The effect of inulin and wheat bran on intestinal health and microbiota in the early life of broiler chickens

The effect of inulin and wheat bran on intestinal health and microbiota in the early life of... ABSTRACT Inulin and wheat bran were added to the starter diets of broiler chickens to investigate the potential of these ingredients to improve the host's health and growth performance, as well as the underlying mechanisms of their effects. A total of 960 1-day-old chicks were assigned to 4 treatments: control (CON), 2% inulin (IN), 10% wheat bran (WB), and 10% wheat bran +2% inulin (WB+IN). On day 11, 6 chicks per treatment were euthanized. A general linear model procedure with Tukey's multiple range test was performed to compare a series of parameters between treatments. The WB-containing treatments improved BW on day 7, day 11, day 35, and BW gain until day 11 (P < 0.05), but only the WB+IN treatment showed a lower feed conversion ratio than the CON treatment (P = 0.011). Furthermore, the WB+IN treatment showed the highest villus height in the jejunum and ileum (P < 0.05), and the highest jejunal ratio villus height/crypt depth (P = 0.035). The concentration of acetate in the ceca was higher in the CON treatment compared to the IN treatment (P = 0.040). The IN treatment increased the concentration (P = 0.003) and ratio (P = 0.004) of iso-butyrate compared to the WB+IN and the CON treatments (P < 0.05). A clustering result exhibited similar intestinal microbiota profiles in the chicks receiving the IN and the WB+IN diets (P > 0.05), but these profiles were different from those found in chicks receiving the WB and the CON diets (P < 0.05). In conclusion, wheat bran and the combination of wheat bran and inulin ameliorated the growth performance and gut morphology of the starter chicks, which resulted in a higher BW until day 35. Inulin, on the other hand, had a greater ability to influence the microbiota profile. The beneficial results found in relation to BW and gut morphology during the starter period suggested a synergistic effect of inulin and wheat bran. INTRODUCTION Inulin, a heterogeneous blend of fructose polymers, extracted from chicory roots, is a widely recognized prebiotic. It is the only one to date that was awarded an EU health claim on improving bowel function (Gibson et al., 2017). Wheat bran is a byproduct of the wheat milling process and specific components of wheat bran, such as arabinoxylans, have been shown to display prebiotic effects (Neyrinck and Delzenne, 2010; Broekaert et al., 2011). In poultry, inulin and wheat bran enhance the abundance of Bifidobacterium and Lactobacillus, thus improving the host's microbial balance (Courtin et al., 2008; Rebolé et al., 2010; Nabizadeh, 2012). As per definition of prebiotics, inulin and wheat bran serve as a substrate for short-chain fatty acids (SCFA) synthesis by different types of bacteria, generating increased amounts of propionate and butyrate (Gibson et al., 2004; De Paepe et al., 2017). These trophic substances have been shown to ameliorate the development of gut morphology (Scheppach, 1994; Hosseini et al., 2011). Furthermore, inulin and wheat bran can also improve the intestinal barrier, protecting the host against pathogens (Neyrinck et al., 2012; Chen et al., 2013; Chen et al., 2017; Wu et al., 2017). Since the initial stage of microbiota colonization in the intestine starts immediately from birth or hatch, it is important to establish a beneficial microbial community as soon as possible to have a long-lasting positive effect on intestinal health (Edwards and Parrett, 2002, 2003; Amit-Romach et al., 2004; Thompson et al., 2008). With this in mind, one strategy gaining increasing attention is to attempt to modulate the colonization of microbiota in early life. In poultry, effect of a temporary supplementation of prebiotics early in life is poorly investigated. Indeed, the standard strategy of using prebiotics or feed additives is to provide these ingredients during the entire rearing period, or from the growing period onwards (Jørgensen et al., 1996; Rebolé et al., 2010; Nabizadeh, 2012). Therefore, in this study, a supplementation of inulin and wheat bran separately or in combination, limited to the starter period, was applied to investigate whether these ingredients would impact the cecal microbiota and intestinal health at this young age and if the potential changes would last later over the growing period and improve global performances, providing a guidance to further research on the long-term effect of these ingredients. MATERIALS AND METHODS Ethics Statement The present animal experiment was approved by the Ethical Committee of Liège University (Ethical protocol 1703, Belgium) and was performed at the facilities of Gembloux Agro-Bio Tech (Gembloux, Belgium). Experimental Design, Broilers, and Diets A total of 960 1-day-old male Ross 308 broiler chicks (Belgabroed, Merksplas, Belgium) were housed in 24 floor pens (3 m × 1 m), each containing 40 birds. Wood shavings were used as bedding material. Pens (n = 6) were randomly assigned to 1 of the following 4 groups: 1) IN (2% inulin diet); 2) WB (10% wheat bran diet); 3) WB+IN (10% wheat bran+2% inulin diet); 4) CON (control diet without inulin or wheat bran). Inulin was provided by COSUCRA (Warcoing, Belgium), and is composed of linear chains of fructose units with 1 terminal glucose unit with a degree of polymerization ranging from 2 to 60 and with average polymerization of about 10. Wheat bran was provided by Bauwens sprl (Sombreffe, Belgium). Nutrient levels of the diets (Table 1) were based on Aviagen guidelines (2014) for Ross 308 broilers recommendations and were iso-energetic and iso-nitrogenous between treatments. Birds had free access to water and feed throughout the whole experiment. The environmental temperature during the first 3 d of life was 34°C, and was reduced progressively to 25°C until day 11. The lighting program consisted of 23 h of light and 1 h of darkness per day during the first week and 18 h of light and 6 h of darkness thereafter. Table 1. Composition and nutrient content of the starter diet. %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. 1Providing per kilogram of complete feed: vitamin A (retinyl acetate) 13,500 IU, vitamin D3 3,000 IU, vitamin E (dl-alpha-tocopheryl acetate) 55 IU, vitamin E (dl-alpha-tocopherol) 55 IU, vitamin B1/thiamine 1.6 mg, vitamin B1 2 mg, vitamin B2 5 mg, vitamin B3 15 mg, vitamin B5 30 mg, vitamin B6 4 mg, vitamin B9 1 mg, vitamin B12 25 mg, vitamin K3 5 mg, iron 100 mg, copper 36 mg, zinc 120 mg, iodine 2.4 mg, selenium 0.7 mg, manganese 192 mg. ADF, acid detergent fiber; NDF, neutral detergent fiber. View Large Table 1. Composition and nutrient content of the starter diet. %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. 1Providing per kilogram of complete feed: vitamin A (retinyl acetate) 13,500 IU, vitamin D3 3,000 IU, vitamin E (dl-alpha-tocopheryl acetate) 55 IU, vitamin E (dl-alpha-tocopherol) 55 IU, vitamin B1/thiamine 1.6 mg, vitamin B1 2 mg, vitamin B2 5 mg, vitamin B3 15 mg, vitamin B5 30 mg, vitamin B6 4 mg, vitamin B9 1 mg, vitamin B12 25 mg, vitamin K3 5 mg, iron 100 mg, copper 36 mg, zinc 120 mg, iodine 2.4 mg, selenium 0.7 mg, manganese 192 mg. ADF, acid detergent fiber; NDF, neutral detergent fiber. View Large Growth Performance and Nutrient Digestibility The average BW per pen on day 0, day 7, day 11, and the feed intake per pen during the starter period were recorded in order to measure the BW gain and feed conversion ratio (FCR). From day 11 onwards, 39 reserving birds per treatment were reared until day 35 on a standard grower (day 11 to day 24) (CP: 19.95% and ME: 2,864 kcal/kg) and finisher (day 24 to day 35) (CP: 18.11% and ME: 3,215 kcal/kg) diet. Individual BW of these broilers was determined on day 35. On day 3, 6 chicks per pen were transferred to digestibility cages. They were fed their respective experimental diets with the addition of 0.5% titanium dioxide as an indigestible marker. Droppings were collected from day 8 to day 10 and pooled per cage by mixing equal daily amounts together. On day 10, all chicks from the digestibility cages were euthanized by electrical stunning followed by decapitation and ileal contents were collected by saline flushing. Individual samples were pooled per cage for subsequent analyses. Dietary content and freeze-dried fecal and ileal matter were ground to 1 mm and analyzed for their contents in dry matter after drying at 105°C for 24 h (method 967.03, AOAC, 1990). The nitrogen (N) content was analyzed by using the Kjeldahl method and calculating the crude protein content (N × 6.25, method 981.10, AOAC, 1990); crude fat content was determined using the Soxhlet method with diethyl ether (method 920.29; AOAC, 1990), and gross energy was calculated by means of an adiabatic oxygen bomb calorimeter (1241 Adiabatic Calorimeter, PARR Instrument Co., IL). TiO2 was measured as described by Myers et al. (2004), and the results were used to calculate nutrient digestibility as follows: digestibility or retention = 1–[(diet TiO2/digesta TiO2) × (digesta nutrient/diet nutrient)]. In addition, the diets were also analyzed for their content in neutral detergent fiber using thermostable amylase (Termamyl, Novo Nordisk, Bagsværd, Denmark) and in acid detergent fiber, both were corrected for ash (550°C for 8 h, method 923.03; AOAC, 1990). Sample Collection Within 5 min after euthanasia on day 11, the gastrointestinal tract was removed from 1 bird from each pen (n = 6). Cecal content was collected, snap-frozen in liquid nitrogen, and then stored at –80°C until further microbiota and SCFA analysis. Five-centimeter jejunal and ileal segments were taken and stored in 4% paraformaldehyde for gut morphology analysis. Another 5-cm segment from the jejunum and the ileum were snap-frozen in liquid nitrogen and stored at –80°C for gene expression analysis. Gut Morphology After 48 h of fixation in 4% paraformaldehyde, the samples were stored in 70% ethanol and processed through a series of dehydration, clearing, and impregnation with wax. Paraffin-embedded samples were sliced into 5-μm sections using a microtome, fixed onto slides, and stained with hematoxylin and eosin. Villus height and crypt depth were measured at 4 × magnification using an OLYMPUS BX51 microscope and imaging software (Olympus Corporation, Hamburg, Germany) in 15 well-oriented villi and associated crypts per animal. Gene Expression Total RNA was isolated from the sampled jejunum and ileum tissue using PureYield RNA Midiprep System (Promega, Madison), according to the manufacturer's instructions. The isolated RNA was tested for purity and quantity using a spectrophotometer (Thermo Scientific NanoDrop 2000). In addition, RNA integrity was verified by visualization of 18 and 28S ribosomal RNA bands stained with Midori Green from Nippon Genetics (Filter Service, Eupen, Belgium) after gel electrophoresis on a 1% agarose gel. Single-stranded cDNA was synthesized from 0.95 μg of total RNA using the PrimeScript RT Reagent Kit (Perfect Real Time) (Takara, Japan). Real-time PCR was performed in ABI StepOnePlus (Applied Biosystems), using the SYBR Premix EX Taq II (Tli RNaseH plus) kit (Takara, Japan). The following PCR reaction program was applied: 30 s heating at 95°C, followed by 40 cycles of denaturation (5 s at 95°C), annealing (30 s at 60°C), and extension (30 s at 72°C). Three reference genes ACTB (β-actin), B2M (β2-microglobulin), and EF1A1 (eukaryotic translation elongation factor 1 alpha 1) (Table 2) were selected for normalization purposes. A melting curve analysis was performed in order to check the specificity of the primers, and the standard curve was determined by using pooled samples to ensure an amplification efficiency of between 90 and 110%. The 2−ΔΔCt method was used automatically by the ABI StepOnePlus system to analyze Mucin 2, Occludin, and Claudin-1. Table 2. Primer information for quantitative RT-PCR assays. Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      View Large Table 2. Primer information for quantitative RT-PCR assays. Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      View Large SCFA Analysis A mixture of cecal content and water 1:4 (wt/wt) was homogenized for 30 s and centrifuged at 13,000 g for 15 min. After centrifugation, 1 mL supernatant was collected and the pH was adjusted to 2–3 using 1 N H2SO4. The supernatant was filtered through a sterile acetate filter. Acetate, propionate, butyrate, valerate, iso-butyrate, and iso-valerate concentrations were analyzed by HPLC, using a Waters system fitted with an Aminex HPX-87H column (Bio-Rad, Hercules, CA) combined with a UV detector (210 nm), with sulfuric acid (5 mM) as the mobile phase at a flow rate of 0.6 mL/min. Gut Microbiota Analysis DNA extraction of the cecal content was performed using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's recommendations but adding a bead-beating step. PCR amplification of the V1-V3 region of the 16S rDNA and library preparation were performed with the following primers, forward (5′-GAGAGTTTGATYMTGGCTCAG-3′) and reverse (5′-ACCGCGGCTGCTGGCAC-3′). Sequencing was performed on an Illumina MiSeq platform, following Bindels et al. (2015). Statistical Analysis Ordination analysis and 3d plots were performed with Vegan, Vegan3d, and rgl packages in R. Non-metric dimensional scaling, based upon the Bray-Curtis dissimilarity matrix, was applied in order to visualize the biodiversity between the groups. Analysis of molecular variance test was performed to assess the diversity clustering of the Bray-Curtis matrix treatments using MOTHUR software (Martin, 2002). Statistical differences between bacterial biodiversity, richness, and evenness were assessed with an unpaired t-test using PRISM 6 (Graphpad Software). The results regarding growth performance, gut morphology, gene expression, SCFA profile, and bacterial genera were analyzed by single-factor ANOVA using the general linear model procedure of the SPSS software (IBM SPSS Statistics 21) with the dietary treatment as a variable. Significant differences between treatment means were determined by Tukey's multiple range test. Significance was based on P < 0.05. RESULTS Growth Performance and Nutrient Digestibility Mortality was low for all treatments. The initial BW and feed intake until day 11 did not differ between the dietary treatments (P > 0.05) (Table 3). The WB-containing treatments induced a higher BW on day 7 (P = 0.003) and on day 11 (P < 0.001), and increased BW gains until day 11 (P < 0.001) compared to the IN and the CON treatments. The beneficial effect of the WB-containing treatments on BW remained until day 35 (P < 0.001). Only the WB+IN treatment showed a lower FCR compared to the CON treatment, whereas the other treatments showed intermediate values (P = 0.011). No significant treatment effect on apparent digestibility of ME, ileal crude protein, or total tract N retention was observed (P > 0.05). However, the highest total tract digestibility of crude fat occurred in the WB treatment, which was higher compared to the CON treatment, with the IN and the WB+IN treatments showing intermediate values (P = 0.020). Table 3. Effect of inulin and wheat bran in the starter diets on the growth performance of broiler chickens from day 1 to day 11, final individual BW on day 35 and digestibility of feces and ileal content on day 10.   CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102    CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment and n = 33–38 for final BW on day 35. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Table 3. Effect of inulin and wheat bran in the starter diets on the growth performance of broiler chickens from day 1 to day 11, final individual BW on day 35 and digestibility of feces and ileal content on day 10.   CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102    CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment and n = 33–38 for final BW on day 35. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Gut Morphology In the jejunum, the WB+IN treatment increased villus height compared to the IN and the CON treatments, with the WB treatment showing intermediate values (P = 0.001) (Table 4). The ileal villus height in the WB+IN treatment was higher compared to the other 3 treatments (P < 0.001). No difference in crypt depth was observed in the jejunum or ileum (P > 0.05). The dietary treatments were found not to affect the villus height/crypth depth (V/C) ratio in the ileum (P = 0.156), but the WB+IN treatment showed the highest V/C ratio in the jejunum compared to the IN and the CON treatments, whereas the WB treatment gave intermediate values (P = 0.035). Table 4. Effect of inulin and wheat bran in the starter diets on the villus height (μm), crypt depth (μm), and the ratio villus height/crypt depth (V/C ratio) in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156    CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, 6 chicks per treatment and 15 units per chick. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Table 4. Effect of inulin and wheat bran in the starter diets on the villus height (μm), crypt depth (μm), and the ratio villus height/crypt depth (V/C ratio) in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156    CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, 6 chicks per treatment and 15 units per chick. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Gene Expression The expressions of Mucin 2, Occludin, and Claudin-1, as shown in Table 5, were not affected by the dietary treatments (P > 0.05). Table 5. Effect of inulin and wheat bran in the starter diets on the relative abundance (arbitrary units) of gene expression in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217    CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. View Large Table 5. Effect of inulin and wheat bran in the starter diets on the relative abundance (arbitrary units) of gene expression in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217    CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. View Large SCFA Analysis The concentration of acetate was higher in the CON treatment compared to the IN treatment, with the WB and the WB+IN treatments showing intermediate values (P = 0.040) (Table 6). The IN treatment was found to increase the concentration (P = 0.003) and molar ratio (P = 0.004) of iso-butyrate compared to the WB+IN and the CON treatments, whereas WB showed intermediate values. No differences between dietary treatments were shown for the concentration of total SCFA, propionate, butyrate, or iso-valerate, or for the molar ratio of acetate, propionate, butyrate, or iso-valerate (P > 0.05). Valerate was not detectible in these samples. Table 6. Effect of inulin and wheat bran in the starter diets on the SCFA profile in the cecal content of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410    CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). SCFA, short-chain fatty acid. View Large Table 6. Effect of inulin and wheat bran in the starter diets on the SCFA profile in the cecal content of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410    CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). SCFA, short-chain fatty acid. View Large 16S rDNA High-Throughput Sequencing A total of 24 DNA samples of cecal content were used in 16S rDNA high-throughput sequencing. After removing chimeric sequences, 103,817 high-quality sequences were selected to generate Operational Taxonomic Units (OTUs) with a 97% sequence similarity across 22 samples (1 sample of IN treatment and 1 sample of WB treatment were marked as outliers and were removed). The OTU table was filtered, leaving 10,080 OTUs for subsequent analysis. The differences within the intestinal microbial population between treatments were visualized by non-metric dimensional scaling built upon a Bray-Curtis distance matrix, based on the species taxonomic level (Figure 1a). A distinct cluster was observed in the chicks receiving the IN and the WB+IN diets compared to those receiving the WB and the CON diets, and this was confirmed by analysis of molecular variance of the distance matrix (P < 0.05). Alpha-diversity showed a slightly lower bacterial diversity, bacterial richness, and bacterial evenness in the WB+IN treatment, but none of these effects reached significance (Figure 1b). At the phylum level (Figure 1c), most of the bacteria were found to belong to Firmicutes, followed by Proteobacteria, Tenericutes, and Bacteroidetes, but we did not observe any shift between phyla. Genera that were each represented by >0.05% of total sequences in at least 1 of the 22 samples were used for further statistical comparison (Figure 1d and Table 7). The 4 predominant genera were vadin BB60_ unclassified, Ruminococcaceae_ unclassified, Lachnospiraceae_ unclassified, and Blautia. For the Firmicutes phylum, Vadin BB60_ unclassified was the most predominant genus and its relative abundance was highest in the WB+IN treatment (P = 0.015), but Flavonifractor, Defluviitaleaceae_unclassified, Anaerotruncus, Intestinimonas, and Clostridia_unclassified showed a lower relative abundance in the WB+IN treatment compared to the CON treatment (P < 0.05). The same differences occurred in the WB treatment compared to the CON treatment, except for Flavonifractor, Anaerotruncus, and Defluviitaleaceae_unclassified (P < 0.05). Furthermore, the relative abundance of Faecalibacterium and Anaerostipes was higher and the relative abundance of Flavonifractor, Intestinimonas, and Clostridia_unclassified were lower in the IN treatment compared to the CON treatment (P < 0.05). In the Proteobacteria phylum, only the relative abundance of Escherichia-Shigella was significant, showing a higher value in the WB+IN treatment compared to the WB and the CON treatments (P = 0.031). Figure 1. View largeDownload slide Spatial ordination, bacterial diversity, and taxonomical distribution deduced by 16S profiling CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. (a) Non-metric dimensional scaling (NMDS, 3 axes) showing standard deviation, CON treatment in black, IN treatment in red, WB treatment in green, and WB+IN treatment in blue. (b) Bacterial diversity (Inverse Simpson Biodiversity Index), bacterial richness (Chao1 Richness Index), and bacterial evenness (deduced from Simpson Index). (c) and (d) Mean phylotype distribution (phylum (c) and genus (d) levels) expressed as mean cumulative relative abundance in the cecal content of chicks on day 11. Figure 1. View largeDownload slide Spatial ordination, bacterial diversity, and taxonomical distribution deduced by 16S profiling CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. (a) Non-metric dimensional scaling (NMDS, 3 axes) showing standard deviation, CON treatment in black, IN treatment in red, WB treatment in green, and WB+IN treatment in blue. (b) Bacterial diversity (Inverse Simpson Biodiversity Index), bacterial richness (Chao1 Richness Index), and bacterial evenness (deduced from Simpson Index). (c) and (d) Mean phylotype distribution (phylum (c) and genus (d) levels) expressed as mean cumulative relative abundance in the cecal content of chicks on day 11. Table 7. Bacterial genera that accounted for >0.05% of the total sequences in at least 1 of the 22 samples in the cecal content of chicks on day 11 (abundance of the phylum and genera was expressed as %). Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 5 to 6 per treatment, where 1 IN sample and 1 WB sample have been canceled entirely. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Table 7. Bacterial genera that accounted for >0.05% of the total sequences in at least 1 of the 22 samples in the cecal content of chicks on day 11 (abundance of the phylum and genera was expressed as %). Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 5 to 6 per treatment, where 1 IN sample and 1 WB sample have been canceled entirely. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large DISCUSSION The objective of the present study was to investigate whether inulin and wheat bran provided either separately or in combination during the starter period exert prebiotic effects, have an impact on growth performance, on fermentation in the ceca, or on the morphology and the intestinal barrier function of the small intestine. Our study showed that the presence of 2% inulin in the starter diet did not improve the growth performance of broiler chickens, and this finding is in agreement with those of other studies (Biggs et al., 2007; Rehman et al., 2008; Alzueta et al., 2010; Świątkiewicz et al., 2011). However, Rebolé et al. (2010) and Nabizadeh (2012) reported a beneficial effect of inulin (0.5 to 1%) in the broiler diet on BW gain. On the other hand, in the present study, the inclusion of 10% wheat bran was found to improve BW on day 7 and on day 11, and to increase BW gain until day 11. The use of high amounts of wheat bran (18.7 and 37.5%) from day 12 onwards has been shown to increase BW and daily BW gain of broilers of 7 wk of age (Jørgensen et al., 1996). A similar beneficial effect on BW has been shown to occur in laying pullets from 10 to 16 wk with 15% wheat bran in the diet (Martínez et al., 2015). In the present study, the addition of wheat bran to the diet increased total tract fat digestibility, which might have been partly responsible for the improved growth in the starter period. The improved BW found here, as a result of the WB and WB+IN treatments, remained until day 35. Whether the effect of wheat bran on the intestinal physiology provides a lasting result needs to be further investigated. Given that the WB+IN treatment resulted in the most beneficial BW, concomitant with the lowest FCR, we can deduce that the combination of inulin and wheat bran in the starter diet may have had a synergistic effect. We can also hypothesize that these combined ingredients played a particular role on the gut morphology of the chicks, increasing villus height and its ratio, both in the jejunum and ileum. Interestingly, the inclusion of wheat bran alone in the diet did not influence the gut morphology results. In that regard, our results are similar to those of Chen et al. (2013), who found no effect on gut morphology when 10% wheat bran was added to the diet of pigs. Along similar lines, Jenab and Thompson (2000) reported no difference in the crypt depth of the colon tissue in rats, as a result of the same dietary addition. Inversely, in the present study, inulin tended to decrease jejunal villus height and V/C ratio, which is surprising, as several studies have shown an improved intestinal mucosal architecture as a result of adding this prebiotic to broiler chicken diets (Rehman et al., 2007; Rebolé et al., 2010; Nabizadeh, 2012). It is possible that, in our case, the inclusion level of 2% inulin might have been too high for these young chicks. An experiment conducted by Xu et al. (2003), examining the effects of fructooligosaccharides (FOS) in the diet of broiler chickens, reported that feeding 0.8% FOS slightly decreased villus height and the V/C ratio in the animals’ jejunum and ileum, in comparison with feeding 0.2% and 0.4% FOS. Some studies in pigs, humans, and mice have suggested that the addition of either inulin or wheat bran might alter some of the tight junction or mucus proteins affecting the epithelial barrier function (Neyrinck et al., 2012; Chen et al., 2013; Chen et al., 2017; Wu et al., 2017). However, in our study, no differences between treatments were revealed for the gene expressions of Mucin 2, Occludin, or Claudin-1 in the jejunum or ileum. In agreement with our finding, the expression of Mucin 2 or Occludin in the colon of mice after a high fat diet was found not to be affected by feeding wheat-derived AXOS (Neyrinck et al., 2012). Moreover, Chen et al. (2013) observed no alteration in the Claudin-1 mRNA level in the ileum and colon of weaned pigs, following wheat bran supplementation. Furthermore, Wu et al. (2017) failed to detect, via cell culture, any effect of inulin on the gene or protein expression of Claudin-1 in human intestinal organoids. Our study did not reveal a strong effect of either inulin or wheat bran on the SCFA or microbiota profile. Only an alteration in the levels of acetate and iso-butyrate was observed in the ceca. The lack of a greater impact on the SCFA profile might be explained by one or more of the following: 1) the possible occurrence of fermentation earlier in the gastrointestinal tract; 2) the fact that a relatively poor fermentation process occurs at this young age (Amit-Romach et al., 2004); 3) the fact that SCFAs are immediately absorbed by the host or are otherwise utilized by other bacteria (Topping and Clifton, 2001; Duncan et al., 2004a, 2004b; Louis et al., 2007); or 4) the possibility that a different amount of digesta was present in the ceca, affecting the absolute amount of SCFA rather than the concentration. All these possible explanations mean that differences in SCFA profile can be difficult to interpret. The SCFA profile found in the present study, i.e., showing the highest levels of acetate, followed by butyrate, and propionate, is in accordance with the studies of Jørgensen et al. (1996), Rehman et al. (2008), and Rebolé et al. (2010). With regard to the results found for the gut microbiota in the present study, 4 major phyla (Firmicutes, Proteobacteria, Tenericutes, and Bacteroidetes) were predominant in the ceca and the relative abundance of Firmicutes was more than 90%, which is consistent with other studies (Corrigan et al., 2015; Pourabedin and Zhao, 2015; Awad et al., 2016). Amit-Romach et al. (2004) found that chicken intestinal microbiota started to colonize at between day 2 and day 4 post-hatch, but could take 14 to 30 d to fully develop in the ceca. Awad et al. (2016) reported that Proteobacteria was significantly more present in chicks during the first days of life and decreased thereafter, whereas Firmicutes was the predominant phylum from the second week onwards. In our study, this situation had already occurred by day 11 and in the study of Corrigan et al. (2015) by day 7. In the present study, a distinct cluster was found in the inulin-containing treatments compared to the WB and the CON treatments. It seemed that, compared to wheat bran, inulin in the diet had a greater ability to influence the microbiota profile. We found that vadinBB60 was the predominant genus in the WB+IN treatment, followed by the WB and the CON treatments, whereas the IN treatment showed the lowest abundance. This finding of a lower abundance of vadinBB60 unclassified induced by inulin is in agreement with the results of a study of the effect of inulin in mice (Neyrinck et al., 2016). However, so far, the reason why the combination of inulin and wheat bran would have increased the abundance of this genus remains unclear. Most of the significant bacteria found (i.e., Flavonifractor, Faecalibacterium, Intestinimonas, and Anaerostipes) have been shown to be related to butyrate production (Schoefer et al., 2003; Sokol et al., 2008; Eeckhaut et al., 2010; Kläring et al., 2013; Van-den-Abbeele et al., 2013). In the present study, inulin was found to increase the relative abundance of Faecalibacterium and Anaerostipes in comparison with the other 3 alternative treatments used here. Studies in humans (Ramirez-Farias et al., 2008; Dewulf et al., 2012; Claus, 2017) have demonstrated that inulin exhibited a significant increase in Anaerostipes and Faecalibacterium. To our knowledge, our study is the first report on chickens to provide findings in line with these results. In the present study, the abundance of Escherichia-Shigella, which was found to be the most abundant genus of the Proteobacteria, increased as a result of the WB+IN treatment. Interestingly, this genus has previously been found to be highly abundant in the feces of low FCR birds compared to high FCR birds (Singh et al., 2012). As the WB+IN treatment also had the lowest FCR, in the present study, our results are in line with these findings of Singh et al. (2012). In conclusion, in this study, for both inulin and wheat bran, similar microbiota changes were observed as in other studies on human or animal, but inulin had a greater ability to shape the microbiota profile. However, the inclusion of 2% inulin in the starter diet might have been too high for these young chicks to positively affect performance, as demonstrated by the BW and gut morphology results. In contrast, wheat bran alone and the combination of wheat bran and inulin as an ingredient of the starter diet for broiler chicks could ameliorate growth performance and/or gut morphology during this early period, possibly without requiring any specific measurable positive effect on the intestinal barrier. The beneficial results for the combined diet on BW, FCR, and gut morphology during the starter period suggested a synergistic effect of inulin and wheat bran. In addition, the greater BW of wheat bran alone or in combination with inulin was found to last for a couple of weeks after several weeks after termination of the supplementation, which suggests a long-term effect that deserves further investigation. ACKNOWLEDGEMENTS We thank the GIGA of the University of Liège for the gut morphological analysis, and COSUCRA for the provision of inulin. This study was supported by the Welcome Grant received by Nadia Everaert of the University of Liège. It was also partially supported by the China Scholarship Council (CSC). Footnotes 1The nucleotide sequence data reported in this paper have been submitted to National Center for Biotechnology Information (NCBI) nucleotide sequence database and have been assigned the accession number PRJNA419868. REFERENCES Alzueta C., Rodriguez M. L., Ortiz L. T., Rebole A., Trevino J.. 2010. Effects of inulin on growth performance, nutrient digestibility and metabolisable energy in broiler chickens. Br. Poult. Sci.  51: 393– 398. Google Scholar CrossRef Search ADS PubMed  Amit-Romach E., Sklan D., Uni Z.. 2004. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult. Sci.  83: 1093– 1098. Google Scholar CrossRef Search ADS PubMed  AOAC. 1990. Official Methods of Analysis . Association Official Analytical Chemists, Arlington. Awad W. A., Mann E., Dzieciol M., Hess C., Schmitz-Esser S., Wagner M., Hess M.. 2016. Age-related differences in the luminal and mucosa-associated gut microbiome of broiler chickens and shifts associated with Campylobacter jejuni infection. Front. Cell. Infect. Microbiol.  6: 154. Google Scholar CrossRef Search ADS PubMed  Biggs P., Parsons C. M., Fahey G. C.. 2007. The effects of several oligosaccharides on growth performance, nutrient digestibilities, and cecal microbial populations in young chicks. Poult. Sci.  86: 2327– 2336. Google Scholar CrossRef Search ADS PubMed  Bindels L. B., Neyrinck A. M., Salazar N., Taminiau B., Druart C., Muccioli G. G., François E., Blecker C., Richel A., Daube G., Mahillon J.. 2015. Non digestible oligosaccharides modulate the gut microbiota to control the development of leukemia and associated cachexia in mice. PLoS One  10: 0131009. Google Scholar CrossRef Search ADS   Broekaert W. F., Courtin C. M., Verbeke K., Van de Wiele T., Verstraete W., Delcour J. A.. 2011. Prebiotic and other health-related effects of cereal-derived arabinoxylans, arabinoxylan-oligosaccharides, and xylooligosaccharides. Crit. Rev. Food Sci. Nutr.  51: 178– 194. Google Scholar CrossRef Search ADS PubMed  Chen H., Mao X., He J., Yu B., Huang Z., Yu J., Zheng P., Chen D.. 2013. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Br. J. Nutr.  110: 1837– 1848. Google Scholar CrossRef Search ADS PubMed  Chen K., Chen H., Faas M. M., Haan B. J., Li J., Xiao P., Zhang H., Diana J., Vos P., Sun J.. 2017. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis. Mol. Nutr. Food Res.  61: 1601006. Google Scholar CrossRef Search ADS   Claus S. P. 2017. Inulin prebiotic: is it all about bifidobacteria? Gut . 66: 1883– 1884. Google Scholar CrossRef Search ADS PubMed  Corrigan A., de Leeuw M., Penaud-Frézet S., Dimova D., Murphy R. A.. 2015. Phylogenetic and functional alterations in bacterial community compositions in broiler ceca as a result of mannan oligosaccharide supplementation. Appl. Environ. Microbiol.  81: 3460– 3470. Google Scholar CrossRef Search ADS PubMed  Courtin C. M., Swennen K., Broekaert W. F., Swennen Q., Buyse J., Decuypere E., Michiels C. W., Ketelaere B. D., Delcour J. A.. 2008. Effects of dietary inclusion of xylooligo- saccharides, arabinoxylooligosaccha- rides and soluble arabinoxylan on the microbial composition of caecal contents of chickens. J. Sci. Food Agric.  88: 2517– 2522. Google Scholar CrossRef Search ADS   De Paepe K., Kerckhof F. M., Verspreet J., Courtin C. M., Van de Wiele T.. 2017. Inter-individual differences determine the outcome of wheat bran colonization by the human gut microbiome. Environ. Microbiol.  19: 3251– 3267 Google Scholar CrossRef Search ADS PubMed  Dewulf E. M., Cani P. D., Claus S. P., Fuentes S., Puylaert P. G., Neyrinck A. M., Bindels L. B., de Vos W. M., Gibson G. R., Thissen J. P., Delzenne N. M.. 2013. Insight into the prebiotic concept: lessons from an exploratory, double blind intervention study with inulin-type fructans in obese women. Gut . 62: 1112– 1121. Google Scholar CrossRef Search ADS PubMed  Duncan S. H., Holtrop G., Lobley G. E., Calder A. G., Stewart C. S., Flint H. J.. 2004a. Contribution of acetate to butyrate formation by human faecal bacteria. Br. J. Nutr.  91: 915– 923. Google Scholar CrossRef Search ADS   Duncan S. H., Louis P., Flint H. J.. 2004b. Lactate-utilizing bacteria, isolated from human feces, that produce butyrate as a major fermentation product. Appl. Environ. Microbiol.  70: 5810– 5817. Google Scholar CrossRef Search ADS   Edwards C. A., Parrett A. M.. 2002. Intestinal flora during the first months of life: new perspectives. Br. J. Nutr.  88: 11– 18. Google Scholar CrossRef Search ADS PubMed  Edwards C. A., Parrett A. M.. 2003. Dietary fibre in infancy and childhood. Proc. Nutr. Soc.  62: 17– 23. Google Scholar CrossRef Search ADS PubMed  Eeckhaut V., Van Immerseel F., Pasmans F., De Brandt E., Haesebrouck F., Ducatelle R., Vandamme P.. 2010. Anaerostipes butyraticus sp. nov., an anaerobic, butyrate-producing bacterium from Clostridium cluster XIVa isolated from broiler chicken caecal content, and emended description of the genus Anaerostipes. Int. J. Syst. Evol. Microbiol.  60: 1108– 1112 Google Scholar CrossRef Search ADS PubMed  Gibson G. R., Probert H. M., Van Loo J., Rastall R. A., Roberfroid M. B.. 2004. Dietary modulation of the human colonic microbiota: updating the concept of prebiotics. Nutr. Res. Rev.  17: 259– 275. Google Scholar CrossRef Search ADS PubMed  Gibson G. R., Hutkins R., Sanders M. E., Prescott S. L., Reimer R. A., Salminen S. J., Scott K., Stanton C., Swanson K. S., Cani P. D., Verbeke K.. 2017. Expert consensus document: The international scientific association for probiotics and prebiotics (ISAPP) consensus statement on the definition and scope of prebiotics. Nat. Rev. Gastroenterol. Hepatol.  14: 491– 502. Google Scholar PubMed  Hosseini E., Grootaert C., Verstraete W., Van de Wiele T.. 2011. Propionate as a health-promoting microbial metabolite in the human gut. Nutr. Rev.  69: 245– 258. Google Scholar CrossRef Search ADS PubMed  Jenab M., Thompson L. U.. 2000. Phytic acid in wheat bran affects colon morphology, cell differentiation and apoptosis. Carcinogenesis . 21: 1547– 1552. Google Scholar CrossRef Search ADS PubMed  Jørgensen H., Zhao X. Q., Knudsen K. E. B., Eggum B. O.. 1996. The influence of dietary fibre source and level on the development of the gastrointestinal tract, digestibility and energy metabolism in broiler chickens. Br. J. Nutr . 75: 379– 395. Google Scholar CrossRef Search ADS PubMed  Kläring K., Hanske L., Bui N., Charrier C., Blaut M., Haller D., Plugge C. M., Clavel T.. 2013. Intestinimonas butyriciproducens gen. nov., sp. nov., a butyrate-producing bacterium from the mouse intestine. Int. J. Syst. Evol. Microbiol.  63: 4606– 4612. Google Scholar CrossRef Search ADS PubMed  Louis P., Scott K. P., Duncan S. H., Flint H. J.. 2007. Understanding the effects of diet on bacterial metabolism in the large intestine. J. Appl. Microbiol.  102: 1197– 1208. Google Scholar CrossRef Search ADS PubMed  Martin A. P. 2002. Phylogenetic approaches for describing and comparing the diversity of microbial communities. Appl. Environ. Microbiol.  68: 3673– 3682 Google Scholar CrossRef Search ADS PubMed  Martínez Y., Carrión Y., Rodríguez R., Valdivié M., Olmo C., Betancur C., Liu G., Al-Dhabi N. A., Duraipandiyan V.. 2015. Growth performance, organ weights and some blood parameters of replacement laying pullets fed with increasing levels of wheat bran. Rev. Bras. Cienc. Avic.  17: 347– 354. Google Scholar CrossRef Search ADS   Myers W. D., Ludden P. A., Nayigihugu V., Hess B. W.. 2004. Technical Note: A procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci.  82: 179– 183. Google Scholar CrossRef Search ADS PubMed  Nabizadeh A. 2012. The effect of inulin on broiler chicken intestinal microflora, gut morphology, and performance. J. Anim. Feed Sci.  21: 725– 734. Google Scholar CrossRef Search ADS   Neyrinck A. M., Delzenne N. M.. 2010. Potential interest of gut microbial changes induced by non-digestible carbohydrates of wheat in the management of obesity and related disorders. Curr. Opin. Clin. Nutr. Metab. Care  13: 722– 728. Google Scholar CrossRef Search ADS PubMed  Neyrinck A. M., Pachikian B., Taminiau B., Daube G., Frédérick R., Cani P. D., L. B., Bindels, Delzenne N. M.. 2016. Intestinal sucrase as a novel target contributing to the regulation of glycemia by prebiotics. PLoS One  11: 0160488. Google Scholar CrossRef Search ADS   Neyrinck A. M., Van Hée V. F., Piront N., De Backer F., Toussaint O., Cani P. D., Delzenne N. M.. 2012. Wheat-derived arabinoxylan oligosaccharides with prebiotic effect increase satietogenic gut peptides and reduce metabolic endotoxemia in diet-induced obese mice. Nutr. Diabetes  2: e28– e28. Google Scholar CrossRef Search ADS PubMed  Pourabedin M., Zhao X.. 2015. Prebiotics and gut microbiota in chickens. FEMS. Microbiol. Lett . 15: 362 Ramirez-Farias C., Slezak K., Fuller Z., Duncan A., Holtrop G., Louis P.. 2008. Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii. Br. J. Nutr . 101: 541– 550. Google Scholar PubMed  Rebolé A., Ortiz L. T., Rodríguez M., Alzueta C., Treviño J., Velasco S.. 2010. Effects of inulin and enzyme complex, individually or in combination, on growth performance, intestinal microflora, cecal fermentation characteristics, and jejunal histomorphology in broiler chickens fed a wheat- and barley-based diet. Poult. Sci.  89: 276– 286. Google Scholar CrossRef Search ADS PubMed  Rehman H., Hellweg P., Taras D., Zentek J.. 2008. Effects of dietary inulin on the intestinal short chain fatty acids and microbial ecology in broiler chickens as revealed by denaturing gradient gel electrophoresis. Poult. Sci.  87: 783– 789. Google Scholar CrossRef Search ADS PubMed  Rehman H., Rosenkranz C., Böhm J., Zentek J.. 2007. Dietary inulin affects the morphology but not the sodium-dependent glucose and glutamine transport in the jejunum of broilers. Poult. Sci.  86: 118– 122. Google Scholar CrossRef Search ADS PubMed  Scheppach W. 1994. Effects of short chain fatty acids on gut morphology and function. Gut . 35: S35– S38. Google Scholar CrossRef Search ADS PubMed  Schoefer L., Mohan R., Schwiertz A., Braune A., Blaut M.. 2003. Anaerobic degradation of flavonoids by Clostridium orbiscindens. Appl. Environ. Microbiol.  69: 5849– 5854. Google Scholar CrossRef Search ADS PubMed  Singh K. M., Shah T., Deshpande S., Jakhesara S. J., Koringa P. G., Rank D. N., Joshi C. G.. 2012. High through put 16S rRNA gene-based pyrosequencing analysis of the fecal microbiota of high FCR and low FCR broiler growers. Mol. Biol. Rep . 39: 10595– 10602. Google Scholar CrossRef Search ADS PubMed  Sokol H., Pigneur B., Watterlot L., Lakhdari O., Bermúdez-Humarán L. G., Gratadoux J. J., Blugeon S., Bridonneau C., Furet J. P., Corthier G., Grangette C.. 2008. Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proc. Natl. Acad. Sci. USA . 105: 16731– 16736. Google Scholar CrossRef Search ADS   Świątkiewicz S., Koreleski J., Arczewska-Włosek A.. 2011. Effect of inulin and oligofructose on performance and bone characteristics of broiler chickens fed on diets with different concentrations of calcium and phosphorus. Br. Poult. Sci.  52: 483– 491. Google Scholar CrossRef Search ADS PubMed  Thompson C. L., Wang B., Holmes A. J.. 2008. The immediate environment during postnatal development has long-term impact on gut community structure in pigs. ISME J.  2: 739– 748. Google Scholar CrossRef Search ADS PubMed  Topping D. L., Clifton P. M.. 2001. Short-chain fatty acids and human colonic function: roles of resistant starch and nonstarch polysaccharides. Physiol. Rev.  81: 1031– 1064. Google Scholar CrossRef Search ADS PubMed  Van den Abbeele P., Belzer C., Goossens M., Kleerebezem M., De Vos W. M., Thas O., De Weirdt R., Kerckhof F. M., Van de Wiele T.. 2013. Butyrate-producing Clostridium cluster XIVa species specifically colonize mucins in an in vitro gut model. ISME J.  7: 949– 961. Google Scholar CrossRef Search ADS PubMed  Wu R. Y., Abdullah M., Määttänen P., Pilar A. V. C., Scruten E., Johnson-Henry K. C., Napper S., O’Brien C., Jones N. L., Sherman P. M.. 2017. Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function. Sci. Rep.  7: 40820. Google Scholar CrossRef Search ADS PubMed  Xu Z. R., Hu C. H., Xia M. S., Zhan X. A., Wang M. Q.. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci.  82: 1030– 1036. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices) http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Poultry Science Oxford University Press

The effect of inulin and wheat bran on intestinal health and microbiota in the early life of broiler chickens

Loading next page...
 
/lp/ou_press/the-effect-of-inulin-and-wheat-bran-on-intestinal-health-and-VwbU6Of0se
Publisher
Oxford University Press
Copyright
© 2018 Poultry Science Association Inc.
ISSN
0032-5791
eISSN
1525-3171
D.O.I.
10.3382/ps/pey195
Publisher site
See Article on Publisher Site

Abstract

ABSTRACT Inulin and wheat bran were added to the starter diets of broiler chickens to investigate the potential of these ingredients to improve the host's health and growth performance, as well as the underlying mechanisms of their effects. A total of 960 1-day-old chicks were assigned to 4 treatments: control (CON), 2% inulin (IN), 10% wheat bran (WB), and 10% wheat bran +2% inulin (WB+IN). On day 11, 6 chicks per treatment were euthanized. A general linear model procedure with Tukey's multiple range test was performed to compare a series of parameters between treatments. The WB-containing treatments improved BW on day 7, day 11, day 35, and BW gain until day 11 (P < 0.05), but only the WB+IN treatment showed a lower feed conversion ratio than the CON treatment (P = 0.011). Furthermore, the WB+IN treatment showed the highest villus height in the jejunum and ileum (P < 0.05), and the highest jejunal ratio villus height/crypt depth (P = 0.035). The concentration of acetate in the ceca was higher in the CON treatment compared to the IN treatment (P = 0.040). The IN treatment increased the concentration (P = 0.003) and ratio (P = 0.004) of iso-butyrate compared to the WB+IN and the CON treatments (P < 0.05). A clustering result exhibited similar intestinal microbiota profiles in the chicks receiving the IN and the WB+IN diets (P > 0.05), but these profiles were different from those found in chicks receiving the WB and the CON diets (P < 0.05). In conclusion, wheat bran and the combination of wheat bran and inulin ameliorated the growth performance and gut morphology of the starter chicks, which resulted in a higher BW until day 35. Inulin, on the other hand, had a greater ability to influence the microbiota profile. The beneficial results found in relation to BW and gut morphology during the starter period suggested a synergistic effect of inulin and wheat bran. INTRODUCTION Inulin, a heterogeneous blend of fructose polymers, extracted from chicory roots, is a widely recognized prebiotic. It is the only one to date that was awarded an EU health claim on improving bowel function (Gibson et al., 2017). Wheat bran is a byproduct of the wheat milling process and specific components of wheat bran, such as arabinoxylans, have been shown to display prebiotic effects (Neyrinck and Delzenne, 2010; Broekaert et al., 2011). In poultry, inulin and wheat bran enhance the abundance of Bifidobacterium and Lactobacillus, thus improving the host's microbial balance (Courtin et al., 2008; Rebolé et al., 2010; Nabizadeh, 2012). As per definition of prebiotics, inulin and wheat bran serve as a substrate for short-chain fatty acids (SCFA) synthesis by different types of bacteria, generating increased amounts of propionate and butyrate (Gibson et al., 2004; De Paepe et al., 2017). These trophic substances have been shown to ameliorate the development of gut morphology (Scheppach, 1994; Hosseini et al., 2011). Furthermore, inulin and wheat bran can also improve the intestinal barrier, protecting the host against pathogens (Neyrinck et al., 2012; Chen et al., 2013; Chen et al., 2017; Wu et al., 2017). Since the initial stage of microbiota colonization in the intestine starts immediately from birth or hatch, it is important to establish a beneficial microbial community as soon as possible to have a long-lasting positive effect on intestinal health (Edwards and Parrett, 2002, 2003; Amit-Romach et al., 2004; Thompson et al., 2008). With this in mind, one strategy gaining increasing attention is to attempt to modulate the colonization of microbiota in early life. In poultry, effect of a temporary supplementation of prebiotics early in life is poorly investigated. Indeed, the standard strategy of using prebiotics or feed additives is to provide these ingredients during the entire rearing period, or from the growing period onwards (Jørgensen et al., 1996; Rebolé et al., 2010; Nabizadeh, 2012). Therefore, in this study, a supplementation of inulin and wheat bran separately or in combination, limited to the starter period, was applied to investigate whether these ingredients would impact the cecal microbiota and intestinal health at this young age and if the potential changes would last later over the growing period and improve global performances, providing a guidance to further research on the long-term effect of these ingredients. MATERIALS AND METHODS Ethics Statement The present animal experiment was approved by the Ethical Committee of Liège University (Ethical protocol 1703, Belgium) and was performed at the facilities of Gembloux Agro-Bio Tech (Gembloux, Belgium). Experimental Design, Broilers, and Diets A total of 960 1-day-old male Ross 308 broiler chicks (Belgabroed, Merksplas, Belgium) were housed in 24 floor pens (3 m × 1 m), each containing 40 birds. Wood shavings were used as bedding material. Pens (n = 6) were randomly assigned to 1 of the following 4 groups: 1) IN (2% inulin diet); 2) WB (10% wheat bran diet); 3) WB+IN (10% wheat bran+2% inulin diet); 4) CON (control diet without inulin or wheat bran). Inulin was provided by COSUCRA (Warcoing, Belgium), and is composed of linear chains of fructose units with 1 terminal glucose unit with a degree of polymerization ranging from 2 to 60 and with average polymerization of about 10. Wheat bran was provided by Bauwens sprl (Sombreffe, Belgium). Nutrient levels of the diets (Table 1) were based on Aviagen guidelines (2014) for Ross 308 broilers recommendations and were iso-energetic and iso-nitrogenous between treatments. Birds had free access to water and feed throughout the whole experiment. The environmental temperature during the first 3 d of life was 34°C, and was reduced progressively to 25°C until day 11. The lighting program consisted of 23 h of light and 1 h of darkness per day during the first week and 18 h of light and 6 h of darkness thereafter. Table 1. Composition and nutrient content of the starter diet. %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. 1Providing per kilogram of complete feed: vitamin A (retinyl acetate) 13,500 IU, vitamin D3 3,000 IU, vitamin E (dl-alpha-tocopheryl acetate) 55 IU, vitamin E (dl-alpha-tocopherol) 55 IU, vitamin B1/thiamine 1.6 mg, vitamin B1 2 mg, vitamin B2 5 mg, vitamin B3 15 mg, vitamin B5 30 mg, vitamin B6 4 mg, vitamin B9 1 mg, vitamin B12 25 mg, vitamin K3 5 mg, iron 100 mg, copper 36 mg, zinc 120 mg, iodine 2.4 mg, selenium 0.7 mg, manganese 192 mg. ADF, acid detergent fiber; NDF, neutral detergent fiber. View Large Table 1. Composition and nutrient content of the starter diet. %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  %  CON  IN  WB  WB+IN  Corn  50.50  50.50  27.75  20.31  Soybean meal 49  19.62  22.69  24.34  26.46  Soybean oil  2.96  4.78  6.50  7.00  Corn starch  6.97  4.10  17.70  21.76  Extruded soybean  15.00  11.00  9.21  7.89  Inulin  0  2.00  0  2.00  Wheat bran  0  0  10.00  10.00  Salt  0.15  0.15  0.15  0.15  Cellulose  0.40  0.41  0  0.09  Monocalcium phosphate  1.54  1.55  1.58  1.61  Limestone  1.46  1.46  1.41  1.39  1Vit:Min 0.1%  0.10  0.10  0.10  0.10  L-Lysine HCl  0.52  0.51  0.49  0.46  DL-Methionine  0.48  0.47  0.49  0.50  L-Threonine  0.27  0.26  0.27  0.27  Tryptophan  0.03  0.02  0.01  0.01            Nutrient composition (analyzed, %)          Crude protein  22.06  21.41  21.16  21.17  Crude fat  9.67  10.83  11.76  11.03  NDF  11.91  12.44  11.06  10.59  ADF  4.59  4.73  4.38  4.10  ME, kcal/kg  3088  3258  3289  2907  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. 1Providing per kilogram of complete feed: vitamin A (retinyl acetate) 13,500 IU, vitamin D3 3,000 IU, vitamin E (dl-alpha-tocopheryl acetate) 55 IU, vitamin E (dl-alpha-tocopherol) 55 IU, vitamin B1/thiamine 1.6 mg, vitamin B1 2 mg, vitamin B2 5 mg, vitamin B3 15 mg, vitamin B5 30 mg, vitamin B6 4 mg, vitamin B9 1 mg, vitamin B12 25 mg, vitamin K3 5 mg, iron 100 mg, copper 36 mg, zinc 120 mg, iodine 2.4 mg, selenium 0.7 mg, manganese 192 mg. ADF, acid detergent fiber; NDF, neutral detergent fiber. View Large Growth Performance and Nutrient Digestibility The average BW per pen on day 0, day 7, day 11, and the feed intake per pen during the starter period were recorded in order to measure the BW gain and feed conversion ratio (FCR). From day 11 onwards, 39 reserving birds per treatment were reared until day 35 on a standard grower (day 11 to day 24) (CP: 19.95% and ME: 2,864 kcal/kg) and finisher (day 24 to day 35) (CP: 18.11% and ME: 3,215 kcal/kg) diet. Individual BW of these broilers was determined on day 35. On day 3, 6 chicks per pen were transferred to digestibility cages. They were fed their respective experimental diets with the addition of 0.5% titanium dioxide as an indigestible marker. Droppings were collected from day 8 to day 10 and pooled per cage by mixing equal daily amounts together. On day 10, all chicks from the digestibility cages were euthanized by electrical stunning followed by decapitation and ileal contents were collected by saline flushing. Individual samples were pooled per cage for subsequent analyses. Dietary content and freeze-dried fecal and ileal matter were ground to 1 mm and analyzed for their contents in dry matter after drying at 105°C for 24 h (method 967.03, AOAC, 1990). The nitrogen (N) content was analyzed by using the Kjeldahl method and calculating the crude protein content (N × 6.25, method 981.10, AOAC, 1990); crude fat content was determined using the Soxhlet method with diethyl ether (method 920.29; AOAC, 1990), and gross energy was calculated by means of an adiabatic oxygen bomb calorimeter (1241 Adiabatic Calorimeter, PARR Instrument Co., IL). TiO2 was measured as described by Myers et al. (2004), and the results were used to calculate nutrient digestibility as follows: digestibility or retention = 1–[(diet TiO2/digesta TiO2) × (digesta nutrient/diet nutrient)]. In addition, the diets were also analyzed for their content in neutral detergent fiber using thermostable amylase (Termamyl, Novo Nordisk, Bagsværd, Denmark) and in acid detergent fiber, both were corrected for ash (550°C for 8 h, method 923.03; AOAC, 1990). Sample Collection Within 5 min after euthanasia on day 11, the gastrointestinal tract was removed from 1 bird from each pen (n = 6). Cecal content was collected, snap-frozen in liquid nitrogen, and then stored at –80°C until further microbiota and SCFA analysis. Five-centimeter jejunal and ileal segments were taken and stored in 4% paraformaldehyde for gut morphology analysis. Another 5-cm segment from the jejunum and the ileum were snap-frozen in liquid nitrogen and stored at –80°C for gene expression analysis. Gut Morphology After 48 h of fixation in 4% paraformaldehyde, the samples were stored in 70% ethanol and processed through a series of dehydration, clearing, and impregnation with wax. Paraffin-embedded samples were sliced into 5-μm sections using a microtome, fixed onto slides, and stained with hematoxylin and eosin. Villus height and crypt depth were measured at 4 × magnification using an OLYMPUS BX51 microscope and imaging software (Olympus Corporation, Hamburg, Germany) in 15 well-oriented villi and associated crypts per animal. Gene Expression Total RNA was isolated from the sampled jejunum and ileum tissue using PureYield RNA Midiprep System (Promega, Madison), according to the manufacturer's instructions. The isolated RNA was tested for purity and quantity using a spectrophotometer (Thermo Scientific NanoDrop 2000). In addition, RNA integrity was verified by visualization of 18 and 28S ribosomal RNA bands stained with Midori Green from Nippon Genetics (Filter Service, Eupen, Belgium) after gel electrophoresis on a 1% agarose gel. Single-stranded cDNA was synthesized from 0.95 μg of total RNA using the PrimeScript RT Reagent Kit (Perfect Real Time) (Takara, Japan). Real-time PCR was performed in ABI StepOnePlus (Applied Biosystems), using the SYBR Premix EX Taq II (Tli RNaseH plus) kit (Takara, Japan). The following PCR reaction program was applied: 30 s heating at 95°C, followed by 40 cycles of denaturation (5 s at 95°C), annealing (30 s at 60°C), and extension (30 s at 72°C). Three reference genes ACTB (β-actin), B2M (β2-microglobulin), and EF1A1 (eukaryotic translation elongation factor 1 alpha 1) (Table 2) were selected for normalization purposes. A melting curve analysis was performed in order to check the specificity of the primers, and the standard curve was determined by using pooled samples to ensure an amplification efficiency of between 90 and 110%. The 2−ΔΔCt method was used automatically by the ABI StepOnePlus system to analyze Mucin 2, Occludin, and Claudin-1. Table 2. Primer information for quantitative RT-PCR assays. Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      View Large Table 2. Primer information for quantitative RT-PCR assays. Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      Gene  5′-primer-3′  GenBank Accession No.  Efficiency (%)  ACTB  F-CAACACAGTGCTGTCTGGTGGTA  X00182.1  101    R-ATCGTACTCCTGCTTGCTGATCC      B2M  F-GGCACGCCATCACTATC  Z48922  99    R-CCTGCATCTGCCCATTT      EF1A1  F-CGCCGTGCGGGTGTCGTTTC  NM_204,157.2  103    R-TTGCCGGAATCGACGTGGCC      Mucin 2  F-CACCAACGGCAACTGAAATAGTC  XM_421,035.2  101    R- GCCAAACCATGGGTAACTCACA      Occludin  F-TCATCGCCTCCATCGTCTAC  NM_205,128.1  100    R-TCTTACTGCGCGTCTTCTGG      Claudin-1  F-CTGATTGCTTCCAACCAG  NM_0,010,13611  107    R-CAGGTCAAACAGAGGTACAAG      View Large SCFA Analysis A mixture of cecal content and water 1:4 (wt/wt) was homogenized for 30 s and centrifuged at 13,000 g for 15 min. After centrifugation, 1 mL supernatant was collected and the pH was adjusted to 2–3 using 1 N H2SO4. The supernatant was filtered through a sterile acetate filter. Acetate, propionate, butyrate, valerate, iso-butyrate, and iso-valerate concentrations were analyzed by HPLC, using a Waters system fitted with an Aminex HPX-87H column (Bio-Rad, Hercules, CA) combined with a UV detector (210 nm), with sulfuric acid (5 mM) as the mobile phase at a flow rate of 0.6 mL/min. Gut Microbiota Analysis DNA extraction of the cecal content was performed using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's recommendations but adding a bead-beating step. PCR amplification of the V1-V3 region of the 16S rDNA and library preparation were performed with the following primers, forward (5′-GAGAGTTTGATYMTGGCTCAG-3′) and reverse (5′-ACCGCGGCTGCTGGCAC-3′). Sequencing was performed on an Illumina MiSeq platform, following Bindels et al. (2015). Statistical Analysis Ordination analysis and 3d plots were performed with Vegan, Vegan3d, and rgl packages in R. Non-metric dimensional scaling, based upon the Bray-Curtis dissimilarity matrix, was applied in order to visualize the biodiversity between the groups. Analysis of molecular variance test was performed to assess the diversity clustering of the Bray-Curtis matrix treatments using MOTHUR software (Martin, 2002). Statistical differences between bacterial biodiversity, richness, and evenness were assessed with an unpaired t-test using PRISM 6 (Graphpad Software). The results regarding growth performance, gut morphology, gene expression, SCFA profile, and bacterial genera were analyzed by single-factor ANOVA using the general linear model procedure of the SPSS software (IBM SPSS Statistics 21) with the dietary treatment as a variable. Significant differences between treatment means were determined by Tukey's multiple range test. Significance was based on P < 0.05. RESULTS Growth Performance and Nutrient Digestibility Mortality was low for all treatments. The initial BW and feed intake until day 11 did not differ between the dietary treatments (P > 0.05) (Table 3). The WB-containing treatments induced a higher BW on day 7 (P = 0.003) and on day 11 (P < 0.001), and increased BW gains until day 11 (P < 0.001) compared to the IN and the CON treatments. The beneficial effect of the WB-containing treatments on BW remained until day 35 (P < 0.001). Only the WB+IN treatment showed a lower FCR compared to the CON treatment, whereas the other treatments showed intermediate values (P = 0.011). No significant treatment effect on apparent digestibility of ME, ileal crude protein, or total tract N retention was observed (P > 0.05). However, the highest total tract digestibility of crude fat occurred in the WB treatment, which was higher compared to the CON treatment, with the IN and the WB+IN treatments showing intermediate values (P = 0.020). Table 3. Effect of inulin and wheat bran in the starter diets on the growth performance of broiler chickens from day 1 to day 11, final individual BW on day 35 and digestibility of feces and ileal content on day 10.   CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102    CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment and n = 33–38 for final BW on day 35. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Table 3. Effect of inulin and wheat bran in the starter diets on the growth performance of broiler chickens from day 1 to day 11, final individual BW on day 35 and digestibility of feces and ileal content on day 10.   CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102    CON  IN  WB  WB+IN  SEM  P  BW on day 0, g  46  44  45  45  0.23  0.358  BW on day 7, g  136b  136b  143a  147a  1.40  0.003  BW on d 11, g  258b  254b  269a  277a  2.16  <0.001  BW gain, day 0 to day 11, g/bird  213b  210b  224a  232a  2.11  <0.001  Feed intake day 0 to day 11, g/bird  294  278  296  293  2.79  0.081  FCR, day 0 to day 11  1.38a  1.33a,b  1.32a,b  1.27b  0.01  0.011  Final BW on day 35, g  1845b  1796b  2027a  1953a  20.20  <0.001                AME (%)  0.64  0.67  0.68  0.61  0.01  0.103  Total tract crude fat digestibility (%)  0.63b  0.66a,b  0.75a  0.71a,b  0.02  0.020  Total tract N retention (%)  0.55  0.58  0.61  0.52  0.01  0.180  Ileal crude protein digestibility (%)  0.79  0.76  0.78  0.79  0.00  0.102  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment and n = 33–38 for final BW on day 35. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Gut Morphology In the jejunum, the WB+IN treatment increased villus height compared to the IN and the CON treatments, with the WB treatment showing intermediate values (P = 0.001) (Table 4). The ileal villus height in the WB+IN treatment was higher compared to the other 3 treatments (P < 0.001). No difference in crypt depth was observed in the jejunum or ileum (P > 0.05). The dietary treatments were found not to affect the villus height/crypth depth (V/C) ratio in the ileum (P = 0.156), but the WB+IN treatment showed the highest V/C ratio in the jejunum compared to the IN and the CON treatments, whereas the WB treatment gave intermediate values (P = 0.035). Table 4. Effect of inulin and wheat bran in the starter diets on the villus height (μm), crypt depth (μm), and the ratio villus height/crypt depth (V/C ratio) in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156    CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, 6 chicks per treatment and 15 units per chick. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Table 4. Effect of inulin and wheat bran in the starter diets on the villus height (μm), crypt depth (μm), and the ratio villus height/crypt depth (V/C ratio) in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156    CON  IN  WB  WB+IN  SEM  P  Villus height              Jejunum  832b  760b  941a,b  1075a  33.47  0.001  Ileum  463b  475b  484b  579a  12.36  <0.001  Crypt depth              Jejunum  152  146  150  164  3.00  0.165  Ileum  126  119  121  134  3.12  0.345  V/C ratio              Jejunum  5.48b  5.21b  6.31a,b  6.61a  0.21  0.035  Ileum  3.72  4.02  4.01  4.35  0.10  0.156  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, 6 chicks per treatment and 15 units per chick. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Gene Expression The expressions of Mucin 2, Occludin, and Claudin-1, as shown in Table 5, were not affected by the dietary treatments (P > 0.05). Table 5. Effect of inulin and wheat bran in the starter diets on the relative abundance (arbitrary units) of gene expression in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217    CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. View Large Table 5. Effect of inulin and wheat bran in the starter diets on the relative abundance (arbitrary units) of gene expression in the jejunum and ileum of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217    CON  IN  WB  WB+IN  SEM  P  Jejunum              Mucin 2  0.47  0.47  0.43  0.50  0.05  0.960  Occludin  1.00  1.13  1.17  1.08  0.04  0.574  Claudin-1  0.61  0.69  0.69  0.58  0.02  0.305  Ileum              Mucin 2  0.78  0.76  0.64  0.69  0.07  0.884  Occludin  1.15  1.16  1.13  1.15  0.05  0.996  Claudin-1  1.14  1.00  0.80  0.77  0.07  0.217  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. View Large SCFA Analysis The concentration of acetate was higher in the CON treatment compared to the IN treatment, with the WB and the WB+IN treatments showing intermediate values (P = 0.040) (Table 6). The IN treatment was found to increase the concentration (P = 0.003) and molar ratio (P = 0.004) of iso-butyrate compared to the WB+IN and the CON treatments, whereas WB showed intermediate values. No differences between dietary treatments were shown for the concentration of total SCFA, propionate, butyrate, or iso-valerate, or for the molar ratio of acetate, propionate, butyrate, or iso-valerate (P > 0.05). Valerate was not detectible in these samples. Table 6. Effect of inulin and wheat bran in the starter diets on the SCFA profile in the cecal content of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410    CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). SCFA, short-chain fatty acid. View Large Table 6. Effect of inulin and wheat bran in the starter diets on the SCFA profile in the cecal content of broiler chickens on day 11.   CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410    CON  IN  WB  WB+IN  SEM  P  mmol/L wet intestinal contents  Total SCFA  88.27  63.21  76.60  66.55  3.70  0.060  Acetate  69.18a  46.10b  61.89a,b  51.54a,b  3.23  0.040  Propionate  4.60  4.89  3.57  3.09  0.50  0.601  Butyrate  14.50  12.22  11.14  11.93  1.15  0.782  Iso-butyrate  0.64b  1.61a  0.92a,b  0.39b  0.14  0.003  Iso-valerate  1.70  0.44  1.27  2.10  0.41  0.542  Molar ratio (%)  Acetate  76.58  70.47  78.46  73.46  1.49  0.255  Propionate  5.16  7.44  4.71  5.16  0.75  0.596  Butyrate  15.72  18.71  13.92  17.68  1.21  0.538  Iso-butyrate  0.71b  2.71a  1.18a,b  0.55b  0.26  0.004  Iso-valerate  1.83  0.67  1.73  3.15  0.51  0.410  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). SCFA, short-chain fatty acid. View Large 16S rDNA High-Throughput Sequencing A total of 24 DNA samples of cecal content were used in 16S rDNA high-throughput sequencing. After removing chimeric sequences, 103,817 high-quality sequences were selected to generate Operational Taxonomic Units (OTUs) with a 97% sequence similarity across 22 samples (1 sample of IN treatment and 1 sample of WB treatment were marked as outliers and were removed). The OTU table was filtered, leaving 10,080 OTUs for subsequent analysis. The differences within the intestinal microbial population between treatments were visualized by non-metric dimensional scaling built upon a Bray-Curtis distance matrix, based on the species taxonomic level (Figure 1a). A distinct cluster was observed in the chicks receiving the IN and the WB+IN diets compared to those receiving the WB and the CON diets, and this was confirmed by analysis of molecular variance of the distance matrix (P < 0.05). Alpha-diversity showed a slightly lower bacterial diversity, bacterial richness, and bacterial evenness in the WB+IN treatment, but none of these effects reached significance (Figure 1b). At the phylum level (Figure 1c), most of the bacteria were found to belong to Firmicutes, followed by Proteobacteria, Tenericutes, and Bacteroidetes, but we did not observe any shift between phyla. Genera that were each represented by >0.05% of total sequences in at least 1 of the 22 samples were used for further statistical comparison (Figure 1d and Table 7). The 4 predominant genera were vadin BB60_ unclassified, Ruminococcaceae_ unclassified, Lachnospiraceae_ unclassified, and Blautia. For the Firmicutes phylum, Vadin BB60_ unclassified was the most predominant genus and its relative abundance was highest in the WB+IN treatment (P = 0.015), but Flavonifractor, Defluviitaleaceae_unclassified, Anaerotruncus, Intestinimonas, and Clostridia_unclassified showed a lower relative abundance in the WB+IN treatment compared to the CON treatment (P < 0.05). The same differences occurred in the WB treatment compared to the CON treatment, except for Flavonifractor, Anaerotruncus, and Defluviitaleaceae_unclassified (P < 0.05). Furthermore, the relative abundance of Faecalibacterium and Anaerostipes was higher and the relative abundance of Flavonifractor, Intestinimonas, and Clostridia_unclassified were lower in the IN treatment compared to the CON treatment (P < 0.05). In the Proteobacteria phylum, only the relative abundance of Escherichia-Shigella was significant, showing a higher value in the WB+IN treatment compared to the WB and the CON treatments (P = 0.031). Figure 1. View largeDownload slide Spatial ordination, bacterial diversity, and taxonomical distribution deduced by 16S profiling CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. (a) Non-metric dimensional scaling (NMDS, 3 axes) showing standard deviation, CON treatment in black, IN treatment in red, WB treatment in green, and WB+IN treatment in blue. (b) Bacterial diversity (Inverse Simpson Biodiversity Index), bacterial richness (Chao1 Richness Index), and bacterial evenness (deduced from Simpson Index). (c) and (d) Mean phylotype distribution (phylum (c) and genus (d) levels) expressed as mean cumulative relative abundance in the cecal content of chicks on day 11. Figure 1. View largeDownload slide Spatial ordination, bacterial diversity, and taxonomical distribution deduced by 16S profiling CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. (a) Non-metric dimensional scaling (NMDS, 3 axes) showing standard deviation, CON treatment in black, IN treatment in red, WB treatment in green, and WB+IN treatment in blue. (b) Bacterial diversity (Inverse Simpson Biodiversity Index), bacterial richness (Chao1 Richness Index), and bacterial evenness (deduced from Simpson Index). (c) and (d) Mean phylotype distribution (phylum (c) and genus (d) levels) expressed as mean cumulative relative abundance in the cecal content of chicks on day 11. Table 7. Bacterial genera that accounted for >0.05% of the total sequences in at least 1 of the 22 samples in the cecal content of chicks on day 11 (abundance of the phylum and genera was expressed as %). Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 5 to 6 per treatment, where 1 IN sample and 1 WB sample have been canceled entirely. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large Table 7. Bacterial genera that accounted for >0.05% of the total sequences in at least 1 of the 22 samples in the cecal content of chicks on day 11 (abundance of the phylum and genera was expressed as %). Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  Phylum  Genus  CON  IN  WB  WB+IN  SEM  P  Firmicutes  vadinBB60_unclassified  27.93a,b  17.79b  35.18a,b  59.39a  5.16  0.015    Flavonifractor  5.71a  0.67b  2.57a,b  0.36b  0.79  0.034    Faecalibacterium  0.00b  9.56a  1.05b  0.38b  1.19  0.006    Defluviitaleaceae_unclassified  2.33a  0.98a,b  2.10a  0.72b  0.25  0.037    Anaerotruncus  2.25a  1.66a,b  0.94a,b  0.45b  0.24  0.023    Intestinimonas  2.04a  0.33b  0.33b  0.26b  0.27  0.029    Anaerostipes  0.09b  0.98a  0.27b  0.35a,b  0.10  0.009    Clostridia_unclassified  0.04a  0.00b  0.00b  0.00b  0.00b  0.003    Ruminococcaceae_unclassified  19.87  22.93  21.66  13.84  1.52  0.141    Lachnospiraceae_unclassified  20.15  20.05  19.04  13.34  1.62  0.384    Blautia  6.74  9.00  5.67  3.16  1.45  0.587    Clostridiales_unclassified  3.53  3.07  2.62  2.06  0.33  0.438    Subdoligranulum  1.72  3.55  1.38  0.38  0.67  0.437    Erysipelotrichaceae_unclassified  0.66  2.22  0.44  1.07  0.29  0.133    Lactobacillus  0.87  0.85  0.70  0.66  0.13  0.923    Pseudoflavonifractor  0.23  0.34  0.18  0.34  0.07  0.813    Firmicutes_unclassified  0.22  0.07  0.27  0.14  0.04  0.449    Candidatus_Arthromitus  0.08  0.08  0.03  0.05  0.01  0.469  Proteobacteria  Escherichia-Shigella  0.49b  1.03a,b  0.55b  2.86a  0.36  0.031  CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 5 to 6 per treatment, where 1 IN sample and 1 WB sample have been canceled entirely. a,bMeans in the same row not sharing a common superscript are significantly different (P < 0.05). View Large DISCUSSION The objective of the present study was to investigate whether inulin and wheat bran provided either separately or in combination during the starter period exert prebiotic effects, have an impact on growth performance, on fermentation in the ceca, or on the morphology and the intestinal barrier function of the small intestine. Our study showed that the presence of 2% inulin in the starter diet did not improve the growth performance of broiler chickens, and this finding is in agreement with those of other studies (Biggs et al., 2007; Rehman et al., 2008; Alzueta et al., 2010; Świątkiewicz et al., 2011). However, Rebolé et al. (2010) and Nabizadeh (2012) reported a beneficial effect of inulin (0.5 to 1%) in the broiler diet on BW gain. On the other hand, in the present study, the inclusion of 10% wheat bran was found to improve BW on day 7 and on day 11, and to increase BW gain until day 11. The use of high amounts of wheat bran (18.7 and 37.5%) from day 12 onwards has been shown to increase BW and daily BW gain of broilers of 7 wk of age (Jørgensen et al., 1996). A similar beneficial effect on BW has been shown to occur in laying pullets from 10 to 16 wk with 15% wheat bran in the diet (Martínez et al., 2015). In the present study, the addition of wheat bran to the diet increased total tract fat digestibility, which might have been partly responsible for the improved growth in the starter period. The improved BW found here, as a result of the WB and WB+IN treatments, remained until day 35. Whether the effect of wheat bran on the intestinal physiology provides a lasting result needs to be further investigated. Given that the WB+IN treatment resulted in the most beneficial BW, concomitant with the lowest FCR, we can deduce that the combination of inulin and wheat bran in the starter diet may have had a synergistic effect. We can also hypothesize that these combined ingredients played a particular role on the gut morphology of the chicks, increasing villus height and its ratio, both in the jejunum and ileum. Interestingly, the inclusion of wheat bran alone in the diet did not influence the gut morphology results. In that regard, our results are similar to those of Chen et al. (2013), who found no effect on gut morphology when 10% wheat bran was added to the diet of pigs. Along similar lines, Jenab and Thompson (2000) reported no difference in the crypt depth of the colon tissue in rats, as a result of the same dietary addition. Inversely, in the present study, inulin tended to decrease jejunal villus height and V/C ratio, which is surprising, as several studies have shown an improved intestinal mucosal architecture as a result of adding this prebiotic to broiler chicken diets (Rehman et al., 2007; Rebolé et al., 2010; Nabizadeh, 2012). It is possible that, in our case, the inclusion level of 2% inulin might have been too high for these young chicks. An experiment conducted by Xu et al. (2003), examining the effects of fructooligosaccharides (FOS) in the diet of broiler chickens, reported that feeding 0.8% FOS slightly decreased villus height and the V/C ratio in the animals’ jejunum and ileum, in comparison with feeding 0.2% and 0.4% FOS. Some studies in pigs, humans, and mice have suggested that the addition of either inulin or wheat bran might alter some of the tight junction or mucus proteins affecting the epithelial barrier function (Neyrinck et al., 2012; Chen et al., 2013; Chen et al., 2017; Wu et al., 2017). However, in our study, no differences between treatments were revealed for the gene expressions of Mucin 2, Occludin, or Claudin-1 in the jejunum or ileum. In agreement with our finding, the expression of Mucin 2 or Occludin in the colon of mice after a high fat diet was found not to be affected by feeding wheat-derived AXOS (Neyrinck et al., 2012). Moreover, Chen et al. (2013) observed no alteration in the Claudin-1 mRNA level in the ileum and colon of weaned pigs, following wheat bran supplementation. Furthermore, Wu et al. (2017) failed to detect, via cell culture, any effect of inulin on the gene or protein expression of Claudin-1 in human intestinal organoids. Our study did not reveal a strong effect of either inulin or wheat bran on the SCFA or microbiota profile. Only an alteration in the levels of acetate and iso-butyrate was observed in the ceca. The lack of a greater impact on the SCFA profile might be explained by one or more of the following: 1) the possible occurrence of fermentation earlier in the gastrointestinal tract; 2) the fact that a relatively poor fermentation process occurs at this young age (Amit-Romach et al., 2004); 3) the fact that SCFAs are immediately absorbed by the host or are otherwise utilized by other bacteria (Topping and Clifton, 2001; Duncan et al., 2004a, 2004b; Louis et al., 2007); or 4) the possibility that a different amount of digesta was present in the ceca, affecting the absolute amount of SCFA rather than the concentration. All these possible explanations mean that differences in SCFA profile can be difficult to interpret. The SCFA profile found in the present study, i.e., showing the highest levels of acetate, followed by butyrate, and propionate, is in accordance with the studies of Jørgensen et al. (1996), Rehman et al. (2008), and Rebolé et al. (2010). With regard to the results found for the gut microbiota in the present study, 4 major phyla (Firmicutes, Proteobacteria, Tenericutes, and Bacteroidetes) were predominant in the ceca and the relative abundance of Firmicutes was more than 90%, which is consistent with other studies (Corrigan et al., 2015; Pourabedin and Zhao, 2015; Awad et al., 2016). Amit-Romach et al. (2004) found that chicken intestinal microbiota started to colonize at between day 2 and day 4 post-hatch, but could take 14 to 30 d to fully develop in the ceca. Awad et al. (2016) reported that Proteobacteria was significantly more present in chicks during the first days of life and decreased thereafter, whereas Firmicutes was the predominant phylum from the second week onwards. In our study, this situation had already occurred by day 11 and in the study of Corrigan et al. (2015) by day 7. In the present study, a distinct cluster was found in the inulin-containing treatments compared to the WB and the CON treatments. It seemed that, compared to wheat bran, inulin in the diet had a greater ability to influence the microbiota profile. We found that vadinBB60 was the predominant genus in the WB+IN treatment, followed by the WB and the CON treatments, whereas the IN treatment showed the lowest abundance. This finding of a lower abundance of vadinBB60 unclassified induced by inulin is in agreement with the results of a study of the effect of inulin in mice (Neyrinck et al., 2016). However, so far, the reason why the combination of inulin and wheat bran would have increased the abundance of this genus remains unclear. Most of the significant bacteria found (i.e., Flavonifractor, Faecalibacterium, Intestinimonas, and Anaerostipes) have been shown to be related to butyrate production (Schoefer et al., 2003; Sokol et al., 2008; Eeckhaut et al., 2010; Kläring et al., 2013; Van-den-Abbeele et al., 2013). In the present study, inulin was found to increase the relative abundance of Faecalibacterium and Anaerostipes in comparison with the other 3 alternative treatments used here. Studies in humans (Ramirez-Farias et al., 2008; Dewulf et al., 2012; Claus, 2017) have demonstrated that inulin exhibited a significant increase in Anaerostipes and Faecalibacterium. To our knowledge, our study is the first report on chickens to provide findings in line with these results. In the present study, the abundance of Escherichia-Shigella, which was found to be the most abundant genus of the Proteobacteria, increased as a result of the WB+IN treatment. Interestingly, this genus has previously been found to be highly abundant in the feces of low FCR birds compared to high FCR birds (Singh et al., 2012). As the WB+IN treatment also had the lowest FCR, in the present study, our results are in line with these findings of Singh et al. (2012). In conclusion, in this study, for both inulin and wheat bran, similar microbiota changes were observed as in other studies on human or animal, but inulin had a greater ability to shape the microbiota profile. However, the inclusion of 2% inulin in the starter diet might have been too high for these young chicks to positively affect performance, as demonstrated by the BW and gut morphology results. In contrast, wheat bran alone and the combination of wheat bran and inulin as an ingredient of the starter diet for broiler chicks could ameliorate growth performance and/or gut morphology during this early period, possibly without requiring any specific measurable positive effect on the intestinal barrier. The beneficial results for the combined diet on BW, FCR, and gut morphology during the starter period suggested a synergistic effect of inulin and wheat bran. In addition, the greater BW of wheat bran alone or in combination with inulin was found to last for a couple of weeks after several weeks after termination of the supplementation, which suggests a long-term effect that deserves further investigation. ACKNOWLEDGEMENTS We thank the GIGA of the University of Liège for the gut morphological analysis, and COSUCRA for the provision of inulin. This study was supported by the Welcome Grant received by Nadia Everaert of the University of Liège. It was also partially supported by the China Scholarship Council (CSC). Footnotes 1The nucleotide sequence data reported in this paper have been submitted to National Center for Biotechnology Information (NCBI) nucleotide sequence database and have been assigned the accession number PRJNA419868. REFERENCES Alzueta C., Rodriguez M. L., Ortiz L. T., Rebole A., Trevino J.. 2010. Effects of inulin on growth performance, nutrient digestibility and metabolisable energy in broiler chickens. Br. Poult. Sci.  51: 393– 398. Google Scholar CrossRef Search ADS PubMed  Amit-Romach E., Sklan D., Uni Z.. 2004. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult. Sci.  83: 1093– 1098. Google Scholar CrossRef Search ADS PubMed  AOAC. 1990. Official Methods of Analysis . Association Official Analytical Chemists, Arlington. Awad W. A., Mann E., Dzieciol M., Hess C., Schmitz-Esser S., Wagner M., Hess M.. 2016. Age-related differences in the luminal and mucosa-associated gut microbiome of broiler chickens and shifts associated with Campylobacter jejuni infection. Front. Cell. Infect. Microbiol.  6: 154. Google Scholar CrossRef Search ADS PubMed  Biggs P., Parsons C. M., Fahey G. C.. 2007. The effects of several oligosaccharides on growth performance, nutrient digestibilities, and cecal microbial populations in young chicks. Poult. Sci.  86: 2327– 2336. Google Scholar CrossRef Search ADS PubMed  Bindels L. B., Neyrinck A. M., Salazar N., Taminiau B., Druart C., Muccioli G. G., François E., Blecker C., Richel A., Daube G., Mahillon J.. 2015. Non digestible oligosaccharides modulate the gut microbiota to control the development of leukemia and associated cachexia in mice. PLoS One  10: 0131009. Google Scholar CrossRef Search ADS   Broekaert W. F., Courtin C. M., Verbeke K., Van de Wiele T., Verstraete W., Delcour J. A.. 2011. Prebiotic and other health-related effects of cereal-derived arabinoxylans, arabinoxylan-oligosaccharides, and xylooligosaccharides. Crit. Rev. Food Sci. Nutr.  51: 178– 194. Google Scholar CrossRef Search ADS PubMed  Chen H., Mao X., He J., Yu B., Huang Z., Yu J., Zheng P., Chen D.. 2013. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Br. J. Nutr.  110: 1837– 1848. Google Scholar CrossRef Search ADS PubMed  Chen K., Chen H., Faas M. M., Haan B. J., Li J., Xiao P., Zhang H., Diana J., Vos P., Sun J.. 2017. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis. Mol. Nutr. Food Res.  61: 1601006. Google Scholar CrossRef Search ADS   Claus S. P. 2017. Inulin prebiotic: is it all about bifidobacteria? Gut . 66: 1883– 1884. Google Scholar CrossRef Search ADS PubMed  Corrigan A., de Leeuw M., Penaud-Frézet S., Dimova D., Murphy R. A.. 2015. Phylogenetic and functional alterations in bacterial community compositions in broiler ceca as a result of mannan oligosaccharide supplementation. Appl. Environ. Microbiol.  81: 3460– 3470. Google Scholar CrossRef Search ADS PubMed  Courtin C. M., Swennen K., Broekaert W. F., Swennen Q., Buyse J., Decuypere E., Michiels C. W., Ketelaere B. D., Delcour J. A.. 2008. Effects of dietary inclusion of xylooligo- saccharides, arabinoxylooligosaccha- rides and soluble arabinoxylan on the microbial composition of caecal contents of chickens. J. Sci. Food Agric.  88: 2517– 2522. Google Scholar CrossRef Search ADS   De Paepe K., Kerckhof F. M., Verspreet J., Courtin C. M., Van de Wiele T.. 2017. Inter-individual differences determine the outcome of wheat bran colonization by the human gut microbiome. Environ. Microbiol.  19: 3251– 3267 Google Scholar CrossRef Search ADS PubMed  Dewulf E. M., Cani P. D., Claus S. P., Fuentes S., Puylaert P. G., Neyrinck A. M., Bindels L. B., de Vos W. M., Gibson G. R., Thissen J. P., Delzenne N. M.. 2013. Insight into the prebiotic concept: lessons from an exploratory, double blind intervention study with inulin-type fructans in obese women. Gut . 62: 1112– 1121. Google Scholar CrossRef Search ADS PubMed  Duncan S. H., Holtrop G., Lobley G. E., Calder A. G., Stewart C. S., Flint H. J.. 2004a. Contribution of acetate to butyrate formation by human faecal bacteria. Br. J. Nutr.  91: 915– 923. Google Scholar CrossRef Search ADS   Duncan S. H., Louis P., Flint H. J.. 2004b. Lactate-utilizing bacteria, isolated from human feces, that produce butyrate as a major fermentation product. Appl. Environ. Microbiol.  70: 5810– 5817. Google Scholar CrossRef Search ADS   Edwards C. A., Parrett A. M.. 2002. Intestinal flora during the first months of life: new perspectives. Br. J. Nutr.  88: 11– 18. Google Scholar CrossRef Search ADS PubMed  Edwards C. A., Parrett A. M.. 2003. Dietary fibre in infancy and childhood. Proc. Nutr. Soc.  62: 17– 23. Google Scholar CrossRef Search ADS PubMed  Eeckhaut V., Van Immerseel F., Pasmans F., De Brandt E., Haesebrouck F., Ducatelle R., Vandamme P.. 2010. Anaerostipes butyraticus sp. nov., an anaerobic, butyrate-producing bacterium from Clostridium cluster XIVa isolated from broiler chicken caecal content, and emended description of the genus Anaerostipes. Int. J. Syst. Evol. Microbiol.  60: 1108– 1112 Google Scholar CrossRef Search ADS PubMed  Gibson G. R., Probert H. M., Van Loo J., Rastall R. A., Roberfroid M. B.. 2004. Dietary modulation of the human colonic microbiota: updating the concept of prebiotics. Nutr. Res. Rev.  17: 259– 275. Google Scholar CrossRef Search ADS PubMed  Gibson G. R., Hutkins R., Sanders M. E., Prescott S. L., Reimer R. A., Salminen S. J., Scott K., Stanton C., Swanson K. S., Cani P. D., Verbeke K.. 2017. Expert consensus document: The international scientific association for probiotics and prebiotics (ISAPP) consensus statement on the definition and scope of prebiotics. Nat. Rev. Gastroenterol. Hepatol.  14: 491– 502. Google Scholar PubMed  Hosseini E., Grootaert C., Verstraete W., Van de Wiele T.. 2011. Propionate as a health-promoting microbial metabolite in the human gut. Nutr. Rev.  69: 245– 258. Google Scholar CrossRef Search ADS PubMed  Jenab M., Thompson L. U.. 2000. Phytic acid in wheat bran affects colon morphology, cell differentiation and apoptosis. Carcinogenesis . 21: 1547– 1552. Google Scholar CrossRef Search ADS PubMed  Jørgensen H., Zhao X. Q., Knudsen K. E. B., Eggum B. O.. 1996. The influence of dietary fibre source and level on the development of the gastrointestinal tract, digestibility and energy metabolism in broiler chickens. Br. J. Nutr . 75: 379– 395. Google Scholar CrossRef Search ADS PubMed  Kläring K., Hanske L., Bui N., Charrier C., Blaut M., Haller D., Plugge C. M., Clavel T.. 2013. Intestinimonas butyriciproducens gen. nov., sp. nov., a butyrate-producing bacterium from the mouse intestine. Int. J. Syst. Evol. Microbiol.  63: 4606– 4612. Google Scholar CrossRef Search ADS PubMed  Louis P., Scott K. P., Duncan S. H., Flint H. J.. 2007. Understanding the effects of diet on bacterial metabolism in the large intestine. J. Appl. Microbiol.  102: 1197– 1208. Google Scholar CrossRef Search ADS PubMed  Martin A. P. 2002. Phylogenetic approaches for describing and comparing the diversity of microbial communities. Appl. Environ. Microbiol.  68: 3673– 3682 Google Scholar CrossRef Search ADS PubMed  Martínez Y., Carrión Y., Rodríguez R., Valdivié M., Olmo C., Betancur C., Liu G., Al-Dhabi N. A., Duraipandiyan V.. 2015. Growth performance, organ weights and some blood parameters of replacement laying pullets fed with increasing levels of wheat bran. Rev. Bras. Cienc. Avic.  17: 347– 354. Google Scholar CrossRef Search ADS   Myers W. D., Ludden P. A., Nayigihugu V., Hess B. W.. 2004. Technical Note: A procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci.  82: 179– 183. Google Scholar CrossRef Search ADS PubMed  Nabizadeh A. 2012. The effect of inulin on broiler chicken intestinal microflora, gut morphology, and performance. J. Anim. Feed Sci.  21: 725– 734. Google Scholar CrossRef Search ADS   Neyrinck A. M., Delzenne N. M.. 2010. Potential interest of gut microbial changes induced by non-digestible carbohydrates of wheat in the management of obesity and related disorders. Curr. Opin. Clin. Nutr. Metab. Care  13: 722– 728. Google Scholar CrossRef Search ADS PubMed  Neyrinck A. M., Pachikian B., Taminiau B., Daube G., Frédérick R., Cani P. D., L. B., Bindels, Delzenne N. M.. 2016. Intestinal sucrase as a novel target contributing to the regulation of glycemia by prebiotics. PLoS One  11: 0160488. Google Scholar CrossRef Search ADS   Neyrinck A. M., Van Hée V. F., Piront N., De Backer F., Toussaint O., Cani P. D., Delzenne N. M.. 2012. Wheat-derived arabinoxylan oligosaccharides with prebiotic effect increase satietogenic gut peptides and reduce metabolic endotoxemia in diet-induced obese mice. Nutr. Diabetes  2: e28– e28. Google Scholar CrossRef Search ADS PubMed  Pourabedin M., Zhao X.. 2015. Prebiotics and gut microbiota in chickens. FEMS. Microbiol. Lett . 15: 362 Ramirez-Farias C., Slezak K., Fuller Z., Duncan A., Holtrop G., Louis P.. 2008. Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii. Br. J. Nutr . 101: 541– 550. Google Scholar PubMed  Rebolé A., Ortiz L. T., Rodríguez M., Alzueta C., Treviño J., Velasco S.. 2010. Effects of inulin and enzyme complex, individually or in combination, on growth performance, intestinal microflora, cecal fermentation characteristics, and jejunal histomorphology in broiler chickens fed a wheat- and barley-based diet. Poult. Sci.  89: 276– 286. Google Scholar CrossRef Search ADS PubMed  Rehman H., Hellweg P., Taras D., Zentek J.. 2008. Effects of dietary inulin on the intestinal short chain fatty acids and microbial ecology in broiler chickens as revealed by denaturing gradient gel electrophoresis. Poult. Sci.  87: 783– 789. Google Scholar CrossRef Search ADS PubMed  Rehman H., Rosenkranz C., Böhm J., Zentek J.. 2007. Dietary inulin affects the morphology but not the sodium-dependent glucose and glutamine transport in the jejunum of broilers. Poult. Sci.  86: 118– 122. Google Scholar CrossRef Search ADS PubMed  Scheppach W. 1994. Effects of short chain fatty acids on gut morphology and function. Gut . 35: S35– S38. Google Scholar CrossRef Search ADS PubMed  Schoefer L., Mohan R., Schwiertz A., Braune A., Blaut M.. 2003. Anaerobic degradation of flavonoids by Clostridium orbiscindens. Appl. Environ. Microbiol.  69: 5849– 5854. Google Scholar CrossRef Search ADS PubMed  Singh K. M., Shah T., Deshpande S., Jakhesara S. J., Koringa P. G., Rank D. N., Joshi C. G.. 2012. High through put 16S rRNA gene-based pyrosequencing analysis of the fecal microbiota of high FCR and low FCR broiler growers. Mol. Biol. Rep . 39: 10595– 10602. Google Scholar CrossRef Search ADS PubMed  Sokol H., Pigneur B., Watterlot L., Lakhdari O., Bermúdez-Humarán L. G., Gratadoux J. J., Blugeon S., Bridonneau C., Furet J. P., Corthier G., Grangette C.. 2008. Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proc. Natl. Acad. Sci. USA . 105: 16731– 16736. Google Scholar CrossRef Search ADS   Świątkiewicz S., Koreleski J., Arczewska-Włosek A.. 2011. Effect of inulin and oligofructose on performance and bone characteristics of broiler chickens fed on diets with different concentrations of calcium and phosphorus. Br. Poult. Sci.  52: 483– 491. Google Scholar CrossRef Search ADS PubMed  Thompson C. L., Wang B., Holmes A. J.. 2008. The immediate environment during postnatal development has long-term impact on gut community structure in pigs. ISME J.  2: 739– 748. Google Scholar CrossRef Search ADS PubMed  Topping D. L., Clifton P. M.. 2001. Short-chain fatty acids and human colonic function: roles of resistant starch and nonstarch polysaccharides. Physiol. Rev.  81: 1031– 1064. Google Scholar CrossRef Search ADS PubMed  Van den Abbeele P., Belzer C., Goossens M., Kleerebezem M., De Vos W. M., Thas O., De Weirdt R., Kerckhof F. M., Van de Wiele T.. 2013. Butyrate-producing Clostridium cluster XIVa species specifically colonize mucins in an in vitro gut model. ISME J.  7: 949– 961. Google Scholar CrossRef Search ADS PubMed  Wu R. Y., Abdullah M., Määttänen P., Pilar A. V. C., Scruten E., Johnson-Henry K. C., Napper S., O’Brien C., Jones N. L., Sherman P. M.. 2017. Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function. Sci. Rep.  7: 40820. Google Scholar CrossRef Search ADS PubMed  Xu Z. R., Hu C. H., Xia M. S., Zhan X. A., Wang M. Q.. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci.  82: 1030– 1036. Google Scholar CrossRef Search ADS PubMed  © 2018 Poultry Science Association Inc. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/about_us/legal/notices)

Journal

Poultry ScienceOxford University Press

Published: May 26, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off