The solute transport profile of two Aza-guanine transporters from the Honey bee pathogen Paenibacillus larvae

The solute transport profile of two Aza-guanine transporters from the Honey bee pathogen... Abstract Two nucleobase transporters encoded in the genome of the Honey bee bacterial pathogen Paenibacillus larvae belong to the azaguanine-like transporters and are referred to as PlAzg1 and PlAzg2. PlAzg1 and 2 display significant amino acid sequence similarity, and share predicted secondary structures and functional sequence motifs with two Escherichia coli nucleobase cation symporter 2 (NCS2) members: adenine permease (EcAdeP) and guanine-hypoxanthine permease EcGhxP. However, similarity does not define function. Heterologous complementation and functional analysis using nucleobase transporter-deficient Saccharomyces cerevisiae strains revealed that PlAzg1 transports adenine, hypoxanthine, xanthine and uracil, while PlAzg2 transports adenine, guanine, hypoxanthine, xanthine, cytosine and uracil. Both PlAzg1 and 2 display high affinity for adenine with Km of 2.95 ± 0.22 and 1.92 ± 0.22 μM, respectively. These broad nucleobase transport profiles are in stark contrast to the narrow transport range observed for EcAdeP (adenine) and EcGhxP (guanine and hypoxanthine). PlAzg1 and 2 are similar to eukaryotic Azg-like transporters in that they share a broad solute transport profile, particularly the fungal Aspergillus nidulans AzgA (that transports adenine, guanine and hypoxanthine) and plant AzgA transporters from Arabidopsis thaliana and Zea mays (that collectively move adenine, guanine, hypoxanthine, xanthine, cytosine and uracil). Paenibacillus larvae, azaguanine-like transporters, purine, pyrimidine, heterologous complementation INTRODUCTION The gram-positive bacterium Paenibacillus larvae is the causative agent of the American foulbrood and powdery scale disease in Honey bees (Apis millifera Linnaeus) (White 1906; Katznelson 1950). Endospores of P. larvae infect only larvae once consumed in contaminated royal jelly (Genersch 2010; Ebeling et al.2015). Larvae are most susceptible 12 to 36 h after hatching. Once in the nutrient-rich larval midgut, spores of P. larvae germinate and greatly proliferate (Yue et al.2008). Recent work has shown that in vitro spore germination is triggered by L-tyrosine and uric acid (Alvarado et al.2013). Uric acid, a waste product from purine degradation and metabolized proteins, accumulates to high levels in the midgut as the midgut and hind gut are not yet connected in young larvae (Winston 1987). Once the midgut epithelium is breeched, bacteria proliferate in the hemocoel, producing extracellular proteases (Antúnez et al.2009) and toxins (Poppinga and Genersch 2015). Larval cell death ensues culminating in a putrid and ropey mass. Bacteria produce highly resistant spores once nutrients are depleted. Worker bees sense the decay, open the brood chamber, remove the carcass and become coated with spores that are available to infect subsequent larvae (Genersch 2010; Ebeling et al.2015). The abundance of cellular metabolites, including nitrogen-rich nucleobases, nucleosides and nucleotides, in the hemoceol of infected larvae offers P. larvae ample opportunity to import valuable nutrients for rapid proliferation. Nucleobase transporters are ubiquitous among eukaryotes and prokaryotes and belong to five independent families. Nucleobase cation symporter 1 (NCS1) transporters are present in bacteria, fungi and plants (Pantazopoulou and Diallinas 2007; Ma et al.2013). The nucleobase cation symporter 2 (NCS2) family, also known as the nucleobase ascorbate transporter (NAT) family, are a large family found in bacteria, fungi (except Saccharomyces cerevisiae), plants and mammals (Pantazopoulou and Diallinas 2007; Gournas, Papageorgiou and Diallinas 2008; Frillingos 2012). The closely related Aza-guanine transporters (AzgA) are restricted to bacteria, fungi and plants (Diallinas et al.1995; Krypotou et al.2014). In addition, two other nucleobase families, the purine permease (PUP) and ureide permeases (UPS), are found only in plants (Desimone et al.2002; Schmidt et al.2004, 2006; Jelesko 2012). Nucleobase transporter families have solute transport preferences among purines and pyrimidines. Comparison of solute transport profiles between families reveals overlapping solute transport capabilities. Even within a transporter family, members often have overlapping but unique solute transport and binding profiles. The role of nucleobase transports differs between multicellular organisms and single-cell organisms. In plants, the plethora of nucleobase transporters locates in many different subcellular membranes and serves the needs of extensive nucleobase de novo synthesis, salvage and catabolic pathways. In single-celled organisms, nucleobase transporters function for the acquisition of these nitrogen-rich molecules from the external environment. The NCS2 and the closely related azaguanine-like transporter (Azg) belong to the Clusters of Orthologous Groups (COG) 2233 and 2252, respectively. In plants, NCS2 tend to have broad and mixed solute transport and binding profiles including combinations of xanthine, uric acid, uracil, adenine, guanine, cytosine and hypoxanthine (Argyrou et al.2001; Niopek-Witz et al.2014; Schultes and Mourad pers. comm.). Microbes, in contrast, have NCS2 with more restricted solute transport and binding profiles. Fungal nucleobase transporters have been well studied in Aspergillus nidulans including two NCS2, UapA and UapC, that transport uric acid and xanthine (Gournas, Papageorgiou and Diallinas 2008) and the purine transporter AzgA that moves adenine, hypoxanthine and guanine (Cecchetto et al.2004; Goudela, Tsilivi and Diallinas 2006). Both UapA and AzgA have been extensively studied with dozens of mutations that have been characterized at the biochemical level (Kosti et al.2012; Krypotou et al.2014). In bacteria, NCS2 and AzgA have been most studied in Escherichia coli which contains 10 NCS2 with narrow solute transport profiles: the COG2252 members include EcGhxQ (YgfQ) and EcGhxP (YjcD) transporting guanine and hypoxanthine (Papakostas, Botou and Frillingos 2013) and EcAdeP (YieG) and EcAdeQ (YicO) transporting adenine (Papakostas, Botou and Frillingos 2013), while the COG2233 members include EcUraA transporting uracil (Lu et al.2011), EcXanP (YicE) and EcXanQ (YgfO) transporting xanthine (Karatza and Frillingos 2005), EcUacT transporting uric acid (Papakostas and Frillingos 2012) and EcRutG (Kim et al.2010) and EcYbbY are of unknown function (Cusa et al.1999). The recent elucidation of the 3D structures of EcUraA (Lu et al.2011) and the NCS2 xanthine/uric acid transporter UapA of Aspergillus nidulans (Alguel et al.2016), in combination with functional analysis of cysteine-scanning and site-directed mutants of EcAdeP, EcGhxP, EcXanP and EcUacT, offers insight into the functional working of NCS2 and AzgA transport (Karatza et al.2006; Papakostas, Georgopoulou and Frillngos 2008; Papakostas and Frillingos 2012; Papakostas, Botou and Frillingos 2013). It is with this setting that the solute transport profile for two COG2233 transporters from P. larvae are investigated here. MATERIALS AND METHODS Microbial strains and growth conditions Paenibacillus larvae subspecies larvae strain NRRL B-3650 was grown on MYPGP media (Dingman and Stahly 1983). Growth profiles of B-3650 in the presence of 0, 10, 100 and 500 μg/ml of 6-thioguanine (6TG) were inoculated with 1/50 overnight culture into 0.5 ml MYPGP, grown at 37°C with an orbital shake of 205 CPM in CytoOne 48-well flat bottom sterile microtiter plates (USA Scientific, Inc., Ocala, FL) and optical density (590 nm) measured every 20 min over 17 h using a Synergy H1 microplate reader (BioTek Instruments, Inc., Winooski, VT) running Gen5 Data Analysis Software ver. 2.07. Turbidity data were analyzed using Microsoft Excel. Escherichia coli strain DH5α (fhuA2 lacΔU169 phoA glnV44 Φ80' lacZΔM15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) was grown on LB media with 50 mg/ml carbenicillin and used for molecular cloning. Saccharomyces cerevisiae strains RG191 [MATα, fyc2Δ::kanMX4, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0] (Winzeler et al.1999) and NC122-sp6 [MAT α leu2 fur4Δ] (Jund et al.1988) were grown in synthetic complete (SC) medium at 30°C. Yeast transformations were performed by the lithium acetate method (Gietz and Woods 2002). Nucleic acid manipulations Genomic DNA was isolated from P. larvae strain B-3650 using QIAamp Tissue kit (Qiagen Inc. Santa Clarita, CA). The coding regions for PlAzg1 and PlAzg2 were amplified from genomic DNA by the polymerase chain reaction using oligonucleotides primers PlAzg1a 5΄ gggagctctcgagatgtcaaggtacgcccaagtgaaagg 3΄ and PlAzg1b 5΄ ataagaatgcggccgcttatgaatggataaatccaagctg 3΄ or primers PlAzg2a 5΄ 5΄ cccaagcttctcgagatgtacgtttcctccttactctt 3΄ and PlAzg2b 5΄ ataagaatgcggccgcttacatcgtctgaagcacaaagtg 3΄, respectively. The PCR products were purified using QIAquick PCR purification kit (Qiagen Inc.) and, along with yeast expression vector pRG399, cut with endonuclease restriction enzymes Xho I and Not I, ligated and transformed into E. coli strain DH5α to generate plasmids pRH718 (PlAzg2) and pRH720 (PlAzg1). DNA sequence analysis was performed at the W.M. Keck Biotechnology Resource Laboratory at Yale School of Medicine (New Haven, CT, USA) to verify sequence integrity. Plasmids pRH718 and 720 were transformed into yeast strains RG191 and NC122-Sp6 and selected on SC—leucine media. RNA was isolated from P. larvae strain B-3650 culture grown in MYPGP to an OD600 of 0.64 using the RNeasy Protection Kit/RNA protect Bacterial Reagent (Qiagen Inc.) and treated with RNase-free DNaseI (Roche, Indianapolis, IN). Genomic DNA, RNase-treated total RNA and RNase-treated total RNA with Invitrogen SuperScript One-Step RT-PCR treatment (ThermoFisher, Waltham, MA) was amplified with primers Plazga1F 5΄ ttgccgtgactttactgctg 3΄ and Plazga1R 5΄ ccgatccggattctacaaga 3΄ or PlAzg2F 5΄ atttgttcggccagttatcg 3΄ and PlAzg2R 5΄ atccgttcgaaggaaatgtg 3΄ to generate fragments of 390 and 412 bp, respectively, using amplification conditions of 94°C 2 min, 94°C 15 s, 55°C 30 s, 70°C 2 min, Repeat 39X; 72°C 10 min. DNA products were visualized by agarose gel electrophoresis. Phylogenetic analysis employed Phylogeny.fr (Dereeper et al., 2008) using MUSCLE alignment (Edgar 2004) and either Bayesian inference (Mr. Bayes 3.2.3) (Ronquist and Huelsenbeck 2003) (Fig. 1) or Maximum Likelihood PhyML 3.1 (Guindon et al.2010) (Fig. S1, Supporting Information) and tree construction TreeDyn (Chevenet et al.2006). Figure 1. View largeDownload slide Phylogenetic relationships of PlAzg1 and 2 with select NCS2 transporters based upon Bayesian inference. Amino acid sequence accession numbers are given as PlAzg1 (EFX46818.1); PlAzg2 (EFX46366.1); E. coli EcUraA (BAA16385.1), EcRutG (P75892.2), EcXanQ (P67444.2), EcXanP (P0AGM9.1), EcUacT (Q46821.1), EcYbbY (P77328.2), EcGhxQ (Q46817.2), EcGhxP (P0AF52.1), EcAdeP (P31466.2), EcAdeQ (P31440.3). EcCodB (POAA82), a nucleobase symporter 1 transporter, serves as the outgroup. Phylogenetic tree constructed using Phylogeny.fr (Dereeper et al.2008) using MUSCLE alignment (Edgar 2004) and tree construction employing Bayesian inference Mr Bayes 3.2.3 (Ronquist and Huelsenbeck 2003). Figure 1. View largeDownload slide Phylogenetic relationships of PlAzg1 and 2 with select NCS2 transporters based upon Bayesian inference. Amino acid sequence accession numbers are given as PlAzg1 (EFX46818.1); PlAzg2 (EFX46366.1); E. coli EcUraA (BAA16385.1), EcRutG (P75892.2), EcXanQ (P67444.2), EcXanP (P0AGM9.1), EcUacT (Q46821.1), EcYbbY (P77328.2), EcGhxQ (Q46817.2), EcGhxP (P0AF52.1), EcAdeP (P31466.2), EcAdeQ (P31440.3). EcCodB (POAA82), a nucleobase symporter 1 transporter, serves as the outgroup. Phylogenetic tree constructed using Phylogeny.fr (Dereeper et al.2008) using MUSCLE alignment (Edgar 2004) and tree construction employing Bayesian inference Mr Bayes 3.2.3 (Ronquist and Huelsenbeck 2003). Radiolabel uptake by yeast expressing PlAzg1 and 2 Yeast strain RG191 harboring pRG399, pRH718 or pRH720 was grown for 24 h at 30°C; concentrated to OD600 = 4; and incubated for 5 min with 0.25 μM [8–3H]-guanine, [2,8–3H]-adenine, [8–3H]-xanthine, [5–3H]-cytosine and [8–3H]-hypoxanthine (Moravek, Brea, CA) in 100 mM citrate buffer (pH 3.5) with 1% glucose. Aliquots (25 μl) were added to 4 ml of ice-cold water and filtered through a 0.45-μm Metricel membrane filter (Gelman Sciences, Ann Arbor, MI). Filters were then washed with 8 ml of water and radioactivity was measured in a Tracor Analytic Delta 300 model 6891(Tracor Analytic Inc., Elk Grove Village, IL) liquid scintillation counter. Yeast strain NC122-Sp6 harboring pRG399, pRH718 or pRH720 was grown, incubated with [5,6–3H]-uracil and assayed as above. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). The standard error of the mean is derived from three independent experiments. Transport kinetics and inhibitor studies of PlAzg1 and 2 The Km values of PlAzg1 and 2 for adenine were measured through traditional Michaelis-Menten kinetics experiments. RG191 cells (OD600 = 4) containing pRH718 or pRH720 were incubated with increasing concentrations of [2,8–3H]-adenine (0.1, 0.25, 0.5, 1.0, 10.0, 20.0, and 30.0 μM), for 10 min and the amount of radiolabel taken up by cells was measured as mentioned above. Three independent replicas were used for each substrate concentration. Substrate saturation data were fitted by non-linear regression. Estimates of Km were calculated from the double reciprocal Lineweaver–Burk plot transformation (Ritchie and Prvan 1996). The Ki value of PlAzg1 and 2 for uric acid was determined by heterologous competition. RG191 cells containing pRH718 or pRH720 were incubated with 1 μM [2,8–3H]-adenine in the presence of different unlabeled competitor uric acids (0, 5, 10, 50, 100, 1000, and 2000 μM) and the resulting radiolabel measured as above. Ki values were determined using GraphPad Prism software (version 6) for data analysis. RG191 cells containing pRH718 and pRH720 were incubated with 1 μM [2,8–3H]-adenine alone or in the presence of 100 μM carbonyl cyanide m-chlorophenylhydrazone (CCCP) or 1 mM Ouabain octahydrate. The reaction was incubated at 30˚C with samples taken at 0 and 5 min, and radioactivity was measured as above. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). The standard error of the mean is derived from three independent experiments. RESULTS AND DISCUSSION Two azaguanine-like transporters are encoded in the genome of P. larvae A search of the P. larvae B-3560 genome through the National Center for Biotechnology Information database with the amino acid sequence of the E. coli adenine permease AdeP (also known as PurP and YieG) using tblastn (Altschul et al.1990) located two presumptive proteins Gb# EFX46818.1 and EFX46366.1 now referred to as PlAzg1 and PlAzg2, respectively (Chan et al.2011). Ultimately we want to determine the function of each protein. The first avenue to pursue is to establish which of the 10 E. coli NCS2 proteins are most closely related to PlAzg1 and 2 and then determine if amino acid sequence similarities can be used as a surrogate to assign function or not. Two tiers of comparisons are used: (i) measuring the levels of overall amino acid sequence identity/similarity and (ii) correlating key amino acid positions in E. coli NCS2 transporters—previously identified as key to function—with the analogous positions in PlAzg1 and 2. A phylogenetic tree detailing amino acid sequence comparisons of other NCS2 proteins reveals a close association between PlAzg1 and PlAzg2 and the E. coli adenine and guanine-hypoxanthine transporters in COG2252 (Fig. 1). PlAzg1 and 2 are more distantly related to other E. coli NCS2 proteins in NCS2 subgroup COG2233 which contains uracil, xanthine and uric acid transporters. This phylogenetic association is robust as an analysis employing either Bayesian inference (Fig. 1) or maximum likelihood (Fig. S1, Supporting Information) settles on the same tree structure. PlAzg1 and 2 show 25%–37% amino acid identity/60%–82% similarity to EcAdeP and EcGhxP, between 20%–29%/57%–60% identity/similarity with Arabidopsis thaliana AtAzg1 and 2 and 20%–26%/53%–55% identity/similarity with Aspergillus nidulans AnAzgA (Fig. S2, Supporting Information). A close analysis of amino acids key for solute discrimination and transport reveals that both PlAzg1 and 2 share only 21 of 35 invariant amino acids identified with E. coli adenine and guanine-hypoxanthine transporters and other COG2252 members (Papakostas, Botou and Frillingos 2013) (see Fig. S2, Supporting Information). Of the eight amino acids found to be important for adenine transport by site directed mutagenesis in EcAdeP, PlAzg1 is conserved for only four and PlAzg2 conserved for only one (Papakostas, Botou and Frillingos 2013) (see Fig. S1, Supporting Information). Similarly, for the same eight amino acids determined essential for hypoxanthine transport by site-directed mutagenesis in EcGhxP, PlAzg1 is conserved for only three and PlAzg2 conserved for only one (Papakostas, Botou and Frillingos 2013) (see Fig. S2, Supporting Information). PlAzg1 and 2 do share amino acid identity with a majority of the nine amino acids in AnAzgA that are essential for substrate binding and transport or critical for function (Cecchetto et al.2004) (see Fig. S2, Supporting Information). Sequence analysis alone is insufficient to assign transporter function to PlAzg1 and2, and direct experimental determination of function is needed. End point reverse transcription polymerase chain reaction of P. larvae RNA from vegetative cells reveals that the PlAzg1 and 2 loci are expressed (Fig. 2a). The close structural toxic analog of guanine 6TG is transported by EcGhxP (Papakostas, Botou and Frillingos 2013). As shown in Fig. 2b growth of P. larvae is diminished in the presence of increasing concentrations of 6TG. These data are consistent with the presence of P. larvae transporter(s) that recognize and move this guanine analog during vegetative growth. The higher level of amino acids conserved between PlAzg1 and 2 and those functionally important for the eukaryotic AnAzgA compared to the low level of amino acid conservation with those functionally important in bacterial EcAdeP and EcGhxP raises the questions as to what is the solute transport profile for PlAzg1 and 2. Figure 2. View largeDownload slide Expression of PlAzg1 and 2 by P. larvae and growth of P. larvae on 6-thioguanine. (a) Expression of PlAzg1and 2 in P. larvae by endpoint RT-PCR. Lane 1, exACTGene 1 kb plus DNA ladder (Fisher); lanes 2 and 6, genomic DNA PCR control; lanes 3 and 7, DNaseI-treated RNA PCR control; and lanes 4 and 8, RT-PCR of total RNA with lanes 2–4 amplified with PlAzg1-specific primers and lanes 6–8 amplified with PlAzg2-specific primers. (b) Growth of P. larvae B-3650 in MYPGP alone or supplemented with 10, 100 and 500 mg/ml of 6-TG at 37°C for 17 h and turbidity measured at 590 nm. Figure 2. View largeDownload slide Expression of PlAzg1 and 2 by P. larvae and growth of P. larvae on 6-thioguanine. (a) Expression of PlAzg1and 2 in P. larvae by endpoint RT-PCR. Lane 1, exACTGene 1 kb plus DNA ladder (Fisher); lanes 2 and 6, genomic DNA PCR control; lanes 3 and 7, DNaseI-treated RNA PCR control; and lanes 4 and 8, RT-PCR of total RNA with lanes 2–4 amplified with PlAzg1-specific primers and lanes 6–8 amplified with PlAzg2-specific primers. (b) Growth of P. larvae B-3650 in MYPGP alone or supplemented with 10, 100 and 500 mg/ml of 6-TG at 37°C for 17 h and turbidity measured at 590 nm. Defining the solute transport profile of PlAzg1 and 2 The coding regions of PlAzg1 and 2 were amplified from genomic DNA isolated from P. larvae strain B-3650 and cloned as transcriptional fusions into the yeast high copy expression vector pRG399 (with the PMA1 promoter producing a moderately high constitutive level of expression) (Serrano and Villalba 1995; Mansfield, Schultes and Mourad 2009) to create plasmids pRH720 and pRH718, respectively. Plasmids pRH718 and 720 were transformed into S. cerevisiae strains RG191 and NC122-Sp6. Strain 191 is deficient in transport of adenine, guanine, hypoxanthine and cytosine due to a deletion of the Fcy2 locus. Strain NC122-Sp6 is deficient in the transport of uracil as it carries a deletion of the Fur4 locus. Yeast genomes do not contain loci for xanthine or uric acid transport. The solute transport profile for other plant and microbial nucleobase transporters has been successfully determined employing the fcy2- and fur4-deficient strains and expression plasmids via heterologous complementation experiments and monitoring for the uptake of radiolabeled purines and pyrimidines (Mansfield, Schultes and Mourad 2009; Mourad et al.2012; Schein et al.2013; Minton et al.2016; Rapp et al.2016). Figure 3 reveals that yeast strains containing PlAzg1 took up significantly more [3H]-adenine, [3H]-hypoxanthine and [3H]-xanthine [3H]-uracil than strains containing the empty vector, but no statistically different uptake for [3H]-guanine or [3H]-cytosine (Fig. 3a–f). Yeast strains harboring PlAzg2 took up significantly more [3H]-adenine, [3H]-guanine, [3H]-hypoxanthine, [3H]-xanthine [3H]-uracil and [3H]-cytosine than strains containing the empty vector (Fig. 3a-f). It appears that both PlAzg1 and 2 have unique and broad nucleobase transport abilities for both purines and pyrimidines. This is in contrast to the E. coli Azg-like transporters AdeP and GhxP in COG2252 that transport only adenine or guanine, hypoxanthine and 6TG, respectively (Kozmin et al.2013; Papakostas, Botou and Frillingos 2013). Further, the binding capacity of EcAdeP is also very restrictive as it does not competitively bind xanthine, uracil or cytosine and shows a very limited ability to bind guanine, hypoxanthine and 6TG (Papakostas, Botou and Frillingos 2013). Similarly, the binding capacity for EcGhxP is restricted not recognizing adenine, xanthine, uracil or cytosine (Papakostas, Botou and Frillingos 2013). PlAzg1 and 2 share broad transport profiles similar to those of fungal and plant Azg transporters. AtAzg1 and 2 are known to transport both adenine and guanine, and AnAzgA is known to transport adenine, guanine and hypoxanthine (Goudela, Tsilivi and Diallinas 2006; Mansfield, Schultes and Mourad 2009). More recently, the characterization of three Azg transporters in Zea mays revealed unique solute transport profiles that together include adenine, guanine, hypoxanthine, xanthine, cytosine and uracil (Mourad and Schultes pers. comm.). As observed with NCS1 transporters, each Azg transporter has a unique solute transport and binding profile. Although AnAzgA transports adenine and guanine, it does not recognize xanthine or uric acid, yet PlAzg1 and 2 both transport xanthine and recognize uric acid (see below). Figure 3. View largeDownload slide Uptake of radiolabeled nucleobases by yeast containing PlAzg1 and 2. Yeast strain RG191 alone (fcy2Δ) or containing pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 5 min for the uptake of (a) [8–3H]-guanine, (b) [2,8–3H]-adenine, (d) [5–3H]-cytosine, or (e) [8–3H]-hypoxanthine. Strain NC122-Sp6 alone or with pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 0 and 5 min for the uptake of (c) [5,6–3H]-uracil or (f) [8–3H]-xanthine. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). All error bars represent SEM. Figure 3. View largeDownload slide Uptake of radiolabeled nucleobases by yeast containing PlAzg1 and 2. Yeast strain RG191 alone (fcy2Δ) or containing pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 5 min for the uptake of (a) [8–3H]-guanine, (b) [2,8–3H]-adenine, (d) [5–3H]-cytosine, or (e) [8–3H]-hypoxanthine. Strain NC122-Sp6 alone or with pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 0 and 5 min for the uptake of (c) [5,6–3H]-uracil or (f) [8–3H]-xanthine. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). All error bars represent SEM. It is interesting to note that the eight common and functionally important amino acids in EcAdeP and EcGhxP, as determined by site-directed mutagenesis coupled with adenine or hypoxanthine transport studies, are poorly conserved in PlAzg1 and 2 (see Fig. S1, Supporting Information). These residues locate in transmembrane spanning domains 1, 3, 8, 9 and 10 that comprise the ‘core domain’ based upon the experimentally derived 3D structure of EcUraA (an NCS2 transporter) (Lu et al.2011). The solute-binding pocket is formed in the junction between the core domains and the remaining TM in the gate domain (Lu et al.2011). Site-directed mutagenesis of the analogous residues in EcUacT and EcXanQ also affect solute transport or specificity (Frillingos 2012; Papakostas and Frillingos 2012). However, the results of such site-directed alterations are not necessarily transferable to closely related proteins. Specifically, the A91G and D267E alterations in EcAdeP abolish adenine transport, yet are present as G and E, respectively, in PlAzg1 and 2 which exhibits robust adenine transport. Similarly, the D271E alteration in EcGhxP (analogous to the D267E in EcAdeP) abolishes hypoxanthine transport but in PlAzg1 and 2, E is already present and hypoxanthine transport occurs. The take home lesson from this study is that neither amino acid sequence similarity of a transporter nor taxonomic proximity of host organisms is sufficient to assign functionality. PlAzg1 and 2 show high affinity for adenine and uric acid The affinity of PlAzg1 and 2 for adenine was determined using Michaelis Menten kinetics experiments in which RG191 harboring PlAzg1 or 2 was incubated with increasing concentrations of [3H]-adenine and then the resulting radiolabel uptake was monitored. Data reveal that both PlAzg1 and 2 have high affinities for adenine with a Km of 2.95 ± 0.22 μM and 1.92 ± 0.22 μM, respectively (Fig. 4). These are similar to the affinities observed for adenine in EcAdeP 1.0 μM and AzgA 3 μM (Papkostas et al.2013; Krypotou et al.2014). Heterologous competition experiments employing labeled adenine and unlabeled uric acid yielded a Ki of 33 μM for PlAzg1 and 0.32 μM for PlAzg2 for uric acid (data not shown). PlAzg1 and 2 show moderate and high affinity for uric acid in contrast to the general nucleobase transporter PlUacP (uric acid-like permease) that has a low affinity for uric acid Ki 336 μM (Stoffer, Mourad and Schultes pers. comm.). Given that there is an accumulation of uric acid in the young Honey bee larvae midgut, and that uric acid might serve as a signal for P. larvae spore germination (Alvarado et al.2013), it is conceivable that this nitrogen-rich molecule would be readily transported into vegetative growing cells (Yue et al.2008) prior to invasion into the Honey bee larvae hemocoel. Figure 4. View largeDownload slide Kinetic values of select nucleobases for PlAzg1 and 2. Substrate saturation assays in yeast strain RG191 containing pRH720 (fcy2Δ/PlAzg1) (a) or pRH718 (fcy2Δ/PlAzg2) (c) for [2,8–3H]-adenine. Double reciprocal Lineweaver–Burk plots for PlAzg1 (b) and PlAzg2 (d) were constructed from the substrate saturation curves. Figure 4. View largeDownload slide Kinetic values of select nucleobases for PlAzg1 and 2. Substrate saturation assays in yeast strain RG191 containing pRH720 (fcy2Δ/PlAzg1) (a) or pRH718 (fcy2Δ/PlAzg2) (c) for [2,8–3H]-adenine. Double reciprocal Lineweaver–Burk plots for PlAzg1 (b) and PlAzg2 (d) were constructed from the substrate saturation curves. Yeast strain RG191 containing PlAzg1 or 2 takes up significantly less [3H]-adenine in the presence of the proton uncoupler carbonyl cyanide m-chlorophenylhydrazone, but not the Na+ gradient disruptor Ouabain (Table 1). Like their bacterial, fungal and plant NCS2 homologs, PlAzg1 and 2 appear to be a proton-nucleobase symporter, in contrast to mammalian NCS2 that rely upon a Na+ gradient for function (Gournas, Papageorgiou and Diallinas 2008). During rapid cell growth in infected honeybee larval, a rich plethora of compounds released from disrupted cells are available for uptake by the pathogen—including nitrogen-rich purines and pyrimidines. Here, it is shown that the solute transport function of PlAzg1 and 2 allows P. larvae to import a wide range of nucleobases from external sources. Paenibacillus larvae spores germinate and grow in a uric acid-rich midgut environment and invade into the nutrient-rich hemocoel. Our research has shown that nucleobase transporters capable of taking up adenine, guanine and one transporter that strongly recognizes and binds uric acid exist in P. larvae. Future experiments aim at mutagenizing the PlAzg1 and 2 loci in P. larvae and determining their role in the American foulbrood disease process. Table 1. Effects of inhibitors on the function of PlAzg1 and 2.   %[2,3–3H]-adenine uptake  RG191/PlAzg1  100 ± 10.5  RG191/PlAzg1 + CCCP  16* ± 1.7  RG191/PlAzg1 + Ouabain  104 ± 4.4  RG191/PlAzg2  100 ± 2.2  RG191/PlAzg2 + CCCP  33.3* ± 4.6  RG191/PlAzg2 + Ouabain  83.3 ± 12.3    %[2,3–3H]-adenine uptake  RG191/PlAzg1  100 ± 10.5  RG191/PlAzg1 + CCCP  16* ± 1.7  RG191/PlAzg1 + Ouabain  104 ± 4.4  RG191/PlAzg2  100 ± 2.2  RG191/PlAzg2 + CCCP  33.3* ± 4.6  RG191/PlAzg2 + Ouabain  83.3 ± 12.3  Significance was measured at P = 0.05 (*). View Large SUPPLEMENTARY DATA Supplementary data are available at FEMSLE online. Acknowledgements We thank Regan Huntley and Carol Clark at CAES for expert technical assistance. FUNDING This work was supported by research funds from Indiana University-Purdue University Fort Wayne to GSM and from the United States Department of Agriculture [Hatch Fund CONH00253 to NPS]. Conflict of interest. None declared. REFERENCES Alguel T, Amillis S, Leung J et al.   Structure of eukaryotic purine/H+ symporter UapA suggests a role for homodimerization in transport activity. Nat Commun  2016, DOI: 10.1038/ncomms11336. Altschul SF, Gish W, Miller W et al.   Basic local alignment search tool. J Mol Biol  1990; 5: 401– 10. Alvarado I, Phui A, Elekonich MM et al.   Requirements for in vitro germination of Paenibacillus larvae spores. J Bacteriol  2013; 195: 1005– 11. Google Scholar CrossRef Search ADS PubMed  Antúnez K, Anido M, Schlapp G et al.   Characterization of secreted proteases of Paenibacillus larvae, potential virulence factors involved in honeybee larval infection. J Inv Pathol  2009; 102: 129– 32. Google Scholar CrossRef Search ADS   Argyrou E, Sophianopoulou V, Schultes N et al.   Functional characterization of a maize purine transporter by expression in Aspergillus nidulans. Plant Cell  2001; 13: 953– 96. Google Scholar CrossRef Search ADS PubMed  Cecchetto G, Amillis S, Diallinas G et al.   The AzgA purine transporter of Aspergillus nidulans. Characterization of a protein belonging to a new phylogenetic cluster. J Biol Chem  2004; 279: 3132– 41. Google Scholar CrossRef Search ADS PubMed  Chan QWT, Comman RS, Birol I et al.   Updated genome assembly and annotation of Paenibacillus larvae, the agent of American foulbrood disease of honey bees. BMC Genomics  2011; 12: 450. Google Scholar CrossRef Search ADS PubMed  Chevenet F, Brun C, Banuls AL et al.   TreeDyn: towards dynamic graphics and annotations for analyses of trees. BMC Bioinformatics  2006; 7: 439. Google Scholar CrossRef Search ADS PubMed  Cusa E, Obradors N, Baldoma L et al.   Genetic analysis of a chromosomal region containing genes required for assimilation of allantoin nitrogen and linked glyocylate metabolism in Escherichia coli. J Bacteriol  1999; 181: 7479– 84. Google Scholar PubMed  Dereeper A, Guignon V, Blanc G et al.   Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res  2008; 36: W465– 469. Google Scholar CrossRef Search ADS PubMed  Desimone M, Catoni E, Ludewig U et al.   A novel superfamily of transporters for allantoin and other oxo -derivatives of nitrogen heterocyclic compounds in Arabidopsis. Plant Cell  2002; 14: 847– 56. Google Scholar CrossRef Search ADS PubMed  Diallinas G, Gorfinkiel L, Arst HN et al.   Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes. J Biol Chem  1995; 270: 8610– 22. Google Scholar CrossRef Search ADS PubMed  Dingman DW, Stahly DP. Medium promoting sporulation of Bacillus larvae and metabolism of medium components. Appl Environ Microb  1983; 46: 860– 9. Ebeling J, Knispel H, Hertlein G et al.   Biology of Paenibacillus larvae, a deadly pathogen of honey bee larvae. Appl Microbiol Biot  2015; 17: 7387– 95. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res . 2004; 32: 1792– 7. Google Scholar CrossRef Search ADS PubMed  Frillingos S. Insights to theevolution of Nucleobase-Ascorbate transporters (NAT/NCS2 family) from the Cys-scanning analysis of xanthine permease XanQ. Int J Biochem Mol Biol  2012; 3: 250– 72. Google Scholar PubMed  Genersch E. American Foulbrood in honeybees and its causative agent, Paenibacillus larvae. J Inv Pathol  2010; 103: S10– 9. Google Scholar CrossRef Search ADS   Gietz DR, Woods RA. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Method Enzymol  2002; 350: 87– 96. Google Scholar CrossRef Search ADS   Goudela S, Tsilivi H, Diallinas G. Comparative kinetic analysis of AzgA and Fcy21p, prototypes of the two major fungal hypoxanthine-adenine-guanine transporter families. Mol Membr Biol  2006; 23: 291– 303. Google Scholar CrossRef Search ADS PubMed  Gournas C, Papageorgiou I, Diallinas G. The nucleobase-ascorbate transporter (NAT) family: genomics, evolution, structure-function relationships and physiological role. Mol BioSyst  2008; 4: 404– 16. Google Scholar CrossRef Search ADS PubMed  Guindon S, Dufayard JF, Lefort V et al.   New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol  2010; 59: 307– 21. Google Scholar CrossRef Search ADS PubMed  Jelesko JG. An expanding role for purine uptake permease-like transporters in plant secondary metabolism. Front Plant Sci  2012; 3: 1– 5. Google Scholar CrossRef Search ADS PubMed  Jund R, Chevallier MR, Lacroute F. Primary structure of the uracil transport protein of Saccharomyces cerevisiae. Eur. J Biochem  1988; 171: 417– 24. Karatza P, Frillingos S. Cloning and functional characterization of two bacterial members of the NAT/NCS2 family in Escherichia coli. Mol Membr Biol  2005; 22: 251– 61. Google Scholar CrossRef Search ADS PubMed  Karatza P, Panos P, Georgopoulou E et al.   Cysteine-scanning analysis of the enucleobase-ascorbate transporter signature motif in YgfO permease of Escherichia coli. J Biol Chem  2006; 281: 39881– 90. Google Scholar CrossRef Search ADS PubMed  Katznelson H. Bacillus pulvifaciens (n. sp.), an organism associated with powdery scale of honeybee larvae. J Bacteriol  1950; 59: 153– 5. Google Scholar PubMed  Kim KS, Pelton JG, Inwood WB et al.   The Rut pathway for pyrimidine degradation: novel chemistry and toxicity problems. J Bacteriol  2010; 192: 4089– 102. Google Scholar CrossRef Search ADS PubMed  Kosti V, Lambrinidis G, Myrianthopoulos V et al.   Identification of the substrate recognition and transport pathway in a eukaryotic member of the nucleobase-ascorbate transporter (NAT) family. PLoS One  2012; 7: e41939. Google Scholar CrossRef Search ADS PubMed  Kozmin SG, Stepchenkova EI, Chow SC et al.   A critical role for the putative NCS2 nucleobase permease YjcD in the sensitivity of Escherichia coli to cytotoxic and mutagenic purine analogs. mBio  2013; 4: e00661– 13. Google Scholar CrossRef Search ADS PubMed  Krypotou E, Lambrinidis G, Evangelidis T et al.   Modelling, substrate docking and mutational analysis identify residues essential for function and specificity of the major fungal purine transporter AzgA. Mol Microbiol  2014; 93: 129– 45. Google Scholar CrossRef Search ADS PubMed  Lu F, Li S, Jiang Y et al.   Structure and mechanism of the uracil transporter UraA. Nature  2011; 472: 243– 6. Google Scholar CrossRef Search ADS PubMed  Ma P, Baldwin JM, Baldwin SA et al.   Membrane transport proteins: the nucleobase cation symporter 1 family. In: Roberts GCK (ed.). Encyclopedia of Biophysics . Berlin, Heidelberg: Springer, 2013, 1485– 9. Google Scholar CrossRef Search ADS   Mansfield TA, Schultes NP, Mourad GS. AtAzg1 and AtAzg2 comprise a novel family of purine transporters in Arabidopsis. FEBS Lett  2009; 583: 481– 6. Google Scholar CrossRef Search ADS PubMed  Minton JA, Rapp M, Stoffer AJ et al.   Heterologous complementation studies reveal the solute transport profiles of a two-member nucleobase cation symporter 1 (NCS1) family of Physcomitrella patens. Plant Physiol Biochem  2016; 100: 12– 17. Google Scholar CrossRef Search ADS PubMed  Mourad GS, Tippmann-Crosby J, Hunt KA et al.   Genetic and molecular characterization reveals a unique nucleobase cation symporter 1 in Arabidopsis. FEBS Lett  2012; 586: 1370– 8. Google Scholar CrossRef Search ADS PubMed  Niopek-Witz S, Deppe J, Lemieux MJ et al.   Biochemical characterization and structure-function relationship of two plant NCS2 proteins, the nucleotase transporters NAT3 and NAT12 from Arabidopsis thaliana. Biochem Biophys Acta  2014; 1838: 3025– 35. Google Scholar CrossRef Search ADS PubMed  Pantazopoulou A, Diallinas G. Fungal nucleobase transporters. FEMS Microbiol Rev  2007; 31: 657– 75. Google Scholar CrossRef Search ADS PubMed  Papakostas K, Botou M, Frillingos S. Functional identification of the hypoxanthine/guanine transporters YjcD and YgfQ and the adenine transporters PurP and YicO of Escherichia coli K-12. J Biol Chem  2013; 288: 36827– 40. Google Scholar CrossRef Search ADS PubMed  Papakostas K, Frillingos S. Substrate selectivity of YgfU, a uric acid transporter from Escherichia coli. J Biol Chem  2012; 287: 15684– 95. Google Scholar CrossRef Search ADS PubMed  Papakostas K, Georgopoulou E, Frillngos S. Cysteine-scanning analysis of putative helix XII in the YgfO Xanthine permease. J Biol Chem  2008; 283: 13666– 78. Google Scholar CrossRef Search ADS PubMed  Poppinga L, Genersch E. Molecular pathogenesis of American foulbrood: how Paenibacillus larvae kills honey bee larvae. Curr Opin Insect Sci  2015; 10: 29– 36. Google Scholar CrossRef Search ADS   Rapp M, Schein J, Hunt KA et al.   The solute specificity profiles of nucleobase cation symporter 1 (NCS1) from Zea mays and Setaria viridis illustrate functional flexibility. Protoplasma  2016; 253: 611– 23. Google Scholar CrossRef Search ADS PubMed  Ritchie RJ, Prvan T. Current statistical methods for estimating the Km and Vmax of Michaelis-Menten kinetics. Biochemical Education  1996; 24: 16– 206. Google Scholar CrossRef Search ADS   Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics  2003; 19: 1572– 4. Google Scholar CrossRef Search ADS PubMed  Schein J, Hunt KA, Minton J et al.   The nucleobase cation symporter 1 from Chlamydomonas reinhardtii and the evolutionary distant Arabidopsis thaliana share function and establish a plant-specific solute transport profile. Plant Physiol Biochem  2013; 70: 52– 60. Google Scholar CrossRef Search ADS PubMed  Schmidt A, Baumann N, Schwarzkopf A et al.   Comparative studies on ureide permeases in Arabidopsis thaliana and analysis of two alternative splice variants of AtUPS5. Planta  2006; 224: 1329– 40. Google Scholar CrossRef Search ADS PubMed  Schmidt A, Su Y-H, Kunze R et al.   UPS1 and UPS2 from Arabidopsis mediate high affinity transport of uracil and 5-fluorouracil. J Biol Chem  2004; 279: 44817– 24. Google Scholar CrossRef Search ADS PubMed  Serrano R, Villalba JM. Expression and localization of plant membrane proteins in Saccharomyces cerevisiae. Method Cell Biol  1995; 50: 481– 96. Google Scholar CrossRef Search ADS   Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res  1994; 22: 4673– 80. Google Scholar CrossRef Search ADS PubMed  Yue D, Nordhoff M, Wieler LH et al.   Fluorescence in situ-hybirdization (FISH) analysis of the interactions between honeybee larvae and Paenibacillus larvae, the causal agent of American Foulbrood of honeybees (Apis melifera). Environ Microbiol  2008; 10: 1612– 20. Google Scholar CrossRef Search ADS PubMed  White GF. The Bacteria of the Apiary, with Special Reference to Bee Diseases . Bureau of Entomology Technical Series no 14. Washington DC: US Department of Agriculture, 1906. Google Scholar CrossRef Search ADS   Winston ML. The Biology of the Honey Bee . Cambridge: Harvard University Press, 1987. Winzeler EA, Shoemaker DD, Astromoff A et al.   Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science  1999; 285: 901– 6. Google Scholar CrossRef Search ADS PubMed  © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png FEMS Microbiology Letters Oxford University Press

The solute transport profile of two Aza-guanine transporters from the Honey bee pathogen Paenibacillus larvae

Loading next page...
 
/lp/ou_press/the-solute-transport-profile-of-two-aza-guanine-transporters-from-the-7XDlLgywOe
Publisher
Blackwell
Copyright
© FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
ISSN
0378-1097
eISSN
1574-6968
D.O.I.
10.1093/femsle/fny018
Publisher site
See Article on Publisher Site

Abstract

Abstract Two nucleobase transporters encoded in the genome of the Honey bee bacterial pathogen Paenibacillus larvae belong to the azaguanine-like transporters and are referred to as PlAzg1 and PlAzg2. PlAzg1 and 2 display significant amino acid sequence similarity, and share predicted secondary structures and functional sequence motifs with two Escherichia coli nucleobase cation symporter 2 (NCS2) members: adenine permease (EcAdeP) and guanine-hypoxanthine permease EcGhxP. However, similarity does not define function. Heterologous complementation and functional analysis using nucleobase transporter-deficient Saccharomyces cerevisiae strains revealed that PlAzg1 transports adenine, hypoxanthine, xanthine and uracil, while PlAzg2 transports adenine, guanine, hypoxanthine, xanthine, cytosine and uracil. Both PlAzg1 and 2 display high affinity for adenine with Km of 2.95 ± 0.22 and 1.92 ± 0.22 μM, respectively. These broad nucleobase transport profiles are in stark contrast to the narrow transport range observed for EcAdeP (adenine) and EcGhxP (guanine and hypoxanthine). PlAzg1 and 2 are similar to eukaryotic Azg-like transporters in that they share a broad solute transport profile, particularly the fungal Aspergillus nidulans AzgA (that transports adenine, guanine and hypoxanthine) and plant AzgA transporters from Arabidopsis thaliana and Zea mays (that collectively move adenine, guanine, hypoxanthine, xanthine, cytosine and uracil). Paenibacillus larvae, azaguanine-like transporters, purine, pyrimidine, heterologous complementation INTRODUCTION The gram-positive bacterium Paenibacillus larvae is the causative agent of the American foulbrood and powdery scale disease in Honey bees (Apis millifera Linnaeus) (White 1906; Katznelson 1950). Endospores of P. larvae infect only larvae once consumed in contaminated royal jelly (Genersch 2010; Ebeling et al.2015). Larvae are most susceptible 12 to 36 h after hatching. Once in the nutrient-rich larval midgut, spores of P. larvae germinate and greatly proliferate (Yue et al.2008). Recent work has shown that in vitro spore germination is triggered by L-tyrosine and uric acid (Alvarado et al.2013). Uric acid, a waste product from purine degradation and metabolized proteins, accumulates to high levels in the midgut as the midgut and hind gut are not yet connected in young larvae (Winston 1987). Once the midgut epithelium is breeched, bacteria proliferate in the hemocoel, producing extracellular proteases (Antúnez et al.2009) and toxins (Poppinga and Genersch 2015). Larval cell death ensues culminating in a putrid and ropey mass. Bacteria produce highly resistant spores once nutrients are depleted. Worker bees sense the decay, open the brood chamber, remove the carcass and become coated with spores that are available to infect subsequent larvae (Genersch 2010; Ebeling et al.2015). The abundance of cellular metabolites, including nitrogen-rich nucleobases, nucleosides and nucleotides, in the hemoceol of infected larvae offers P. larvae ample opportunity to import valuable nutrients for rapid proliferation. Nucleobase transporters are ubiquitous among eukaryotes and prokaryotes and belong to five independent families. Nucleobase cation symporter 1 (NCS1) transporters are present in bacteria, fungi and plants (Pantazopoulou and Diallinas 2007; Ma et al.2013). The nucleobase cation symporter 2 (NCS2) family, also known as the nucleobase ascorbate transporter (NAT) family, are a large family found in bacteria, fungi (except Saccharomyces cerevisiae), plants and mammals (Pantazopoulou and Diallinas 2007; Gournas, Papageorgiou and Diallinas 2008; Frillingos 2012). The closely related Aza-guanine transporters (AzgA) are restricted to bacteria, fungi and plants (Diallinas et al.1995; Krypotou et al.2014). In addition, two other nucleobase families, the purine permease (PUP) and ureide permeases (UPS), are found only in plants (Desimone et al.2002; Schmidt et al.2004, 2006; Jelesko 2012). Nucleobase transporter families have solute transport preferences among purines and pyrimidines. Comparison of solute transport profiles between families reveals overlapping solute transport capabilities. Even within a transporter family, members often have overlapping but unique solute transport and binding profiles. The role of nucleobase transports differs between multicellular organisms and single-cell organisms. In plants, the plethora of nucleobase transporters locates in many different subcellular membranes and serves the needs of extensive nucleobase de novo synthesis, salvage and catabolic pathways. In single-celled organisms, nucleobase transporters function for the acquisition of these nitrogen-rich molecules from the external environment. The NCS2 and the closely related azaguanine-like transporter (Azg) belong to the Clusters of Orthologous Groups (COG) 2233 and 2252, respectively. In plants, NCS2 tend to have broad and mixed solute transport and binding profiles including combinations of xanthine, uric acid, uracil, adenine, guanine, cytosine and hypoxanthine (Argyrou et al.2001; Niopek-Witz et al.2014; Schultes and Mourad pers. comm.). Microbes, in contrast, have NCS2 with more restricted solute transport and binding profiles. Fungal nucleobase transporters have been well studied in Aspergillus nidulans including two NCS2, UapA and UapC, that transport uric acid and xanthine (Gournas, Papageorgiou and Diallinas 2008) and the purine transporter AzgA that moves adenine, hypoxanthine and guanine (Cecchetto et al.2004; Goudela, Tsilivi and Diallinas 2006). Both UapA and AzgA have been extensively studied with dozens of mutations that have been characterized at the biochemical level (Kosti et al.2012; Krypotou et al.2014). In bacteria, NCS2 and AzgA have been most studied in Escherichia coli which contains 10 NCS2 with narrow solute transport profiles: the COG2252 members include EcGhxQ (YgfQ) and EcGhxP (YjcD) transporting guanine and hypoxanthine (Papakostas, Botou and Frillingos 2013) and EcAdeP (YieG) and EcAdeQ (YicO) transporting adenine (Papakostas, Botou and Frillingos 2013), while the COG2233 members include EcUraA transporting uracil (Lu et al.2011), EcXanP (YicE) and EcXanQ (YgfO) transporting xanthine (Karatza and Frillingos 2005), EcUacT transporting uric acid (Papakostas and Frillingos 2012) and EcRutG (Kim et al.2010) and EcYbbY are of unknown function (Cusa et al.1999). The recent elucidation of the 3D structures of EcUraA (Lu et al.2011) and the NCS2 xanthine/uric acid transporter UapA of Aspergillus nidulans (Alguel et al.2016), in combination with functional analysis of cysteine-scanning and site-directed mutants of EcAdeP, EcGhxP, EcXanP and EcUacT, offers insight into the functional working of NCS2 and AzgA transport (Karatza et al.2006; Papakostas, Georgopoulou and Frillngos 2008; Papakostas and Frillingos 2012; Papakostas, Botou and Frillingos 2013). It is with this setting that the solute transport profile for two COG2233 transporters from P. larvae are investigated here. MATERIALS AND METHODS Microbial strains and growth conditions Paenibacillus larvae subspecies larvae strain NRRL B-3650 was grown on MYPGP media (Dingman and Stahly 1983). Growth profiles of B-3650 in the presence of 0, 10, 100 and 500 μg/ml of 6-thioguanine (6TG) were inoculated with 1/50 overnight culture into 0.5 ml MYPGP, grown at 37°C with an orbital shake of 205 CPM in CytoOne 48-well flat bottom sterile microtiter plates (USA Scientific, Inc., Ocala, FL) and optical density (590 nm) measured every 20 min over 17 h using a Synergy H1 microplate reader (BioTek Instruments, Inc., Winooski, VT) running Gen5 Data Analysis Software ver. 2.07. Turbidity data were analyzed using Microsoft Excel. Escherichia coli strain DH5α (fhuA2 lacΔU169 phoA glnV44 Φ80' lacZΔM15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) was grown on LB media with 50 mg/ml carbenicillin and used for molecular cloning. Saccharomyces cerevisiae strains RG191 [MATα, fyc2Δ::kanMX4, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0] (Winzeler et al.1999) and NC122-sp6 [MAT α leu2 fur4Δ] (Jund et al.1988) were grown in synthetic complete (SC) medium at 30°C. Yeast transformations were performed by the lithium acetate method (Gietz and Woods 2002). Nucleic acid manipulations Genomic DNA was isolated from P. larvae strain B-3650 using QIAamp Tissue kit (Qiagen Inc. Santa Clarita, CA). The coding regions for PlAzg1 and PlAzg2 were amplified from genomic DNA by the polymerase chain reaction using oligonucleotides primers PlAzg1a 5΄ gggagctctcgagatgtcaaggtacgcccaagtgaaagg 3΄ and PlAzg1b 5΄ ataagaatgcggccgcttatgaatggataaatccaagctg 3΄ or primers PlAzg2a 5΄ 5΄ cccaagcttctcgagatgtacgtttcctccttactctt 3΄ and PlAzg2b 5΄ ataagaatgcggccgcttacatcgtctgaagcacaaagtg 3΄, respectively. The PCR products were purified using QIAquick PCR purification kit (Qiagen Inc.) and, along with yeast expression vector pRG399, cut with endonuclease restriction enzymes Xho I and Not I, ligated and transformed into E. coli strain DH5α to generate plasmids pRH718 (PlAzg2) and pRH720 (PlAzg1). DNA sequence analysis was performed at the W.M. Keck Biotechnology Resource Laboratory at Yale School of Medicine (New Haven, CT, USA) to verify sequence integrity. Plasmids pRH718 and 720 were transformed into yeast strains RG191 and NC122-Sp6 and selected on SC—leucine media. RNA was isolated from P. larvae strain B-3650 culture grown in MYPGP to an OD600 of 0.64 using the RNeasy Protection Kit/RNA protect Bacterial Reagent (Qiagen Inc.) and treated with RNase-free DNaseI (Roche, Indianapolis, IN). Genomic DNA, RNase-treated total RNA and RNase-treated total RNA with Invitrogen SuperScript One-Step RT-PCR treatment (ThermoFisher, Waltham, MA) was amplified with primers Plazga1F 5΄ ttgccgtgactttactgctg 3΄ and Plazga1R 5΄ ccgatccggattctacaaga 3΄ or PlAzg2F 5΄ atttgttcggccagttatcg 3΄ and PlAzg2R 5΄ atccgttcgaaggaaatgtg 3΄ to generate fragments of 390 and 412 bp, respectively, using amplification conditions of 94°C 2 min, 94°C 15 s, 55°C 30 s, 70°C 2 min, Repeat 39X; 72°C 10 min. DNA products were visualized by agarose gel electrophoresis. Phylogenetic analysis employed Phylogeny.fr (Dereeper et al., 2008) using MUSCLE alignment (Edgar 2004) and either Bayesian inference (Mr. Bayes 3.2.3) (Ronquist and Huelsenbeck 2003) (Fig. 1) or Maximum Likelihood PhyML 3.1 (Guindon et al.2010) (Fig. S1, Supporting Information) and tree construction TreeDyn (Chevenet et al.2006). Figure 1. View largeDownload slide Phylogenetic relationships of PlAzg1 and 2 with select NCS2 transporters based upon Bayesian inference. Amino acid sequence accession numbers are given as PlAzg1 (EFX46818.1); PlAzg2 (EFX46366.1); E. coli EcUraA (BAA16385.1), EcRutG (P75892.2), EcXanQ (P67444.2), EcXanP (P0AGM9.1), EcUacT (Q46821.1), EcYbbY (P77328.2), EcGhxQ (Q46817.2), EcGhxP (P0AF52.1), EcAdeP (P31466.2), EcAdeQ (P31440.3). EcCodB (POAA82), a nucleobase symporter 1 transporter, serves as the outgroup. Phylogenetic tree constructed using Phylogeny.fr (Dereeper et al.2008) using MUSCLE alignment (Edgar 2004) and tree construction employing Bayesian inference Mr Bayes 3.2.3 (Ronquist and Huelsenbeck 2003). Figure 1. View largeDownload slide Phylogenetic relationships of PlAzg1 and 2 with select NCS2 transporters based upon Bayesian inference. Amino acid sequence accession numbers are given as PlAzg1 (EFX46818.1); PlAzg2 (EFX46366.1); E. coli EcUraA (BAA16385.1), EcRutG (P75892.2), EcXanQ (P67444.2), EcXanP (P0AGM9.1), EcUacT (Q46821.1), EcYbbY (P77328.2), EcGhxQ (Q46817.2), EcGhxP (P0AF52.1), EcAdeP (P31466.2), EcAdeQ (P31440.3). EcCodB (POAA82), a nucleobase symporter 1 transporter, serves as the outgroup. Phylogenetic tree constructed using Phylogeny.fr (Dereeper et al.2008) using MUSCLE alignment (Edgar 2004) and tree construction employing Bayesian inference Mr Bayes 3.2.3 (Ronquist and Huelsenbeck 2003). Radiolabel uptake by yeast expressing PlAzg1 and 2 Yeast strain RG191 harboring pRG399, pRH718 or pRH720 was grown for 24 h at 30°C; concentrated to OD600 = 4; and incubated for 5 min with 0.25 μM [8–3H]-guanine, [2,8–3H]-adenine, [8–3H]-xanthine, [5–3H]-cytosine and [8–3H]-hypoxanthine (Moravek, Brea, CA) in 100 mM citrate buffer (pH 3.5) with 1% glucose. Aliquots (25 μl) were added to 4 ml of ice-cold water and filtered through a 0.45-μm Metricel membrane filter (Gelman Sciences, Ann Arbor, MI). Filters were then washed with 8 ml of water and radioactivity was measured in a Tracor Analytic Delta 300 model 6891(Tracor Analytic Inc., Elk Grove Village, IL) liquid scintillation counter. Yeast strain NC122-Sp6 harboring pRG399, pRH718 or pRH720 was grown, incubated with [5,6–3H]-uracil and assayed as above. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). The standard error of the mean is derived from three independent experiments. Transport kinetics and inhibitor studies of PlAzg1 and 2 The Km values of PlAzg1 and 2 for adenine were measured through traditional Michaelis-Menten kinetics experiments. RG191 cells (OD600 = 4) containing pRH718 or pRH720 were incubated with increasing concentrations of [2,8–3H]-adenine (0.1, 0.25, 0.5, 1.0, 10.0, 20.0, and 30.0 μM), for 10 min and the amount of radiolabel taken up by cells was measured as mentioned above. Three independent replicas were used for each substrate concentration. Substrate saturation data were fitted by non-linear regression. Estimates of Km were calculated from the double reciprocal Lineweaver–Burk plot transformation (Ritchie and Prvan 1996). The Ki value of PlAzg1 and 2 for uric acid was determined by heterologous competition. RG191 cells containing pRH718 or pRH720 were incubated with 1 μM [2,8–3H]-adenine in the presence of different unlabeled competitor uric acids (0, 5, 10, 50, 100, 1000, and 2000 μM) and the resulting radiolabel measured as above. Ki values were determined using GraphPad Prism software (version 6) for data analysis. RG191 cells containing pRH718 and pRH720 were incubated with 1 μM [2,8–3H]-adenine alone or in the presence of 100 μM carbonyl cyanide m-chlorophenylhydrazone (CCCP) or 1 mM Ouabain octahydrate. The reaction was incubated at 30˚C with samples taken at 0 and 5 min, and radioactivity was measured as above. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). The standard error of the mean is derived from three independent experiments. RESULTS AND DISCUSSION Two azaguanine-like transporters are encoded in the genome of P. larvae A search of the P. larvae B-3560 genome through the National Center for Biotechnology Information database with the amino acid sequence of the E. coli adenine permease AdeP (also known as PurP and YieG) using tblastn (Altschul et al.1990) located two presumptive proteins Gb# EFX46818.1 and EFX46366.1 now referred to as PlAzg1 and PlAzg2, respectively (Chan et al.2011). Ultimately we want to determine the function of each protein. The first avenue to pursue is to establish which of the 10 E. coli NCS2 proteins are most closely related to PlAzg1 and 2 and then determine if amino acid sequence similarities can be used as a surrogate to assign function or not. Two tiers of comparisons are used: (i) measuring the levels of overall amino acid sequence identity/similarity and (ii) correlating key amino acid positions in E. coli NCS2 transporters—previously identified as key to function—with the analogous positions in PlAzg1 and 2. A phylogenetic tree detailing amino acid sequence comparisons of other NCS2 proteins reveals a close association between PlAzg1 and PlAzg2 and the E. coli adenine and guanine-hypoxanthine transporters in COG2252 (Fig. 1). PlAzg1 and 2 are more distantly related to other E. coli NCS2 proteins in NCS2 subgroup COG2233 which contains uracil, xanthine and uric acid transporters. This phylogenetic association is robust as an analysis employing either Bayesian inference (Fig. 1) or maximum likelihood (Fig. S1, Supporting Information) settles on the same tree structure. PlAzg1 and 2 show 25%–37% amino acid identity/60%–82% similarity to EcAdeP and EcGhxP, between 20%–29%/57%–60% identity/similarity with Arabidopsis thaliana AtAzg1 and 2 and 20%–26%/53%–55% identity/similarity with Aspergillus nidulans AnAzgA (Fig. S2, Supporting Information). A close analysis of amino acids key for solute discrimination and transport reveals that both PlAzg1 and 2 share only 21 of 35 invariant amino acids identified with E. coli adenine and guanine-hypoxanthine transporters and other COG2252 members (Papakostas, Botou and Frillingos 2013) (see Fig. S2, Supporting Information). Of the eight amino acids found to be important for adenine transport by site directed mutagenesis in EcAdeP, PlAzg1 is conserved for only four and PlAzg2 conserved for only one (Papakostas, Botou and Frillingos 2013) (see Fig. S1, Supporting Information). Similarly, for the same eight amino acids determined essential for hypoxanthine transport by site-directed mutagenesis in EcGhxP, PlAzg1 is conserved for only three and PlAzg2 conserved for only one (Papakostas, Botou and Frillingos 2013) (see Fig. S2, Supporting Information). PlAzg1 and 2 do share amino acid identity with a majority of the nine amino acids in AnAzgA that are essential for substrate binding and transport or critical for function (Cecchetto et al.2004) (see Fig. S2, Supporting Information). Sequence analysis alone is insufficient to assign transporter function to PlAzg1 and2, and direct experimental determination of function is needed. End point reverse transcription polymerase chain reaction of P. larvae RNA from vegetative cells reveals that the PlAzg1 and 2 loci are expressed (Fig. 2a). The close structural toxic analog of guanine 6TG is transported by EcGhxP (Papakostas, Botou and Frillingos 2013). As shown in Fig. 2b growth of P. larvae is diminished in the presence of increasing concentrations of 6TG. These data are consistent with the presence of P. larvae transporter(s) that recognize and move this guanine analog during vegetative growth. The higher level of amino acids conserved between PlAzg1 and 2 and those functionally important for the eukaryotic AnAzgA compared to the low level of amino acid conservation with those functionally important in bacterial EcAdeP and EcGhxP raises the questions as to what is the solute transport profile for PlAzg1 and 2. Figure 2. View largeDownload slide Expression of PlAzg1 and 2 by P. larvae and growth of P. larvae on 6-thioguanine. (a) Expression of PlAzg1and 2 in P. larvae by endpoint RT-PCR. Lane 1, exACTGene 1 kb plus DNA ladder (Fisher); lanes 2 and 6, genomic DNA PCR control; lanes 3 and 7, DNaseI-treated RNA PCR control; and lanes 4 and 8, RT-PCR of total RNA with lanes 2–4 amplified with PlAzg1-specific primers and lanes 6–8 amplified with PlAzg2-specific primers. (b) Growth of P. larvae B-3650 in MYPGP alone or supplemented with 10, 100 and 500 mg/ml of 6-TG at 37°C for 17 h and turbidity measured at 590 nm. Figure 2. View largeDownload slide Expression of PlAzg1 and 2 by P. larvae and growth of P. larvae on 6-thioguanine. (a) Expression of PlAzg1and 2 in P. larvae by endpoint RT-PCR. Lane 1, exACTGene 1 kb plus DNA ladder (Fisher); lanes 2 and 6, genomic DNA PCR control; lanes 3 and 7, DNaseI-treated RNA PCR control; and lanes 4 and 8, RT-PCR of total RNA with lanes 2–4 amplified with PlAzg1-specific primers and lanes 6–8 amplified with PlAzg2-specific primers. (b) Growth of P. larvae B-3650 in MYPGP alone or supplemented with 10, 100 and 500 mg/ml of 6-TG at 37°C for 17 h and turbidity measured at 590 nm. Defining the solute transport profile of PlAzg1 and 2 The coding regions of PlAzg1 and 2 were amplified from genomic DNA isolated from P. larvae strain B-3650 and cloned as transcriptional fusions into the yeast high copy expression vector pRG399 (with the PMA1 promoter producing a moderately high constitutive level of expression) (Serrano and Villalba 1995; Mansfield, Schultes and Mourad 2009) to create plasmids pRH720 and pRH718, respectively. Plasmids pRH718 and 720 were transformed into S. cerevisiae strains RG191 and NC122-Sp6. Strain 191 is deficient in transport of adenine, guanine, hypoxanthine and cytosine due to a deletion of the Fcy2 locus. Strain NC122-Sp6 is deficient in the transport of uracil as it carries a deletion of the Fur4 locus. Yeast genomes do not contain loci for xanthine or uric acid transport. The solute transport profile for other plant and microbial nucleobase transporters has been successfully determined employing the fcy2- and fur4-deficient strains and expression plasmids via heterologous complementation experiments and monitoring for the uptake of radiolabeled purines and pyrimidines (Mansfield, Schultes and Mourad 2009; Mourad et al.2012; Schein et al.2013; Minton et al.2016; Rapp et al.2016). Figure 3 reveals that yeast strains containing PlAzg1 took up significantly more [3H]-adenine, [3H]-hypoxanthine and [3H]-xanthine [3H]-uracil than strains containing the empty vector, but no statistically different uptake for [3H]-guanine or [3H]-cytosine (Fig. 3a–f). Yeast strains harboring PlAzg2 took up significantly more [3H]-adenine, [3H]-guanine, [3H]-hypoxanthine, [3H]-xanthine [3H]-uracil and [3H]-cytosine than strains containing the empty vector (Fig. 3a-f). It appears that both PlAzg1 and 2 have unique and broad nucleobase transport abilities for both purines and pyrimidines. This is in contrast to the E. coli Azg-like transporters AdeP and GhxP in COG2252 that transport only adenine or guanine, hypoxanthine and 6TG, respectively (Kozmin et al.2013; Papakostas, Botou and Frillingos 2013). Further, the binding capacity of EcAdeP is also very restrictive as it does not competitively bind xanthine, uracil or cytosine and shows a very limited ability to bind guanine, hypoxanthine and 6TG (Papakostas, Botou and Frillingos 2013). Similarly, the binding capacity for EcGhxP is restricted not recognizing adenine, xanthine, uracil or cytosine (Papakostas, Botou and Frillingos 2013). PlAzg1 and 2 share broad transport profiles similar to those of fungal and plant Azg transporters. AtAzg1 and 2 are known to transport both adenine and guanine, and AnAzgA is known to transport adenine, guanine and hypoxanthine (Goudela, Tsilivi and Diallinas 2006; Mansfield, Schultes and Mourad 2009). More recently, the characterization of three Azg transporters in Zea mays revealed unique solute transport profiles that together include adenine, guanine, hypoxanthine, xanthine, cytosine and uracil (Mourad and Schultes pers. comm.). As observed with NCS1 transporters, each Azg transporter has a unique solute transport and binding profile. Although AnAzgA transports adenine and guanine, it does not recognize xanthine or uric acid, yet PlAzg1 and 2 both transport xanthine and recognize uric acid (see below). Figure 3. View largeDownload slide Uptake of radiolabeled nucleobases by yeast containing PlAzg1 and 2. Yeast strain RG191 alone (fcy2Δ) or containing pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 5 min for the uptake of (a) [8–3H]-guanine, (b) [2,8–3H]-adenine, (d) [5–3H]-cytosine, or (e) [8–3H]-hypoxanthine. Strain NC122-Sp6 alone or with pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 0 and 5 min for the uptake of (c) [5,6–3H]-uracil or (f) [8–3H]-xanthine. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). All error bars represent SEM. Figure 3. View largeDownload slide Uptake of radiolabeled nucleobases by yeast containing PlAzg1 and 2. Yeast strain RG191 alone (fcy2Δ) or containing pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 5 min for the uptake of (a) [8–3H]-guanine, (b) [2,8–3H]-adenine, (d) [5–3H]-cytosine, or (e) [8–3H]-hypoxanthine. Strain NC122-Sp6 alone or with pRH720 (fcy2Δ/PlAzg1) or pRH718 (fcy2Δ/PlAzg2) was monitored at 0 and 5 min for the uptake of (c) [5,6–3H]-uracil or (f) [8–3H]-xanthine. Statistical analysis used an independent paired t-test. Significance was measured at P = 0.05 (*). All error bars represent SEM. It is interesting to note that the eight common and functionally important amino acids in EcAdeP and EcGhxP, as determined by site-directed mutagenesis coupled with adenine or hypoxanthine transport studies, are poorly conserved in PlAzg1 and 2 (see Fig. S1, Supporting Information). These residues locate in transmembrane spanning domains 1, 3, 8, 9 and 10 that comprise the ‘core domain’ based upon the experimentally derived 3D structure of EcUraA (an NCS2 transporter) (Lu et al.2011). The solute-binding pocket is formed in the junction between the core domains and the remaining TM in the gate domain (Lu et al.2011). Site-directed mutagenesis of the analogous residues in EcUacT and EcXanQ also affect solute transport or specificity (Frillingos 2012; Papakostas and Frillingos 2012). However, the results of such site-directed alterations are not necessarily transferable to closely related proteins. Specifically, the A91G and D267E alterations in EcAdeP abolish adenine transport, yet are present as G and E, respectively, in PlAzg1 and 2 which exhibits robust adenine transport. Similarly, the D271E alteration in EcGhxP (analogous to the D267E in EcAdeP) abolishes hypoxanthine transport but in PlAzg1 and 2, E is already present and hypoxanthine transport occurs. The take home lesson from this study is that neither amino acid sequence similarity of a transporter nor taxonomic proximity of host organisms is sufficient to assign functionality. PlAzg1 and 2 show high affinity for adenine and uric acid The affinity of PlAzg1 and 2 for adenine was determined using Michaelis Menten kinetics experiments in which RG191 harboring PlAzg1 or 2 was incubated with increasing concentrations of [3H]-adenine and then the resulting radiolabel uptake was monitored. Data reveal that both PlAzg1 and 2 have high affinities for adenine with a Km of 2.95 ± 0.22 μM and 1.92 ± 0.22 μM, respectively (Fig. 4). These are similar to the affinities observed for adenine in EcAdeP 1.0 μM and AzgA 3 μM (Papkostas et al.2013; Krypotou et al.2014). Heterologous competition experiments employing labeled adenine and unlabeled uric acid yielded a Ki of 33 μM for PlAzg1 and 0.32 μM for PlAzg2 for uric acid (data not shown). PlAzg1 and 2 show moderate and high affinity for uric acid in contrast to the general nucleobase transporter PlUacP (uric acid-like permease) that has a low affinity for uric acid Ki 336 μM (Stoffer, Mourad and Schultes pers. comm.). Given that there is an accumulation of uric acid in the young Honey bee larvae midgut, and that uric acid might serve as a signal for P. larvae spore germination (Alvarado et al.2013), it is conceivable that this nitrogen-rich molecule would be readily transported into vegetative growing cells (Yue et al.2008) prior to invasion into the Honey bee larvae hemocoel. Figure 4. View largeDownload slide Kinetic values of select nucleobases for PlAzg1 and 2. Substrate saturation assays in yeast strain RG191 containing pRH720 (fcy2Δ/PlAzg1) (a) or pRH718 (fcy2Δ/PlAzg2) (c) for [2,8–3H]-adenine. Double reciprocal Lineweaver–Burk plots for PlAzg1 (b) and PlAzg2 (d) were constructed from the substrate saturation curves. Figure 4. View largeDownload slide Kinetic values of select nucleobases for PlAzg1 and 2. Substrate saturation assays in yeast strain RG191 containing pRH720 (fcy2Δ/PlAzg1) (a) or pRH718 (fcy2Δ/PlAzg2) (c) for [2,8–3H]-adenine. Double reciprocal Lineweaver–Burk plots for PlAzg1 (b) and PlAzg2 (d) were constructed from the substrate saturation curves. Yeast strain RG191 containing PlAzg1 or 2 takes up significantly less [3H]-adenine in the presence of the proton uncoupler carbonyl cyanide m-chlorophenylhydrazone, but not the Na+ gradient disruptor Ouabain (Table 1). Like their bacterial, fungal and plant NCS2 homologs, PlAzg1 and 2 appear to be a proton-nucleobase symporter, in contrast to mammalian NCS2 that rely upon a Na+ gradient for function (Gournas, Papageorgiou and Diallinas 2008). During rapid cell growth in infected honeybee larval, a rich plethora of compounds released from disrupted cells are available for uptake by the pathogen—including nitrogen-rich purines and pyrimidines. Here, it is shown that the solute transport function of PlAzg1 and 2 allows P. larvae to import a wide range of nucleobases from external sources. Paenibacillus larvae spores germinate and grow in a uric acid-rich midgut environment and invade into the nutrient-rich hemocoel. Our research has shown that nucleobase transporters capable of taking up adenine, guanine and one transporter that strongly recognizes and binds uric acid exist in P. larvae. Future experiments aim at mutagenizing the PlAzg1 and 2 loci in P. larvae and determining their role in the American foulbrood disease process. Table 1. Effects of inhibitors on the function of PlAzg1 and 2.   %[2,3–3H]-adenine uptake  RG191/PlAzg1  100 ± 10.5  RG191/PlAzg1 + CCCP  16* ± 1.7  RG191/PlAzg1 + Ouabain  104 ± 4.4  RG191/PlAzg2  100 ± 2.2  RG191/PlAzg2 + CCCP  33.3* ± 4.6  RG191/PlAzg2 + Ouabain  83.3 ± 12.3    %[2,3–3H]-adenine uptake  RG191/PlAzg1  100 ± 10.5  RG191/PlAzg1 + CCCP  16* ± 1.7  RG191/PlAzg1 + Ouabain  104 ± 4.4  RG191/PlAzg2  100 ± 2.2  RG191/PlAzg2 + CCCP  33.3* ± 4.6  RG191/PlAzg2 + Ouabain  83.3 ± 12.3  Significance was measured at P = 0.05 (*). View Large SUPPLEMENTARY DATA Supplementary data are available at FEMSLE online. Acknowledgements We thank Regan Huntley and Carol Clark at CAES for expert technical assistance. FUNDING This work was supported by research funds from Indiana University-Purdue University Fort Wayne to GSM and from the United States Department of Agriculture [Hatch Fund CONH00253 to NPS]. Conflict of interest. None declared. REFERENCES Alguel T, Amillis S, Leung J et al.   Structure of eukaryotic purine/H+ symporter UapA suggests a role for homodimerization in transport activity. Nat Commun  2016, DOI: 10.1038/ncomms11336. Altschul SF, Gish W, Miller W et al.   Basic local alignment search tool. J Mol Biol  1990; 5: 401– 10. Alvarado I, Phui A, Elekonich MM et al.   Requirements for in vitro germination of Paenibacillus larvae spores. J Bacteriol  2013; 195: 1005– 11. Google Scholar CrossRef Search ADS PubMed  Antúnez K, Anido M, Schlapp G et al.   Characterization of secreted proteases of Paenibacillus larvae, potential virulence factors involved in honeybee larval infection. J Inv Pathol  2009; 102: 129– 32. Google Scholar CrossRef Search ADS   Argyrou E, Sophianopoulou V, Schultes N et al.   Functional characterization of a maize purine transporter by expression in Aspergillus nidulans. Plant Cell  2001; 13: 953– 96. Google Scholar CrossRef Search ADS PubMed  Cecchetto G, Amillis S, Diallinas G et al.   The AzgA purine transporter of Aspergillus nidulans. Characterization of a protein belonging to a new phylogenetic cluster. J Biol Chem  2004; 279: 3132– 41. Google Scholar CrossRef Search ADS PubMed  Chan QWT, Comman RS, Birol I et al.   Updated genome assembly and annotation of Paenibacillus larvae, the agent of American foulbrood disease of honey bees. BMC Genomics  2011; 12: 450. Google Scholar CrossRef Search ADS PubMed  Chevenet F, Brun C, Banuls AL et al.   TreeDyn: towards dynamic graphics and annotations for analyses of trees. BMC Bioinformatics  2006; 7: 439. Google Scholar CrossRef Search ADS PubMed  Cusa E, Obradors N, Baldoma L et al.   Genetic analysis of a chromosomal region containing genes required for assimilation of allantoin nitrogen and linked glyocylate metabolism in Escherichia coli. J Bacteriol  1999; 181: 7479– 84. Google Scholar PubMed  Dereeper A, Guignon V, Blanc G et al.   Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res  2008; 36: W465– 469. Google Scholar CrossRef Search ADS PubMed  Desimone M, Catoni E, Ludewig U et al.   A novel superfamily of transporters for allantoin and other oxo -derivatives of nitrogen heterocyclic compounds in Arabidopsis. Plant Cell  2002; 14: 847– 56. Google Scholar CrossRef Search ADS PubMed  Diallinas G, Gorfinkiel L, Arst HN et al.   Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes. J Biol Chem  1995; 270: 8610– 22. Google Scholar CrossRef Search ADS PubMed  Dingman DW, Stahly DP. Medium promoting sporulation of Bacillus larvae and metabolism of medium components. Appl Environ Microb  1983; 46: 860– 9. Ebeling J, Knispel H, Hertlein G et al.   Biology of Paenibacillus larvae, a deadly pathogen of honey bee larvae. Appl Microbiol Biot  2015; 17: 7387– 95. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res . 2004; 32: 1792– 7. Google Scholar CrossRef Search ADS PubMed  Frillingos S. Insights to theevolution of Nucleobase-Ascorbate transporters (NAT/NCS2 family) from the Cys-scanning analysis of xanthine permease XanQ. Int J Biochem Mol Biol  2012; 3: 250– 72. Google Scholar PubMed  Genersch E. American Foulbrood in honeybees and its causative agent, Paenibacillus larvae. J Inv Pathol  2010; 103: S10– 9. Google Scholar CrossRef Search ADS   Gietz DR, Woods RA. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Method Enzymol  2002; 350: 87– 96. Google Scholar CrossRef Search ADS   Goudela S, Tsilivi H, Diallinas G. Comparative kinetic analysis of AzgA and Fcy21p, prototypes of the two major fungal hypoxanthine-adenine-guanine transporter families. Mol Membr Biol  2006; 23: 291– 303. Google Scholar CrossRef Search ADS PubMed  Gournas C, Papageorgiou I, Diallinas G. The nucleobase-ascorbate transporter (NAT) family: genomics, evolution, structure-function relationships and physiological role. Mol BioSyst  2008; 4: 404– 16. Google Scholar CrossRef Search ADS PubMed  Guindon S, Dufayard JF, Lefort V et al.   New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol  2010; 59: 307– 21. Google Scholar CrossRef Search ADS PubMed  Jelesko JG. An expanding role for purine uptake permease-like transporters in plant secondary metabolism. Front Plant Sci  2012; 3: 1– 5. Google Scholar CrossRef Search ADS PubMed  Jund R, Chevallier MR, Lacroute F. Primary structure of the uracil transport protein of Saccharomyces cerevisiae. Eur. J Biochem  1988; 171: 417– 24. Karatza P, Frillingos S. Cloning and functional characterization of two bacterial members of the NAT/NCS2 family in Escherichia coli. Mol Membr Biol  2005; 22: 251– 61. Google Scholar CrossRef Search ADS PubMed  Karatza P, Panos P, Georgopoulou E et al.   Cysteine-scanning analysis of the enucleobase-ascorbate transporter signature motif in YgfO permease of Escherichia coli. J Biol Chem  2006; 281: 39881– 90. Google Scholar CrossRef Search ADS PubMed  Katznelson H. Bacillus pulvifaciens (n. sp.), an organism associated with powdery scale of honeybee larvae. J Bacteriol  1950; 59: 153– 5. Google Scholar PubMed  Kim KS, Pelton JG, Inwood WB et al.   The Rut pathway for pyrimidine degradation: novel chemistry and toxicity problems. J Bacteriol  2010; 192: 4089– 102. Google Scholar CrossRef Search ADS PubMed  Kosti V, Lambrinidis G, Myrianthopoulos V et al.   Identification of the substrate recognition and transport pathway in a eukaryotic member of the nucleobase-ascorbate transporter (NAT) family. PLoS One  2012; 7: e41939. Google Scholar CrossRef Search ADS PubMed  Kozmin SG, Stepchenkova EI, Chow SC et al.   A critical role for the putative NCS2 nucleobase permease YjcD in the sensitivity of Escherichia coli to cytotoxic and mutagenic purine analogs. mBio  2013; 4: e00661– 13. Google Scholar CrossRef Search ADS PubMed  Krypotou E, Lambrinidis G, Evangelidis T et al.   Modelling, substrate docking and mutational analysis identify residues essential for function and specificity of the major fungal purine transporter AzgA. Mol Microbiol  2014; 93: 129– 45. Google Scholar CrossRef Search ADS PubMed  Lu F, Li S, Jiang Y et al.   Structure and mechanism of the uracil transporter UraA. Nature  2011; 472: 243– 6. Google Scholar CrossRef Search ADS PubMed  Ma P, Baldwin JM, Baldwin SA et al.   Membrane transport proteins: the nucleobase cation symporter 1 family. In: Roberts GCK (ed.). Encyclopedia of Biophysics . Berlin, Heidelberg: Springer, 2013, 1485– 9. Google Scholar CrossRef Search ADS   Mansfield TA, Schultes NP, Mourad GS. AtAzg1 and AtAzg2 comprise a novel family of purine transporters in Arabidopsis. FEBS Lett  2009; 583: 481– 6. Google Scholar CrossRef Search ADS PubMed  Minton JA, Rapp M, Stoffer AJ et al.   Heterologous complementation studies reveal the solute transport profiles of a two-member nucleobase cation symporter 1 (NCS1) family of Physcomitrella patens. Plant Physiol Biochem  2016; 100: 12– 17. Google Scholar CrossRef Search ADS PubMed  Mourad GS, Tippmann-Crosby J, Hunt KA et al.   Genetic and molecular characterization reveals a unique nucleobase cation symporter 1 in Arabidopsis. FEBS Lett  2012; 586: 1370– 8. Google Scholar CrossRef Search ADS PubMed  Niopek-Witz S, Deppe J, Lemieux MJ et al.   Biochemical characterization and structure-function relationship of two plant NCS2 proteins, the nucleotase transporters NAT3 and NAT12 from Arabidopsis thaliana. Biochem Biophys Acta  2014; 1838: 3025– 35. Google Scholar CrossRef Search ADS PubMed  Pantazopoulou A, Diallinas G. Fungal nucleobase transporters. FEMS Microbiol Rev  2007; 31: 657– 75. Google Scholar CrossRef Search ADS PubMed  Papakostas K, Botou M, Frillingos S. Functional identification of the hypoxanthine/guanine transporters YjcD and YgfQ and the adenine transporters PurP and YicO of Escherichia coli K-12. J Biol Chem  2013; 288: 36827– 40. Google Scholar CrossRef Search ADS PubMed  Papakostas K, Frillingos S. Substrate selectivity of YgfU, a uric acid transporter from Escherichia coli. J Biol Chem  2012; 287: 15684– 95. Google Scholar CrossRef Search ADS PubMed  Papakostas K, Georgopoulou E, Frillngos S. Cysteine-scanning analysis of putative helix XII in the YgfO Xanthine permease. J Biol Chem  2008; 283: 13666– 78. Google Scholar CrossRef Search ADS PubMed  Poppinga L, Genersch E. Molecular pathogenesis of American foulbrood: how Paenibacillus larvae kills honey bee larvae. Curr Opin Insect Sci  2015; 10: 29– 36. Google Scholar CrossRef Search ADS   Rapp M, Schein J, Hunt KA et al.   The solute specificity profiles of nucleobase cation symporter 1 (NCS1) from Zea mays and Setaria viridis illustrate functional flexibility. Protoplasma  2016; 253: 611– 23. Google Scholar CrossRef Search ADS PubMed  Ritchie RJ, Prvan T. Current statistical methods for estimating the Km and Vmax of Michaelis-Menten kinetics. Biochemical Education  1996; 24: 16– 206. Google Scholar CrossRef Search ADS   Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics  2003; 19: 1572– 4. Google Scholar CrossRef Search ADS PubMed  Schein J, Hunt KA, Minton J et al.   The nucleobase cation symporter 1 from Chlamydomonas reinhardtii and the evolutionary distant Arabidopsis thaliana share function and establish a plant-specific solute transport profile. Plant Physiol Biochem  2013; 70: 52– 60. Google Scholar CrossRef Search ADS PubMed  Schmidt A, Baumann N, Schwarzkopf A et al.   Comparative studies on ureide permeases in Arabidopsis thaliana and analysis of two alternative splice variants of AtUPS5. Planta  2006; 224: 1329– 40. Google Scholar CrossRef Search ADS PubMed  Schmidt A, Su Y-H, Kunze R et al.   UPS1 and UPS2 from Arabidopsis mediate high affinity transport of uracil and 5-fluorouracil. J Biol Chem  2004; 279: 44817– 24. Google Scholar CrossRef Search ADS PubMed  Serrano R, Villalba JM. Expression and localization of plant membrane proteins in Saccharomyces cerevisiae. Method Cell Biol  1995; 50: 481– 96. Google Scholar CrossRef Search ADS   Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res  1994; 22: 4673– 80. Google Scholar CrossRef Search ADS PubMed  Yue D, Nordhoff M, Wieler LH et al.   Fluorescence in situ-hybirdization (FISH) analysis of the interactions between honeybee larvae and Paenibacillus larvae, the causal agent of American Foulbrood of honeybees (Apis melifera). Environ Microbiol  2008; 10: 1612– 20. Google Scholar CrossRef Search ADS PubMed  White GF. The Bacteria of the Apiary, with Special Reference to Bee Diseases . Bureau of Entomology Technical Series no 14. Washington DC: US Department of Agriculture, 1906. Google Scholar CrossRef Search ADS   Winston ML. The Biology of the Honey Bee . Cambridge: Harvard University Press, 1987. Winzeler EA, Shoemaker DD, Astromoff A et al.   Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science  1999; 285: 901– 6. Google Scholar CrossRef Search ADS PubMed  © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Journal

FEMS Microbiology LettersOxford University Press

Published: Apr 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off