The Complete Mitochondrial Genome of Coptotermes ‘suzhouensis’ (syn. Coptotermes formosanus) (Isoptera: Rhinotermitidae) and Molecular Phylogeny Analysis

The Complete Mitochondrial Genome of Coptotermes ‘suzhouensis’ (syn. Coptotermes formosanus)... Coptotermes suzhouensis (Isoptera: Rhinotermitidae) is a significant subterranean termite pest of wooden structures and is widely distributed in southeastern China. The complete mitochondrial DNA sequence of C.  suzhouensis was analyzed in this study. The mitogenome was a circular molecule of 15,764 bp in length, which contained 13 protein-coding genes (PCGs), 22 transfer RNA genes, two ribosomal RNA genes, and an A+T-rich region with a gene arrangement typical of Isoptera mitogenomes. All PCGs were initiated by ATN codons and terminated by complete termination codons (TAA), except COX2, ND5, and Cytb, which ended with an incomplete termination Ser(AGN) codon T. All tRNAs displayed a typical clover-leaf structure, except for tRNA , which did not contain the stem- loop structure in the DHU arm. The A+T content (69.23%) of the A+T-rich region (949  bp) was higher than that of the entire mitogenome (65.60%), and two different sets of repeat units (A+B) were distributed in this region. Comparison of complete mitogenome sequences with those of Coptotermes formosanus indicated that the two taxa have very high genetic similarity. Forty-one representative termite species were used to construct phylogenetic trees by maximum likelihood, maximum parsimony, and Bayesian inference methods. The phylogenetic analyses also strongly supported (BPP , MLBP , and MPBP = 100%) that all C. suzhouensis and C. formosanus samples gathered into one clade with genetic distances between 0.000 and 0.002. This study provides molecular evidence for a more robust phylogenetic position of C. suzhouensis and inferrs that C. suzhouensis was the synonymy of C. formosanus. Key words: Coptotermes suzhouensis, mitochondrial genome, phylogenetic analysis, synonymy representatives of major pest genera Coptotermes, Reticulitermes, Introduction and Heterotermes (Huang et al. 2000, Cheng 2012). The difficulty Termites (Isoptera) (Eggleton et al. 2007) comprise more than 3,000 in identifying termites is recognized by many termite classifica- species in approximately 283 genera (Inward et al. 2007a, Krishna tion experts, especially in the genus Coptotermes (Emerson 1952, et  al. 2013, Cheng 2014). Of all termite species recognized glob- Watson and Gay 1991, Huang et al. 2000, Chouvenc et al. 2016). ally, only 183 are significant pest species known to damage build- Taxonomic limits between species in genus Coptotermes, are poorly ings (Krishna et al. 2013, Chouvenc et al. 2015), of which the genus established, which has resulted in different names being used for the Coptotermes contains the largest number (18) of pest species (Rust same species (Chouvenc et al. 2016). This has created additional dif- and Su 2012). Due to their destructive effect on wooden structures ficulties in the identification of termites, which were already been and their essential role in decomposition and nutrient recycling, complicated by the limited morphological features available for research on the biological characteristics, classification, identifica- identifications. The number of species in the genus Coptotermes tion, and phylogenetic relationships of termites has received increas- is frequently revised, as synonyms of other species are recognised ing attention (Wolstenholme 1992, Brody et al. 2010, Hausberger (Engel and Krishna 2004, Krishna et  al. 2013, Cameron 2014a). et  al. 2011, Korb et  al. 2015, Chouvenc et  al. 2016, Bourguignon Most species of Coptotermes are considered to be similar to each et al. 2016, Rocha et al. 2017). In China, 4 families, 44 genera, and other, and their identification is thus very difficult. Kambhampati 473 species of termites have been recorded (Huang et  al. 2000, (2000) also thought that many synonyms were found in the nomen- Cheng 2014). The Rhinotermitidae are widely distributed in China, clature of termites based on morphological classifications. The with approximately 200 described species in seven genera, including © The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/ licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 2 Journal of Insect Science, 2018, Vol. 18, No. 2 classification and identification of Coptotermes have been revised extension period 72°C (10 min). PCR products were checked using based on molecular data (Cai and Chen 1964, Huang et al. 2000, Xu 1% agarose gels and were sequenced at MAP Biotech Company et al. 2009, Cheng 2012). To date, 22 species of Coptotermes have (Shanghai, China) with ABI3730 Genetic Analyzer. been recorded in China (Krishna et al. 2013). Coptotermes suzho- uensis (Isoptera: Rhinotermitidae) is very similar to Coptotermes Sequence Assembly, Annotation, and Analysis formosanus (Isoptera: Rhinotermitidae), a major invasive species, in Sequences were assembled and aligned with complete mitog- morphology. C.  suzhouensis is widely distributed in the regions of enomes from C.  formosanus in Sequencher 4.1.4. The location, southeastern China and is a pest of wooden buildings (Xia and He size, and coding direction of each gene, including 13 protein cod- 1986, Huang et al. 2000, Li 2002, Cheng 2012). There has always ing genes (PCGs), 22 tRNA genes, and two rRNA genes were been controversy regarding the relationship between the two species determined with DOGMA (Wyman et al. 2004). Secondary struc- (C. suzhouensis and C. formosanus). tures of tRNA were predicted using MITOS (Bernt et  al. 2013) In the study, we determined the complete mitogenome sequence and tRNAscan-SE Search Server v.2.0 online (Lowe and Chan of C.  suzhouensis and compared it to available mitogenomes of 2016). Amino acid composition and coding region for each PCG other termites using phylogenetic analyses. In doing so, we provide was identified with ORF Finder (http://www.ncbi.nlm.nih.gov/ robust molecular evidence for the taxonomic status of C. suzhouen- gorf/gorf.html). Nucleotide composition statistics (excluding sis and reveal the evolutionary relationships of C. suzhouensis and stop codons) and relative synonymous codon usage (RSCU) of C. formosanus. 13 PCGs were calculated with MEGA 5.1 (Tamura et  al. 2014). Composition skew analysis was calculated according to formulas AT skew = [A−T]/[A+T] and GC skew = [G−C]/[G+C], respectively Materials and Methods (Perna and Kocher 1995). Collection and Storage Specimens of C. suzhouensis were collected from colonies of termites The Reconstruction of Phylogenetic Trees living in wooden buildings in Feixi County in Hefei, Anhui Province, Along with the C.  suzhouensis mitochondrial genome, 41 termite China (31°42′31″N, 117°10′38″E). The specimens were preserved in mitogenomes and two outgroup species (Shelfordella lateralis and 95% ethanol and stored at −20°C until DNA extraction. Periplaneta australasiae: Blattodea) were used in phylogenetic ana- lysis. Sampling and sequence availability used in this study are sum- Morphological Identification of Termites marized in Table 2. Concatenated amino acid sequences from the 13 Soldier specimens of all the populations collected were identified by PCGs was used in phylogenetic analysis, with maximum likelihood the Hefei Termite Control Institute based on their morphological (RAxML7.03; Stamatakis et al. 2008), maximum parsimony (PAUP characteristics (Xia and He 1986, Huang et al. 2000). 4.0b10; Swofford 2002), and Bayesian inference methods (Mr Bayes v.3.1.2) (Huelsenbeck and Ronquist 2001). Modeltest ver3.06 (Posada DNA Isolation, Polymerase Chain Reaction, and and Crandall 1998) was used to infer best-fitting model for Bayesian Sequencing inference (BI) and maximum likelihood (ML) analysis. The GTR + Whole genomic DNA was extracted from the heads of 20 soldiers I + G model was selected based on the Akaike information criterion using One-tube General Sample DNAup Kit (Sangon Biotech, (Akaike 1974). Bayesian inference was performed with the following Shanghai, China) for polymerase chain reaction (PCR), following settings: four MCMC chains (one cold chain and three hot chains) manufacturer’s instructions. Mitochondrial genome sequences of the for 10,000,000 generations until the average standard deviation of termites related to C. suzhouensis were downloaded from the NCBI split frequencies reached a value less than 0.01. Bayesian posterior database. ClustalX ver1.8 was used for alignment, and Premier probabilities (BPP) were calculated from the sample points after the Primer 5 software was applied to design five pairs of primers from MCMC algorithm had started to converge. In ML and MP analyses, a conserved regions (Table 1). Fragments were amplified by long dis- heuristic search with 100 random addition replicates was applied. BPP tance PCR using Takara LA Taq (Takara Bio, Japan) with the fol- values were mapped onto the tree, and nodal support for ML&MP lowing cycling conditions: an initial denaturation for 3 min at 94°C, was assessed using nonparametric bootstrapping (Felsenstein 1985) followed by 35 cycles of denaturation at 94°C (30 s), annealing at in PAUP for the MP analyses (MPBP) and RAxML (Stamatakis et al. 52−58°C (30 s; Table  1), elongation at 72°C (10 min); and a final 2008) for ML (MLBP) using 1,000 pseudoreplicates each. Table 1. The primers for PCR in this study Primers Sequences (5ʹ–3ʹ) Positions (5ʹ–3ʹ) Size of PCR Annealing temperatures (°C) product (bp) Primer-1-F TATCGCCATACCATCACTACGACTCCTA 3,340–3,367 5,154 55 Primer-1-R TGCTCCCCCTTCTCTTAATCTTCTCGGT 8,493-8,466 Primer-2-F GAACCAAAGCAGACACAGGAGTAGGAGC 7,481–7,508 4,742 58 Primer-2-R TGGGCTTCGTGCTTTGGCTCAGACTATC 12,222-12,195 Primer-3-F AGAAACCAACTCCGATTCCCCCTCAGCA 11,988–12,015 7,427 58 Primer-3-R GTCGTCCTGGTGTGGCGTCTGTTTTTAC 3,650-3,623 Primer-COX3-F ATTCCACCAATACGACAACAGCCTA 4,872–4,896 582 52 Primer-COX3-R GAGAAGTGTAGGGCTGCTTGTCGTA 5,453-5,429 Primer-Cytb-F GACATCAATACCGCATTTTCCAGAG 10,638–10,662 850 52 Primer-Cytb-R GTCGTGCTCCGATTCAGGTAAGTAG 11,487-11,463 Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 3 Table 2. Detailed information of the termites species analyzed in this study Family Species Size (bp) Accession number References Rhinotermitidae Reticulitermes aculabialis 16,475 KP334994.1 Wang et al. (2015) Reticulitermes chinensis 15,925 KM216388.1 Chen et al. (2016) Reticulitermes flavipes 16,565 EF206314.1 Cameron and Whiting (2007) Reticulitermes hageni 16,590 EF206320.1 Cameron and Whiting (2007) Reticulitermes santonensis 16,567 EF206315.1 Cameron and Whiting (2007) Reticulitermes virginicus 16,513 EF206318.1 Cameron and Whiting (2007) Reticulitermes labralis 15,914 KU877221.1 Wang et al. (2016) Reticulitermes speratus kyushuensis 15,898 KY484910.1 Lee et al. (2017) Reticulitermes sp. 14,907 KU925239.1 Bourguignon et al. (2017) Reticulitermes grassei 14,910 KU925237.1 Bourguignon et al. (2017) Reticulitermes flaviceps 16,485 KX712090.1 Chen et al. (2016) Heterotermes sp. 16,370 JX144936.1 Cameron et al. (2012) Heterotermes cf.occiduus 14,919 KU925230.1 Bourguignon et al. (2017) Heterotermes cf. paradoxus 14,904 KU925225.1 Bourguignon et al. (2017) Heterotermes nr. tenuis 14,944 KU925228.1 Bourguignon et al. (2017) Heterotermes platycephalus 14,919 KU925231.1 Bourguignon et al. (2017) Heterotermes tenuis 14,940 KU925233.1 Bourguignon et al. (2017) Heterotermes validus 14,922 KU925235.1 Bourguignon et al. (2017) Coptotermes acinaciformis raffrayi 14,897 KU925196.1 Bourguignon et al. 2017 Coptotermes acinaciforis 14,896 KU925198.1 Bourguignon et al. (2017) Coptotermes amanii 14,894 KU925200.1 Bourguignon et al. (2017) Coptotermes lacteus 16,326 JX144934.1 Cameron et al. (2012) Coptotermes frenchi 14,912 KU925204.1 Bourguignon et al. (2017) Coptotermes gestroi 14,919 KU925205.1 Bourguignon et al. (2017) Coptotermes heimi 14,908 KU925206.1 Bourguignon et al. (2017) Coptotermes kalshoveni 14,889 KU925210.1 Bourguignon et al. (2017) Coptotermes michaelseni 14,900 KU925212.1 Bourguignon et al. 2017 Coptotermes remotus 14,742 KU925213.1 Bourguignon et al. 2017 Coptotermes sjoestedti 14,899 KU925217.1 Bourguignon et al. 2017 Coptotermes sepangensis 14,905 KU925215.1 Bourguignon et al. (2017) Coptotermes travians 14,892 KU925222.1 Bourguignon et al. (2017) Coptotermes testaceus 15,752 KR872938.1 Li et al. (2016) Coptotermes formosanus 14,908 KU925203.1 Bourguignon et al. (2017) Coptotermes formosanus 16,324 AB626147.1 Tokuda et al. (2012) Coptotermes formosanus 16,326 AB626146.1 Tokuda et al. (2012) Coptotermes formosanus 1,326 AB626145.1 Tokuda et al. (2012) Coptotermes suzhouensis 15,764 MG000963 present study Termitidae Macrotermes barneyi 15,940 JX050221.1 Wei et al. (2012) Acanthotermes acanthothorax 15,231 KP026280.1 Bourguignon et al. (2015) Ancistrotermes pakistanicus 15,299 KP026267.1 Bourguignon et al. (2015) Macrotermes natalensis 16,325 KM405637.1 Meng et al. (2016) Macrotermes subhyalinus 16,351 JX144937.1 Cameron et al. (2012) Serritermitidae Serritermes serrifer 14,783 KP026264.1 Bourguignon et al. (2015) Glossotermes occulatus 14,791 KP026291.1 Bourguignon et al. (2015) Kalotermitidae Glyptotermes satsumensis 15,611 KP026257.1 Bourguignon et al. (2015) Cryptotermes secundus 15,695 KP026283.1 Bourguignon et al. (2015) Mastotermitidae Mastotermes darwiniensis 15,487 JX144929.1 Cameron et al. (2012) Outgroup Shelfordella lateralis 15,601 KU684413.1 Cheng et al. (2016) Periplaneta australasiae 15,605 KX640825.1 Ma et al. (2017) observed in termites’ mitogenomes (Bourguignon et  al. 2015; Results Table  3). In total, 23 genes (9 PCGs and 14 tRNAs) were located Sequencing and Organization of on the majority strand (H-strand) and the others (4 PCGs, 8 tRNAs, Mitochondrial Genome and 2 rRNAs) were located on the minority strand (L-strand; Fig. 1). The mitochondrial genome of C.  suzhouensis is a typical circular The order and the orientation of the genes were identical to those DNA molecule of 15,764 bp in length (GenBank: MG000963). The previously reported from other Coptotermes species, which retain mitochondrial DNA (mtDNA) consisted of 13 PCGs (ATP6, ATP8, the ancestral insect arrangement. COX1-3, ND1-6, ND4L, and Cytb), 2 rRNA genes (srRNA and The mitogenome of C. suzhouensis harbored a total of 139 bp of lrRNA), 22 tRNA genes, and a noncoding A+T-rich region (Fig.  1, intergenic spacers, made up of 19 individual regions ranging in size Table  4). Nucleotide composition was A/T (65.60%) biased and from 1 to 21  bp. There were 35 base pairs of overlapping regions composed as follows: A  =  6,891 (43.71%), T  =  3,450 (21.89%), total, at 10 intergenic positions, which ranged in size from 1 to 8 bp G  =  1,854 (11.76%), C  =  3,569 (22.64%), which is commonly (Table 4). Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 4 Journal of Insect Science, 2018, Vol. 18, No. 2 Fig. 1. Circular map of the mitogenome of C. suzhouensis. Genes encoded on the H-strand (clockwise orientation) are colored in the outside. Genes encoded on the L-strand (anticlockwise orientation) are colored in the inside. Table 3. Nucleotides composition of the C. suzhouensis mitochondrion in different regions Feature Proportion of nucleotides A% T% G% C% A+T% AT-skew GC-skew Siz e(bp) Whole genome 43.71 21.89 11.76 22.64 65.60 0.33 −0.32 15,764 PCGs 43.52 21.06 12.05 23.37 64.58 0.35 −0.32 11,166 tRNA genes 39.05 26.84 13.82 20.29 65.89 0.19 −0.19 1,498 srRNA genes 45.25 20.63 10.45 23.66 65.89 0.37 −0.39 727 lrRNA gene 48.56 22.05 8.56 20.83 70.61 0.38 −0.42 1,320 A+T-rich region 43.94 25.29 11.70 19.07 69.23 0.27 −0.24 949 Protein-Coding Genes Transfer RNA and Ribosomal RNA Genes The total length of the 13 PCGs was 11,166  bp, representing The mtDNA contained 22 tRNA genes, ranging in size from Ala Tyr 70.83% of the entire mitochondrial genome. PCGs used ATN as ini- 63  bp (tRNA ) to 76  bp (tRNA ) in length, and were AT tiation codon, all had ATG as start codon, except for ATP8, ND3, biased (65.89%). The secondary structures of tRNAs were pre- ND5, ND6 (ATA), and COX1 (ATT). Ten PCGs used the standard dicted by MITOS online (Bernt et  al. 2013) and tRNAscan-SE stop codon TAA, whereas COX2, ND5, and Cytb genes used a single 2.0 online (Lowe and Chan 2016). The genes that could not be T nucleotide. Codon usage of the PCGs exhibited an AT bias with detected by the softwares were determined through comparison an A+T composition of 64.58% (Table  3). It was found that the with published mitogenomes of Coptotermes (Cameron et  al. relative synonymous codon usage values of NNU/NNA codons was 2012, Tokuda et al. 2012). All tRNAs could be folded into typ- essentially greater than of NNC/NNG, indicating higher U+A bias ical cloverleaf secondary structures, with the exception of the Ser(AGN) at third condons. Our analysis showed that UUU (Phe), CUA (Leu), tRNA , which was lacking a stable stem-loop structure AUA (Met), and AUU (Ile) were the most frequently used codons, in the DHU arm, as observed in most insects (Cameron 2014b; accounting for 19.32% of all the codons (Table 5). Fig. 2) . Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 5 Table 4. Annotation and gene organization of the C. suzhouensis mitogenome Gene Coding Region Size (bp) Intergenic Overlapping Anticodon Start Stop strand nucleotide nucleotide codon codon Ile tRNA H 1–66 66 GAT (30–32) Gln tRNA L 64–133 70 3 TTG (101–103) Met tRNA H 155–223 69 21 CAT (187–189) ND2 H 224–1,261 1,038 ATG TAA Trp tRNA H 1,267–1,334 68 5 TCA (1,298–1,300) Cys tRNA L 1,327–1,395 69 8 GCA (1,363–1,365) Tyr tRNA L 1,406–1,481 76 10 GTA (1,442–1,444) COX1 H 1,483–3,030 1,548 1 ATT TAA Leu(UUR) tRNA H 3,042–3,107 66 11 TAA (3,071–3,073) COX2 H 3,116–3,800 685 8 ATG T Lys tRNA H 3,801–3,871 71 CTT (3,831–3,833) Asp tRNA H 3,871–3,935 65 1 GTC (3,902–3,904) ATP8 H 3,936–4,094 159 ATA TAA ATP6 H 4,088–4,768 681 7 ATG TAA COX3 H 4,768–5,556 789 1 ATG TAA Gly tRNA H 5,563–5,630 68 6 TCC (5,597–5,599) ND3 H 5,631–5,984 354 ATA TAA Ala tRNA H 5,994–6,056 63 9 TGC (6,023–6,025) Arg tRNA H 6,062–6,130 69 5 TCG (6,091–6,093) Asn tRNA H 6,136–6,203 68 5 GTT (6,167–6,169) Ser(AGN) tRNA H 6,201–6,272 72 3 GCT (6,228–6,230) Glu tRNA H 6,270–6,333 64 3 TTC(6,299–6,301) Phe tRNA L 6,345–6,412 68 11 GAA (6,376–6,378) ND5 L 6,413–8,138 1,726 ATA T His tRNA L 8,142–8,206 65 3 GTG (8,173–8,175) ND4 L 8,220–9,554 1,335 13 ATG TAA ND4L L 9,548–9,835 288 7 ATG TAA Thr tRNA H 9,839–9,903 65 3 TGT (9,869–9,871) Pro tRNA L 9,903–9,971 69 1 TGG (9,938–9,940) ND6 H 9,973–10,464 492 1 ATA TAA Cytb H 10,464–11,595 1,132 1 ATG T Ser(UCN) tRNA H 11,596–11,668 73 TGA (11,629–11,631) ND1 L 11,688–12,626 939 19 ATG TAA Leu(CUN) tRNA L 12,633–12,699 67 6 TAG (12,668–12,670) lrRNA(16S) L 12,700–14,019 1,320 Val tRNA L 14,021–14,087 67 1 TAC (14,056–14,058) srRNA(12S) L 14,089–14,815 727 1 A+T-rich nc 14,816–15,764 949 Repeat A1 nc 14,913–14,978 66 Repeat A2 nc 15,102–15,167 66 Repeat B1 nc 15,156–15,717 562 Repeat B2 nc 15,718–15,755 38 Table 5. Codon usage in 13 PCGs of the C. suzhouensis mitochondrial genome Codon (aa) Count % RSCU Codon (aa) Count % RSCU Codon (aa) Count % RSCU Codon (aa) Count % RSCU UUU(F) 201 5.42 1.24 UCU(S) 96 2.59 2.12 UAU(Y) 102 2.75 1.29 UGU(C) 38 1.02 1.55 UUC(F) 122 3.29 0.76 UCC(S) 19 0.51 0.42 UAC(Y) 56 1.51 0.71 UGC(C) 11 0.3 0.45 UUA(L) 103 2.78 1.16 UCA(S) 102 2.75 2.25 UAA(*) 0 0 0 UGA(W) 68 1.83 1.33 UUG(L) 146 3.93 1.64 UCG(S) 10 0.27 0.22 UAG(*) 0 0 0 UGG(W) 34 0.92 0.67 CUU(L) 61 1.64 0.68 CCU(P) 45 1.21 1.22 CAU(H) 22 0.59 0.61 CGU(R) 21 0.57 1.4 CUC(L) 17 0.46 0.19 CCC(P) 17 0.46 0.46 CAC(H) 50 1.35 1.39 CGC(R) 0 0 0 CUA(L) 189 5.09 2.12 CCA(P) 82 2.21 2.23 CAA(Q) 53 1.43 1.51 CGA(R) 35 0.94 2.33 CUG(L) 19 0.51 0.21 CCG(P) 3 0.08 0.08 CAG(Q) 17 0.46 0.49 CGG(R) 4 0.11 0.27 AUU(I) 155 4.18 1.11 ACU(T) 46 1.24 0.76 AAU(N) 65 1.75 0.87 AGU(S) 32 0.86 0.71 AUC(I) 124 3.34 0.89 ACC(T) 44 1.19 0.73 AAC(N) 85 2.29 1.13 AGC(S) 6 0.16 0.13 AUA(M) 172 4.63 1.42 ACA(T) 141 3.8 2.33 AAA(K) 60 1.62 1.52 AGA(S) 79 2.13 1.75 AUG(M) 70 1.89 0.58 ACG(T) 11 0.3 0.18 AAG(K) 19 0.51 0.48 AGG(S) 18 0.49 0.4 GUU(V) 114 3.07 1.82 GCU(A) 50 1.35 1.09 GAU(D) 36 0.97 1.04 GGU(G) 91 2.45 1.45 GUC(V) 18 0.49 0.29 GCC(A) 27 0.73 0.59 GAC(D) 33 0.89 0.96 GGC(G) 14 0.38 0.22 GUA(V) 96 2.59 1.53 GCA(A) 94 2.53 2.04 GAA(E) 63 1.7 1.47 GGA(G) 117 3.15 1.86 GUG(V) 23 0.62 0.37 GCG(A) 13 0.35 0.28 GAG(E) 23 0.62 0.53 GGG(G) 29 0.78 0.46 Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 6 Journal of Insect Science, 2018, Vol. 18, No. 2 Fig. 2. Secondary structures for 22 tRNAs of C. suzhouensis mitogenome predicted by the the MITOS and tRNAscan-SE 2.0 online. As typically observed in other insect mitogenomes, two rRNA Homology Analysis of Mitochondrial Sequences of genes (srRNA and lrRNA) were found on the L strand of the mitog- C. suzhouensis Leu(CUN) Val enome, which were located between tRNA and tRNA , To explore the phylogenetic potential of the determined sequence, Val tRNA and CR region, respectively. The rRNAs of C. suzhouensis we performed multiple alignment of the mitogenomes determined were 1,320 bp for lrRNA and 727 bp for srRNA in length, and the for C. suzhouensis and Rhinotermitidae. The nucleic acid similarity A+T content of the two genes was 70.61 and 65.89%, respectively. rate between these taxa was found to rang from 85 to 99%. Further, C.  suzhouensis shared the highest homology with C.  formosanus, Control Region with nucleic acid similarity of more than 99%, whereas the deduced The 949-bp control region of C.  suzhouensis was located between amino acids similarity of individual PCGs ranged from 99.72 to Ile srRNA and tRNA with an A+T content of 69.23%, which was 100%. The base composition of Rhinotermitidae mitogenomes higher than that of the complete mitogenome (65.60%). There were showed a high degree of similarity with A+T biased (61.77−66.33%). two different sets of repeat units in the CR zone (A+B repeats). The Differences in mitochondrial sequences between C.  suzhouensis A repeats contained two identical units A1 and A2 (66 bp). The B and C. formosanus were shown in Table 6. Comparison of complete repeats consisted of one complete unit B1 (562 bp) and a partial unit mitogenome sequences with the three populations of C. formosanus B2 (38 bp). Shiraki (AB626145.1−AB626147.1) showed five to seven site Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 7 Table 6. Differences in the nucleotides of C. suzhouensis and C. formosanus mitochondrial genomes Position Gene C. suzhouensis C. formosanus C. formosanus C. formosanus C. formosanus (MG000963) (AB626145.1) (AB626146.1) (AB626147.1) (KU925203.1) 15,764 bp 16,326 bp 16,326 bp 16,324 bp 14,908 bp 482 ND2 T(Phe) T T T C(Leu) 646 A(Met) A A A G(Met) 1,578 COX1 T(Leu) T T T C(Leu) 1,990 A(Met) A A A G(Val) 2,061 G(Leu) G G G A(Leu) 2,334 T(Phe) C(Phe) C(Phe) C(Phe) C(Phe) Leu(UUR) 3,056 tRNA C C C C T 3,063 A A A A G 3,337 COX2 A(Val) A A A G(Val) 3,397 G(Thr) A(Thr) A(Thr) A(Thr) A(Thr) 3,412 T(Ala) T T T A(Ala) Lys 3,824 tRNA A A C A A 4,223 ATP6 A(Met) A A A T(Leu) 4,348 C(Phe) C C C T(Phe) 4,465 T(His) T T T C(His) Gly 5,580 tRNA A A A — — 5,581 A A A — — 5,928 ND3 T(Leu) T T T C(Leu) 5,981 A(Lys) A A A C(Asn) Ala 6,020 tRNA A A A A G 7,598 ND5 T(Met) T T T C(Val) 7,719 C(Met) C C C T(Met) 7,866 C(Ser) C C C A(Ser) 8,523 ND4 C(Trp) C C C T(Trp) 10,722 Cytb G(Gly) G A(Ser) G G 11,687–11,688 intergenic region — — — — TTAC Ser(UCN) (tRNA — ND1) 11,978 ND1 T(Ile) C(Val) C(Val) T T 13,040 lrRNA(16S) C T T T T 13,660 C C C T T 14,514 srRNA(12S) A A A A — 14,590 A A A A T 14,664 T T T T C 14,765 C C C C T 14,963 CR T C C T — 14,816–15,764 (14,816–15,764) (14,816–16,326) (14,816–16,326) (14,816–16,326) — 949bp 1,511bp 1,511bp 1,511bp — (A1,A2,B1,B3) (A1,A2.B1,B2,B3) (A1.,A2,B1,B2,B3) (A1,A2,B1,B2,B3) — Nonsynonymous substitutions are indicated with the bold font; corresponding amino acids are shown in parentheses. Positions are relevant to MG000963. Deletions are indicated as —. differences and a long fragment deletion (B1 repeat region of 562 bp; the phylogenetic tree was largely consistent, and the classifica- 3.47% sequence divergence; Table 6). Variable sites between C. suzho- tion of the family was clear. The analyzed species (41 termites) uensis and C. formosanus were located in four PCGs (COX1, COX2, were divided into five major clades with the basic framework: Gly Cytb, and ND1), tRNA , lrRNA (16S), and Repeat A1 region; var- (Mastotermitidae + (Kalotermitidae + (Serritermitidae + iation in COX1 and COX2 was synonymous. However, two sites in (Termitidae + Rhinotermitidae)))) (Fig. 3). In the phylogenetic tree, Cytb and ND1 were nonsynomyous. The A to G (C. suzhouensis) at Coptotermes, Heterotermes, and Reticulitermes formed a mono- position 10,722 led to serine (AGA) to glycine (GGA) transformation, phyletic group, and the relationship between the three genera was whereas the C to T at 11,978 led to valine (GTT) to isoleucine (ATT) Reticulitermes + (Heterotermes + Coptotermes), which is consistent transformation, respectively. In contrast, the differences between with morphological data, and findings of previous molecular studies C.  suzhouensis and C.  formosanus (KU925203) were greater, with (Bourguignon et  al. 2015, Bourguignon et  al. 2017, Inward et  al. 31 differences, of which 13 were synonymous, and 5 were nonsyno- 2007b, Lo et al. 2004). myous. Comparative analyses suggested that the complete mtDNA of Phylogenetic analyses suggested that C.  suzhouensis and C. suzhouensis and C. formosanus are highly similar, consistant with C.  formosanus were clustered in one branch with strong support them being the same species. (BPP  =  100%, MLBP  =  100%, and MPBP  =  100%), and these two groups formed a sister group to (C.  kalshoveni + (C.  remotus Phylogenetic Relationships + C.  sepangensis)). The genetic distances between C.  suzhouen- Phylogenetic trees were built from 13 PCGs using three differ- sis and several C.  formosanus samples was 0.000 (AB626145.1− ent methods (ML, MP, and BI). The topological structure of AB626147.1), while the genetic distance between C.  suzhouensis Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 8 Journal of Insect Science, 2018, Vol. 18, No. 2 Fig.  3. Phylogenetic trees inferred with the amino acid sequences of 13 PCGs of the mitogenome of 41 termites species. S.  lateralis (KU684413.1) and P. australasiae (KX640825.1) were used as outgroups. Numbers above the branches represent Bayesian posterior probabilities and bootstrap branch support for Maximum likelihood and Maximum parsimony, respectively. Nodes, which all support rates were 100%, were marked with an asterisk. and C. formosanus was 0.002 (KU925203.1), which indicated that In Rhinotermitidae, the initiation and termination of 13 PCGs C. suzhouensis shared considerably close evolutionary relationships were essentially consistent. The majority of PCGs utilized canon- with C. formosanus. ical start codons (ATN) and stop codons (TAA, TAG, TA, or T). For C.  suzhouensis, the stop codons of 13 PCGs were TAA, except for 3 PCGs (COX2, ND5, and Cytb), which were terminated with the Discussion partial stop codon T. Incomplete stop codons are common features of insect mitogenomes (Dietrich and Brune 2014, Hervé and Brune Termites play an important role in nutrient cycling and decompos- 2017), and it has been proposed that the complete termination ition but are also often considered pest species as they may damage codons are generated by the post-transcriptional polyadenylation wooden buildings. Identifying termite species, especially those in the (Ojala et al. 1981). genus Coptotermes, is very difficult, and the taxonomic validity of The A+T rich region, known for the initiation of replication, is many named Coptotermes species remains unclear (Chouvenc et al. Ile located between srRNA and tRNA in Rhinotermitidae. And, the 2015). mtDNA has been extensively used as an informative molecu- A+T content (69.23%) of the control region (949 bp) in C. suzho- lar marker for diverse evolutionary studies of animals, including in uensis was higher than that of the entire mitogenome (65.60%), molecular evolution, phylogenetics, and population genetics (Gissi which is consistent with other Rhinotermitidae mitogenomes. The et al. 2008, Cameron 2014b, Qin et al. 2015). Thus, molecular tools control region has the highly variability in the base composition may aid in the identification of termite species and resolves the rela- and structure within Rhinotermitidae. In termites, the complicated tionships between C. suzhouensis and C. formosanus. double repeat units were first found in Reticulitermes, consisting of The present study analyzed the complete mtDNA sequence of short (type-A) repeats adjacent to the srRNA end and long (type-B) C. suzhouensis. The gene arrangement of the mitogenome was iden- Ile repeats adjacent to the tRNA end (Supp Table  2 [online only]). tical to that of Coptotermes, as well as consistent with the ancestral Cameron (2012) considered that the repeat units are involved in arrangement of the insect mitogenome, indicating that it has been the replication-mediated processes and are a synapomorphic fea- conserved during the evolution of these insects (Wei et  al. 2010). ture of Neotermitoidea, secondarily lost A-type repeats in higher Genetic analysis indicated interspecies genetic distance within Termitidae (non-macrotermitine termitids). In C.  suzhouensis, the Rhinotermitidae was 0.029−0.186. In Coptotermes, the difference repeat units consist of two full A units, one full B, and one partial among individuals within species (0.000−0.019) was lower than B unit (A-A-B-Bp). In addition, the second A and full B units over- that among species (0.029−0.116), whereas the average genetic dis- lap 12  bp. Compared to C.  formosanus (A-A-B-B-Bp), a deletion tance between C. suzhouensis and C. formosanus was 0.000−0.002, of one complete B repeat was found in the CR zone of C.  suzho- indicating that the two taxa share considerably close evolutionary uensis, and the phenomenon of repeat unit reduction was also relationships with each other (consistent with the findings of phy- observed in other termites [Reticulitermes virginicus (Isoptera: logenetic analyses; Fig. 3, Supp Table 1 [online only]). Our phyloge- Rhinotermitidae), Cameron et  al. 2007] . Comparative analysis of netic analyses support the viewpoint that C.  suzhouensis was the the control region within Rhinotermitidae revealed two conserved synonymy of C. formosanus. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 9 phylogenomics resolves the global spread of higher termites, ecosystem sequences ‘AATCCTAAACTTATCT’ (located at B1 repeat region: engineers of the tropics. Mol. Biol. Evol 34: 589–597. from 15,223 to 15,238) and ‘AGATAAGTTTAGGATT’ (located Brody, A. K., T. M.  Palmer, K.  Fox-Dobbs, and D. F.  Doak. 2010. Termites, at B1 repeat region: from 15,254 to 15,269) in the control regions vertebrate herbivores, and the fruiting success of Acacia drepanolobium. of C.  suzhouensis (Supp Fig. 1 [online only]) that formed the hair- Ecology 91: 399–407. pin loop structure. The hairpin loop known as RGC (rare genomic Cai, B. H., and N. S. Chen. 1964. The classification and regional of termites in change) is considered to have a high degree of sequence conservation Chinese. Acta Entomol. Sinica 13: 25–37. in all termite species and speculated to be the origin of replication Cameron, S. L., and M. F.  Whiting. 2007. Mitochondrial genomic compari- for the mitogenome (Saito et  al. 2005). Further, a poly-T stretch sons of the subterranean termites from the Genus Reticulitermes (Insecta: Isoptera: Rhinotermitidae). Genome 50: 188–202. (located at B1 repeat region: from 15,238 to 15,245) was found in Cameron, S. L., N. Lo, T. Bourguignon, G. J. Svenson, and T. A. Evans. 2012. the loop of hairpin structure, spanning 8-bp long, which also existed A mitochondrial genome phylogeny of termites (Blattodea: Termitoidae): in other Coptotermes species. No typical microsatellite-like regions robust support for interfamilial relationships and molecular synapomor- were found in the AT-rich region of C. suzhouensis, which are com- phies define major clades. Mol. Phylogenet. Evol 65: 163–173. monly found in other insect species, but absent from all reported Cameron, S. L. 2014a. How to sequence and annotate insect mitochondrial Rhinotermitidae species identified thus far (Beier et al. 2017). genomes for systematic and comparative genomics research. Syst. Entomol In termites, species descriptions have historically relied upon 39: 400–411. morphological characters of the soldiers and alates, which has con- Cameron, S. L. 2014b. Insect mitochondrial genomics: implications for evolu- tion and phylogeny. Annu. Rev. Entomol 59: 95–117. tributed to synonyms within Coptotermes (more than 40 junior Chen, Q., K. Wang, Y. L. Tan, and L. X. Xing. 2016. The complete mitochon- synonyms) (Krishna et  al. 2013). A  recent analysis using molecu- drial genome of the subterranean termite, reticulitermes chinensis Snyder lar data has provided some insight into Coptotermes phylogenetics (Isoptera: Rhinotermitidae). Mitochondrial DNA A.  DNA Mapp. Seq. and radiation (Bourguignon et al. 2017). For example, Coptotermes Anal 27: 1428–1429. havilandi (Isoptera: Rhinotermitidae) and Coptotermes gestroi Cheng, D. B. 2012. Advances of researches on classification of termites (Isoptera: Rhinotermitidae), Coptotermes elisae (Desneux) (Isoptera: (Isoptera). J. Entomol. Res. Central China 8:257–263. Rhinotermitidae), and Coptotermes curvignathus (Isoptera: Cheng, D. B. 2014. Termites. Science Press, Beijing, China. Rhinotermitidae), as well as C.  gestroi and Coptotermes vastator Cheng, X. F., L. P. Zhang, D. N. Yu, K. B. Storey, and J. Y. Zhang. 2016. The complete mitochondrial genomes of four cockroaches (Insecta: Blattodea) (Isoptera: Rhinotermitidae), were each revealed to be synonymous and phylogenetic analyses within cockroaches. Gene 586: 115–122. (Kirton and Brown 2003, Wang 2004, Kirton et al. 2005, Bengkeok Chouvenc, T., E. E.  Helmick, and N. Y.  Su. 2015. Hybridization of two et  al. 2007, Lee et  al. 2015) . In this study, we described the com- major termite invaders as a consequence of human activity. Plos One 10: plete mitogenome sequence of C. suzhouensis and compared it to the e0120745. available mitogenomes of other termites using phylogenetic analyses. Chouvenc, T., H. F. Li, J. Austin, C. Bordereau, T. Bourguignon, S. L. Cameron, Our results suggest that C. suzhouensis and C. formosanus are likely E. M. Cancello, R. Constantino, A. M. Costa‐Leonardo, and P. Eggleton to be synonyms. 2016. Revisiting Coptotermes (Isoptera: Rhinotermitidae): a global taxo- nomic road map for species validity and distribution of an economically important subterranean termite genus. Syst. Entomol 41: 299–306. Acknowledgments Dietrich, C., and A. Brune. 2014. The complete mitogenomes of six higher ter- mite species reconstructed from metagenomic datasets (Cornitermes sp., This work was support by Natural Science Foundation of Anhui Province Cubitermes ugandensis, Microcerotermes parvus, Nasutitermes corniger, (11040606M78), Key Research Program of the Education Department of Neocapritermes taracua, and Termes hospes). Mitochondrial DNA 4: 1–2. Anhui Province (KJ2012A016) and Project of Hefei Termite Control Institute Eggleton, P., G.  Beccaloni, and D.  Inward 2007. Response to Lo et  al. Biol (Y06090504). We declare no competing interest. We express gratitude for sup- Lett 3: 564–565. port by Hefei Termite Control Institute. Emerson, A. E. 1952. The biogeography of termites. Bull. Am. Mus. Nat. Hist. 99: 217–225. References Cited Engel, M. S., and K.  Krishna, 2004. Family-group names for termites (Isoptera). Am. Mus. Nov. 3432: 1–9. Akaike, H. 1974. A new look at the statistical model identification. IEEE Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the Trans. Aut. Control 19: 716–723. bootstrap. Evolution 39: 783–791. Beier, S., T. Thiel, T. Münch, U. Scholz, and M. Mascher. 2017. MISA-web: a Gissi, C., F.  Iannelli, and G.  Pesole. 2008. Evolution of the mitochondrial web server for microsatellite prediction. Bioinformatics 33: 2583–2585. genome of Metazoa as exemplified by comparison of congeneric species. Bengkeok, Y., A. S. Othman, V.S. Lee, and L. Chowyang. 2007. Genetic rela- Heredity (Edinb.) 101: 301–320. tionship between Coptotermes gestroi and Coptotermes vastator (Isoptera: Hausberger, B., D. Kimpel, A. van Neer, and J. Korb. 2011. Uncovering cryptic Rhinotermitidae). J. Econ. Entomol 100: 467–474. species diversity of a termite community in a West African savanna. Mol. Bernt, M., A.  Donath, F.  Jühling, F.  Externbrink, C.  Florentz, G.  Fritzsch, Phylogenet. Evol 61: 964–969. J.  Pütz, M.  Middendorf, and P. F.  Stadler. 2013. MITOS: improved de Hervé, V., and A.  Brune 2017. The complete mitochondrial genomes of novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol the higher termites Labiotermes labralis and Embiratermes neotenicus 69: 313–319. (Termitidae: Syntermitinae). Mitochondrial DNA 2: 109–110. Bourguignon, T., N. Lo, S. L. Cameron, J. Šobotník, Y. Hayashi, S. Shigenobu, Huang, F. S., S. M. Zhu, Z. M. Ping, X. S. He, G. X. Li, and D. R. Gao 2000. D. Watanabe, Y. Roisin, T. Miura, and T. A. Evans. 2015. The evolutionary Fauna Sinica Isecta. Vol. 17, Isoptera. Science Press, Beijing, China. history of termites as inferred from 66 mitochondrial genomes. Mol. Biol. Huelsenbeck, J. P., and F. Ronquist. 2001. MRBAYES: Bayesian inference of Evol 32: 406–421. phylogenetic trees. Bioinformatics 17: 754–755. Bourguignon, T., N.  Lo, J.  Šobotník, D.  Sillam-Dussès, Y.  Roisin, and T. Inward, D., G. Beccaloni, and P. Eggleton. 2007a. Death of an order: a compre- A.  Evans. 2016. Oceanic dispersal, vicariance and human introduction hensive molecular phylogenetic study confirms that termites are eusocial shaped the modern distribution of the termites reticulitermes, heterotermes cockroaches. Biol. Lett 3: 331–335. and coptotermes. Proc. Biol Sci 283: 20160179. Inward, D. J., A. P. Vogler, and P. Eggleton. 2007b. A comprehensive phyloge- Bourguignon, T., N. Lo, J. Šobotník, S. Y. Ho, N. Iqbal, E. Coissac, M. Lee, netic analysis of termites (Isoptera) illuminates key aspects of their evolu- M. M. Jendryka, D. Sillam-Dussès, B. Krížková, et al. 2017. Mitochondrial tionary biology. Mol. Phylogenet. Evol 44: 953–967. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 10 Journal of Insect Science, 2018, Vol. 18, No. 2 Kambhampati, S., and P. Eggleton 2000. Taxonomy and phylogeny of termites, pp. Qin, J., Y.  Zhang, X.  Zhou, X.  Kong, S.  Wei, R. D.  Ward and A. B.  Zhang 1–23. In T. Abe, D.E. Bignell, M. Higashi (eds) Termites: evolution, sociality, 2015. Mitochondrial phylogenomics and genetic relationships of closely symbiose, ecology. Kluwer Academic Publishers, Dordrecht, the Netherlands. related pine moth (Lasiocampidae: Dendrolimus) species in China, using Kim, I., S. Y. Cha, M. H. Yoon, J. S. Hwang, S. M. Lee, H. D. Sohn, and B. whole mitochondrial genomes. BMC Genomics 16: 1–12. R. Jin. 2005. The complete nucleotide sequence and gene organization of Rocha, M. M., C. Cuezzo, and E. M. Cancello 2017. Phylogenetic reconstruc- the mitochondrial genome of the oriental mole cricket, Gryllotalpa orien- tion of Syntermitinae (Isoptera, Termitidae) based on morphological and talis (Orthoptera: Gryllotalpidae). Gene 353: 155–168. molecular data. Plos One 12: e0174366. Kirton, L. G., and V. K. Brown. 2003. The taxonomic status of pest species of Rust, M. K., and N. Y. Su. 2012. Managing social insects of urban importance. Coptotermes in Southeast Asia: resolving the paradox in the pest status of Annu. Rev. Entomol 57: 355–375. the termites, Coptotermes gestroi, C. havilandi and C. travians (Isoptera: Saito, S., K. Tamura, and T. Aotsuka. 2005. Replication origin of mitochon- Rhinotermitidae). Sociobiology 42: 43–63. drial DNA in insects. Genetics 171: 1695–1705. Kirton, L. G., Lee, C. Y., and W. H. Robinson. 2005. The importance of accur- Stamatakis, A., P. Hoover, and J. Rougemont. 2008. A rapid bootstrap algo- ate termite taxonomy in the broader perspective of termite management, rithm for the RAxML Web servers. Syst. Biol. 57: 758–771. pp. 1–7. P&Y Design Network. Penang, Malaysia. Swofford, D. L. 2002. PAUP*. phylogenetic analysis using parsimony Korb, J., M. Poulsen, H. Hu, C. Li, J. J. Boomsma, G. Zhang, and J. Liebig. (*and other methods). version 4.0b10. Mccarthy, doi: 10.1111/j.0014- 2015. A genomic comparison of two termites with different social com- 3820.2002.tb00191.x. plexity. Front. Genet. 6: 9. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar 2014. Krishna, K., D. A. Grimaldi, V. Krishna, and M. S. Engel. 2013. Treatise on the MEGA5: molecular evolutionary genetics analysis using maximum like- isoptera of the world. Bull. Am. Mus. Nat. Hist. 377: 1–2704. lihood, evolutionary distance, and maximum parsimony methods. Mol. Lee, T. R., S. L. Cameron, T. A. Evans, S. Y. Ho, and N. Lo. 2015. The origins Biol. Evol. 28: 2731–2739. and radiation of Australian Coptotermes termites: from rainforest to des- Tokuda, G., H.  Isagawa, and K.  Sugio 2012. The complete mitogenome of ert dwellers. Mol. Phylogenet. Evol. 82 (Pt A): 234–244. the Formosan termite, Coptotermes formosanus Shiraki. Insectes. Soc. 59: Lee, W., T. Han, J. H. Lee, K. J. Hong, and J. Park 2017. The complete mito- 17–24. chondrial genome of the subterranean termite, Reticulitermes speratus Wang, J. G. 2004. Phylognetic study of termites based on the morphologi- kyushuensis Morimoto, 1968 (Isoptera: Rhinotermitidae). Mitochondrial cal and molecular approache. Shouthen China Agricultral University, DNA Part B 2:178–179. Guangzhou. pp. 1–142. Legendre, F., M. F. Whiting, C. Bordereau, E. M. Cancello, T. A. Evans, and Wang, Y. L., Y. H.  Chen, C. C.  Xia, X. Q.  Xia, R. S.  Tao, and J. S.  Hao. P.  Grandcolas. 2008. The phylogeny of termites (Dictyoptera: Isoptera) 2015. The complete mitochondrial genome of the Common Red Apollo, based on mitochondrial and nuclear markers: implications for the evolu- Parnassius epaphus (Lepidoptera: Papilionidae: Parnassiinae). J. Asia-Pac. tion of the worker and pseudergate castes, and foraging behaviors. Mol. Entomol. 18: 239–248. Phylogenet. Evol. 48: 615–627. Wang, P., J. Zhu, M. Wang, Y. Zhang, J. Wang, Y. Zhu, and P. Zhang. 2016. The Li, G. X. 2002. Chinese termites and control. Science Press, Beijing, China. complete mitochondrial genome of and implications for Rhinotermitidae Li, Y. X., X. G. Wang, J. Ou, F. J. Yao, Y. Yang, and Z. M. Wei. 2016. The complete taxonomy. Mitochondrial DNA Part B Res. 1: 392–393. mitochondrial genome of Coptotermes testaceus (Isoptera: Rhinotermitidae). Watson, J., and F.  Gay. 1991. Isoptera (Termites), pp. 330–347. In: CSIRO Mitochondrial DNA A. DNA Mapp. Seq. Anal. 27: 3466–3468. (ed.), Insects of Australia, Vol. 1. Cornell University Press, Ithaca, NY. Lo, N., O.  Kitade, T.  Miura, R.  Constantino, and T.  Matsumoto. 2004. Wei, S. J., M. Shi, X. X. Chen, M. J. Sharkey, C. van Achterberg, G. Y. Ye, and Molecular phylogeny of the Rhinotermitidae. Insectes. Soc. 51: J. H. He. 2010. New views on strand asymmetry in insect mitochondrial 365–371. genomes. PLoS One 5: e12708. Lowe, T. M., and P. P. Chan. 2016. tRNAscan-SE on-line: integrating search Wei, S. J., J. F.  Ni, M. L.  Yu, and B. C.  Shi. 2012. The complete mitochon- and context for analysis of transfer RNA genes. Nucleic Acids Res 44: drial genome of Macrotermes barneyi Light (Isoptera: Termitidae). W54–W57. Mitochondrial DNA 23: 426–428. Ma, J., C.  Du, C.  Zhou, Y.  Sheng, Z.  Fan, B.  Yue, and X.  Zhang. 2017. Wolstenholme, D. R. 1992. Animal mitochondrial DNA: structure and evolu- Complete mitochondrial genomes of two blattid cockroaches, Periplaneta tion. Int. Rev. Cytol. 141: 173–216. australasiae and Neostylopyga rhombifolia, and phylogenetic relation- Wyman, S. K., R. K. Jansen, and J. L. Boore. 2004. Automatic annotation of ships within the Blattaria. PLoS One 12: e0177162. organellar genomes with DOGMA. Bioinformatics 20: 3252–3255. Meng, Z., S. Jiang, X. Chen, and C. Lei. 2016. The complete mitochondrial Xia, K. L., and X. S. He. 1986. The research on Coptotermes in Chinese Bulletin genome of fungus-growing termite, Macrotermes natalensis (Isoptera: of Entomological Research. Shanghai Scientific & Technical Publishers, Macrotermitinae). Mitochondrial DNA A.  DNA Mapp. Seq. Anal. 27: Shanghai. pp. 157–182. 1728–1729. Xiao, B., A. H. Chen, Y. Y. Zhang, G. F. Jiang, C. C. Hu, and C. D. Zhu. 2012. Ojala, D., J.  Montoya, and G.  Attardi. 1981. tRNA punctuation model of Complete mitochondrial genomes of two cockroaches, Blattella german- RNA processing in human mitochondria. Nature 290: 470–474. ica and Periplaneta americana, and the phylogenetic position of termites. Perna, N. T., and T. D. Kocher. 1995. Patterns of nucleotide composition at fourfold Curr. Genet. 58: 65–77. degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 41: 353–358. Xu, L. P., X. S. Liang, Q. J. Zhou, and J. S. Xue 2009. Application of classifi- Posada, D., and K. A.  Crandall. 1998. MODELTEST: testing the model of cation of termites by means of molecular biological techniques. J. Inspect. DNA substitution. Bioinformatics 14: 817–818. Quarantine 19: 70–74. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Insect Science Oxford University Press

The Complete Mitochondrial Genome of Coptotermes ‘suzhouensis’ (syn. Coptotermes formosanus) (Isoptera: Rhinotermitidae) and Molecular Phylogeny Analysis

Free
10 pages

Loading next page...
 
/lp/ou_press/the-complete-mitochondrial-genome-of-coptotermes-suzhouensis-syn-k3MC3skMoE
Publisher
Entomological Society of America
Copyright
© The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America.
eISSN
1536-2442
D.O.I.
10.1093/jisesa/iey018
Publisher site
See Article on Publisher Site

Abstract

Coptotermes suzhouensis (Isoptera: Rhinotermitidae) is a significant subterranean termite pest of wooden structures and is widely distributed in southeastern China. The complete mitochondrial DNA sequence of C.  suzhouensis was analyzed in this study. The mitogenome was a circular molecule of 15,764 bp in length, which contained 13 protein-coding genes (PCGs), 22 transfer RNA genes, two ribosomal RNA genes, and an A+T-rich region with a gene arrangement typical of Isoptera mitogenomes. All PCGs were initiated by ATN codons and terminated by complete termination codons (TAA), except COX2, ND5, and Cytb, which ended with an incomplete termination Ser(AGN) codon T. All tRNAs displayed a typical clover-leaf structure, except for tRNA , which did not contain the stem- loop structure in the DHU arm. The A+T content (69.23%) of the A+T-rich region (949  bp) was higher than that of the entire mitogenome (65.60%), and two different sets of repeat units (A+B) were distributed in this region. Comparison of complete mitogenome sequences with those of Coptotermes formosanus indicated that the two taxa have very high genetic similarity. Forty-one representative termite species were used to construct phylogenetic trees by maximum likelihood, maximum parsimony, and Bayesian inference methods. The phylogenetic analyses also strongly supported (BPP , MLBP , and MPBP = 100%) that all C. suzhouensis and C. formosanus samples gathered into one clade with genetic distances between 0.000 and 0.002. This study provides molecular evidence for a more robust phylogenetic position of C. suzhouensis and inferrs that C. suzhouensis was the synonymy of C. formosanus. Key words: Coptotermes suzhouensis, mitochondrial genome, phylogenetic analysis, synonymy representatives of major pest genera Coptotermes, Reticulitermes, Introduction and Heterotermes (Huang et al. 2000, Cheng 2012). The difficulty Termites (Isoptera) (Eggleton et al. 2007) comprise more than 3,000 in identifying termites is recognized by many termite classifica- species in approximately 283 genera (Inward et al. 2007a, Krishna tion experts, especially in the genus Coptotermes (Emerson 1952, et  al. 2013, Cheng 2014). Of all termite species recognized glob- Watson and Gay 1991, Huang et al. 2000, Chouvenc et al. 2016). ally, only 183 are significant pest species known to damage build- Taxonomic limits between species in genus Coptotermes, are poorly ings (Krishna et al. 2013, Chouvenc et al. 2015), of which the genus established, which has resulted in different names being used for the Coptotermes contains the largest number (18) of pest species (Rust same species (Chouvenc et al. 2016). This has created additional dif- and Su 2012). Due to their destructive effect on wooden structures ficulties in the identification of termites, which were already been and their essential role in decomposition and nutrient recycling, complicated by the limited morphological features available for research on the biological characteristics, classification, identifica- identifications. The number of species in the genus Coptotermes tion, and phylogenetic relationships of termites has received increas- is frequently revised, as synonyms of other species are recognised ing attention (Wolstenholme 1992, Brody et al. 2010, Hausberger (Engel and Krishna 2004, Krishna et  al. 2013, Cameron 2014a). et  al. 2011, Korb et  al. 2015, Chouvenc et  al. 2016, Bourguignon Most species of Coptotermes are considered to be similar to each et al. 2016, Rocha et al. 2017). In China, 4 families, 44 genera, and other, and their identification is thus very difficult. Kambhampati 473 species of termites have been recorded (Huang et  al. 2000, (2000) also thought that many synonyms were found in the nomen- Cheng 2014). The Rhinotermitidae are widely distributed in China, clature of termites based on morphological classifications. The with approximately 200 described species in seven genera, including © The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/ licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 2 Journal of Insect Science, 2018, Vol. 18, No. 2 classification and identification of Coptotermes have been revised extension period 72°C (10 min). PCR products were checked using based on molecular data (Cai and Chen 1964, Huang et al. 2000, Xu 1% agarose gels and were sequenced at MAP Biotech Company et al. 2009, Cheng 2012). To date, 22 species of Coptotermes have (Shanghai, China) with ABI3730 Genetic Analyzer. been recorded in China (Krishna et al. 2013). Coptotermes suzho- uensis (Isoptera: Rhinotermitidae) is very similar to Coptotermes Sequence Assembly, Annotation, and Analysis formosanus (Isoptera: Rhinotermitidae), a major invasive species, in Sequences were assembled and aligned with complete mitog- morphology. C.  suzhouensis is widely distributed in the regions of enomes from C.  formosanus in Sequencher 4.1.4. The location, southeastern China and is a pest of wooden buildings (Xia and He size, and coding direction of each gene, including 13 protein cod- 1986, Huang et al. 2000, Li 2002, Cheng 2012). There has always ing genes (PCGs), 22 tRNA genes, and two rRNA genes were been controversy regarding the relationship between the two species determined with DOGMA (Wyman et al. 2004). Secondary struc- (C. suzhouensis and C. formosanus). tures of tRNA were predicted using MITOS (Bernt et  al. 2013) In the study, we determined the complete mitogenome sequence and tRNAscan-SE Search Server v.2.0 online (Lowe and Chan of C.  suzhouensis and compared it to available mitogenomes of 2016). Amino acid composition and coding region for each PCG other termites using phylogenetic analyses. In doing so, we provide was identified with ORF Finder (http://www.ncbi.nlm.nih.gov/ robust molecular evidence for the taxonomic status of C. suzhouen- gorf/gorf.html). Nucleotide composition statistics (excluding sis and reveal the evolutionary relationships of C. suzhouensis and stop codons) and relative synonymous codon usage (RSCU) of C. formosanus. 13 PCGs were calculated with MEGA 5.1 (Tamura et  al. 2014). Composition skew analysis was calculated according to formulas AT skew = [A−T]/[A+T] and GC skew = [G−C]/[G+C], respectively Materials and Methods (Perna and Kocher 1995). Collection and Storage Specimens of C. suzhouensis were collected from colonies of termites The Reconstruction of Phylogenetic Trees living in wooden buildings in Feixi County in Hefei, Anhui Province, Along with the C.  suzhouensis mitochondrial genome, 41 termite China (31°42′31″N, 117°10′38″E). The specimens were preserved in mitogenomes and two outgroup species (Shelfordella lateralis and 95% ethanol and stored at −20°C until DNA extraction. Periplaneta australasiae: Blattodea) were used in phylogenetic ana- lysis. Sampling and sequence availability used in this study are sum- Morphological Identification of Termites marized in Table 2. Concatenated amino acid sequences from the 13 Soldier specimens of all the populations collected were identified by PCGs was used in phylogenetic analysis, with maximum likelihood the Hefei Termite Control Institute based on their morphological (RAxML7.03; Stamatakis et al. 2008), maximum parsimony (PAUP characteristics (Xia and He 1986, Huang et al. 2000). 4.0b10; Swofford 2002), and Bayesian inference methods (Mr Bayes v.3.1.2) (Huelsenbeck and Ronquist 2001). Modeltest ver3.06 (Posada DNA Isolation, Polymerase Chain Reaction, and and Crandall 1998) was used to infer best-fitting model for Bayesian Sequencing inference (BI) and maximum likelihood (ML) analysis. The GTR + Whole genomic DNA was extracted from the heads of 20 soldiers I + G model was selected based on the Akaike information criterion using One-tube General Sample DNAup Kit (Sangon Biotech, (Akaike 1974). Bayesian inference was performed with the following Shanghai, China) for polymerase chain reaction (PCR), following settings: four MCMC chains (one cold chain and three hot chains) manufacturer’s instructions. Mitochondrial genome sequences of the for 10,000,000 generations until the average standard deviation of termites related to C. suzhouensis were downloaded from the NCBI split frequencies reached a value less than 0.01. Bayesian posterior database. ClustalX ver1.8 was used for alignment, and Premier probabilities (BPP) were calculated from the sample points after the Primer 5 software was applied to design five pairs of primers from MCMC algorithm had started to converge. In ML and MP analyses, a conserved regions (Table 1). Fragments were amplified by long dis- heuristic search with 100 random addition replicates was applied. BPP tance PCR using Takara LA Taq (Takara Bio, Japan) with the fol- values were mapped onto the tree, and nodal support for ML&MP lowing cycling conditions: an initial denaturation for 3 min at 94°C, was assessed using nonparametric bootstrapping (Felsenstein 1985) followed by 35 cycles of denaturation at 94°C (30 s), annealing at in PAUP for the MP analyses (MPBP) and RAxML (Stamatakis et al. 52−58°C (30 s; Table  1), elongation at 72°C (10 min); and a final 2008) for ML (MLBP) using 1,000 pseudoreplicates each. Table 1. The primers for PCR in this study Primers Sequences (5ʹ–3ʹ) Positions (5ʹ–3ʹ) Size of PCR Annealing temperatures (°C) product (bp) Primer-1-F TATCGCCATACCATCACTACGACTCCTA 3,340–3,367 5,154 55 Primer-1-R TGCTCCCCCTTCTCTTAATCTTCTCGGT 8,493-8,466 Primer-2-F GAACCAAAGCAGACACAGGAGTAGGAGC 7,481–7,508 4,742 58 Primer-2-R TGGGCTTCGTGCTTTGGCTCAGACTATC 12,222-12,195 Primer-3-F AGAAACCAACTCCGATTCCCCCTCAGCA 11,988–12,015 7,427 58 Primer-3-R GTCGTCCTGGTGTGGCGTCTGTTTTTAC 3,650-3,623 Primer-COX3-F ATTCCACCAATACGACAACAGCCTA 4,872–4,896 582 52 Primer-COX3-R GAGAAGTGTAGGGCTGCTTGTCGTA 5,453-5,429 Primer-Cytb-F GACATCAATACCGCATTTTCCAGAG 10,638–10,662 850 52 Primer-Cytb-R GTCGTGCTCCGATTCAGGTAAGTAG 11,487-11,463 Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 3 Table 2. Detailed information of the termites species analyzed in this study Family Species Size (bp) Accession number References Rhinotermitidae Reticulitermes aculabialis 16,475 KP334994.1 Wang et al. (2015) Reticulitermes chinensis 15,925 KM216388.1 Chen et al. (2016) Reticulitermes flavipes 16,565 EF206314.1 Cameron and Whiting (2007) Reticulitermes hageni 16,590 EF206320.1 Cameron and Whiting (2007) Reticulitermes santonensis 16,567 EF206315.1 Cameron and Whiting (2007) Reticulitermes virginicus 16,513 EF206318.1 Cameron and Whiting (2007) Reticulitermes labralis 15,914 KU877221.1 Wang et al. (2016) Reticulitermes speratus kyushuensis 15,898 KY484910.1 Lee et al. (2017) Reticulitermes sp. 14,907 KU925239.1 Bourguignon et al. (2017) Reticulitermes grassei 14,910 KU925237.1 Bourguignon et al. (2017) Reticulitermes flaviceps 16,485 KX712090.1 Chen et al. (2016) Heterotermes sp. 16,370 JX144936.1 Cameron et al. (2012) Heterotermes cf.occiduus 14,919 KU925230.1 Bourguignon et al. (2017) Heterotermes cf. paradoxus 14,904 KU925225.1 Bourguignon et al. (2017) Heterotermes nr. tenuis 14,944 KU925228.1 Bourguignon et al. (2017) Heterotermes platycephalus 14,919 KU925231.1 Bourguignon et al. (2017) Heterotermes tenuis 14,940 KU925233.1 Bourguignon et al. (2017) Heterotermes validus 14,922 KU925235.1 Bourguignon et al. (2017) Coptotermes acinaciformis raffrayi 14,897 KU925196.1 Bourguignon et al. 2017 Coptotermes acinaciforis 14,896 KU925198.1 Bourguignon et al. (2017) Coptotermes amanii 14,894 KU925200.1 Bourguignon et al. (2017) Coptotermes lacteus 16,326 JX144934.1 Cameron et al. (2012) Coptotermes frenchi 14,912 KU925204.1 Bourguignon et al. (2017) Coptotermes gestroi 14,919 KU925205.1 Bourguignon et al. (2017) Coptotermes heimi 14,908 KU925206.1 Bourguignon et al. (2017) Coptotermes kalshoveni 14,889 KU925210.1 Bourguignon et al. (2017) Coptotermes michaelseni 14,900 KU925212.1 Bourguignon et al. 2017 Coptotermes remotus 14,742 KU925213.1 Bourguignon et al. 2017 Coptotermes sjoestedti 14,899 KU925217.1 Bourguignon et al. 2017 Coptotermes sepangensis 14,905 KU925215.1 Bourguignon et al. (2017) Coptotermes travians 14,892 KU925222.1 Bourguignon et al. (2017) Coptotermes testaceus 15,752 KR872938.1 Li et al. (2016) Coptotermes formosanus 14,908 KU925203.1 Bourguignon et al. (2017) Coptotermes formosanus 16,324 AB626147.1 Tokuda et al. (2012) Coptotermes formosanus 16,326 AB626146.1 Tokuda et al. (2012) Coptotermes formosanus 1,326 AB626145.1 Tokuda et al. (2012) Coptotermes suzhouensis 15,764 MG000963 present study Termitidae Macrotermes barneyi 15,940 JX050221.1 Wei et al. (2012) Acanthotermes acanthothorax 15,231 KP026280.1 Bourguignon et al. (2015) Ancistrotermes pakistanicus 15,299 KP026267.1 Bourguignon et al. (2015) Macrotermes natalensis 16,325 KM405637.1 Meng et al. (2016) Macrotermes subhyalinus 16,351 JX144937.1 Cameron et al. (2012) Serritermitidae Serritermes serrifer 14,783 KP026264.1 Bourguignon et al. (2015) Glossotermes occulatus 14,791 KP026291.1 Bourguignon et al. (2015) Kalotermitidae Glyptotermes satsumensis 15,611 KP026257.1 Bourguignon et al. (2015) Cryptotermes secundus 15,695 KP026283.1 Bourguignon et al. (2015) Mastotermitidae Mastotermes darwiniensis 15,487 JX144929.1 Cameron et al. (2012) Outgroup Shelfordella lateralis 15,601 KU684413.1 Cheng et al. (2016) Periplaneta australasiae 15,605 KX640825.1 Ma et al. (2017) observed in termites’ mitogenomes (Bourguignon et  al. 2015; Results Table  3). In total, 23 genes (9 PCGs and 14 tRNAs) were located Sequencing and Organization of on the majority strand (H-strand) and the others (4 PCGs, 8 tRNAs, Mitochondrial Genome and 2 rRNAs) were located on the minority strand (L-strand; Fig. 1). The mitochondrial genome of C.  suzhouensis is a typical circular The order and the orientation of the genes were identical to those DNA molecule of 15,764 bp in length (GenBank: MG000963). The previously reported from other Coptotermes species, which retain mitochondrial DNA (mtDNA) consisted of 13 PCGs (ATP6, ATP8, the ancestral insect arrangement. COX1-3, ND1-6, ND4L, and Cytb), 2 rRNA genes (srRNA and The mitogenome of C. suzhouensis harbored a total of 139 bp of lrRNA), 22 tRNA genes, and a noncoding A+T-rich region (Fig.  1, intergenic spacers, made up of 19 individual regions ranging in size Table  4). Nucleotide composition was A/T (65.60%) biased and from 1 to 21  bp. There were 35 base pairs of overlapping regions composed as follows: A  =  6,891 (43.71%), T  =  3,450 (21.89%), total, at 10 intergenic positions, which ranged in size from 1 to 8 bp G  =  1,854 (11.76%), C  =  3,569 (22.64%), which is commonly (Table 4). Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 4 Journal of Insect Science, 2018, Vol. 18, No. 2 Fig. 1. Circular map of the mitogenome of C. suzhouensis. Genes encoded on the H-strand (clockwise orientation) are colored in the outside. Genes encoded on the L-strand (anticlockwise orientation) are colored in the inside. Table 3. Nucleotides composition of the C. suzhouensis mitochondrion in different regions Feature Proportion of nucleotides A% T% G% C% A+T% AT-skew GC-skew Siz e(bp) Whole genome 43.71 21.89 11.76 22.64 65.60 0.33 −0.32 15,764 PCGs 43.52 21.06 12.05 23.37 64.58 0.35 −0.32 11,166 tRNA genes 39.05 26.84 13.82 20.29 65.89 0.19 −0.19 1,498 srRNA genes 45.25 20.63 10.45 23.66 65.89 0.37 −0.39 727 lrRNA gene 48.56 22.05 8.56 20.83 70.61 0.38 −0.42 1,320 A+T-rich region 43.94 25.29 11.70 19.07 69.23 0.27 −0.24 949 Protein-Coding Genes Transfer RNA and Ribosomal RNA Genes The total length of the 13 PCGs was 11,166  bp, representing The mtDNA contained 22 tRNA genes, ranging in size from Ala Tyr 70.83% of the entire mitochondrial genome. PCGs used ATN as ini- 63  bp (tRNA ) to 76  bp (tRNA ) in length, and were AT tiation codon, all had ATG as start codon, except for ATP8, ND3, biased (65.89%). The secondary structures of tRNAs were pre- ND5, ND6 (ATA), and COX1 (ATT). Ten PCGs used the standard dicted by MITOS online (Bernt et  al. 2013) and tRNAscan-SE stop codon TAA, whereas COX2, ND5, and Cytb genes used a single 2.0 online (Lowe and Chan 2016). The genes that could not be T nucleotide. Codon usage of the PCGs exhibited an AT bias with detected by the softwares were determined through comparison an A+T composition of 64.58% (Table  3). It was found that the with published mitogenomes of Coptotermes (Cameron et  al. relative synonymous codon usage values of NNU/NNA codons was 2012, Tokuda et al. 2012). All tRNAs could be folded into typ- essentially greater than of NNC/NNG, indicating higher U+A bias ical cloverleaf secondary structures, with the exception of the Ser(AGN) at third condons. Our analysis showed that UUU (Phe), CUA (Leu), tRNA , which was lacking a stable stem-loop structure AUA (Met), and AUU (Ile) were the most frequently used codons, in the DHU arm, as observed in most insects (Cameron 2014b; accounting for 19.32% of all the codons (Table 5). Fig. 2) . Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 5 Table 4. Annotation and gene organization of the C. suzhouensis mitogenome Gene Coding Region Size (bp) Intergenic Overlapping Anticodon Start Stop strand nucleotide nucleotide codon codon Ile tRNA H 1–66 66 GAT (30–32) Gln tRNA L 64–133 70 3 TTG (101–103) Met tRNA H 155–223 69 21 CAT (187–189) ND2 H 224–1,261 1,038 ATG TAA Trp tRNA H 1,267–1,334 68 5 TCA (1,298–1,300) Cys tRNA L 1,327–1,395 69 8 GCA (1,363–1,365) Tyr tRNA L 1,406–1,481 76 10 GTA (1,442–1,444) COX1 H 1,483–3,030 1,548 1 ATT TAA Leu(UUR) tRNA H 3,042–3,107 66 11 TAA (3,071–3,073) COX2 H 3,116–3,800 685 8 ATG T Lys tRNA H 3,801–3,871 71 CTT (3,831–3,833) Asp tRNA H 3,871–3,935 65 1 GTC (3,902–3,904) ATP8 H 3,936–4,094 159 ATA TAA ATP6 H 4,088–4,768 681 7 ATG TAA COX3 H 4,768–5,556 789 1 ATG TAA Gly tRNA H 5,563–5,630 68 6 TCC (5,597–5,599) ND3 H 5,631–5,984 354 ATA TAA Ala tRNA H 5,994–6,056 63 9 TGC (6,023–6,025) Arg tRNA H 6,062–6,130 69 5 TCG (6,091–6,093) Asn tRNA H 6,136–6,203 68 5 GTT (6,167–6,169) Ser(AGN) tRNA H 6,201–6,272 72 3 GCT (6,228–6,230) Glu tRNA H 6,270–6,333 64 3 TTC(6,299–6,301) Phe tRNA L 6,345–6,412 68 11 GAA (6,376–6,378) ND5 L 6,413–8,138 1,726 ATA T His tRNA L 8,142–8,206 65 3 GTG (8,173–8,175) ND4 L 8,220–9,554 1,335 13 ATG TAA ND4L L 9,548–9,835 288 7 ATG TAA Thr tRNA H 9,839–9,903 65 3 TGT (9,869–9,871) Pro tRNA L 9,903–9,971 69 1 TGG (9,938–9,940) ND6 H 9,973–10,464 492 1 ATA TAA Cytb H 10,464–11,595 1,132 1 ATG T Ser(UCN) tRNA H 11,596–11,668 73 TGA (11,629–11,631) ND1 L 11,688–12,626 939 19 ATG TAA Leu(CUN) tRNA L 12,633–12,699 67 6 TAG (12,668–12,670) lrRNA(16S) L 12,700–14,019 1,320 Val tRNA L 14,021–14,087 67 1 TAC (14,056–14,058) srRNA(12S) L 14,089–14,815 727 1 A+T-rich nc 14,816–15,764 949 Repeat A1 nc 14,913–14,978 66 Repeat A2 nc 15,102–15,167 66 Repeat B1 nc 15,156–15,717 562 Repeat B2 nc 15,718–15,755 38 Table 5. Codon usage in 13 PCGs of the C. suzhouensis mitochondrial genome Codon (aa) Count % RSCU Codon (aa) Count % RSCU Codon (aa) Count % RSCU Codon (aa) Count % RSCU UUU(F) 201 5.42 1.24 UCU(S) 96 2.59 2.12 UAU(Y) 102 2.75 1.29 UGU(C) 38 1.02 1.55 UUC(F) 122 3.29 0.76 UCC(S) 19 0.51 0.42 UAC(Y) 56 1.51 0.71 UGC(C) 11 0.3 0.45 UUA(L) 103 2.78 1.16 UCA(S) 102 2.75 2.25 UAA(*) 0 0 0 UGA(W) 68 1.83 1.33 UUG(L) 146 3.93 1.64 UCG(S) 10 0.27 0.22 UAG(*) 0 0 0 UGG(W) 34 0.92 0.67 CUU(L) 61 1.64 0.68 CCU(P) 45 1.21 1.22 CAU(H) 22 0.59 0.61 CGU(R) 21 0.57 1.4 CUC(L) 17 0.46 0.19 CCC(P) 17 0.46 0.46 CAC(H) 50 1.35 1.39 CGC(R) 0 0 0 CUA(L) 189 5.09 2.12 CCA(P) 82 2.21 2.23 CAA(Q) 53 1.43 1.51 CGA(R) 35 0.94 2.33 CUG(L) 19 0.51 0.21 CCG(P) 3 0.08 0.08 CAG(Q) 17 0.46 0.49 CGG(R) 4 0.11 0.27 AUU(I) 155 4.18 1.11 ACU(T) 46 1.24 0.76 AAU(N) 65 1.75 0.87 AGU(S) 32 0.86 0.71 AUC(I) 124 3.34 0.89 ACC(T) 44 1.19 0.73 AAC(N) 85 2.29 1.13 AGC(S) 6 0.16 0.13 AUA(M) 172 4.63 1.42 ACA(T) 141 3.8 2.33 AAA(K) 60 1.62 1.52 AGA(S) 79 2.13 1.75 AUG(M) 70 1.89 0.58 ACG(T) 11 0.3 0.18 AAG(K) 19 0.51 0.48 AGG(S) 18 0.49 0.4 GUU(V) 114 3.07 1.82 GCU(A) 50 1.35 1.09 GAU(D) 36 0.97 1.04 GGU(G) 91 2.45 1.45 GUC(V) 18 0.49 0.29 GCC(A) 27 0.73 0.59 GAC(D) 33 0.89 0.96 GGC(G) 14 0.38 0.22 GUA(V) 96 2.59 1.53 GCA(A) 94 2.53 2.04 GAA(E) 63 1.7 1.47 GGA(G) 117 3.15 1.86 GUG(V) 23 0.62 0.37 GCG(A) 13 0.35 0.28 GAG(E) 23 0.62 0.53 GGG(G) 29 0.78 0.46 Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 6 Journal of Insect Science, 2018, Vol. 18, No. 2 Fig. 2. Secondary structures for 22 tRNAs of C. suzhouensis mitogenome predicted by the the MITOS and tRNAscan-SE 2.0 online. As typically observed in other insect mitogenomes, two rRNA Homology Analysis of Mitochondrial Sequences of genes (srRNA and lrRNA) were found on the L strand of the mitog- C. suzhouensis Leu(CUN) Val enome, which were located between tRNA and tRNA , To explore the phylogenetic potential of the determined sequence, Val tRNA and CR region, respectively. The rRNAs of C. suzhouensis we performed multiple alignment of the mitogenomes determined were 1,320 bp for lrRNA and 727 bp for srRNA in length, and the for C. suzhouensis and Rhinotermitidae. The nucleic acid similarity A+T content of the two genes was 70.61 and 65.89%, respectively. rate between these taxa was found to rang from 85 to 99%. Further, C.  suzhouensis shared the highest homology with C.  formosanus, Control Region with nucleic acid similarity of more than 99%, whereas the deduced The 949-bp control region of C.  suzhouensis was located between amino acids similarity of individual PCGs ranged from 99.72 to Ile srRNA and tRNA with an A+T content of 69.23%, which was 100%. The base composition of Rhinotermitidae mitogenomes higher than that of the complete mitogenome (65.60%). There were showed a high degree of similarity with A+T biased (61.77−66.33%). two different sets of repeat units in the CR zone (A+B repeats). The Differences in mitochondrial sequences between C.  suzhouensis A repeats contained two identical units A1 and A2 (66 bp). The B and C. formosanus were shown in Table 6. Comparison of complete repeats consisted of one complete unit B1 (562 bp) and a partial unit mitogenome sequences with the three populations of C. formosanus B2 (38 bp). Shiraki (AB626145.1−AB626147.1) showed five to seven site Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 7 Table 6. Differences in the nucleotides of C. suzhouensis and C. formosanus mitochondrial genomes Position Gene C. suzhouensis C. formosanus C. formosanus C. formosanus C. formosanus (MG000963) (AB626145.1) (AB626146.1) (AB626147.1) (KU925203.1) 15,764 bp 16,326 bp 16,326 bp 16,324 bp 14,908 bp 482 ND2 T(Phe) T T T C(Leu) 646 A(Met) A A A G(Met) 1,578 COX1 T(Leu) T T T C(Leu) 1,990 A(Met) A A A G(Val) 2,061 G(Leu) G G G A(Leu) 2,334 T(Phe) C(Phe) C(Phe) C(Phe) C(Phe) Leu(UUR) 3,056 tRNA C C C C T 3,063 A A A A G 3,337 COX2 A(Val) A A A G(Val) 3,397 G(Thr) A(Thr) A(Thr) A(Thr) A(Thr) 3,412 T(Ala) T T T A(Ala) Lys 3,824 tRNA A A C A A 4,223 ATP6 A(Met) A A A T(Leu) 4,348 C(Phe) C C C T(Phe) 4,465 T(His) T T T C(His) Gly 5,580 tRNA A A A — — 5,581 A A A — — 5,928 ND3 T(Leu) T T T C(Leu) 5,981 A(Lys) A A A C(Asn) Ala 6,020 tRNA A A A A G 7,598 ND5 T(Met) T T T C(Val) 7,719 C(Met) C C C T(Met) 7,866 C(Ser) C C C A(Ser) 8,523 ND4 C(Trp) C C C T(Trp) 10,722 Cytb G(Gly) G A(Ser) G G 11,687–11,688 intergenic region — — — — TTAC Ser(UCN) (tRNA — ND1) 11,978 ND1 T(Ile) C(Val) C(Val) T T 13,040 lrRNA(16S) C T T T T 13,660 C C C T T 14,514 srRNA(12S) A A A A — 14,590 A A A A T 14,664 T T T T C 14,765 C C C C T 14,963 CR T C C T — 14,816–15,764 (14,816–15,764) (14,816–16,326) (14,816–16,326) (14,816–16,326) — 949bp 1,511bp 1,511bp 1,511bp — (A1,A2,B1,B3) (A1,A2.B1,B2,B3) (A1.,A2,B1,B2,B3) (A1,A2,B1,B2,B3) — Nonsynonymous substitutions are indicated with the bold font; corresponding amino acids are shown in parentheses. Positions are relevant to MG000963. Deletions are indicated as —. differences and a long fragment deletion (B1 repeat region of 562 bp; the phylogenetic tree was largely consistent, and the classifica- 3.47% sequence divergence; Table 6). Variable sites between C. suzho- tion of the family was clear. The analyzed species (41 termites) uensis and C. formosanus were located in four PCGs (COX1, COX2, were divided into five major clades with the basic framework: Gly Cytb, and ND1), tRNA , lrRNA (16S), and Repeat A1 region; var- (Mastotermitidae + (Kalotermitidae + (Serritermitidae + iation in COX1 and COX2 was synonymous. However, two sites in (Termitidae + Rhinotermitidae)))) (Fig. 3). In the phylogenetic tree, Cytb and ND1 were nonsynomyous. The A to G (C. suzhouensis) at Coptotermes, Heterotermes, and Reticulitermes formed a mono- position 10,722 led to serine (AGA) to glycine (GGA) transformation, phyletic group, and the relationship between the three genera was whereas the C to T at 11,978 led to valine (GTT) to isoleucine (ATT) Reticulitermes + (Heterotermes + Coptotermes), which is consistent transformation, respectively. In contrast, the differences between with morphological data, and findings of previous molecular studies C.  suzhouensis and C.  formosanus (KU925203) were greater, with (Bourguignon et  al. 2015, Bourguignon et  al. 2017, Inward et  al. 31 differences, of which 13 were synonymous, and 5 were nonsyno- 2007b, Lo et al. 2004). myous. Comparative analyses suggested that the complete mtDNA of Phylogenetic analyses suggested that C.  suzhouensis and C. suzhouensis and C. formosanus are highly similar, consistant with C.  formosanus were clustered in one branch with strong support them being the same species. (BPP  =  100%, MLBP  =  100%, and MPBP  =  100%), and these two groups formed a sister group to (C.  kalshoveni + (C.  remotus Phylogenetic Relationships + C.  sepangensis)). The genetic distances between C.  suzhouen- Phylogenetic trees were built from 13 PCGs using three differ- sis and several C.  formosanus samples was 0.000 (AB626145.1− ent methods (ML, MP, and BI). The topological structure of AB626147.1), while the genetic distance between C.  suzhouensis Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 8 Journal of Insect Science, 2018, Vol. 18, No. 2 Fig.  3. Phylogenetic trees inferred with the amino acid sequences of 13 PCGs of the mitogenome of 41 termites species. S.  lateralis (KU684413.1) and P. australasiae (KX640825.1) were used as outgroups. Numbers above the branches represent Bayesian posterior probabilities and bootstrap branch support for Maximum likelihood and Maximum parsimony, respectively. Nodes, which all support rates were 100%, were marked with an asterisk. and C. formosanus was 0.002 (KU925203.1), which indicated that In Rhinotermitidae, the initiation and termination of 13 PCGs C. suzhouensis shared considerably close evolutionary relationships were essentially consistent. The majority of PCGs utilized canon- with C. formosanus. ical start codons (ATN) and stop codons (TAA, TAG, TA, or T). For C.  suzhouensis, the stop codons of 13 PCGs were TAA, except for 3 PCGs (COX2, ND5, and Cytb), which were terminated with the Discussion partial stop codon T. Incomplete stop codons are common features of insect mitogenomes (Dietrich and Brune 2014, Hervé and Brune Termites play an important role in nutrient cycling and decompos- 2017), and it has been proposed that the complete termination ition but are also often considered pest species as they may damage codons are generated by the post-transcriptional polyadenylation wooden buildings. Identifying termite species, especially those in the (Ojala et al. 1981). genus Coptotermes, is very difficult, and the taxonomic validity of The A+T rich region, known for the initiation of replication, is many named Coptotermes species remains unclear (Chouvenc et al. Ile located between srRNA and tRNA in Rhinotermitidae. And, the 2015). mtDNA has been extensively used as an informative molecu- A+T content (69.23%) of the control region (949 bp) in C. suzho- lar marker for diverse evolutionary studies of animals, including in uensis was higher than that of the entire mitogenome (65.60%), molecular evolution, phylogenetics, and population genetics (Gissi which is consistent with other Rhinotermitidae mitogenomes. The et al. 2008, Cameron 2014b, Qin et al. 2015). Thus, molecular tools control region has the highly variability in the base composition may aid in the identification of termite species and resolves the rela- and structure within Rhinotermitidae. In termites, the complicated tionships between C. suzhouensis and C. formosanus. double repeat units were first found in Reticulitermes, consisting of The present study analyzed the complete mtDNA sequence of short (type-A) repeats adjacent to the srRNA end and long (type-B) C. suzhouensis. The gene arrangement of the mitogenome was iden- Ile repeats adjacent to the tRNA end (Supp Table  2 [online only]). tical to that of Coptotermes, as well as consistent with the ancestral Cameron (2012) considered that the repeat units are involved in arrangement of the insect mitogenome, indicating that it has been the replication-mediated processes and are a synapomorphic fea- conserved during the evolution of these insects (Wei et  al. 2010). ture of Neotermitoidea, secondarily lost A-type repeats in higher Genetic analysis indicated interspecies genetic distance within Termitidae (non-macrotermitine termitids). In C.  suzhouensis, the Rhinotermitidae was 0.029−0.186. In Coptotermes, the difference repeat units consist of two full A units, one full B, and one partial among individuals within species (0.000−0.019) was lower than B unit (A-A-B-Bp). In addition, the second A and full B units over- that among species (0.029−0.116), whereas the average genetic dis- lap 12  bp. Compared to C.  formosanus (A-A-B-B-Bp), a deletion tance between C. suzhouensis and C. formosanus was 0.000−0.002, of one complete B repeat was found in the CR zone of C.  suzho- indicating that the two taxa share considerably close evolutionary uensis, and the phenomenon of repeat unit reduction was also relationships with each other (consistent with the findings of phy- observed in other termites [Reticulitermes virginicus (Isoptera: logenetic analyses; Fig. 3, Supp Table 1 [online only]). Our phyloge- Rhinotermitidae), Cameron et  al. 2007] . Comparative analysis of netic analyses support the viewpoint that C.  suzhouensis was the the control region within Rhinotermitidae revealed two conserved synonymy of C. formosanus. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 Journal of Insect Science, 2018, Vol. 18, No. 2 9 phylogenomics resolves the global spread of higher termites, ecosystem sequences ‘AATCCTAAACTTATCT’ (located at B1 repeat region: engineers of the tropics. Mol. Biol. Evol 34: 589–597. from 15,223 to 15,238) and ‘AGATAAGTTTAGGATT’ (located Brody, A. K., T. M.  Palmer, K.  Fox-Dobbs, and D. F.  Doak. 2010. Termites, at B1 repeat region: from 15,254 to 15,269) in the control regions vertebrate herbivores, and the fruiting success of Acacia drepanolobium. of C.  suzhouensis (Supp Fig. 1 [online only]) that formed the hair- Ecology 91: 399–407. pin loop structure. The hairpin loop known as RGC (rare genomic Cai, B. H., and N. S. Chen. 1964. The classification and regional of termites in change) is considered to have a high degree of sequence conservation Chinese. Acta Entomol. Sinica 13: 25–37. in all termite species and speculated to be the origin of replication Cameron, S. L., and M. F.  Whiting. 2007. Mitochondrial genomic compari- for the mitogenome (Saito et  al. 2005). Further, a poly-T stretch sons of the subterranean termites from the Genus Reticulitermes (Insecta: Isoptera: Rhinotermitidae). Genome 50: 188–202. (located at B1 repeat region: from 15,238 to 15,245) was found in Cameron, S. L., N. Lo, T. Bourguignon, G. J. Svenson, and T. A. Evans. 2012. the loop of hairpin structure, spanning 8-bp long, which also existed A mitochondrial genome phylogeny of termites (Blattodea: Termitoidae): in other Coptotermes species. No typical microsatellite-like regions robust support for interfamilial relationships and molecular synapomor- were found in the AT-rich region of C. suzhouensis, which are com- phies define major clades. Mol. Phylogenet. Evol 65: 163–173. monly found in other insect species, but absent from all reported Cameron, S. L. 2014a. How to sequence and annotate insect mitochondrial Rhinotermitidae species identified thus far (Beier et al. 2017). genomes for systematic and comparative genomics research. Syst. Entomol In termites, species descriptions have historically relied upon 39: 400–411. morphological characters of the soldiers and alates, which has con- Cameron, S. L. 2014b. Insect mitochondrial genomics: implications for evolu- tion and phylogeny. Annu. Rev. Entomol 59: 95–117. tributed to synonyms within Coptotermes (more than 40 junior Chen, Q., K. Wang, Y. L. Tan, and L. X. Xing. 2016. The complete mitochon- synonyms) (Krishna et  al. 2013). A  recent analysis using molecu- drial genome of the subterranean termite, reticulitermes chinensis Snyder lar data has provided some insight into Coptotermes phylogenetics (Isoptera: Rhinotermitidae). Mitochondrial DNA A.  DNA Mapp. Seq. and radiation (Bourguignon et al. 2017). For example, Coptotermes Anal 27: 1428–1429. havilandi (Isoptera: Rhinotermitidae) and Coptotermes gestroi Cheng, D. B. 2012. Advances of researches on classification of termites (Isoptera: Rhinotermitidae), Coptotermes elisae (Desneux) (Isoptera: (Isoptera). J. Entomol. Res. Central China 8:257–263. Rhinotermitidae), and Coptotermes curvignathus (Isoptera: Cheng, D. B. 2014. Termites. Science Press, Beijing, China. Rhinotermitidae), as well as C.  gestroi and Coptotermes vastator Cheng, X. F., L. P. Zhang, D. N. Yu, K. B. Storey, and J. Y. Zhang. 2016. The complete mitochondrial genomes of four cockroaches (Insecta: Blattodea) (Isoptera: Rhinotermitidae), were each revealed to be synonymous and phylogenetic analyses within cockroaches. Gene 586: 115–122. (Kirton and Brown 2003, Wang 2004, Kirton et al. 2005, Bengkeok Chouvenc, T., E. E.  Helmick, and N. Y.  Su. 2015. Hybridization of two et  al. 2007, Lee et  al. 2015) . In this study, we described the com- major termite invaders as a consequence of human activity. Plos One 10: plete mitogenome sequence of C. suzhouensis and compared it to the e0120745. available mitogenomes of other termites using phylogenetic analyses. Chouvenc, T., H. F. Li, J. Austin, C. Bordereau, T. Bourguignon, S. L. Cameron, Our results suggest that C. suzhouensis and C. formosanus are likely E. M. Cancello, R. Constantino, A. M. Costa‐Leonardo, and P. Eggleton to be synonyms. 2016. Revisiting Coptotermes (Isoptera: Rhinotermitidae): a global taxo- nomic road map for species validity and distribution of an economically important subterranean termite genus. Syst. Entomol 41: 299–306. Acknowledgments Dietrich, C., and A. Brune. 2014. The complete mitogenomes of six higher ter- mite species reconstructed from metagenomic datasets (Cornitermes sp., This work was support by Natural Science Foundation of Anhui Province Cubitermes ugandensis, Microcerotermes parvus, Nasutitermes corniger, (11040606M78), Key Research Program of the Education Department of Neocapritermes taracua, and Termes hospes). Mitochondrial DNA 4: 1–2. Anhui Province (KJ2012A016) and Project of Hefei Termite Control Institute Eggleton, P., G.  Beccaloni, and D.  Inward 2007. Response to Lo et  al. Biol (Y06090504). We declare no competing interest. We express gratitude for sup- Lett 3: 564–565. port by Hefei Termite Control Institute. Emerson, A. E. 1952. The biogeography of termites. Bull. Am. Mus. Nat. Hist. 99: 217–225. References Cited Engel, M. S., and K.  Krishna, 2004. Family-group names for termites (Isoptera). Am. Mus. Nov. 3432: 1–9. Akaike, H. 1974. A new look at the statistical model identification. IEEE Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the Trans. Aut. Control 19: 716–723. bootstrap. Evolution 39: 783–791. Beier, S., T. Thiel, T. Münch, U. Scholz, and M. Mascher. 2017. MISA-web: a Gissi, C., F.  Iannelli, and G.  Pesole. 2008. Evolution of the mitochondrial web server for microsatellite prediction. Bioinformatics 33: 2583–2585. genome of Metazoa as exemplified by comparison of congeneric species. Bengkeok, Y., A. S. Othman, V.S. Lee, and L. Chowyang. 2007. Genetic rela- Heredity (Edinb.) 101: 301–320. tionship between Coptotermes gestroi and Coptotermes vastator (Isoptera: Hausberger, B., D. Kimpel, A. van Neer, and J. Korb. 2011. Uncovering cryptic Rhinotermitidae). J. Econ. Entomol 100: 467–474. species diversity of a termite community in a West African savanna. Mol. Bernt, M., A.  Donath, F.  Jühling, F.  Externbrink, C.  Florentz, G.  Fritzsch, Phylogenet. Evol 61: 964–969. J.  Pütz, M.  Middendorf, and P. F.  Stadler. 2013. MITOS: improved de Hervé, V., and A.  Brune 2017. The complete mitochondrial genomes of novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol the higher termites Labiotermes labralis and Embiratermes neotenicus 69: 313–319. (Termitidae: Syntermitinae). Mitochondrial DNA 2: 109–110. Bourguignon, T., N. Lo, S. L. Cameron, J. Šobotník, Y. Hayashi, S. Shigenobu, Huang, F. S., S. M. Zhu, Z. M. Ping, X. S. He, G. X. Li, and D. R. Gao 2000. D. Watanabe, Y. Roisin, T. Miura, and T. A. Evans. 2015. The evolutionary Fauna Sinica Isecta. Vol. 17, Isoptera. Science Press, Beijing, China. history of termites as inferred from 66 mitochondrial genomes. Mol. Biol. Huelsenbeck, J. P., and F. Ronquist. 2001. MRBAYES: Bayesian inference of Evol 32: 406–421. phylogenetic trees. Bioinformatics 17: 754–755. Bourguignon, T., N.  Lo, J.  Šobotník, D.  Sillam-Dussès, Y.  Roisin, and T. Inward, D., G. Beccaloni, and P. Eggleton. 2007a. Death of an order: a compre- A.  Evans. 2016. Oceanic dispersal, vicariance and human introduction hensive molecular phylogenetic study confirms that termites are eusocial shaped the modern distribution of the termites reticulitermes, heterotermes cockroaches. Biol. Lett 3: 331–335. and coptotermes. Proc. Biol Sci 283: 20160179. Inward, D. J., A. P. Vogler, and P. Eggleton. 2007b. A comprehensive phyloge- Bourguignon, T., N. Lo, J. Šobotník, S. Y. Ho, N. Iqbal, E. Coissac, M. Lee, netic analysis of termites (Isoptera) illuminates key aspects of their evolu- M. M. Jendryka, D. Sillam-Dussès, B. Krížková, et al. 2017. Mitochondrial tionary biology. Mol. Phylogenet. Evol 44: 953–967. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018 10 Journal of Insect Science, 2018, Vol. 18, No. 2 Kambhampati, S., and P. Eggleton 2000. Taxonomy and phylogeny of termites, pp. Qin, J., Y.  Zhang, X.  Zhou, X.  Kong, S.  Wei, R. D.  Ward and A. B.  Zhang 1–23. In T. Abe, D.E. Bignell, M. Higashi (eds) Termites: evolution, sociality, 2015. Mitochondrial phylogenomics and genetic relationships of closely symbiose, ecology. Kluwer Academic Publishers, Dordrecht, the Netherlands. related pine moth (Lasiocampidae: Dendrolimus) species in China, using Kim, I., S. Y. Cha, M. H. Yoon, J. S. Hwang, S. M. Lee, H. D. Sohn, and B. whole mitochondrial genomes. BMC Genomics 16: 1–12. R. Jin. 2005. The complete nucleotide sequence and gene organization of Rocha, M. M., C. Cuezzo, and E. M. Cancello 2017. Phylogenetic reconstruc- the mitochondrial genome of the oriental mole cricket, Gryllotalpa orien- tion of Syntermitinae (Isoptera, Termitidae) based on morphological and talis (Orthoptera: Gryllotalpidae). Gene 353: 155–168. molecular data. Plos One 12: e0174366. Kirton, L. G., and V. K. Brown. 2003. The taxonomic status of pest species of Rust, M. K., and N. Y. Su. 2012. Managing social insects of urban importance. Coptotermes in Southeast Asia: resolving the paradox in the pest status of Annu. Rev. Entomol 57: 355–375. the termites, Coptotermes gestroi, C. havilandi and C. travians (Isoptera: Saito, S., K. Tamura, and T. Aotsuka. 2005. Replication origin of mitochon- Rhinotermitidae). Sociobiology 42: 43–63. drial DNA in insects. Genetics 171: 1695–1705. Kirton, L. G., Lee, C. Y., and W. H. Robinson. 2005. The importance of accur- Stamatakis, A., P. Hoover, and J. Rougemont. 2008. A rapid bootstrap algo- ate termite taxonomy in the broader perspective of termite management, rithm for the RAxML Web servers. Syst. Biol. 57: 758–771. pp. 1–7. P&Y Design Network. Penang, Malaysia. Swofford, D. L. 2002. PAUP*. phylogenetic analysis using parsimony Korb, J., M. Poulsen, H. Hu, C. Li, J. J. Boomsma, G. Zhang, and J. Liebig. (*and other methods). version 4.0b10. Mccarthy, doi: 10.1111/j.0014- 2015. A genomic comparison of two termites with different social com- 3820.2002.tb00191.x. plexity. Front. Genet. 6: 9. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar 2014. Krishna, K., D. A. Grimaldi, V. Krishna, and M. S. Engel. 2013. Treatise on the MEGA5: molecular evolutionary genetics analysis using maximum like- isoptera of the world. Bull. Am. Mus. Nat. Hist. 377: 1–2704. lihood, evolutionary distance, and maximum parsimony methods. Mol. Lee, T. R., S. L. Cameron, T. A. Evans, S. Y. Ho, and N. Lo. 2015. The origins Biol. Evol. 28: 2731–2739. and radiation of Australian Coptotermes termites: from rainforest to des- Tokuda, G., H.  Isagawa, and K.  Sugio 2012. The complete mitogenome of ert dwellers. Mol. Phylogenet. Evol. 82 (Pt A): 234–244. the Formosan termite, Coptotermes formosanus Shiraki. Insectes. Soc. 59: Lee, W., T. Han, J. H. Lee, K. J. Hong, and J. Park 2017. The complete mito- 17–24. chondrial genome of the subterranean termite, Reticulitermes speratus Wang, J. G. 2004. Phylognetic study of termites based on the morphologi- kyushuensis Morimoto, 1968 (Isoptera: Rhinotermitidae). Mitochondrial cal and molecular approache. Shouthen China Agricultral University, DNA Part B 2:178–179. Guangzhou. pp. 1–142. Legendre, F., M. F. Whiting, C. Bordereau, E. M. Cancello, T. A. Evans, and Wang, Y. L., Y. H.  Chen, C. C.  Xia, X. Q.  Xia, R. S.  Tao, and J. S.  Hao. P.  Grandcolas. 2008. The phylogeny of termites (Dictyoptera: Isoptera) 2015. The complete mitochondrial genome of the Common Red Apollo, based on mitochondrial and nuclear markers: implications for the evolu- Parnassius epaphus (Lepidoptera: Papilionidae: Parnassiinae). J. Asia-Pac. tion of the worker and pseudergate castes, and foraging behaviors. Mol. Entomol. 18: 239–248. Phylogenet. Evol. 48: 615–627. Wang, P., J. Zhu, M. Wang, Y. Zhang, J. Wang, Y. Zhu, and P. Zhang. 2016. The Li, G. X. 2002. Chinese termites and control. Science Press, Beijing, China. complete mitochondrial genome of and implications for Rhinotermitidae Li, Y. X., X. G. Wang, J. Ou, F. J. Yao, Y. Yang, and Z. M. Wei. 2016. The complete taxonomy. Mitochondrial DNA Part B Res. 1: 392–393. mitochondrial genome of Coptotermes testaceus (Isoptera: Rhinotermitidae). Watson, J., and F.  Gay. 1991. Isoptera (Termites), pp. 330–347. In: CSIRO Mitochondrial DNA A. DNA Mapp. Seq. Anal. 27: 3466–3468. (ed.), Insects of Australia, Vol. 1. Cornell University Press, Ithaca, NY. Lo, N., O.  Kitade, T.  Miura, R.  Constantino, and T.  Matsumoto. 2004. Wei, S. J., M. Shi, X. X. Chen, M. J. Sharkey, C. van Achterberg, G. Y. Ye, and Molecular phylogeny of the Rhinotermitidae. Insectes. Soc. 51: J. H. He. 2010. New views on strand asymmetry in insect mitochondrial 365–371. genomes. PLoS One 5: e12708. Lowe, T. M., and P. P. Chan. 2016. tRNAscan-SE on-line: integrating search Wei, S. J., J. F.  Ni, M. L.  Yu, and B. C.  Shi. 2012. The complete mitochon- and context for analysis of transfer RNA genes. Nucleic Acids Res 44: drial genome of Macrotermes barneyi Light (Isoptera: Termitidae). W54–W57. Mitochondrial DNA 23: 426–428. Ma, J., C.  Du, C.  Zhou, Y.  Sheng, Z.  Fan, B.  Yue, and X.  Zhang. 2017. Wolstenholme, D. R. 1992. Animal mitochondrial DNA: structure and evolu- Complete mitochondrial genomes of two blattid cockroaches, Periplaneta tion. Int. Rev. Cytol. 141: 173–216. australasiae and Neostylopyga rhombifolia, and phylogenetic relation- Wyman, S. K., R. K. Jansen, and J. L. Boore. 2004. Automatic annotation of ships within the Blattaria. PLoS One 12: e0177162. organellar genomes with DOGMA. Bioinformatics 20: 3252–3255. Meng, Z., S. Jiang, X. Chen, and C. Lei. 2016. The complete mitochondrial Xia, K. L., and X. S. He. 1986. The research on Coptotermes in Chinese Bulletin genome of fungus-growing termite, Macrotermes natalensis (Isoptera: of Entomological Research. Shanghai Scientific & Technical Publishers, Macrotermitinae). Mitochondrial DNA A.  DNA Mapp. Seq. Anal. 27: Shanghai. pp. 157–182. 1728–1729. Xiao, B., A. H. Chen, Y. Y. Zhang, G. F. Jiang, C. C. Hu, and C. D. Zhu. 2012. Ojala, D., J.  Montoya, and G.  Attardi. 1981. tRNA punctuation model of Complete mitochondrial genomes of two cockroaches, Blattella german- RNA processing in human mitochondria. Nature 290: 470–474. ica and Periplaneta americana, and the phylogenetic position of termites. Perna, N. T., and T. D. Kocher. 1995. Patterns of nucleotide composition at fourfold Curr. Genet. 58: 65–77. degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 41: 353–358. Xu, L. P., X. S. Liang, Q. J. Zhou, and J. S. Xue 2009. Application of classifi- Posada, D., and K. A.  Crandall. 1998. MODELTEST: testing the model of cation of termites by means of molecular biological techniques. J. Inspect. DNA substitution. Bioinformatics 14: 817–818. Quarantine 19: 70–74. Downloaded from https://academic.oup.com/jinsectscience/article-abstract/18/2/26/4926003 by Ed 'DeepDyve' Gillespie user on 16 March 2018

Journal

Journal of Insect ScienceOxford University Press

Published: Mar 1, 2018

There are no references for this article.

You’re reading a free preview. Subscribe to read the entire article.


DeepDyve is your
personal research library

It’s your single place to instantly
discover and read the research
that matters to you.

Enjoy affordable access to
over 18 million articles from more than
15,000 peer-reviewed journals.

All for just $49/month

Explore the DeepDyve Library

Search

Query the DeepDyve database, plus search all of PubMed and Google Scholar seamlessly

Organize

Save any article or search result from DeepDyve, PubMed, and Google Scholar... all in one place.

Access

Get unlimited, online access to over 18 million full-text articles from more than 15,000 scientific journals.

Your journals are on DeepDyve

Read from thousands of the leading scholarly journals from SpringerNature, Elsevier, Wiley-Blackwell, Oxford University Press and more.

All the latest content is available, no embargo periods.

See the journals in your area

DeepDyve

Freelancer

DeepDyve

Pro

Price

FREE

$49/month
$360/year

Save searches from
Google Scholar,
PubMed

Create lists to
organize your research

Export lists, citations

Read DeepDyve articles

Abstract access only

Unlimited access to over
18 million full-text articles

Print

20 pages / month

PDF Discount

20% off