Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

The directional migration and differentiation of mesenchymal stem cells toward vascular endothelial cells stimulated by biphasic calcium phosphate ceramic

The directional migration and differentiation of mesenchymal stem cells toward vascular... Osteoinductivity of porous calcium phosphate (CaP) ceramics has been widely investigated and confirmed, and it might be attributed to the rapid formation of the vascular networks after in vivo implantation of the ceramics. In this study, to explore the vascularization mechanism within the CaP ceramics, the migration and differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) under the stimulation of porous biphasic calcium phosphate (BCP) ceramic with excellent osteoinductivity were systematically investigated. The results indicated that the directional migra- tion of BMSCs toward BCP ceramic occurred when evaluated by using a transwell model, and the BMSCs migration was enhanced by the seeded macrophages on the ceramic in advance. Besides, by directly culturing BMSCs on BCP ceramic discs under both in vitro and in vivo physiological en- vironment, it was found that the differentiation of BMSCs toward vascular endothelial cells (VECs) happened under the stimulation of BCP ceramic, as was confirmed by the up-regulated gene expressions and protein secretions of VECs-related characteristic factors, including kinase insert domain receptor, von willebrand factor, vascular cell adhesion molecule-1 and cadherin 5 in the BMSCs. This study offered a possibility for explaining the origin of VECs during the rapid vasculari- zation process after in vivo implantation of porous CaP ceramics and could give some useful guid- ance to reveal the vascularization mechanism of the ceramics. Keywords: BCP ceramic; vascularization; BMSCs; VECs; migration; differentiation bone-grafting substitutes, calcium phosphate (CaP) ceramics are Introduction promising candidates for clinical use. This is not only due to their Every year, millions of bone grafting procedures are performed excellent biocompatibility and osteoconductivity [6–8], but also worldwide, needing a large number of bone substitutes [1]. their widely confirmed osteoinductivity [9–20]. However, the Nowadays, autografts and allografts are still the most common solu- osteoinduction mechanism by CaP ceramics is so far unclear. It is tions for bone defects over the critical size in clinical application well known that vascularization plays a key role in the healing pro- [2–4]. However, they have some disadvantages such as the finite re- cess of bone fractures, and bone regeneration after a biomaterial im- source, the additional invasive surgery, the risk of transmission of plantation is highly dependent on the formation of abundant infectious diseases, and the immunological rejection by the host [3]. vascular networks within the implant [21–24]. Thus, the excellent In such cases, artificially synthesized biomaterials for the repair of osteoinductivity of CaP ceramics might be closely related to their bone defects were proposed [4, 5]. Among the current synthetic vascularization capacities. V C The Author(s) 2017. Published by Oxford University Press. 129 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 130 Chen et al. To demonstrate the relationship between angiogenesis and os- Materials and methods teogenesis of CaP ceramics, in our previous work, four types of po- Materials rous CaP ceramics, i.e. hydroxyapatite (HA), biphasic calcium BCP-2 ceramic (HA/b-TCP30/70) was used for the in vitro and phosphates (BCP-1 with HA/b-TCP70/30 and BCP-2 with HA/b- in vivo experiments, which was fabricated according to our previous TCP30/70) and b-tricalcium phosphate (b-TCP), were investi- method [9]. In brief, BCP precursor powders synthesized by wet pre- gated in terms of their vascularization and osteogenesis [9, 24]. cipitations were made into the slurries, which were foamed by H O 2 2 The results revealed that only after 4 weeks of in vivo implantation and then poured into the special mould. After rapid drying at 180 C into the thigh muscles of mice, the mature vascular networks had in an oven, the green bodies were sintered at 1100 C for 2 h in a been formed within the ceramics. The vascularization could be due muffle furnace and then cut into the discs (U14 1.5 mm for trans- to the up-regulated expression of vascular endothelial growth fac- well model, U14 2 mm for in vitro cell culture) or cylinders tors (VEGF) and the enhanced proliferation of vascular endothelial (U2 3 mm for in vivo implantation). The round coverslips cells (VECs) under the stimulation of CaP ceramics [24]. However, (U14 0.17 mm for in vitro cell culture, U3 0.17 mm for in vivo the previous works had not explicated the origin of the VECs. implantation) were used as the control materials. Prior to use, all the Besides the ingrowth of blood vessels from the nearby tissues, is it specimens were sterilized by c-ray irradiation at the dose of 25 kGy. possible that spontaneous formation of new blood vessels within the ceramics? As we know, after a biomaterial being implanted into the body, an inflammatory response happens, accompanying Isolation of rat BMSCs and flow cytometric detection of with the migration of first neutrophils and then macrophages from cell surface antigens nearby tissues and the circulation system into the implanting posi- Rat BMSCs were isolated from bone marrow of the femurs and tib- tion [25–28]. These aggregated inflammatory cells secret a host of ias of newly born SD rats, and cultured in a-minimum essential me- chemokines such as interleukin-1 (IL-1), IL-6, IL-11, IL-18, tumor dium (a-MEM) (Gibco, NY, USA) supplemented with 10% fetal necrosis factor-a (TNF-a) and transforming growth factor-b1 bovine serum (FBS, Gibco), 100 U/ml penicillin, and 100 lg/ml (TGF-b1) [29–31], promoting the further recruitment of mesen- streptomycin [34]. The phenotype of isolated cells was characterized chymal stem cells (MSCs) and other cells [24, 32–35]. As a multi- by analyzing the cell surface antigens CD29, CD34, CD45 and potent stem cells that can differentiate into different cell types, CD90. In brief, digested P2 BMSCs were rinsed in PBS and resus- depending on the cellular microenvironment [36, 37], is it possible pended in PBS to get a cell suspension at density of 5 10 cells/ml. that the MSCs differentiate toward VECs under the stimulation of The monoclonal antibodies (Biolegend, USA), i.e. CD29 (Alexa CaP ceramics, thereby offering the source of VECs for the forma- Fluor 647 anti-mouse/rat), CD34 (FITC anti-human), CD45 (Alexa tion of new blood vessels? Fluor 488 anti-mouse), and CD90 (Alexa Fluor 700 anti-human), So far, some previous reports indicated that MSCs could phe- were added separately, followed by 45 min of incubation in the dark notypically and functionally differentiated into VECs under at 37 C. Labeled BMSCs were rinsed by PBS, centrifuged at 200g certain conditions. Peng and Chi [38] co-cultured bone marrow- for 5 min and resuspended in PBS, and then were analyzed using a derived mesenchymal stem cells (BMSCs) with human umbilical flow cytometer (Cytomics FC500, Beckman, USA). Unstained cells vein endothelial cells (HUVECs), and found that the direct cell– were used as the control. cell contact and talk between the two types of cells initiated the differentiation of BMSCs toward VECs. The mechanism may be Transwell migration assay closely related to the promotion of VEGF secretion after the direct Cell migration assay was performed using a transwell model with cell–cell contact and the cell fusion. Silva et al. [39] constructed 8 lm pore membrane filters (Corning Inc., USA). BMSCs were a chronic ischemic model of dogs and injected BMSCs grown to subconfluence (70%) prior to harvest by trypsinization (100  10 cells/10 ml saline) intraperitoneally. At 60 days postop- and labeling with CellTracker green (1 lM, invitrogen, USA) for 1 h eratively, the histological analysis and immunohistochemical stain- at 37 C. The fluorescently labeled BMSCs (1 10 cells/ml, 200 ml ing confirmed that the BMSCs differentiated into an endothelial per well) were seeded in the upper chamber of the transwell. Four phenotype, thereby enhancing the vascular density and improving types of materials were placed in the bottom chamber, i.e. BCP ce- cardiac function. Oswald et al. [40] cultured BMSCs in the pres- ramic discs (U14 1.5 mm) seeded with macrophages, coverslips ence of 2% fetal calf serum and 50 ng/ml VEGF, and observed a (U14 0.17 mm) seeded with macrophages, BCP ceramic discs with- strong increase of expression of endothelial-specific markers in- out seeded cells, and coverslips without seeded cells. The macro- cluding kinase insert domain receptor (KDR), FLT-1 and von phages were labeled by CellTracker CM-DiI with red fluorescence Willebrand factor (vWF). (1 lM, MAIBIO, China) and the cell seeding density was 1 10 Therefore, to explore the vascularization mechanism of porous cells/well. After incubation for 3, 6, 12, 24 and 48 h, the specimens CaP ceramics after in vivo implantation, in this study, the possibility in the bottom chamber were carefully taken out to check the BMSCs of the oriented migration of BMSCs toward the ceramics and the migration using a confocal laser scanning microscopy (CLSM, TCS differentiation of BMSCs into VECs under the stimulation of the ce- SP5, Leica, Germany). Each experiment was performed in triplicate. ramics were evaluated via in vitro and in vivo models. As we re- ported before, after implantation into the thigh muscle of mice, BCP-2 showed better osteogenesis and vascularization among the BMSCs culture in vitro used four CaP ceramics [9, 24]. Hence, BCP-2 (HA/b-TCP30/70) BCP ceramic discs (U14 2 mm) and round coverslips were used as the material model in this study. The migration and dif- (U14 0.17 mm) were placed in 24-well plates. The BMSCs (P3) ferentiation of BMSCs were carried out by using a transwell model were harvested by treatment with a trypsin/EDTA solution af- and directly culturing BMSCs on the ceramics under an in vitro or ter reaching confluence. The harvested BMSCs were resuspended in in vivo physiological environment, respectively. a Dulbecco’s modified eagle medium (DMEM, Gibco, USA) to Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 131 Table 1. The primers and probes for real-time PCR Target Forward primer Reverse primer GAPDH CTCAACTACATGGTCTACATGTTC CCCATTCTCGGCCTTGACT KDR GATGTTGAAAGAGGGAGCAAC ACATAGTCTTTCCCAGAGCGG vWF ACTTTGAGGTGGTGGAGTCG CCTGTTCCTGGTATGTGTGC VCAM-1 CCCAAACAGAGGCAGAGTGT AGCAGGTCAGGTTCACAGGA CDH5 CATCGCAGAGTCCCTCAGTT TCAGCCAGCATCTTGAACCT prepare a cell suspension at density of 2 10 cells/ml for cell Quantitative assay of protein expression seeding. 1 ml of the cell suspension was added dropwise to the After cultured for 1, 4, 7 and 10 days, the total intracellular and ex- BCP ceramic discs or coverslips. The cells on the specimens were cul- tracellular proteins in the BMSCs cultured on BCP ceramic discs or tured in DMEM supplemented with 10% FBS (Beijing Minhai coverslips were collected. The intracellular proteins of the cells were Biotechnology, China) and 1% penicillin/streptomycin at 37 Cin extracted by a CytoBuster protein extraction reagent (Novagen, an atmosphere of 5% CO . The media were replaced at the 1st, 4th, USA) according to manufacturer’s instruction. The extracellular 7th and 10th days. All the supernatants were collected and stored at proteins were obtained by collecting the supernatants after cell cul- 80 C for subsequent analysis. ture. Quantitative analysis for the secreted KDR, vWF, VCAM-1, CDH5 proteins was carried out by using an enzyme-linked immuno- sorbent assay (ELISA, Cloud-Clone Corp., USA). The total amount Cell morphology and viability of intracellular and extracellular proteins was also assayed by a Live/dead staining was carried out to evaluate cell morphology and BCA Protein Assay Kit (Pierce, USA) and then used to normalize the viability by using the fluorescein diacetate (FDA, Topbio Science, protein expressions of the KDR, vWF, VCAM-1 and CDH5. Each China) and propidium iodide (PI, Topbio Science, China) according experiment was carried out in triplicate. to the specification. After being cultured for 1, 4, 7 and 10 days, the samples were washed twice with warm PBS and incubated in serum- free DMEM containing FDA and PI for 15 min. The stained samples were observed by CLSM. In the live/dead staining, the live cells In vivo implantation would be dyed green after reacting with FDA, while the dead cells To analysis the effects of BCP ceramics on the differentiation of would be dyed red after reacting with PI. Each experiment was car- BMSCs toward VECs in a real physiological environment, an in vivo ried out in triplicate. model was established as shown in Fig. 1. The diffusion chamber was composed of a middle ring (U6.7 5 mm, cut from 96-well cell culture plate) and both ends of membranes (0.22 mm in pore size, Millipore, Cell proliferation assay USA). The membranes were fixed on the ring by using DMSO as a The proliferation of BMSCs cultured on BCP ceramics or coverslips binder. Prior to use, only one side of membrane was sealed to the were detected by an MTT assay. The cells were incubated with chamber, which was sterilized by c-irradiation. When reached 80% 0.5 mg/ml MTT for 4 h at 37 C. The liquid in every well was re- confluence, the BMSCs (P3) were trypsinized, counted, centrifuged and moved and then dimethyl sulphoxide (DMSO) was added to each resuspended in DMEM to get a cell suspension at the density of well for dissolution of the produced purple formazan salts. The opti- 5 10 cells/ml. The cell suspension (40 ml for each sample) was then cal density (O. D.) values were measured at the wavelength of added dropwise onto the BCP ceramic cylinders (U2 3mm) or cover- 490 nm by a multifunctional full wavelength microplate reader slips (U3 0.17 mm). The cell seeded BCP ceramic cylinders or cover- (Varioskan Flash, Thermo Scientific, USA). Each experiment was slips were the carefully transferred to the chambers. The open side of carried out in triplicate. each chamber was then sealed. The diffusion chambers were immersed in DMEM and then surgically inserted into a pocket subcutaneously at Polymerase chain reaction (PCR) assay for in vitro the back of adult New Zealand white rabbits under sodium barbital specimens anesthesia. The wound was carefully rinsed with 0.9% saline solution The gene expressions of VECs-related characteristic factors in- and then closed with suture. All rabbits received ampicillins at consecu- cluding KDR, vWF, vascular cell adhesion molecule-1 (VCAM-1) tive 3 days postoperatively. The animal experiment was approved by andCadherin5(CDH5)inthe BMSCsgrown on BCPceramic the Animal Care and Use Committee of Sichuan University and oper- discs or coverslips were analyzed by a real-time PCR (RT-PCR). ated based on the Guide for the Care and Use of Laboratory Animals After1,4,7 and10 daysof in vitro culture, the total RNA of published by National Academy of Sciences. samples was extracted using an RNeasy Mini Kit (Qiagen, Germany). For conversion of the RNA to complementary DNA (cDNA), an iScript cDNA Synthesis Kit (Bio-RAD, USA) was used. The RT-PCR reaction was carried out using a CFX96 RT- SEM observation PCR detection system (Bio-Rad, USA) with SsoFast EvaGreen At fourth day postoperatively, part of the diffusion chambers were re- Supermix (Bio-Rad, USA). The sequences of primers for KDR, trieved. The specimens were fixed with 2.5% glutaraldehyde for 1 day, vWF, VCAM-1, CDH5 and GAPDH genes (genus: rat) were given followed by dehydrated by an alcohol series (10, 20, 30, 40, 50, 65, in Table 1. GAPDH was selected as the housekeeping gene to nor- 80, 95, 100%, 10 min each time) and xylene (100%, 30 min). After malize the gene expressions. The DDCt-value method was critical point drying, the BMSCs seeded BCP ceramics were cut in half adopted to calculate the relative value of gene expression. Each along the long axis. The BMSCs on BCP ceramics or coverslips were specimen was analyzed in triplicate. observed by a field emission SEM (FE-SEM, S-4800, Hitachi, Japan). Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 132 Chen et al. PCR assay for the in vivo implants a proportion of BMSCs extended to become spindle-shaped, but After 1, 4, 7 and 10 days of implantation, the diffusion chambers others were mainly short rod-like, triangular or stelliform (Fig. 2a). were harvested and the BMSCs seeded BCP ceramics or coverslips The phenotype of isolated cells was characterized by flow cytomet- were retrieved. All the experiment procedures analyzing the expres- ric detection of the lineage-specific markers, demonstrating that the sion of KDR, vWF, VCAM-1 and CDH5 genes were the same as cells expressed high levels of CD29 (97.6%, Fig. 2b) and CD90 those used for in vitro cell culture samples. (99.6%, Fig. 2c), while low levels of CD34 (0.1%, Fig. 2d) and CD45 (2.7%, Fig. 2e). The result confirmed that the isolated cells were mesenchymal types [41]. Statistics analysis All data were expressed as mean6 standard deviation, and every ex- periment was performed at least in triplicate. The statistical analysis Migration of BMSCs was performed by a Student’s t-test, in which a one-way analysis of The migration behavior of BMSCs under different stimulation was variance (ANOVA) with Tukey’s post hoc test was used. A statisti- carried out using a transwell model and observed by CLSM. The cal difference was considered as P< 0.05. BMSCs were seeded in the upper chamber of the transwell inserts. In the bottom chamber, four types of materials were placed, i.e. BCP ceramic discs seeded with macrophages (Group A), coverslips seeded Results with macrophages (Group B), BCP ceramic discs without seeding Morphological observation and purity of BMSCs cells (Group C), and coverslips without seeding cells (Group D). As After 1 day of culture, primary cells attached, while most of the shown in Fig. 3, after cultured for 6 h, the BMSCs in the upper round cells with strong refractivity were erythrocyte. After attach- chambers migrated to the bottom chambers of Groups A, B and C. ment, BMSCs became rod-shaped or spindle-shaped. With the me- After cultured for 12 h, the migration degree of BMSCs increased dium change, the majority of the non-adherent cells were eliminated in an order of Group D< Group C Group B< Group A. After cul- and adherent cells (i.e. BMSCs) gradually proliferated. At passage 2, tured for 48 h, the migration of the BMSCs in Group A was Figure 1. Schematic illustration of the in vivo model to analyze the differentiation of BMSCs under a physiological environment Figure 2. Representative images showing the rat BMSCs morphologies at the second passage (a), scale bar: 200 mm. Flow cytometric detection of cell surface an- tigens CD 29 (b), CD 90 (c), CD 34 (d) and CD 45 (e) Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 133 Figure 3. The migration of BMSCs in the upper chamber of the transwell inserts toward BCP ceramic discs seeded with macrophages (a), coverslips seeded with macrophages (b), BCP ceramic without seeding cells (c) and coverslips without seeding cells (d) in the bottom chamber of the transwell inserts significantly higher than other groups, while the migration of significant difference in the cell proliferation rate was found between BMSCs in Group C was slightly higher than that of Group B. BCP ceramic and coverslip. After 10 days of culture, the cell number Almost no migration of BMSCs was found in Group D. The results on BCP ceramic was significantly higher than that on the coverslip indicated that BCP ceramic could promote the directional migration (P< 0.05). One probable reason was that the porous BCP ceramic pro- of BMSCs, and the migration was more significant under the syner- vided a broader 3D space for cell growth, whereas the cells on the cov- getic stimulations of macrophages and BCP ceramic. erslip fell off or died since the space for cell growth was limited. Morphology and viability of BMSCs cultured on BCP Gene expression of VECs characteristic factors in ceramic discs BMSCs (in vitro) To evaluate the effect of BCP ceramic on the cell morphology and vi- Figure 6 shows the quantitative gene expressions of VECs charac- ability, BMSCs were seeded onto the ceramic discs and cultured for teristic factors (KDR, vWF, VCAM-1 and CDH5) in BMSCs after 1, 4, 7 and 10 days. BMSCs cultured on coverslips were served as cultured on BCP ceramic discs for 1, 4, 7 and 10 days. The gene the control. The CLSM observation for the cell morphology and via- expression of cells cultured on coverslips was used as control. bility is shown in Fig. 4. With time prolongation, the number of the The gene expressions of KDR, vWF, VCAM-1 and CDH5 were cells grown on BCP ceramic discs or coverslips both increased signif- allup-regulatedbyBCP ceramicswhencomparedwithcontrol. icantly, and few dead cells were found, indicating high viability of For KDR and vWF, under the stimulation of BCP ceramics, the BMSCs and good biocompatibility of BCP ceramic. Besides, when gene expressions showed the maximum at the 1st day, and then compared with cells grown on coverslips, BMSCs grown on BCP ce- slightly decreased at the 4th day, following by significantly de- ramic showed more wide-spreading morphology, meaning that the creased at the 7th and 10th days. For VCAM-1, the highest gene ceramic supported the cell growth well. expression was showed at the fourth day and then decreased slowly. For CDH5, the gene expression began to decrease after BMSCs proliferation reaching the maximum at the first day, but there was a slight in- MTT assay was used to compare the proliferation of BMSCs on BCP crease at the seventh day and then decreased again. The expres- ceramic discs and the coverslips. The results are shown in Fig. 5.The sions of all the four characteristic factors were significantly number of BMSCs grown on both BCP ceramics and coverslips in- higher than those of the control group, indicating that BMSCs creased gradually with time prolongation, which was well in accor- differentiate toward endothelial cells under the stimulation of dance with the above CLSM observation. At the first 7 days, no BCP ceramic at the gene level. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 134 Chen et al. Figure 4. CLSM observation for BMSCs grown on BCP ceramic discs (a) and coverslips (b) at high and low magnification after 1, 4, 7 and 10 days in vitro culture. Scale bar for low magnification: 500 lm; for high magnification: 100 lm Figure 5. MTT assay for the proliferation of BMSCs on BCP ceramic discs and coverslips after 1, 4, 7 and 10 days in vitro culture. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05 Protein expression of VECs characteristic factors in analyzed by ELISA kit. As shown in Fig. 7, the protein expressions of KDR, vWF, VCAM-1, CDH5 were all up-regulated by BCP ce- BMSCs (in vitro) ramic when compared with the control group. For KDR and The intracellular and extracellular protein expressions of VECs VCAM-1 (Fig. 7a and c), under the stimulation of BCP ceramic, the characteristic factors (KDR, vWF, VCAM-1 and CDH5) were Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 135 Figure 6. Expressions of KDR (a), vWF (b), VCAM-1 (c) and CDH5 (d) of BMSCs on the BCP ceramic discs and coverslips after 1, 4, 7 and 10 days in vitro culture. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05; **P< 0.01; ***P< 0.001 Figure 7. The intracellular and extracellular protein expression of KDR (a), vWF (b), VCAM-1 (c) and CDH5 (d) of BMSCs on the BCP ceramic discs and coverslips after 1, 4, 7 and 10 days in vitro culture. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05; ***P< 0.001 Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 136 Chen et al. intracellular expressions both reached the maximum value at the Discussion seventh day, whereas the maximum value of extracellular expres- As a promising biomaterial used in bone tissue engineering, porous sions appeared on the fourth day. For vWF (Fig. 7b), the intracellu- CaP ceramics present excellent osteoinductivity, but the mechanism lar and extracellular expressions both reached the maximum value is still not fully understood [9–20]. The relationship between vascu- at the fourth day, whereas the maximum value of extracellular ex- larization and osteogenesis of CaP ceramics has been intensively in- pression appeared on the fourth day. For CDH5 (Fig. 7d), the intra- vestigated in order to reveal the mechanism [9, 20, 24, 42, 43]. In cellular expression reached the maximum value at the fourth day, our previous work, the abundant vascular network formed in the in- whereas the maximum value of extracellular expression appeared ner pores of the implants after 4 weeks postoperatively when porous on the seventh day. Similar to the results of gene expressions, the CaP ceramics were implanted in the thigh muscle of mice [9]. The protein expressions of all the four characteristic factors were signifi- rapid vascularization should be undoubtedly advantageous for new cantly higher than those of the control group, indicating that bone formation in the CaP ceramics, because it will bring about var- BMSCs differentiate toward endothelial cells under the stimulation ious functional cells, growth factors and other nutrient substances of BCP ceramic at the protein level. [44]. Thus far, it is still controversial that whether or not a biomate- rial can induce angiogenesis. In fact, the formation of blood vessels requires a large amount of VECs. Moreover, it has been confirmed Adhesion of BMSCs on BCP ceramic in diffusion that CaP ceramics can promote proliferation and angiogenesis of chamber HUVECs [24, 45]. At the early stage after a biomaterial implanta- The adhesion of BMSCs seeded on BCP ceramic cylinders or cover- tion, the inflammatory response of the host leads to the aggregation slips in the diffusion chamber after 4 days of in vivo implantation of various inflammatory cells, MSCs and other progenitor cells at were checked by SEM (Fig. 8). It was observed that the BMSCs were the implanting site. Therefore, we designed the in vitro and in vivo well attached on BCP ceramic and coverslip under the real physio- experiments by using two types of cells, i.e. macrophages and MSCs logical environment, indicating that both materials had good bio- to verify if the CaP ceramics could recruit MSCs combing with mac- compatibility and can support the adhesion and spreading of rophages and further stimulate their differentiation toward VECs, BMSCs. providing the cell source forming new blood vessels. The migration of BMSCs was evaluated by using a transwell model. The transwell inserts with 8-mm pore membrane filter, which Gene expression of VECs characteristic factors in allows the nutrients, signaling molecules and proteins to pass through, BMSCs (in vivo) while inhibits the transit of cells unless the cells become invasive in re- The in vivo diffusion chamber model was used to evaluate the pos- sponse to certain chemotactic cues. Under the stimulation of BCP ce- sibility of BMSCs differentiation toward VECs under the stimula- ramic, the BMSCs seeded on the upper chamber gradually migrated tion of BCP ceramic in the real physiological environment. After 1, toward the material in the bottom chamber with time prolongation, 4, 7 and 10 days of culture in vivo, the diffusion chambers were and the macrophages seeded on the ceramic discs in advance further harvested and the BCP ceramic cylinders or coverslips were re- promoted the migration of BMSCs (Fig. 3a and c). As one of the most trieved. The gene expressions of VECs characteristic factors in the important inflammatory cells, macrophages can modulate a series of BMSCs were analyzed by PCR assay, and the results are shown in biological response by secreting a variety of inflammatory cytokines Fig. 9. Similar to the in vitro results, the gene expressions of KDR, and growth factors, and these signalling molecules play a vital role in vWF, VCAM-1 and CDH5 in vivo were all up-regulated by BCP cellular processes involving in tissue regeneration [25, 29, 46–48]. ceramic when compared with the control. For KDR and VCAM-1, The previous reports showed that macrophage cytokine secretion was under the stimulation of BCP ceramic, the gene expression showed highly dependent on the properties of the substrate materials [49–54]. the maximum value at the fourth day, and then slightly decreased. Besides, CaP ceramics have strong protein adsorption ability, espe- For vWF, the highest gene expression was showed at the first and cially for some growth factors, such as bone morphogenetic protein 2 seventh days. For CDH5, the gene expression began to decrease af- (BMP-2), VEGF, TGF-b1 and so on [9, 55–58]. Therefore, the syner- ter reaching the maximum value at the first day. All the results gistic stimulation of BCP ceramic and macrophages was stronger than demonstrated that BMSCs had phenotypically differentiated into that of the inert coverslip and macrophages (Fig. 3a and b). VECs under the stimulation of BCP ceramic in the real physiologi- To verify if the BMSCs can differentiate toward VECs under the cal environment. stimulation of BCP ceramic, an in vitro co-culture of BCP ceramic and BMSCs was performed at first. The ceramic showed good biocompati- bility and supported the cell growth well (Figs 4 and 5). After 1, 4, 7 and 10 days of culture, the PCR and ELISA analysis were made to evaluate the gene expressions and protein secretions of the characteris- tic factors of VECs, i.e. KDR, vWF, VCAM-1 and CDH5. When com- pared with the control group, all the four characteristic factors were significantly up-regulated by BCP ceramic at both gene and protein levels (Figs 6 and 7). Next, an in vivo diffusion chamber model simu- lating the real physiological environment, which allows penetration of the body fluids containing various ions, signaling molecules and other nutrients but prevents invasion of the foreign cells and the immune re- jection by the host, was used for co-culture of BCP ceramic and Figure 8. SEM images of the BMSCs seeded on the BCP ceramic discs (a) and BMSCs. After 1, 4, 7 and 10 days of in vivo culture, the BMSCs at- coverslips (b) enclosed in the diffusion chambers after subcutaneously implanted in vivo for 4 days. Scale bar: 5 lm tached on BCP ceramic tightly and showed good spreading (Fig. 8). Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 137 Figure 9. Expressions of KDR (a), vWF (b), VCAM-1 (c) and CDH5 (d) of BMSCs on the BCP ceramic discs and coverslips enclosed in the diffusion chambers after subcutaneously implanted in vivo for 1, 4, 7 and 10 days. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05; **P< 0.01; ***P< 0.001 Similar to the in vitro results, the gene expressions of KDR, vWF, by the ceramic, which could participate the formation and arrange- VCAM-1 and CDH5 were all up-regulated by BCP ceramic to differ- ment of new blood vessels and further promote the new bone forma- ent degrees when compared with the control group (Fig. 9). It is tion. This study could give some useful guidance to explain the rapid known that MSCs are multipotent stem cells and can differentiate to- vascularization of CaP ceramics and provide the useful support to re- ward various cell types, such as adipocytes, osteoblasts, chondrocytes, veal the mechanism of osteoinduction by the ceramics. neuronal cells and so on, depending on the property of the substrate material and the cellular microenvironment [33, 34, 59–63]. Some previous reports showed that MSCs could differentiate into VECs un- Acknowledgements der certain condition [38–40]. The results in this study give the suffi- This study was financially supported by the National Natural Science cient proof that CaP ceramics have the potential to stimulate the Foundation of China (31370973, 31400819), the National Key Research and differentiation of BMSCs into VECs. Development Program of China (2016YFC1102000, 2016YFC1102003) and Our findings in this study may provide better support to reveal the the “111” Project of China (B16033). mechanism of vascularization and osteoinduction of porous CaP ce- Conflict of interest statement. None declared. ramics. After implantation, the CaP ceramics mediated inflammatory response would firstly recruit the aggregation of macrophages from nearby tissues and the circulation system in the inner pores of the im- References plant. Then, the macrophages secrete various signalling molecules un- 1. Henkel J, Woodruff MA, Epari DR et al. Bone regeneration based on tis- der the stimulation of the ceramic, which could further recruit MSCs sue engineering conceptions—a 21st century perspective. Bone Res 2013; and promote their proliferation and differentiate toward VECs or os- 1:216. teoblasts based on the different implantation period and the cellular 2. Laurencin C, Khan Y, El-Amin SF. Bone graft substitutes. Exp Rev Med microenvironment around the implant. The VECs in the CaP ceramics Dev 2006; 3:49–57. participate the formation and arrangement of new blood vessels, 3. Stevens B, Yang Y, Mohandas A et al. A review of materials, fabrication which further promote the subsequent new bone formation, in other methods, and strategies used to enhance bone regeneration in engineered words, lead to the happening of osteoinduction by the ceramics. bone tissues. J Biomed Mater Res B: Appl Biomater 2008; 85B:573–82. 4. Garcia-Gareta E, Coathup MJ, Blunn GW. Osteoinduction of bone grafting materials for bone repair and regeneration. Bone 2015; 81:112–21. Conclusion 5. Fillingham Y, Jacobs J. Bone grafts and their substitutes. Bone Joint J 2016; 98-B:6–9. This study puts forward a possibility for the origin of VECs during the 6. Eliaz N, Metoki N. Calcium phosphate bioceramics: a review of their his- rapid vascularization process after in vivo implantation of porous CaP tory, structure, properties, coating technologies and biomedical applica- ceramics. According to the in vitro and in vivo experimental results, tions. Materials 2017; 10:334. the synergistic effect of BCP ceramic with the seeded macrophages in 7. Ohtsuki C, Kamitakahara M, Miyazaki T. Bioactive ceramic-based mate- advance promoted the directional migration of BMSCs toward the ma- rials with designed reactivity for bone tissue regeneration. J R Soc Interf terial. Then, the BMSCs were stimulated to differentiate toward VECs 2009; 6:S349–S60. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 138 Chen et al. 8. Shao R, Quan R, Zhang L et al. Porous hydroxyapatite bioceramics in 33. Wang J, Liu D, Guo B et al. Role of biphasic calcium phosphate ceramic- bone tissue engineering: current uses and perspectives. J Ceram Soc Jpn mediated secretion of signaling molecules by macrophages in migration and 2015; 123:17–20. osteoblastic differentiation of MSCs. Acta Biomaterialia 2017; 51:447–60. 9. Wang J, Chen Y, Zhu X et al. Effect of phase composition on protein 34. Chen X, Wang J, Chen Y et al. Roles of calcium phosphate-mediated adsorption and osteoinduction of porous calcium phosphate ceramics in integrin expression and MAPK signaling pathways in the osteoblastic mice. J Biomed Mater Res A 2014; 102:4234–43. differentiation of mesenchymal stem cells. J Mater Chem B 2016; 4: 10. Groen N, Yuan H, Hebels DGAJ et al. Linking the transcriptional land- 2280–9. scape of bone induction to biomaterial design parameters. Adv Mater 35. Li X, Dai Y, Shen T et al. Induced migration of endothelial cells into 3D (Deerfield Beach, Fla) 2017; 29:1603259. scaffolds by chemoattractants secreted by pro-inflammatory macrophages 11. Yuan H, Fernandes H, Habibovic P et al. Osteoinductive ceramics as a in situ. Regen Biomater 2017; 4:139–48. synthetic alternative to autologous bone grafting. Proc Natl Acad Sci U S 36. Guadix JA, Zugaza JL, Galvez-Martin P. Characteristics, applications and A 2010; 107:13614–9. prospects of mesenchymal stem cells in cell therapy. Medicina Clinica 12. Barradas AMC, Yuan H, van Blitterswijk CA et al. Osteoinductive bioma- 2017; 148:408–14. terials: current knowledge of properties, experimental models and biologi- 37. Nardi NB, da Silva Meirelles L. Mesenchymal stem cells: isolation, in vitro cal mechanisms. Eur Cells Mater 2011; 21:407–29. expansion and characterization. Stem cells. New York: Springer, 2008, 13. Habibovic P, Sees TM, van den Doel MA et al. Osteoinduction by bioma- 249–82. terials—Physicochemical and structural influences. J Biomed Mater Res A 38. Peng J, Chi L. Effect of cell-cell direct contact to mesenchymal stem cells 2006; 77:747–62. differentiate into vascular endothelial cells. Heart 2012; 98:E100. 14. Habibovic P, de Groot K. Osteoinductive biomaterials—properties and 39. Silva GV, Litovsky S, Assad JA et al. Mesenchymal stem cells differentiate relevance in bone repair. J Tissue Eng Regen Med 2007; 1:25–32. into an endothelial phenotype, enhance vascular density, and improve heart 15. Bouler JM, Pilet P, Gauthier O et al. Biphasic calcium phosphate ceramics function in a canine chronic ischemia model. Circulation 2005; 111:150–6. for bone reconstruction: a review of biological response. Acta 40. Oswald J, Boxberger S, Jørgensen B et al. Mesenchymal stem cells can be dif- Biomaterialia 2017; 53:1–12. ferentiated into endothelial cells in vitro. Stem Cells 2004; 22:377–84. 16. Bohner M, Galea L, Doebelin N. Calcium phosphate bone graft substi- 41. Tasso R, Augello A, Boccardo S et al. Recruitment of a host’s osteoproge- tutes: Failures and hopes. J Eur Ceram Soc 2012; 32:2663–71. nitor cells using exogenous mesenchymal stem cells seeded on porous ce- 17. Samavedi S, Whittington AR, Goldstein AS. Calcium phosphate ceramics ramic. Tissue Eng A 2009; 15:2203–12. in bone tissue engineering: a review of properties and their influence on 42. Zhi W, Zhang C, Duan K et al. A novel porous bioceramics scaffold by ac- cell behavior. Acta Biomaterialia 2013; 9:8037–45. cumulating hydroxyapatite spherulites for large bone tissue engineering 18. LeGeros RZ. Calcium phosphate-based osteoinductive materials. Chem in vivo. II. Construct large volume of bone grafts. J Biomed Mater Res A Rev 2008; 108:4742–53. 2014; 102:2491–501. 19. Yuan H, Yang Z, Li Y et al. Osteoinduction by calcium phosphate bioma- 43. Zhang C, Huang P, Weng J et al. Histomorphological researches on large po- terials. J Mater Sci: Mater Med 1998; 9:723–6. rous hydroxyapatite cylinder tubes with polylactic acid surface coating in dif- 20. Li J, Zhi W, Xu T et al. Ectopic osteogenesis and angiogenesis regulated ferent nonskeletal sites in vivo. JBiomedMater ResA 2012; 100:1203–8. by porous architecture of hydroxyapatite scaffolds with similar intercon- 44. Kanczler JM, Oreffo ROC. Osteogenesis and angiogenesis: the potential necting structure in vivo. Regen Biomater 2016; 3:285–97. for engineering bone. Eur Cells Mater 2008; 15:100–14. 21. Yu H, VandeVord PJ, Mao L et al. Improved tissue-engineered bone re- 45. Zhang M, Wu C, Li H et al. Preparation, characterization and in vitro an- generation by endothelial cell mediated vascularization. Biomaterials giogenic capacity of cobalt substituted beta-tricalcium phosphate ce- 2009; 30:508–17. ramics. J Mater Chem 2012; 22:21686–94. 22. Zhou J, Lin H, Fang T et al. The repair of large segmental bone defects in 46. Behm B, Babilas P, Landthaler M et al. Cytokines, chemokines and growth the rabbit with vascularized tissue engineered bone. Biomaterials 2010; factors in wound healing. J Eur Acad Dermatol Venereol 2012; 26:812–20. 31:1171–9. 47. Barrientos S, Stojadinovic O, Golinko MS et al. Growth factors and cyto- 23. Li H, Xue K, Kong N et al. Silicate bioceramics enhanced vascularization kines in wound healing. Wound Repair Regen 2008; 16:585–601. and osteogenesis through stimulating interactions between endothelia 48. Devescovi V, Leonardi E, Ciapetti G et al. Growth factors in bone repair. cells and bone marrow stromal cells. Biomaterials 2014; 35:3803–18. La Chirurgia Degli Organi Di Movimento 2008; 92:161–8. 24. Chen Y, Wang J, Zhu X et al. Enhanced effect of b-tricalcium phosphate 49. Brodbeck WG, Nakayama Y, Matsuda T et al. Biomaterial surface chem- phase on neovascularization of porous calcium phosphate ceramics: in vi- istry dictates adherent monocyte/macrophage cytokine expression in vitro. tro and in vivo evidence. Acta Biomaterialia 2015; 11:435–48. Cytokine 2002; 18:311–9. 25. Anderson JM, Rodriguez A, Chang DT. Foreign body reaction to biomate- 50. Schutte RJ, Parisi-Amon A, Reichert WM. Cytokine profiling using mono- rials. Semin Immunol 2008; 20:86–100. cytes/macrophages cultured on common biomaterials with a range of sur- 26. Sheikh Z, Brooks PJ, Barzilay O et al. Macrophages, foreign body giant face chemistries. J Biomed Mater Res A 2009; 88:128–39. cells and their response to implantable biomaterials. Materials 2015; 8: 51. Almeida CR, Serra T, Oliveira MI et al. Impact of 3-D printed PLA- and 5671–701. chitosan-based scaffolds on human monocyte/macrophage responses: un- 27. Velnar T, Bunc G, Klobucar R et al. Biomaterials and host versus graft re- raveling the effect of 3-D structures on inflammation. Acta Biomaterialia sponse: a short review. Bosn J Basic Med Sci 2016; 16:82–90. 2014; 10:613–22. 28. Martin P, Leibovich SJ. Inflammatory cells during wound repair: the 52. Blakney AK, Swartzlander MD, Bryant SJ. The effects of substrate stiffness on good, the bad and the ugly. Trends Cell Biol 2005; 15:599–607. the in vitro activation of macrophages and in vivo host response to poly(ethyl- 29. Dimitriou R, Tsiridis E, Giannoudis PV. Current concepts of molecular as- ene glycol)-based hydrogels. JBiomedMater Res A 2012; 100:1375–86. pects of bone healing. Injury 2005; 36:1392–404. 53. Chen S, Jones JA, Xu Y et al. Characterization of topographical effects on 30. Rundle CH, Wang H, Yu H et al. Microarray analysis of gene expression macrophage behavior in a foreign body response model. Biomaterials during the inflammation and endochondral bone formation stages of rat 2010; 31:3479–91. femur fracture repair. Bone 2006; 38:521–9. 54. Bota PCS, Collie AMB, Puolakkainen P et al. Biomaterial topography 31. Selders GS, Fetz AE, Radic MZ et al. An overview of the role of neutro- alters healing in vivo and monocyte/macrophage activation in vitro. phils in innate immunity, inflammation and host-biomaterial integration. J Biomed Mater Res A 2010; 95A:649–57. Regen Biomater 2017; 4:55–68. 55. Wang J, Zhang HJ, Zhu XD et al. Dynamic competitive adsorption of 32. Mountziaris PM, Mikos AG. Modulation of the inflammatory response bone-related proteins on calcium phosphate ceramic particles with different for enhanced bone tissue regeneration. Tissue Eng B: Rev 2008; 14: phase composition and microstructure. JBiomedMater ResB 2013; 101B: 179–86. 1069–77. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 139 56. Zhu XD, Fan HS, Xiao YM et al. Effect of surface structure on protein 60. Guo L, Kawazoe N, Fan Y et al. Chondrogenic differentiation of human adsorption to biphasic calcium-phosphate ceramics in vitro and in vivo. mesenchymal stem cells on photoreactive polymer-modified surfaces. Acta Biomaterialia 2009; 5:1311–8. Biomaterials 2008; 29:23–32. 57. Zhu XD, Zhang HJ, Fan HS et al. Effect of phase composition and micro- 61. Lu H, Guo L, Wozniak MJ et al. Effect of cell density on adipogenic differ- structure of calcium phosphate ceramic particles on protein adsorption. entiation of mesenchymal stem cells. Biochem Biophys Res Commun Acta Biomaterialia 2010; 6:1536–41. 2009; 381:322–7. 58. Chen Y, Wang J, Zhu X et al. Adsorption and release behaviors of vascu- 62. Zhang L, Yuan T, Guo L et al. An in vitro study of collagen hydrogel to in- lar endothelial growth factor on porous hydroxyapatite ceramic under duce the chondrogenic differentiation of mesenchymal stem cells. competitive conditions. J Biomater Tissue Eng 2014; 4:155–61. J Biomed Mater Res A 2012; 100A:2717–25. 59. Hankamolsiri W, Manochantr S, Tantrawatpan C et al. The effects of 63. Miao Z, Sun H, Xue Y. Isolation and characterization of human chorionic high glucose on adipogenic and osteogenic differentiation of gestational membranes mesenchymal stem cells and their neural differentiation. tissue-derived MSCs. Stem Cells Int 2016; 2016:9674614. Tissue Eng Regen Med 2017; 14:143–51. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Regenerative Biomaterials Oxford University Press

The directional migration and differentiation of mesenchymal stem cells toward vascular endothelial cells stimulated by biphasic calcium phosphate ceramic

Download PDF
11 pages

Loading next page...
 
/lp/ou_press/the-directional-migration-and-differentiation-of-mesenchymal-stem-fCOzbdszRB

References (66)

Publisher
Oxford University Press
Copyright
© The Author(s) 2017. Published by Oxford University Press.
ISSN
2056-3418
eISSN
2056-3426
DOI
10.1093/rb/rbx028
Publisher site
See Article on Publisher Site

Abstract

Osteoinductivity of porous calcium phosphate (CaP) ceramics has been widely investigated and confirmed, and it might be attributed to the rapid formation of the vascular networks after in vivo implantation of the ceramics. In this study, to explore the vascularization mechanism within the CaP ceramics, the migration and differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) under the stimulation of porous biphasic calcium phosphate (BCP) ceramic with excellent osteoinductivity were systematically investigated. The results indicated that the directional migra- tion of BMSCs toward BCP ceramic occurred when evaluated by using a transwell model, and the BMSCs migration was enhanced by the seeded macrophages on the ceramic in advance. Besides, by directly culturing BMSCs on BCP ceramic discs under both in vitro and in vivo physiological en- vironment, it was found that the differentiation of BMSCs toward vascular endothelial cells (VECs) happened under the stimulation of BCP ceramic, as was confirmed by the up-regulated gene expressions and protein secretions of VECs-related characteristic factors, including kinase insert domain receptor, von willebrand factor, vascular cell adhesion molecule-1 and cadherin 5 in the BMSCs. This study offered a possibility for explaining the origin of VECs during the rapid vasculari- zation process after in vivo implantation of porous CaP ceramics and could give some useful guid- ance to reveal the vascularization mechanism of the ceramics. Keywords: BCP ceramic; vascularization; BMSCs; VECs; migration; differentiation bone-grafting substitutes, calcium phosphate (CaP) ceramics are Introduction promising candidates for clinical use. This is not only due to their Every year, millions of bone grafting procedures are performed excellent biocompatibility and osteoconductivity [6–8], but also worldwide, needing a large number of bone substitutes [1]. their widely confirmed osteoinductivity [9–20]. However, the Nowadays, autografts and allografts are still the most common solu- osteoinduction mechanism by CaP ceramics is so far unclear. It is tions for bone defects over the critical size in clinical application well known that vascularization plays a key role in the healing pro- [2–4]. However, they have some disadvantages such as the finite re- cess of bone fractures, and bone regeneration after a biomaterial im- source, the additional invasive surgery, the risk of transmission of plantation is highly dependent on the formation of abundant infectious diseases, and the immunological rejection by the host [3]. vascular networks within the implant [21–24]. Thus, the excellent In such cases, artificially synthesized biomaterials for the repair of osteoinductivity of CaP ceramics might be closely related to their bone defects were proposed [4, 5]. Among the current synthetic vascularization capacities. V C The Author(s) 2017. Published by Oxford University Press. 129 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 130 Chen et al. To demonstrate the relationship between angiogenesis and os- Materials and methods teogenesis of CaP ceramics, in our previous work, four types of po- Materials rous CaP ceramics, i.e. hydroxyapatite (HA), biphasic calcium BCP-2 ceramic (HA/b-TCP30/70) was used for the in vitro and phosphates (BCP-1 with HA/b-TCP70/30 and BCP-2 with HA/b- in vivo experiments, which was fabricated according to our previous TCP30/70) and b-tricalcium phosphate (b-TCP), were investi- method [9]. In brief, BCP precursor powders synthesized by wet pre- gated in terms of their vascularization and osteogenesis [9, 24]. cipitations were made into the slurries, which were foamed by H O 2 2 The results revealed that only after 4 weeks of in vivo implantation and then poured into the special mould. After rapid drying at 180 C into the thigh muscles of mice, the mature vascular networks had in an oven, the green bodies were sintered at 1100 C for 2 h in a been formed within the ceramics. The vascularization could be due muffle furnace and then cut into the discs (U14 1.5 mm for trans- to the up-regulated expression of vascular endothelial growth fac- well model, U14 2 mm for in vitro cell culture) or cylinders tors (VEGF) and the enhanced proliferation of vascular endothelial (U2 3 mm for in vivo implantation). The round coverslips cells (VECs) under the stimulation of CaP ceramics [24]. However, (U14 0.17 mm for in vitro cell culture, U3 0.17 mm for in vivo the previous works had not explicated the origin of the VECs. implantation) were used as the control materials. Prior to use, all the Besides the ingrowth of blood vessels from the nearby tissues, is it specimens were sterilized by c-ray irradiation at the dose of 25 kGy. possible that spontaneous formation of new blood vessels within the ceramics? As we know, after a biomaterial being implanted into the body, an inflammatory response happens, accompanying Isolation of rat BMSCs and flow cytometric detection of with the migration of first neutrophils and then macrophages from cell surface antigens nearby tissues and the circulation system into the implanting posi- Rat BMSCs were isolated from bone marrow of the femurs and tib- tion [25–28]. These aggregated inflammatory cells secret a host of ias of newly born SD rats, and cultured in a-minimum essential me- chemokines such as interleukin-1 (IL-1), IL-6, IL-11, IL-18, tumor dium (a-MEM) (Gibco, NY, USA) supplemented with 10% fetal necrosis factor-a (TNF-a) and transforming growth factor-b1 bovine serum (FBS, Gibco), 100 U/ml penicillin, and 100 lg/ml (TGF-b1) [29–31], promoting the further recruitment of mesen- streptomycin [34]. The phenotype of isolated cells was characterized chymal stem cells (MSCs) and other cells [24, 32–35]. As a multi- by analyzing the cell surface antigens CD29, CD34, CD45 and potent stem cells that can differentiate into different cell types, CD90. In brief, digested P2 BMSCs were rinsed in PBS and resus- depending on the cellular microenvironment [36, 37], is it possible pended in PBS to get a cell suspension at density of 5 10 cells/ml. that the MSCs differentiate toward VECs under the stimulation of The monoclonal antibodies (Biolegend, USA), i.e. CD29 (Alexa CaP ceramics, thereby offering the source of VECs for the forma- Fluor 647 anti-mouse/rat), CD34 (FITC anti-human), CD45 (Alexa tion of new blood vessels? Fluor 488 anti-mouse), and CD90 (Alexa Fluor 700 anti-human), So far, some previous reports indicated that MSCs could phe- were added separately, followed by 45 min of incubation in the dark notypically and functionally differentiated into VECs under at 37 C. Labeled BMSCs were rinsed by PBS, centrifuged at 200g certain conditions. Peng and Chi [38] co-cultured bone marrow- for 5 min and resuspended in PBS, and then were analyzed using a derived mesenchymal stem cells (BMSCs) with human umbilical flow cytometer (Cytomics FC500, Beckman, USA). Unstained cells vein endothelial cells (HUVECs), and found that the direct cell– were used as the control. cell contact and talk between the two types of cells initiated the differentiation of BMSCs toward VECs. The mechanism may be Transwell migration assay closely related to the promotion of VEGF secretion after the direct Cell migration assay was performed using a transwell model with cell–cell contact and the cell fusion. Silva et al. [39] constructed 8 lm pore membrane filters (Corning Inc., USA). BMSCs were a chronic ischemic model of dogs and injected BMSCs grown to subconfluence (70%) prior to harvest by trypsinization (100  10 cells/10 ml saline) intraperitoneally. At 60 days postop- and labeling with CellTracker green (1 lM, invitrogen, USA) for 1 h eratively, the histological analysis and immunohistochemical stain- at 37 C. The fluorescently labeled BMSCs (1 10 cells/ml, 200 ml ing confirmed that the BMSCs differentiated into an endothelial per well) were seeded in the upper chamber of the transwell. Four phenotype, thereby enhancing the vascular density and improving types of materials were placed in the bottom chamber, i.e. BCP ce- cardiac function. Oswald et al. [40] cultured BMSCs in the pres- ramic discs (U14 1.5 mm) seeded with macrophages, coverslips ence of 2% fetal calf serum and 50 ng/ml VEGF, and observed a (U14 0.17 mm) seeded with macrophages, BCP ceramic discs with- strong increase of expression of endothelial-specific markers in- out seeded cells, and coverslips without seeded cells. The macro- cluding kinase insert domain receptor (KDR), FLT-1 and von phages were labeled by CellTracker CM-DiI with red fluorescence Willebrand factor (vWF). (1 lM, MAIBIO, China) and the cell seeding density was 1 10 Therefore, to explore the vascularization mechanism of porous cells/well. After incubation for 3, 6, 12, 24 and 48 h, the specimens CaP ceramics after in vivo implantation, in this study, the possibility in the bottom chamber were carefully taken out to check the BMSCs of the oriented migration of BMSCs toward the ceramics and the migration using a confocal laser scanning microscopy (CLSM, TCS differentiation of BMSCs into VECs under the stimulation of the ce- SP5, Leica, Germany). Each experiment was performed in triplicate. ramics were evaluated via in vitro and in vivo models. As we re- ported before, after implantation into the thigh muscle of mice, BCP-2 showed better osteogenesis and vascularization among the BMSCs culture in vitro used four CaP ceramics [9, 24]. Hence, BCP-2 (HA/b-TCP30/70) BCP ceramic discs (U14 2 mm) and round coverslips were used as the material model in this study. The migration and dif- (U14 0.17 mm) were placed in 24-well plates. The BMSCs (P3) ferentiation of BMSCs were carried out by using a transwell model were harvested by treatment with a trypsin/EDTA solution af- and directly culturing BMSCs on the ceramics under an in vitro or ter reaching confluence. The harvested BMSCs were resuspended in in vivo physiological environment, respectively. a Dulbecco’s modified eagle medium (DMEM, Gibco, USA) to Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 131 Table 1. The primers and probes for real-time PCR Target Forward primer Reverse primer GAPDH CTCAACTACATGGTCTACATGTTC CCCATTCTCGGCCTTGACT KDR GATGTTGAAAGAGGGAGCAAC ACATAGTCTTTCCCAGAGCGG vWF ACTTTGAGGTGGTGGAGTCG CCTGTTCCTGGTATGTGTGC VCAM-1 CCCAAACAGAGGCAGAGTGT AGCAGGTCAGGTTCACAGGA CDH5 CATCGCAGAGTCCCTCAGTT TCAGCCAGCATCTTGAACCT prepare a cell suspension at density of 2 10 cells/ml for cell Quantitative assay of protein expression seeding. 1 ml of the cell suspension was added dropwise to the After cultured for 1, 4, 7 and 10 days, the total intracellular and ex- BCP ceramic discs or coverslips. The cells on the specimens were cul- tracellular proteins in the BMSCs cultured on BCP ceramic discs or tured in DMEM supplemented with 10% FBS (Beijing Minhai coverslips were collected. The intracellular proteins of the cells were Biotechnology, China) and 1% penicillin/streptomycin at 37 Cin extracted by a CytoBuster protein extraction reagent (Novagen, an atmosphere of 5% CO . The media were replaced at the 1st, 4th, USA) according to manufacturer’s instruction. The extracellular 7th and 10th days. All the supernatants were collected and stored at proteins were obtained by collecting the supernatants after cell cul- 80 C for subsequent analysis. ture. Quantitative analysis for the secreted KDR, vWF, VCAM-1, CDH5 proteins was carried out by using an enzyme-linked immuno- sorbent assay (ELISA, Cloud-Clone Corp., USA). The total amount Cell morphology and viability of intracellular and extracellular proteins was also assayed by a Live/dead staining was carried out to evaluate cell morphology and BCA Protein Assay Kit (Pierce, USA) and then used to normalize the viability by using the fluorescein diacetate (FDA, Topbio Science, protein expressions of the KDR, vWF, VCAM-1 and CDH5. Each China) and propidium iodide (PI, Topbio Science, China) according experiment was carried out in triplicate. to the specification. After being cultured for 1, 4, 7 and 10 days, the samples were washed twice with warm PBS and incubated in serum- free DMEM containing FDA and PI for 15 min. The stained samples were observed by CLSM. In the live/dead staining, the live cells In vivo implantation would be dyed green after reacting with FDA, while the dead cells To analysis the effects of BCP ceramics on the differentiation of would be dyed red after reacting with PI. Each experiment was car- BMSCs toward VECs in a real physiological environment, an in vivo ried out in triplicate. model was established as shown in Fig. 1. The diffusion chamber was composed of a middle ring (U6.7 5 mm, cut from 96-well cell culture plate) and both ends of membranes (0.22 mm in pore size, Millipore, Cell proliferation assay USA). The membranes were fixed on the ring by using DMSO as a The proliferation of BMSCs cultured on BCP ceramics or coverslips binder. Prior to use, only one side of membrane was sealed to the were detected by an MTT assay. The cells were incubated with chamber, which was sterilized by c-irradiation. When reached 80% 0.5 mg/ml MTT for 4 h at 37 C. The liquid in every well was re- confluence, the BMSCs (P3) were trypsinized, counted, centrifuged and moved and then dimethyl sulphoxide (DMSO) was added to each resuspended in DMEM to get a cell suspension at the density of well for dissolution of the produced purple formazan salts. The opti- 5 10 cells/ml. The cell suspension (40 ml for each sample) was then cal density (O. D.) values were measured at the wavelength of added dropwise onto the BCP ceramic cylinders (U2 3mm) or cover- 490 nm by a multifunctional full wavelength microplate reader slips (U3 0.17 mm). The cell seeded BCP ceramic cylinders or cover- (Varioskan Flash, Thermo Scientific, USA). Each experiment was slips were the carefully transferred to the chambers. The open side of carried out in triplicate. each chamber was then sealed. The diffusion chambers were immersed in DMEM and then surgically inserted into a pocket subcutaneously at Polymerase chain reaction (PCR) assay for in vitro the back of adult New Zealand white rabbits under sodium barbital specimens anesthesia. The wound was carefully rinsed with 0.9% saline solution The gene expressions of VECs-related characteristic factors in- and then closed with suture. All rabbits received ampicillins at consecu- cluding KDR, vWF, vascular cell adhesion molecule-1 (VCAM-1) tive 3 days postoperatively. The animal experiment was approved by andCadherin5(CDH5)inthe BMSCsgrown on BCPceramic the Animal Care and Use Committee of Sichuan University and oper- discs or coverslips were analyzed by a real-time PCR (RT-PCR). ated based on the Guide for the Care and Use of Laboratory Animals After1,4,7 and10 daysof in vitro culture, the total RNA of published by National Academy of Sciences. samples was extracted using an RNeasy Mini Kit (Qiagen, Germany). For conversion of the RNA to complementary DNA (cDNA), an iScript cDNA Synthesis Kit (Bio-RAD, USA) was used. The RT-PCR reaction was carried out using a CFX96 RT- SEM observation PCR detection system (Bio-Rad, USA) with SsoFast EvaGreen At fourth day postoperatively, part of the diffusion chambers were re- Supermix (Bio-Rad, USA). The sequences of primers for KDR, trieved. The specimens were fixed with 2.5% glutaraldehyde for 1 day, vWF, VCAM-1, CDH5 and GAPDH genes (genus: rat) were given followed by dehydrated by an alcohol series (10, 20, 30, 40, 50, 65, in Table 1. GAPDH was selected as the housekeeping gene to nor- 80, 95, 100%, 10 min each time) and xylene (100%, 30 min). After malize the gene expressions. The DDCt-value method was critical point drying, the BMSCs seeded BCP ceramics were cut in half adopted to calculate the relative value of gene expression. Each along the long axis. The BMSCs on BCP ceramics or coverslips were specimen was analyzed in triplicate. observed by a field emission SEM (FE-SEM, S-4800, Hitachi, Japan). Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 132 Chen et al. PCR assay for the in vivo implants a proportion of BMSCs extended to become spindle-shaped, but After 1, 4, 7 and 10 days of implantation, the diffusion chambers others were mainly short rod-like, triangular or stelliform (Fig. 2a). were harvested and the BMSCs seeded BCP ceramics or coverslips The phenotype of isolated cells was characterized by flow cytomet- were retrieved. All the experiment procedures analyzing the expres- ric detection of the lineage-specific markers, demonstrating that the sion of KDR, vWF, VCAM-1 and CDH5 genes were the same as cells expressed high levels of CD29 (97.6%, Fig. 2b) and CD90 those used for in vitro cell culture samples. (99.6%, Fig. 2c), while low levels of CD34 (0.1%, Fig. 2d) and CD45 (2.7%, Fig. 2e). The result confirmed that the isolated cells were mesenchymal types [41]. Statistics analysis All data were expressed as mean6 standard deviation, and every ex- periment was performed at least in triplicate. The statistical analysis Migration of BMSCs was performed by a Student’s t-test, in which a one-way analysis of The migration behavior of BMSCs under different stimulation was variance (ANOVA) with Tukey’s post hoc test was used. A statisti- carried out using a transwell model and observed by CLSM. The cal difference was considered as P< 0.05. BMSCs were seeded in the upper chamber of the transwell inserts. In the bottom chamber, four types of materials were placed, i.e. BCP ceramic discs seeded with macrophages (Group A), coverslips seeded Results with macrophages (Group B), BCP ceramic discs without seeding Morphological observation and purity of BMSCs cells (Group C), and coverslips without seeding cells (Group D). As After 1 day of culture, primary cells attached, while most of the shown in Fig. 3, after cultured for 6 h, the BMSCs in the upper round cells with strong refractivity were erythrocyte. After attach- chambers migrated to the bottom chambers of Groups A, B and C. ment, BMSCs became rod-shaped or spindle-shaped. With the me- After cultured for 12 h, the migration degree of BMSCs increased dium change, the majority of the non-adherent cells were eliminated in an order of Group D< Group C Group B< Group A. After cul- and adherent cells (i.e. BMSCs) gradually proliferated. At passage 2, tured for 48 h, the migration of the BMSCs in Group A was Figure 1. Schematic illustration of the in vivo model to analyze the differentiation of BMSCs under a physiological environment Figure 2. Representative images showing the rat BMSCs morphologies at the second passage (a), scale bar: 200 mm. Flow cytometric detection of cell surface an- tigens CD 29 (b), CD 90 (c), CD 34 (d) and CD 45 (e) Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 133 Figure 3. The migration of BMSCs in the upper chamber of the transwell inserts toward BCP ceramic discs seeded with macrophages (a), coverslips seeded with macrophages (b), BCP ceramic without seeding cells (c) and coverslips without seeding cells (d) in the bottom chamber of the transwell inserts significantly higher than other groups, while the migration of significant difference in the cell proliferation rate was found between BMSCs in Group C was slightly higher than that of Group B. BCP ceramic and coverslip. After 10 days of culture, the cell number Almost no migration of BMSCs was found in Group D. The results on BCP ceramic was significantly higher than that on the coverslip indicated that BCP ceramic could promote the directional migration (P< 0.05). One probable reason was that the porous BCP ceramic pro- of BMSCs, and the migration was more significant under the syner- vided a broader 3D space for cell growth, whereas the cells on the cov- getic stimulations of macrophages and BCP ceramic. erslip fell off or died since the space for cell growth was limited. Morphology and viability of BMSCs cultured on BCP Gene expression of VECs characteristic factors in ceramic discs BMSCs (in vitro) To evaluate the effect of BCP ceramic on the cell morphology and vi- Figure 6 shows the quantitative gene expressions of VECs charac- ability, BMSCs were seeded onto the ceramic discs and cultured for teristic factors (KDR, vWF, VCAM-1 and CDH5) in BMSCs after 1, 4, 7 and 10 days. BMSCs cultured on coverslips were served as cultured on BCP ceramic discs for 1, 4, 7 and 10 days. The gene the control. The CLSM observation for the cell morphology and via- expression of cells cultured on coverslips was used as control. bility is shown in Fig. 4. With time prolongation, the number of the The gene expressions of KDR, vWF, VCAM-1 and CDH5 were cells grown on BCP ceramic discs or coverslips both increased signif- allup-regulatedbyBCP ceramicswhencomparedwithcontrol. icantly, and few dead cells were found, indicating high viability of For KDR and vWF, under the stimulation of BCP ceramics, the BMSCs and good biocompatibility of BCP ceramic. Besides, when gene expressions showed the maximum at the 1st day, and then compared with cells grown on coverslips, BMSCs grown on BCP ce- slightly decreased at the 4th day, following by significantly de- ramic showed more wide-spreading morphology, meaning that the creased at the 7th and 10th days. For VCAM-1, the highest gene ceramic supported the cell growth well. expression was showed at the fourth day and then decreased slowly. For CDH5, the gene expression began to decrease after BMSCs proliferation reaching the maximum at the first day, but there was a slight in- MTT assay was used to compare the proliferation of BMSCs on BCP crease at the seventh day and then decreased again. The expres- ceramic discs and the coverslips. The results are shown in Fig. 5.The sions of all the four characteristic factors were significantly number of BMSCs grown on both BCP ceramics and coverslips in- higher than those of the control group, indicating that BMSCs creased gradually with time prolongation, which was well in accor- differentiate toward endothelial cells under the stimulation of dance with the above CLSM observation. At the first 7 days, no BCP ceramic at the gene level. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 134 Chen et al. Figure 4. CLSM observation for BMSCs grown on BCP ceramic discs (a) and coverslips (b) at high and low magnification after 1, 4, 7 and 10 days in vitro culture. Scale bar for low magnification: 500 lm; for high magnification: 100 lm Figure 5. MTT assay for the proliferation of BMSCs on BCP ceramic discs and coverslips after 1, 4, 7 and 10 days in vitro culture. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05 Protein expression of VECs characteristic factors in analyzed by ELISA kit. As shown in Fig. 7, the protein expressions of KDR, vWF, VCAM-1, CDH5 were all up-regulated by BCP ce- BMSCs (in vitro) ramic when compared with the control group. For KDR and The intracellular and extracellular protein expressions of VECs VCAM-1 (Fig. 7a and c), under the stimulation of BCP ceramic, the characteristic factors (KDR, vWF, VCAM-1 and CDH5) were Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 135 Figure 6. Expressions of KDR (a), vWF (b), VCAM-1 (c) and CDH5 (d) of BMSCs on the BCP ceramic discs and coverslips after 1, 4, 7 and 10 days in vitro culture. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05; **P< 0.01; ***P< 0.001 Figure 7. The intracellular and extracellular protein expression of KDR (a), vWF (b), VCAM-1 (c) and CDH5 (d) of BMSCs on the BCP ceramic discs and coverslips after 1, 4, 7 and 10 days in vitro culture. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05; ***P< 0.001 Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 136 Chen et al. intracellular expressions both reached the maximum value at the Discussion seventh day, whereas the maximum value of extracellular expres- As a promising biomaterial used in bone tissue engineering, porous sions appeared on the fourth day. For vWF (Fig. 7b), the intracellu- CaP ceramics present excellent osteoinductivity, but the mechanism lar and extracellular expressions both reached the maximum value is still not fully understood [9–20]. The relationship between vascu- at the fourth day, whereas the maximum value of extracellular ex- larization and osteogenesis of CaP ceramics has been intensively in- pression appeared on the fourth day. For CDH5 (Fig. 7d), the intra- vestigated in order to reveal the mechanism [9, 20, 24, 42, 43]. In cellular expression reached the maximum value at the fourth day, our previous work, the abundant vascular network formed in the in- whereas the maximum value of extracellular expression appeared ner pores of the implants after 4 weeks postoperatively when porous on the seventh day. Similar to the results of gene expressions, the CaP ceramics were implanted in the thigh muscle of mice [9]. The protein expressions of all the four characteristic factors were signifi- rapid vascularization should be undoubtedly advantageous for new cantly higher than those of the control group, indicating that bone formation in the CaP ceramics, because it will bring about var- BMSCs differentiate toward endothelial cells under the stimulation ious functional cells, growth factors and other nutrient substances of BCP ceramic at the protein level. [44]. Thus far, it is still controversial that whether or not a biomate- rial can induce angiogenesis. In fact, the formation of blood vessels requires a large amount of VECs. Moreover, it has been confirmed Adhesion of BMSCs on BCP ceramic in diffusion that CaP ceramics can promote proliferation and angiogenesis of chamber HUVECs [24, 45]. At the early stage after a biomaterial implanta- The adhesion of BMSCs seeded on BCP ceramic cylinders or cover- tion, the inflammatory response of the host leads to the aggregation slips in the diffusion chamber after 4 days of in vivo implantation of various inflammatory cells, MSCs and other progenitor cells at were checked by SEM (Fig. 8). It was observed that the BMSCs were the implanting site. Therefore, we designed the in vitro and in vivo well attached on BCP ceramic and coverslip under the real physio- experiments by using two types of cells, i.e. macrophages and MSCs logical environment, indicating that both materials had good bio- to verify if the CaP ceramics could recruit MSCs combing with mac- compatibility and can support the adhesion and spreading of rophages and further stimulate their differentiation toward VECs, BMSCs. providing the cell source forming new blood vessels. The migration of BMSCs was evaluated by using a transwell model. The transwell inserts with 8-mm pore membrane filter, which Gene expression of VECs characteristic factors in allows the nutrients, signaling molecules and proteins to pass through, BMSCs (in vivo) while inhibits the transit of cells unless the cells become invasive in re- The in vivo diffusion chamber model was used to evaluate the pos- sponse to certain chemotactic cues. Under the stimulation of BCP ce- sibility of BMSCs differentiation toward VECs under the stimula- ramic, the BMSCs seeded on the upper chamber gradually migrated tion of BCP ceramic in the real physiological environment. After 1, toward the material in the bottom chamber with time prolongation, 4, 7 and 10 days of culture in vivo, the diffusion chambers were and the macrophages seeded on the ceramic discs in advance further harvested and the BCP ceramic cylinders or coverslips were re- promoted the migration of BMSCs (Fig. 3a and c). As one of the most trieved. The gene expressions of VECs characteristic factors in the important inflammatory cells, macrophages can modulate a series of BMSCs were analyzed by PCR assay, and the results are shown in biological response by secreting a variety of inflammatory cytokines Fig. 9. Similar to the in vitro results, the gene expressions of KDR, and growth factors, and these signalling molecules play a vital role in vWF, VCAM-1 and CDH5 in vivo were all up-regulated by BCP cellular processes involving in tissue regeneration [25, 29, 46–48]. ceramic when compared with the control. For KDR and VCAM-1, The previous reports showed that macrophage cytokine secretion was under the stimulation of BCP ceramic, the gene expression showed highly dependent on the properties of the substrate materials [49–54]. the maximum value at the fourth day, and then slightly decreased. Besides, CaP ceramics have strong protein adsorption ability, espe- For vWF, the highest gene expression was showed at the first and cially for some growth factors, such as bone morphogenetic protein 2 seventh days. For CDH5, the gene expression began to decrease af- (BMP-2), VEGF, TGF-b1 and so on [9, 55–58]. Therefore, the syner- ter reaching the maximum value at the first day. All the results gistic stimulation of BCP ceramic and macrophages was stronger than demonstrated that BMSCs had phenotypically differentiated into that of the inert coverslip and macrophages (Fig. 3a and b). VECs under the stimulation of BCP ceramic in the real physiologi- To verify if the BMSCs can differentiate toward VECs under the cal environment. stimulation of BCP ceramic, an in vitro co-culture of BCP ceramic and BMSCs was performed at first. The ceramic showed good biocompati- bility and supported the cell growth well (Figs 4 and 5). After 1, 4, 7 and 10 days of culture, the PCR and ELISA analysis were made to evaluate the gene expressions and protein secretions of the characteris- tic factors of VECs, i.e. KDR, vWF, VCAM-1 and CDH5. When com- pared with the control group, all the four characteristic factors were significantly up-regulated by BCP ceramic at both gene and protein levels (Figs 6 and 7). Next, an in vivo diffusion chamber model simu- lating the real physiological environment, which allows penetration of the body fluids containing various ions, signaling molecules and other nutrients but prevents invasion of the foreign cells and the immune re- jection by the host, was used for co-culture of BCP ceramic and Figure 8. SEM images of the BMSCs seeded on the BCP ceramic discs (a) and BMSCs. After 1, 4, 7 and 10 days of in vivo culture, the BMSCs at- coverslips (b) enclosed in the diffusion chambers after subcutaneously implanted in vivo for 4 days. Scale bar: 5 lm tached on BCP ceramic tightly and showed good spreading (Fig. 8). Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 137 Figure 9. Expressions of KDR (a), vWF (b), VCAM-1 (c) and CDH5 (d) of BMSCs on the BCP ceramic discs and coverslips enclosed in the diffusion chambers after subcutaneously implanted in vivo for 1, 4, 7 and 10 days. Data represent mean6 SD, N¼ 3. Significant difference: *P< 0.05; **P< 0.01; ***P< 0.001 Similar to the in vitro results, the gene expressions of KDR, vWF, by the ceramic, which could participate the formation and arrange- VCAM-1 and CDH5 were all up-regulated by BCP ceramic to differ- ment of new blood vessels and further promote the new bone forma- ent degrees when compared with the control group (Fig. 9). It is tion. This study could give some useful guidance to explain the rapid known that MSCs are multipotent stem cells and can differentiate to- vascularization of CaP ceramics and provide the useful support to re- ward various cell types, such as adipocytes, osteoblasts, chondrocytes, veal the mechanism of osteoinduction by the ceramics. neuronal cells and so on, depending on the property of the substrate material and the cellular microenvironment [33, 34, 59–63]. Some previous reports showed that MSCs could differentiate into VECs un- Acknowledgements der certain condition [38–40]. The results in this study give the suffi- This study was financially supported by the National Natural Science cient proof that CaP ceramics have the potential to stimulate the Foundation of China (31370973, 31400819), the National Key Research and differentiation of BMSCs into VECs. Development Program of China (2016YFC1102000, 2016YFC1102003) and Our findings in this study may provide better support to reveal the the “111” Project of China (B16033). mechanism of vascularization and osteoinduction of porous CaP ce- Conflict of interest statement. None declared. ramics. After implantation, the CaP ceramics mediated inflammatory response would firstly recruit the aggregation of macrophages from nearby tissues and the circulation system in the inner pores of the im- References plant. Then, the macrophages secrete various signalling molecules un- 1. Henkel J, Woodruff MA, Epari DR et al. Bone regeneration based on tis- der the stimulation of the ceramic, which could further recruit MSCs sue engineering conceptions—a 21st century perspective. Bone Res 2013; and promote their proliferation and differentiate toward VECs or os- 1:216. teoblasts based on the different implantation period and the cellular 2. Laurencin C, Khan Y, El-Amin SF. Bone graft substitutes. Exp Rev Med microenvironment around the implant. The VECs in the CaP ceramics Dev 2006; 3:49–57. participate the formation and arrangement of new blood vessels, 3. Stevens B, Yang Y, Mohandas A et al. A review of materials, fabrication which further promote the subsequent new bone formation, in other methods, and strategies used to enhance bone regeneration in engineered words, lead to the happening of osteoinduction by the ceramics. bone tissues. J Biomed Mater Res B: Appl Biomater 2008; 85B:573–82. 4. Garcia-Gareta E, Coathup MJ, Blunn GW. Osteoinduction of bone grafting materials for bone repair and regeneration. Bone 2015; 81:112–21. Conclusion 5. Fillingham Y, Jacobs J. Bone grafts and their substitutes. Bone Joint J 2016; 98-B:6–9. This study puts forward a possibility for the origin of VECs during the 6. Eliaz N, Metoki N. Calcium phosphate bioceramics: a review of their his- rapid vascularization process after in vivo implantation of porous CaP tory, structure, properties, coating technologies and biomedical applica- ceramics. According to the in vitro and in vivo experimental results, tions. Materials 2017; 10:334. the synergistic effect of BCP ceramic with the seeded macrophages in 7. Ohtsuki C, Kamitakahara M, Miyazaki T. Bioactive ceramic-based mate- advance promoted the directional migration of BMSCs toward the ma- rials with designed reactivity for bone tissue regeneration. J R Soc Interf terial. Then, the BMSCs were stimulated to differentiate toward VECs 2009; 6:S349–S60. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 138 Chen et al. 8. Shao R, Quan R, Zhang L et al. Porous hydroxyapatite bioceramics in 33. Wang J, Liu D, Guo B et al. Role of biphasic calcium phosphate ceramic- bone tissue engineering: current uses and perspectives. J Ceram Soc Jpn mediated secretion of signaling molecules by macrophages in migration and 2015; 123:17–20. osteoblastic differentiation of MSCs. Acta Biomaterialia 2017; 51:447–60. 9. Wang J, Chen Y, Zhu X et al. Effect of phase composition on protein 34. Chen X, Wang J, Chen Y et al. Roles of calcium phosphate-mediated adsorption and osteoinduction of porous calcium phosphate ceramics in integrin expression and MAPK signaling pathways in the osteoblastic mice. J Biomed Mater Res A 2014; 102:4234–43. differentiation of mesenchymal stem cells. J Mater Chem B 2016; 4: 10. Groen N, Yuan H, Hebels DGAJ et al. Linking the transcriptional land- 2280–9. scape of bone induction to biomaterial design parameters. Adv Mater 35. Li X, Dai Y, Shen T et al. Induced migration of endothelial cells into 3D (Deerfield Beach, Fla) 2017; 29:1603259. scaffolds by chemoattractants secreted by pro-inflammatory macrophages 11. Yuan H, Fernandes H, Habibovic P et al. Osteoinductive ceramics as a in situ. Regen Biomater 2017; 4:139–48. synthetic alternative to autologous bone grafting. Proc Natl Acad Sci U S 36. Guadix JA, Zugaza JL, Galvez-Martin P. Characteristics, applications and A 2010; 107:13614–9. prospects of mesenchymal stem cells in cell therapy. Medicina Clinica 12. Barradas AMC, Yuan H, van Blitterswijk CA et al. Osteoinductive bioma- 2017; 148:408–14. terials: current knowledge of properties, experimental models and biologi- 37. Nardi NB, da Silva Meirelles L. Mesenchymal stem cells: isolation, in vitro cal mechanisms. Eur Cells Mater 2011; 21:407–29. expansion and characterization. Stem cells. New York: Springer, 2008, 13. Habibovic P, Sees TM, van den Doel MA et al. Osteoinduction by bioma- 249–82. terials—Physicochemical and structural influences. J Biomed Mater Res A 38. Peng J, Chi L. Effect of cell-cell direct contact to mesenchymal stem cells 2006; 77:747–62. differentiate into vascular endothelial cells. Heart 2012; 98:E100. 14. Habibovic P, de Groot K. Osteoinductive biomaterials—properties and 39. Silva GV, Litovsky S, Assad JA et al. Mesenchymal stem cells differentiate relevance in bone repair. J Tissue Eng Regen Med 2007; 1:25–32. into an endothelial phenotype, enhance vascular density, and improve heart 15. Bouler JM, Pilet P, Gauthier O et al. Biphasic calcium phosphate ceramics function in a canine chronic ischemia model. Circulation 2005; 111:150–6. for bone reconstruction: a review of biological response. Acta 40. Oswald J, Boxberger S, Jørgensen B et al. Mesenchymal stem cells can be dif- Biomaterialia 2017; 53:1–12. ferentiated into endothelial cells in vitro. Stem Cells 2004; 22:377–84. 16. Bohner M, Galea L, Doebelin N. Calcium phosphate bone graft substi- 41. Tasso R, Augello A, Boccardo S et al. Recruitment of a host’s osteoproge- tutes: Failures and hopes. J Eur Ceram Soc 2012; 32:2663–71. nitor cells using exogenous mesenchymal stem cells seeded on porous ce- 17. Samavedi S, Whittington AR, Goldstein AS. Calcium phosphate ceramics ramic. Tissue Eng A 2009; 15:2203–12. in bone tissue engineering: a review of properties and their influence on 42. Zhi W, Zhang C, Duan K et al. A novel porous bioceramics scaffold by ac- cell behavior. Acta Biomaterialia 2013; 9:8037–45. cumulating hydroxyapatite spherulites for large bone tissue engineering 18. LeGeros RZ. Calcium phosphate-based osteoinductive materials. Chem in vivo. II. Construct large volume of bone grafts. J Biomed Mater Res A Rev 2008; 108:4742–53. 2014; 102:2491–501. 19. Yuan H, Yang Z, Li Y et al. Osteoinduction by calcium phosphate bioma- 43. Zhang C, Huang P, Weng J et al. Histomorphological researches on large po- terials. J Mater Sci: Mater Med 1998; 9:723–6. rous hydroxyapatite cylinder tubes with polylactic acid surface coating in dif- 20. Li J, Zhi W, Xu T et al. Ectopic osteogenesis and angiogenesis regulated ferent nonskeletal sites in vivo. JBiomedMater ResA 2012; 100:1203–8. by porous architecture of hydroxyapatite scaffolds with similar intercon- 44. Kanczler JM, Oreffo ROC. Osteogenesis and angiogenesis: the potential necting structure in vivo. Regen Biomater 2016; 3:285–97. for engineering bone. Eur Cells Mater 2008; 15:100–14. 21. Yu H, VandeVord PJ, Mao L et al. Improved tissue-engineered bone re- 45. Zhang M, Wu C, Li H et al. Preparation, characterization and in vitro an- generation by endothelial cell mediated vascularization. Biomaterials giogenic capacity of cobalt substituted beta-tricalcium phosphate ce- 2009; 30:508–17. ramics. J Mater Chem 2012; 22:21686–94. 22. Zhou J, Lin H, Fang T et al. The repair of large segmental bone defects in 46. Behm B, Babilas P, Landthaler M et al. Cytokines, chemokines and growth the rabbit with vascularized tissue engineered bone. Biomaterials 2010; factors in wound healing. J Eur Acad Dermatol Venereol 2012; 26:812–20. 31:1171–9. 47. Barrientos S, Stojadinovic O, Golinko MS et al. Growth factors and cyto- 23. Li H, Xue K, Kong N et al. Silicate bioceramics enhanced vascularization kines in wound healing. Wound Repair Regen 2008; 16:585–601. and osteogenesis through stimulating interactions between endothelia 48. Devescovi V, Leonardi E, Ciapetti G et al. Growth factors in bone repair. cells and bone marrow stromal cells. Biomaterials 2014; 35:3803–18. La Chirurgia Degli Organi Di Movimento 2008; 92:161–8. 24. Chen Y, Wang J, Zhu X et al. Enhanced effect of b-tricalcium phosphate 49. Brodbeck WG, Nakayama Y, Matsuda T et al. Biomaterial surface chem- phase on neovascularization of porous calcium phosphate ceramics: in vi- istry dictates adherent monocyte/macrophage cytokine expression in vitro. tro and in vivo evidence. Acta Biomaterialia 2015; 11:435–48. Cytokine 2002; 18:311–9. 25. Anderson JM, Rodriguez A, Chang DT. Foreign body reaction to biomate- 50. Schutte RJ, Parisi-Amon A, Reichert WM. Cytokine profiling using mono- rials. Semin Immunol 2008; 20:86–100. cytes/macrophages cultured on common biomaterials with a range of sur- 26. Sheikh Z, Brooks PJ, Barzilay O et al. Macrophages, foreign body giant face chemistries. J Biomed Mater Res A 2009; 88:128–39. cells and their response to implantable biomaterials. Materials 2015; 8: 51. Almeida CR, Serra T, Oliveira MI et al. Impact of 3-D printed PLA- and 5671–701. chitosan-based scaffolds on human monocyte/macrophage responses: un- 27. Velnar T, Bunc G, Klobucar R et al. Biomaterials and host versus graft re- raveling the effect of 3-D structures on inflammation. Acta Biomaterialia sponse: a short review. Bosn J Basic Med Sci 2016; 16:82–90. 2014; 10:613–22. 28. Martin P, Leibovich SJ. Inflammatory cells during wound repair: the 52. Blakney AK, Swartzlander MD, Bryant SJ. The effects of substrate stiffness on good, the bad and the ugly. Trends Cell Biol 2005; 15:599–607. the in vitro activation of macrophages and in vivo host response to poly(ethyl- 29. Dimitriou R, Tsiridis E, Giannoudis PV. Current concepts of molecular as- ene glycol)-based hydrogels. JBiomedMater Res A 2012; 100:1375–86. pects of bone healing. Injury 2005; 36:1392–404. 53. Chen S, Jones JA, Xu Y et al. Characterization of topographical effects on 30. Rundle CH, Wang H, Yu H et al. Microarray analysis of gene expression macrophage behavior in a foreign body response model. Biomaterials during the inflammation and endochondral bone formation stages of rat 2010; 31:3479–91. femur fracture repair. Bone 2006; 38:521–9. 54. Bota PCS, Collie AMB, Puolakkainen P et al. Biomaterial topography 31. Selders GS, Fetz AE, Radic MZ et al. An overview of the role of neutro- alters healing in vivo and monocyte/macrophage activation in vitro. phils in innate immunity, inflammation and host-biomaterial integration. J Biomed Mater Res A 2010; 95A:649–57. Regen Biomater 2017; 4:55–68. 55. Wang J, Zhang HJ, Zhu XD et al. Dynamic competitive adsorption of 32. Mountziaris PM, Mikos AG. Modulation of the inflammatory response bone-related proteins on calcium phosphate ceramic particles with different for enhanced bone tissue regeneration. Tissue Eng B: Rev 2008; 14: phase composition and microstructure. JBiomedMater ResB 2013; 101B: 179–86. 1069–77. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018 BCP stimulated directional migration and differentiation of MSCs 139 56. Zhu XD, Fan HS, Xiao YM et al. Effect of surface structure on protein 60. Guo L, Kawazoe N, Fan Y et al. Chondrogenic differentiation of human adsorption to biphasic calcium-phosphate ceramics in vitro and in vivo. mesenchymal stem cells on photoreactive polymer-modified surfaces. Acta Biomaterialia 2009; 5:1311–8. Biomaterials 2008; 29:23–32. 57. Zhu XD, Zhang HJ, Fan HS et al. Effect of phase composition and micro- 61. Lu H, Guo L, Wozniak MJ et al. Effect of cell density on adipogenic differ- structure of calcium phosphate ceramic particles on protein adsorption. entiation of mesenchymal stem cells. Biochem Biophys Res Commun Acta Biomaterialia 2010; 6:1536–41. 2009; 381:322–7. 58. Chen Y, Wang J, Zhu X et al. Adsorption and release behaviors of vascu- 62. Zhang L, Yuan T, Guo L et al. An in vitro study of collagen hydrogel to in- lar endothelial growth factor on porous hydroxyapatite ceramic under duce the chondrogenic differentiation of mesenchymal stem cells. competitive conditions. J Biomater Tissue Eng 2014; 4:155–61. J Biomed Mater Res A 2012; 100A:2717–25. 59. Hankamolsiri W, Manochantr S, Tantrawatpan C et al. The effects of 63. Miao Z, Sun H, Xue Y. Isolation and characterization of human chorionic high glucose on adipogenic and osteogenic differentiation of gestational membranes mesenchymal stem cells and their neural differentiation. tissue-derived MSCs. Stem Cells Int 2016; 2016:9674614. Tissue Eng Regen Med 2017; 14:143–51. Downloaded from https://academic.oup.com/rb/article-abstract/5/3/129/4582913 by Ed 'DeepDyve' Gillespie user on 21 June 2018

Journal

Regenerative Biomaterials – Oxford University Press

Published: Oct 31, 2017

There are no references for this article.