role in the development or function of the thyroid and does not function as a tumor suppressor. Peroxisome proliferator–activated receptor γ (PPARγ) is a nuclear receptor transcription factor that regulates adipogenesis, insulin sensitivity, and immune function, but it is widely expressed at low levels and has been shown to regulate numerous other physiological processes. For example, there is evidence in mice and humans that PPARγ can function as a tumor suppressor in colon and other cancers (1–5). In fact, in a mouse model of thyroid cancer due to mutation of thyroid hormone receptor β, whole-animal deletion of one Pparg allele results in more aggressive disease (6). A chromosomal translocation results in expression of a PAX8-PPARγ fusion protein (PPFP) in a subset of human thyroid cancers, raising the possibility that inhibition of endogenous PPARγ may underlie the oncogenic nature of PPFP (7). However, PPARγ is expressed at very low levels in the normal thyroid, and its function in that organ has never been directly examined. Therefore, we have created mice with thyroid-specific, homozygous deletion of Pparg, as well as mice with combined thyroid-specific homozygous deletions of Pparg and Pten. Pten encodes a critical negative regulator of AKT signaling, and increased AKT signaling by loss of PTEN expression or other mechanisms is associated with an increased risk of thyroid cancer (8–10). In the contexts studied, we were unable to identify a role for thyrocyte PPARγ in the development or function of the mouse thyroid, and PPARγ did not function as a tumor suppressor. Materials and Methods Mouse breeding and genotyping All protocols were approved by the University of Michigan Institutional Animal Care and Use Committee. Floxed Pparg mice were obtained from the Jackson Laboratory (Bar Harbor, ME) (Ppargtm2Rev/J; stock no. 004584). Floxed Pten mice (8, 11) and transgenic mice in which Cre recombinase expression is driven by the human thyroid peroxidase (TPO) promoter are as described (12, 13). All mice were bred on a pure FVB/N background. Breeding between these mice yielded progeny that were hemizygous for TPO-Cre and homozygous for floxed Pparg, resulting in homozygous thyroid-specific deletion of Pparg (hereafter denoted PpargThy−/−). Littermate homozygous floxed Pparg mice lacking Cre (PpargF/F) were used as controls. Additional breedings yielded progeny with combined homozygous thyroid-specific deletions of Pparg and Pten (PpargThy−/−;PtenThy−/−), as well as combined homozygous floxed mice (PpargF/F;PtenF/F) and mice with homozygous thyroid-specific deletion of just Pten (PtenThy−/−) that served as controls. Both male and female mice were studied. Genotyping was performed on tail DNA for Cre and the floxed Pten allele as previously described (8, 13) and for the floxed Pparg allele as described on the Jackson Laboratory website (https://www.jax.org/strain/004584). Thyroid gland genomic DNA was isolated using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) and was used to confirm Cre-mediated deletion of Pparg. We have previously confirmed the excision of floxed Pten by TPO promoter-Cre expression in mouse thyroid glands (8). Polymerase chain reaction (PCR) primers are listed in Table 1. Table 1. PCR Primers Target  Forward Primer  Reverse Primer  Pparg, tail genotyping  TGTAATGGAAGGGCAAAAGG  TGGCTTCCAGTGCATAAGTT  Pten, tail genotyping  TCCCAGAGTTCATACCAGGA  AATCTGTGCATGAAGGGAAC  TPO-Cre, tail genotypinga  TCATTGGTGGGCTTTGAGTCT  CTGCCGGCTCGGGGAT and TGCCACATACACTAACTGTGAGA  Pparg, thyroid DNA Cre-mediated excision  GCATGGTGGCACACACTTTA  TGGCTTCCAGTGCATAAGTT  Angptl4, real-time PCRb  AGCTCATTGGCTTGACTCCC  GCTCCCCTTCTTGGAAGAGT  Ccnd1, real-time PCRb  CTACCGCACAACGCACTTTC  CAGGCTTGACTCCAGAAGGG  Cd36, real-time PCRb  AGGCATTCTCATGCCAGTCG  TGTACACAGTGGTGCCTGTT  Duox2, real-time PCRb  AGATCAGTGTGGTGAAGGCG  CACCCACTGCCCTGATTTGT  Fabp4, real-time PCRb  GAGAAAACGAGATGGTGACAAGC  TCTTCCTTTGGCTCATGCCCT  Gpd1, real-time PCRb  CACAGTGGAGATCTGTGGGG  GTGTTGTCACCGAAGCCAAG  Nkx2-1 (TTF-1), real-time PCRb  TCGGAAAGACAGCATCAGCTT  GACTCATCGACATGATTCGGC  Pgk1, real-time PCRb  TGGTATACCTGCTGGCTGGA  ATCTGCTTAGCTCGACCCAC  Slc5a5 (NIS), real-time PCRb  TTGCTCAATTCGCTGCTCAC  CGGCTGAAGCGCAGTTCTA  Tg, real-time PCRb  TGTACCATGTCCCCGAAAGC  GCAGAGTAGAAGGGCAGTCC  Tpo, real-time PCRb  GGAGGGGGATTTCACCACAC  GAGGACCCTGGATCCACTTG  Target  Forward Primer  Reverse Primer  Pparg, tail genotyping  TGTAATGGAAGGGCAAAAGG  TGGCTTCCAGTGCATAAGTT  Pten, tail genotyping  TCCCAGAGTTCATACCAGGA  AATCTGTGCATGAAGGGAAC  TPO-Cre, tail genotypinga  TCATTGGTGGGCTTTGAGTCT  CTGCCGGCTCGGGGAT and TGCCACATACACTAACTGTGAGA  Pparg, thyroid DNA Cre-mediated excision  GCATGGTGGCACACACTTTA  TGGCTTCCAGTGCATAAGTT  Angptl4, real-time PCRb  AGCTCATTGGCTTGACTCCC  GCTCCCCTTCTTGGAAGAGT  Ccnd1, real-time PCRb  CTACCGCACAACGCACTTTC  CAGGCTTGACTCCAGAAGGG  Cd36, real-time PCRb  AGGCATTCTCATGCCAGTCG  TGTACACAGTGGTGCCTGTT  Duox2, real-time PCRb  AGATCAGTGTGGTGAAGGCG  CACCCACTGCCCTGATTTGT  Fabp4, real-time PCRb  GAGAAAACGAGATGGTGACAAGC  TCTTCCTTTGGCTCATGCCCT  Gpd1, real-time PCRb  CACAGTGGAGATCTGTGGGG  GTGTTGTCACCGAAGCCAAG  Nkx2-1 (TTF-1), real-time PCRb  TCGGAAAGACAGCATCAGCTT  GACTCATCGACATGATTCGGC  Pgk1, real-time PCRb  TGGTATACCTGCTGGCTGGA  ATCTGCTTAGCTCGACCCAC  Slc5a5 (NIS), real-time PCRb  TTGCTCAATTCGCTGCTCAC  CGGCTGAAGCGCAGTTCTA  Tg, real-time PCRb  TGTACCATGTCCCCGAAAGC  GCAGAGTAGAAGGGCAGTCC  Tpo, real-time PCRb  GGAGGGGGATTTCACCACAC  GAGGACCCTGGATCCACTTG  Abbreviations: NIS, sodium iodide symporter; TTF-1, thyroid transcription factor 1. a TPO-Cre genotyping utilizes a three-primer PCR so that the wild-type and transgene alleles are both detected (379 and 332 bp, respectively) (13). b All real-time PCR amplicons are intron spanning. View Large Thyroid histology and real-time reverse transcription PCR The right lobes of the mouse thyroid glands were removed en bloc with the trachea and fixed in 10% formalin, and 5-μ sections were stained with hematoxylin and eosin. The left lobes of the thyroid glands were isolated, weighed, and used to prepare total RNA with a Qiagen RNeasy mini kit (Qiagen, Inc., Germantown, MD). The RNA was reverse transcribed using random hexamer primers and Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA). The complementary DNA was analyzed by real-time PCR on an Applied Biosystems (Foster City, CA) Step One Plus instrument using PowerUp SYBR® Green Master Mix (ThermoFisher Scientific, Waltham, MA). Each 20-μL PCR reaction used the complementary DNA from 75 ng total RNA, except the reactions for thyroglobulin and thyroid peroxidase used 1% of that amount. PCR primers are listed in Table 1. Thyroid ultrasound Ultrasound images were recorded using a VisualSonics Vevo 2100 high-resolution microimaging system with a MS 550D transducer (VisualSonics, Toronto, Canada). The largest cross-sectional area of each thyroid lobe was estimated using the formula for the area of an ellipse and the long and short axes dimensions of the lobe. Serum thyroxine Serum thyroxine levels were measured using the AccuDiag T4 ELISA Kit (catalog no. 3149-16) from Diagnostic Automation/Cortex Diagnostics, Inc. (Woodland Hills, CA). Statistical analysis Comparisons were by analysis of variance followed by the Newman-Keuls test, with P < 0.05 considered significant. Because there were no differences between males and females, both sexes were combined for comparisons between genotypes. Twelve mice were studied for each genotype (six male, six female). Results Successful excision of Pparg in the mouse thyroid Genomic DNA was isolated from the thyroid glands of PpargThy−/− and PpargF/F mice. Analysis by PCR demonstrated essentially complete Cre-mediated excision of Pparg in PpargThy−/− mice (Fig. 1). Figure 1. View largeDownload slide Cre-mediated deletion of Pparg in the mouse thyroid. Thyroid DNA was isolated from PpargThy−/− and PpargF/F mice and subjected to PCR to detect Cre-mediated excision of the first two coding exons of PPARγ1. The expected band is 0.8 kb after Cre-mediated excision and 4 kb in the absence of excision. Figure 1. View largeDownload slide Cre-mediated deletion of Pparg in the mouse thyroid. Thyroid DNA was isolated from PpargThy−/− and PpargF/F mice and subjected to PCR to detect Cre-mediated excision of the first two coding exons of PPARγ1. The expected band is 0.8 kb after Cre-mediated excision and 4 kb in the absence of excision. Thyroid biology in the absence of PPARγ As shown in Fig. 2A (left two bars), there was no difference in the cross-sectional areas of the thyroid glands in PpargThy−/− mice compared with PpargF/F mice, and this similarity was confirmed by finding no difference in the weights of the left thyroid lobes (Fig. 2B, left two bars) (the right lobes were fixed in formalin en bloc with the tracheas and therefore were not weighed). Histologically, the thyroid glands of PpargThy−/− and PpargF/F mice also were similar (Fig. 2C, left two panels). To further evaluate potential effects of loss of PPARγ on thyroid function, we used real-time reverse transcription–PCR to measure the expression of five genes that are critical to normal thyroid function: Tg, Tpo, Duox2, Nkx2-1 (thyroid transcription factor 1), and Slc5a5 (sodium iodide symporter), as well as Pgk1 as a housekeeping gene. None of these genes differed in expression between PpargThy−/− and PpargF/F mice (Fig. 2D, left two bars for each gene). Previous RNA-seq and chromatin immunoprecipitation–seq studies of a transgenic mouse model of PPFP thyroid cancer identified genes that are induced by PPFP and that contain PPFP chromatin immunoprecipitation–seq peaks with PPARγ motifs (14), suggesting these genes also might be regulated by endogenous PPARγ in the normal thyroid. We tested the expression of five such genes: the cell cycle gene Ccnd1 and the lipid metabolism genes Angptl4, Cd36, Fabp4, and Gpd1. However, none of these differed in expression between PpargThy−/− and PpargF/F mice (Fig. 2E, left two bars for each gene). Furthermore, the serum T4 levels were not statistically different in PpargThy−/− and PpargF/F mice (Fig. 2F, left two bars). Thus, at least based on these criteria, loss of PPARγ expression within the thyroid gland has no discernable effect on thyroid development or function. Figure 2. View large Download slide Comparison of thyroid glands and thyroid function in mice of the following five genotypes: (1) PpargF/F; (2) PpargThy−/−; (3) PpargF/F;PtenF/F; (4) PtenThy−/−, and (5) PpargThy−/−;PtenThy−/−. Measurements were performed with mice 6 to 7 months of age, 12 mice per genotype, except in panel (E) (6 mice per genotype). (A) Maximal cross-sectional thyroid area measured by ultrasound (mean ± standard deviation). (B) Weight of the left thyroid lobe (mean ± standard deviation). (C) Representative hematoxylin and eosin–stained sections through the thyroid glands. Scale bar, 50 μm. (D, E) Gene expression measured by real-time reverse transcription PCR. The y-axis shows the cycle threshold (mean ± standard deviation). (F) Serum T4 levels (mean ± standard deviation). Statistical analyses are by analysis of variance followed by Newman-Keuls test; brackets with asterisks over bars indicate P < 0.05. To avoid clutter, we show significance in only the biologically important comparisons of PpargF/F vs PpargThy−/− (no comparisons were significant) and PpargF/F;PtenF/F vs PpargThy−/−;PtenThy−/− vs PtenThy−/− mice. All pairwise comparisons are presented in Supplemental Tables 1–14. Figure 2. View large Download slide Comparison of thyroid glands and thyroid function in mice of the following five genotypes: (1) PpargF/F; (2) PpargThy−/−; (3) PpargF/F;PtenF/F; (4) PtenThy−/−, and (5) PpargThy−/−;PtenThy−/−. Measurements were performed with mice 6 to 7 months of age, 12 mice per genotype, except in panel (E) (6 mice per genotype). (A) Maximal cross-sectional thyroid area measured by ultrasound (mean ± standard deviation). (B) Weight of the left thyroid lobe (mean ± standard deviation). (C) Representative hematoxylin and eosin–stained sections through the thyroid glands. Scale bar, 50 μm. (D, E) Gene expression measured by real-time reverse transcription PCR. The y-axis shows the cycle threshold (mean ± standard deviation). (F) Serum T4 levels (mean ± standard deviation). Statistical analyses are by analysis of variance followed by Newman-Keuls test; brackets with asterisks over bars indicate P < 0.05. To avoid clutter, we show significance in only the biologically important comparisons of PpargF/F vs PpargThy−/− (no comparisons were significant) and PpargF/F;PtenF/F vs PpargThy−/−;PtenThy−/− vs PtenThy−/− mice. All pairwise comparisons are presented in Supplemental Tables 1–14. Lack of synergy between deletion of Pparg and deletion of Pten There is evidence that Pparg can function as a tumor suppressor gene (1–6). Although we found there was no thyroid neoplasia with simple deletion of Pparg within the thyroid, the potential exists that loss of PPARγ may synergize with other factors in thyroid neoplasia. We decided to test for an interaction between thyroid-specific deletions of Pparg and Pten for several reasons. In humans, loss-of-function mutations in PTEN cause Cowden syndrome, which is associated with an increased risk of thyroid cancer (9). In FVB/N mice, homozygous deletion of Pten causes benign hyperplasia without neoplasia (8). However, Pten deletion synergizes with thyroid-specific expression of PPFP to cause metastatic thyroid cancer in mice (8). This is consistent with data from patients with PPFP thyroid cancer because they also manifest increased activation (phosphorylation) of AKT (15), and PTEN is a negative regulator of AKT signaling. Thus, a reasonable hypothesis is that the combined deletions of Pparg and Pten might phenocopy the oncogenic effect of PPFP expression combined with Pten deletion. Based on the above considerations, we compared mice with combined thyroid deletions of Pparg and Pten (PpargThy−/−;PtenThy−/−) vs PpargF/F;PtenF/F mice and mice with just Pten deletion (PtenThy−/−) as controls. Relative to PpargF/F;PtenF/F mice, PtenThy−/− mice and PpargThy−/−;PtenThy−/−mice both had an increase in thyroid area (Fig. 2A, right three bars) and weight (Fig. 2B, right three bars). Although the increase in thyroid weight was statistically slightly greater in PpargThy−/−;PtenThy−/− mice than PtenThy−/− mice, this is unlikely to be biologically important because there was no difference in thyroid area between these genotypes or in the other parameters described below. As reported previously (8), PtenThy−/− thyroids have benign hyperplasia, and here we show that there were no further histological changes in the PpargThy−/−;PtenThy−/− mice (Fig. 2C, right two images). Compared with PpargF/F;PtenF/F mice, Pten deletion was associated with decreased thyroidal expression (increased cycle threshold) of Tpo, Duox2, and Slc5a5, but there were no differences between PtenThy−/− and PpargThy−/−;PtenThy−/− mice (Fig. 2D, right three bars for each gene). Similarly, Pten deletion was associated with decreased thyroidal expression of Angptl4, Cd36, Fabp4, and Gpd1, but there were no differences between PtenThy−/− and PpargThy−/−;PtenThy−/− mice (Fig. 2E, right three bars for each gene). Finally, Pten deletion was associated with increased serum T4, but there were no further differences between PtenThy−/− and PpargThy−/−;PtenThy−/− mice (Fig. 2F, right three bars). We conclude that PtenThy−/− and PpargThy−/−;PtenThy−/− mice have essentially identical phenotypes, and the genetic deletions of Pparg and Pten do not synergize to cause thyroid neoplasia. Discussion PPARγ is the master regulator of adipogenesis (16) and was subsequently found to regulate insulin sensitivity when it was discovered to be the target of thiazolidinediones, which are used to treat type 2 diabetes (17). Over time, there has been increased appreciation of low-level PPARγ expression in many cell types, and genetic deletion experiments in mice have revealed roles for PPARγ in, for example, vascular smooth muscle cells (18), macrophages (19), T cells (20), hair follicle stem cells (21), neurons (22, 23), and hepatocytes (24). Furthermore, several lines of evidence suggest PPARγ may have tumor-suppressive properties (1–5). For example, in a mouse model of thyroid cancer due to mutation of thyroid hormone receptor β, the cancer is more aggressive when combined with single-allele whole-mouse deletion of Pparg (6). A subset of thyroid cancers is caused by a chromosomal translocation that results in production of PPFP, suggesting that disruption of endogenous PPARγ function could be part of the oncogenic mechanism (7). However, the function of PPARγ within the thyroid gland has not previously been directly studied. Here, we show that thyroid-specific genetic deletion of Pparg in mice has no effect on thyroid development or function in the basal state. Thyroid size and histology, the expression of thyroid differentiation genes, and serum T4 levels all are unaffected by deletion of Pparg (Fig. 2). Even genes that are likely induced by PPFP via PPARγ binding sites in a mouse model of thyroid cancer (14) have unaltered expression in mice lacking thyroidal PPARγ (Fig. 2E). This is probably due to the fact that PPFP is expressed at high levels in thyroid cancer, but PPARγ is expressed at very low levels in the normal thyroid. It should be noted that the TPO promoter that drives Cre expression becomes active at embryonic day 14.5 (12), and therefore the current studies do not address whether PPARγ could play a role earlier in thyroid development. We also found no evidence for a role for endogenous PPARγ as a thyroid tumor suppressor, either by itself or in concert with loss of PTEN. How can one square these findings with the observation that single-allele deletion of Pparg in mice enhances the oncogenic action of the “PV” mutation in thyroid hormone receptor β (6)? One possibility is that endogenous PPARγ is relevant only in certain types of thyroid cancer. It should be noted that the PV mutation results in severe thyroid hormone resistance with high levels of thyrotropin, thus activating cyclic adenosine monophosphate and potentially other pathways not activated in our mice. Alternatively, it should be noted that the previously described synergy is in the context of a whole-mouse deletion of Pparg, and it may be that the critical cell type for loss of PPARγ expression is not the thyrocyte but, for example, could be immune cells, vascular cells, or other cell types. In addition, differences in genetic background or age of the mice could play a role. The consequences of Pten deletion in the mouse thyroid are strain dependent (25). Furthermore, thyroid cancer due to Pten deletion by itself may take 1 to 2 years to manifest, whereas our mice were studied at 6 to 7 months of age (26). In conclusion, we found no evidence of a role for PPARγ in the development or function of the mouse thyroid gland or evidence that thyroidal PPARγ functions as a tumor suppressor. However, it remains possible that PPARγ could play an important role early in thyroid development (prior to mouse embryonic day 14.5), in other models of thyroid cancer, or under stressful circumstances such as iodine deficiency. Abbreviations: Abbreviations: PCR polymerase chain reaction PPARγ peroxisome proliferator–activated receptor γ PPFP PAX8-PPARγ fusion protein TPO thyroid peroxidase Acknowledgments Financial Support: National Cancer Institute Grant R01CA166033. Disclosure Summary: The authors have nothing to disclose. References 1. Bonofiglio D, Cione E, Qi H, Pingitore A, Perri M, Catalano S, Vizza D, Panno ML, Genchi G, Fuqua SA, Andò S. Combined low doses of PPARgamma and RXR ligands trigger an intrinsic apoptotic pathway in human breast cancer cells. Am J Pathol . 2009; 175( 3): 1270– 1280. Google Scholar CrossRef Search ADS PubMed  2. Fujisawa T, Sugiyama M, Tomimoto A, Wada K, Endo H, Takahashi H, Yoneda K, Yoneda M, Inamori M, Saito S, Terauchi Y, Kadowaki T, Tsuchiya N, Nakagama H, Nakajima A. Inhibition of peroxisome proliferator-activated receptor gamma promotes tumorigenesis through activation of the beta-catenin/T cell factor (TCF) pathway in the mouse intestine. J Pharmacol Sci . 2008; 108( 4): 535– 544. Google Scholar CrossRef Search ADS PubMed  3. McAlpine CA, Barak Y, Matise I, Cormier RT. Intestinal-specific PPARgamma deficiency enhances tumorigenesis in ApcMin/+ mice. Int J Cancer . 2006; 119( 10): 2339– 2346. Google Scholar CrossRef Search ADS PubMed  4. Sarraf P, Mueller E, Smith WM, Wright HM, Kum JB, Aaltonen LA, de la Chapelle A, Spiegelman BM, Eng C. Loss-of-function mutations in PPAR gamma associated with human colon cancer. Mol Cell . 1999; 3( 6): 799– 804. Google Scholar CrossRef Search ADS PubMed  5. Shankaranarayanan P, Rossin A, Khanwalkar H, Alvarez S, Alvarez R, Jacobson A, Nebbioso A, de Lera AR, Altucci L, Gronemeyer H. Growth factor–antagonized rexinoid apoptosis involves permissive PPARgamma/RXR heterodimers to activate the intrinsic death pathway by NO. Cancer Cell . 2009; 16( 3): 220– 231. Google Scholar CrossRef Search ADS PubMed  6. Kato Y, Ying H, Zhao L, Furuya F, Araki O, Willingham MC, Cheng SY. PPARgamma insufficiency promotes follicular thyroid carcinogenesis via activation of the nuclear factor–kappaB signaling pathway. Oncogene . 2005; 25( 19): 2736– 2747. Google Scholar CrossRef Search ADS   7. Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM, Fletcher JA. PAX8-PPARgamma1 fusion oncogene in human thyroid carcinoma [corrected]. Science . 2000; 289( 5483): 1357– 1360. Google Scholar CrossRef Search ADS PubMed  8. Dobson ME, Diallo-Krou E, Grachtchouk V, Yu J, Colby LA, Wilkinson JE, Giordano TJ, Koenig RJ. Pioglitazone induces a proadipogenic antitumor response in mice with PAX8-PPARgamma fusion protein thyroid carcinoma. Endocrinology . 2011; 152( 11): 4455– 4465. Google Scholar CrossRef Search ADS PubMed  9. Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, Tsou HC, Peacocke M, Eng C, Parsons R. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet . 1997; 16( 1): 64– 67. Google Scholar CrossRef Search ADS PubMed  10. Yeager N, Klein-Szanto A, Kimura S, Di Cristofano A. Pten loss in the mouse thyroid causes goiter and follicular adenomas: insights into thyroid function and Cowden disease pathogenesis. Cancer Res . 2007; 67( 3): 959– 966. Google Scholar CrossRef Search ADS PubMed  11. Lesche R, Groszer M, Gao J, Wang Y, Messing A, Sun H, Liu X, Wu H. Cre/loxP-mediated inactivation of the murine Pten tumor suppressor gene. Genesis . 2002; 32( 2): 148– 149. Google Scholar CrossRef Search ADS PubMed  12. Kusakabe T, Kawaguchi A, Kawaguchi R, Feigenbaum L, Kimura S. Thyrocyte-specific expression of Cre recombinase in transgenic mice. Genesis . 2004; 39( 3): 212– 216. Google Scholar CrossRef Search ADS PubMed  13. Raman P, Grachtchouk V, Lyons RH Jr, Koenig RJ. Identification of the genomic insertion site of the thyroid peroxidase promoter-Cre recombinase transgene using a novel, efficient, next-generation DNA sequencing method. Thyroid . 2015; 25: 1162– 1166. Google Scholar CrossRef Search ADS PubMed  14. Zhang Y, Yu J, Grachtchouk V, Qin T, Lumeng CN, Sartor MA, Koenig RJ. Genomic binding of PAX8-PPARG fusion protein regulates cancer-related pathways and alters the immune landscape of thyroid cancer. Oncotarget . 2016; 8( 4): 5761– 5773. 15. Diallo-Krou E, Yu J, Colby LA, Inoki K, Wilkinson JE, Thomas DG, Giordano TJ, Koenig RJ. Paired box gene 8-peroxisome proliferator-activated receptor-gamma fusion protein and loss of phosphatase and tensin homolog synergistically cause thyroid hyperplasia in transgenic mice. Endocrinology . 2009; 150( 11): 5181– 5190. Google Scholar CrossRef Search ADS PubMed  16. Tontonoz P, Hu E, Spiegelman BM. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell . 1994; 79( 7): 1147– 1156. Google Scholar CrossRef Search ADS PubMed  17. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem . 1995; 270( 22): 12953– 12956. Google Scholar CrossRef Search ADS PubMed  18. Chang L, Villacorta L, Zhang J, Garcia-Barrio MT, Yang K, Hamblin M, Whitesall SE, D’Alecy LG, Chen YE. Vascular smooth muscle cell-selective peroxisome proliferator-activated receptor-gamma deletion leads to hypotension. Circulation . 2009; 119( 16): 2161– 2169. Google Scholar CrossRef Search ADS PubMed  19. Cheng WY, Huynh H, Chen P, Peña-Llopis S, Wan Y. Macrophage PPARγ inhibits Gpr132 to mediate the anti-tumor effects of rosiglitazone. eLife . 2016; 5: 5. 20. Huang X, Ren L, Ye P, Cheng C, Wu J, Wang S, Sun Y, Liu Z, Xie A, Xia J. Peroxisome proliferator-activated receptor γ deficiency in T cells accelerates chronic rejection by influencing the differentiation of CD4+ T cells and alternatively activated macrophages. PLoS One . 2014; 9( 11): e112953. Google Scholar CrossRef Search ADS PubMed  21. Karnik P, Tekeste Z, McCormick TS, Gilliam AC, Price VH, Cooper KD, Mirmirani P. Hair follicle stem cell-specific PPARgamma deletion causes scarring alopecia. J Invest Dermatol . 2009; 129( 5): 1243– 1257. Google Scholar CrossRef Search ADS PubMed  22. Liu C, Bookout AL, Lee S, Sun K, Jia L, Lee C, Udit S, Deng Y, Scherer PE, Mangelsdorf DJ, Gautron L, Elmquist JK. PPARγ in vagal neurons regulates high-fat diet induced thermogenesis. Cell Metab . 2014; 19( 4): 722– 730. Google Scholar CrossRef Search ADS PubMed  23. Long L, Toda C, Jeong JK, Horvath TL, Diano S. PPARγ ablation sensitizes proopiomelanocortin neurons to leptin during high-fat feeding. J Clin Invest . 2014; 124( 9): 4017– 4027. Google Scholar CrossRef Search ADS PubMed  24. Morán-Salvador E, López-Parra M, García-Alonso V, Titos E, Martínez-Clemente M, González-Périz A, López-Vicario C, Barak Y, Arroyo V, Clària J. Role for PPARγ in obesity-induced hepatic steatosis as determined by hepatocyte- and macrophage-specific conditional knockouts. FASEB J . 2011; 25( 8): 2538– 2550. Google Scholar CrossRef Search ADS PubMed  25. Tiozzo C, Danopoulos S, Lavarreda-Pearce M, Baptista S, Varimezova R, Al Alam D, Warburton D, Virender R, De Langhe S, Di Cristofano A, Bellusci S, Minoo P. Embryonic epithelial Pten deletion through Nkx2.1-cre leads to thyroid tumorigenesis in a strain-dependent manner. Endocr Relat Cancer . 2011; 19( 2): 111– 122. Google Scholar CrossRef Search ADS   26. Antico-Arciuch VG, Dima M, Liao XH, Refetoff S, Di Cristofano A. Cross-talk between PI3K and estrogen in the mouse thyroid predisposes to the development of follicular carcinomas with a higher incidence in females. Oncogene . 2010; 29( 42): 5678– 5686. Google Scholar CrossRef Search ADS PubMed  Copyright © 2018 Endocrine Society

Journal

EndocrinologyOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off