Systematics, phylogeny and biogeography of the Australasian leaf-curling orb-weaving spiders (Araneae: Araneidae: Zygiellinae), with a comparative analysis of retreat evolution

Systematics, phylogeny and biogeography of the Australasian leaf-curling orb-weaving spiders... INTRODUCTION Australasia, including Australia, Zealandia (New Zealand and New Caledonia) and New Guinea, has long been considered an important area of arachnid diversity, with approximately 3700 species of spiders described from Australia alone (ABRS, 2014). As a relatively isolated island since its separation from Antarctica with the breakup of Gondwana, the unique biota of Australia is hypothesized to have come about from endemics surviving in relictual habitats as the climate of the continent changed and became more arid, and later from immigrants after rifting (Crisp, Cook & Steane, 2004). Multiple examples of distinct spider lineages exclusive to Australia have been examined in recent years alone (Baehr, Harvey & Smith, 2010; Framenau et al., 2010a; Framenau, Scharff & Harvey, 2010b; Baehr et al., 2012; Joseph & Framenau, 2012; Rix & Harvey, 2012; Wood et al., 2013; Harvey et al. 2015; Raven, 2015; Harvey et al., 2017; Rix et al. 2017). The orb-weaving spider family Araneidae Clerck, 1757 is the third most speciose in the order, including more than 3100 species in 174 genera (World Spider Catalog, 2018). This group is extremely diverse morphologically and behaviourally, but making sense of this diversity in a family-wide context remains elusive. A modern systematic analysis testing the monophyly of araneids, as well as the relationships within, remains to be undertaken, and many genus-level relationships are weakly supported and unstable. The most recent analyses, including many araneids, show that the state of our understanding of both inter- and intrafamilial relationships is still in flux (Gregorič et al., 2015; Dimitrov et al., 2017). Major, family-level changes from Dimitrov et al. (2017) include the elevation of Arkys and its kin to the family rank, where they are sister-group to tetragnathids (see also Benavides, Giribet & Hormiga, 2017), and Nephilidae Simon, 1894, ranked as a family by Kuntner (2006) and the monophyly of which was corroborated subsequently (Kuntner et al., 2013), became ranked as a subfamily within Araneidae. Dimitrov et al. (2017) placed the subfamily Nephilinae as the sister-group to Zygiellinae (the clade including ZygiellaF. O. Pickard-Cambridge, 1902, Leviellus Wunderlich, 2004, Phonognatha Simon, 1894 and Deliochus Simon, 1894), which are all sister-group to the remaining araneids. The subfamily Zygiellinae is an early diverging araneid lineage, but its specific affinities are far from being satisfactorily resolved. Depending on the analysis, zygiellines group with nephilines as the earliest diverging (Dimitrov et al., 2017), or the next earliest diverging, after the nephilines (Gregorič et al., 2015; Wheeler et al., 2016). The subfamily is composed of four genera: Phonognatha, Deliochus, Zygiella and Leviellus. This has beens recently reduced by a third by Gregorič et al. (2015), who synonymized Parazygiella Wunderlich, 2004 with Zygiella, and Stroemiellus Wunderlich, 2004 with Leviellus. The emergence of the term Zygiellinae is relatively new, as Zygiella [and its relatives as described by Wunderlich (2004)] was classically understood as deep within araneids (Scharff & Coddington, 1997), whereas Phonognatha and Deliochus were believed to be closely related to Nephila from their initial description until about a century later (Simon, 1894; Hormiga, Eberhard & Coddington, 1995). Zygiellinae, now broadly accepted as basally diverging in the araneid tree, includes taxa that have been the subject of work ranging from studies on web architecture and silk use (Hormiga et al., 1995; Venner, Pasquet & Leborgne, 2000; Gheysens et al., 2005; Townley et al., 2012; Gregorič et al., 2015; Mortimer et al., 2015) to behaviour (Leborgne & Pasquet, 1987; Spiller, 1992; Kralj-Fišer et al., 2013) to development (Chaw, Vance & Black, 2007). Taxonomy & systematics The genera Phonognatha Simon, 1894 and Deliochus Simon, 1894 have a long history of unstable family-level placement. Both genera were authored over 120 years ago from a hugely diverse region with many species unidentified and undescribed. These genera, along with Singotypa Simon, 1894, were initially placed in Phonognatheae Simon, 1894, within the nephiline subfamily of Argiopidae, in Simon’s Histoire Naturelle des Araignées (1894). Simon described phonognathine females as ‘ambiguous’ in their morphology, with the males having robust chelicerae and pedipalps similar in appearance to tetragnathids (Fig. 1). Morphological and behavioural similarity to tetragnathids, as well as Nephila and close relatives, would influence the morphological placement of Phonognatha and Deliochus for a century. Phonognatha and Deliochus were described from Tasmania and Australia, and totalled four species between them: P. graeffei (Keyserling, 1865), S. melania (Koch, 1871) S. melanopyga (Koch, 1871), and D. zelivira (Keyserling, 1887). However, P. graeffei was described prior to the erection of Phonognatha, and was placed in Epeira originally, while P. melania, P. melanopyga and D. zelivira were placed in the tetragnathid genus Meta. Later, Singotypa was synonymized with Phonognatha based on the lack of conclusive morphological differences in the genera, where they were classified as araneids (Dondale, 1966), resulting in two Australasian zygielline genera: Phonognatha and Deliochus. Meanwhile, the cosmopolitan and common genus Zygiella also is unrevised and growing (Tanikawa, 2017). Figure 1. View largeDownload slide Australasian Zygiellinae. A, Phonognatha graeffei from Yuraygir National Park, New South Wales. Photo by RJK. B, Phonognatha tanyodonsp. nov. from Budderoo National Park, New South Wales. Photo by GH. C, Phonognatha graeffei from Lamington National Park, Queensland. Photo by GH. D, Artifex melanopygacomb. nov. from nr. Mareeba, Queensland. Photo by I. Macaulay. E, Deliochus zelivira from Royal Botanic Gardens, Cranbourne, Melbourne, Victoria. Photo by R. Whyte. F, Deliochus idoneus from Gindie, Queesland. Photo by L. Sanders. Figure 1. View largeDownload slide Australasian Zygiellinae. A, Phonognatha graeffei from Yuraygir National Park, New South Wales. Photo by RJK. B, Phonognatha tanyodonsp. nov. from Budderoo National Park, New South Wales. Photo by GH. C, Phonognatha graeffei from Lamington National Park, Queensland. Photo by GH. D, Artifex melanopygacomb. nov. from nr. Mareeba, Queensland. Photo by I. Macaulay. E, Deliochus zelivira from Royal Botanic Gardens, Cranbourne, Melbourne, Victoria. Photo by R. Whyte. F, Deliochus idoneus from Gindie, Queesland. Photo by L. Sanders. Over the course of the next century, Phonognatha and Deliochus remained unrevised, but taxonomic and systematic work otherwise continued. These taxa would be treated as nephilines, but Nephilinae would be placed in Araneidae (Roewer, 1942), then Argiopidae (Bonnet, 1956), then back to Araneidae (Brignoli, 1983; Wunderlich, 1986), followed by placement in Tetragnathidae (Levi & von Eickstedt, 1989). In the first cladistic analysis of this problem, Hormiga et al. (1995) provided morphological and behavioural evidence for both the monophyly of Tetragnathidae and the placement of nephilines (including, by extension, Phonognatha and Deliochus) therein. Nephilines would be elevated to family rank by Kuntner (2006), who placed Phonognatha and Deliochus as early diverging nephilines; later analyses placed those genera as sister-group to all non-nephiline araneids (Kuntner et al., 2008). It is notable that both nephilines and Phonognatha leave a temporary, non-sticky spiral in the final web, and this was inferred to be a significant nephiline synapomorphy (Hormiga et al., 1995) until Phonognatha was confidently placed as a more distant relative of Nephila (Kuntner et al., 2008; Álvarez-Padilla et al., 2009). Meanwhile, Zygiella was transferred to Araneidae from Tetragnathidae following its nested placement in the morphological analysis of Scharff & Coddington (1997). Molecular and total evidence analyses by Álvarez-Padilla et al. (2009) showed Phonognatha and Deliochus were early diverging araneids, and that Nephilidae and Araneidae are sister lineages. It also showed a surprising placement of Zygiella, which has a somewhat typical araneid morphology, yet is closely related to Phonognatha and Deliochus based on molecular evidence; for instance, Zygiella retains a median apophysis, which is subsequently lost in Phonognatha and Deliochus. Parsimony analyses of morphological characters supported a topology more akin to that of Scharff & Coddington (1997), with Zygiella nested within Araneidae and both Phonognatha and Deliochus as early diverging nephilines. The following analysis by Kuntner et al. (2013) was equivocal with respect to the Phonognatha and Deliochus, with various analyses placing the genera as sister-group to the rest of Araneidae (which itself was paraphyletic), weakly supported as sister-group to nephilids. These authors also use the term ‘Zygiellidae’, put forth by Wunderlich (2004), as a potential family-level designation that includes Phonognatha, Deliochus, Zygiella, Parazygiella, Leviellus and Stroemiellus, as these taxa continued to be problematic in some analyses with respect to Araneidae and Nephilidae. While the family Zygiellidae as proposed by Wunderlich (2004) does not stand up to systematic scrutiny [e.g. close relationships between Zygiella and Chrysometa Simon, 1984 are proposed, which defies established family boundaries based on various data; see comments in Hormiga & Griswold (2014)], the subfamily label remains. More recently, Gregorič et al. (2015), using DNA sequence data, show Phonognatha and Deliochus are early diverging araneids, but the former genus is not monophyletic, suggesting that work needs to be done in explaining the generic boundaries within Zygiellinae. Dimitrov et al. (2017) synonymized Nephilidae with Araneidae, but placed Phonognatha and Deliochus as more closely related to nephilines than other araneids, thus bringing their placement nearly full circle, i.e. similar to the taxonomy of Simon (1895). Seven more species and subspecies would be attributed to Phonognatha. The first of these was P. wagneri (Rainbow, 1896), which was subsequently synonymized with P. graeffei by Dondale (1966). Simon (1907) described P. acanthopus from Africa, but this taxon would be transferred to SingafrotypaBenoit, 1962 by Kuntner & Hormiga (2002). Another Western Australian species, P. pallida Dalmas, 1917, was described a decade later. Two taxa would later be described from New Caledonia: P. joannae Berland, 1942 and P. graeffei neocaledonica Berland, 1924. The remaining two Phonognatha were also described from non-Australian localities: P. vicitraSherriffs, 1928 is the only Phonognatha described from India, and P. guangaBarrion and Litsinger, 1995 was described from the Philippines. Deliochus had two additional taxa attributed to it – D. pulchraRainbow, 1916 and D. pulchra melania Rainbow, 1916 – described from Queensland, Australia. The former has been synonymized with Acusilas coccineus Simon, 1895 (Sankaran & Sebastian, submitted). Behaviour Phonognatha is more readily identified based on its web architecture than its morphology (Figs 1C, 2A, 3A), and has been documented and described for decades (Hormiga et al., 1995; Thirunavukarasu, Nicolson & Elgar, 1996); Kuntner et al., 2008). Its web is orbicular, vertical and typically incomplete above the hub. The temporary, non-sticky spiral remains in the finished web (Fig. 2A, arrow). Hormiga et al. (1995) exhaustively outlined the web construction process of Phonognatha, and concluded this was valuable behavioral character placing Phonognatha within the nephilines. However, subsequent molecular analyses (e.g. Álvarez-Padilla et al., 2009; Gregorič et al., 2015) clearly indicate this behavioural character is homoplasious. Even more diagnostic of Phonognatha webs is the presence of a curled leaf retreat situated vertically at the hub of the web. Use of leaves or other foreign substrate within the orb is exhibited in some araneids, while others may have a web adjacent retreat made from silk or leaves. In Australasian habitats, Araneus dimidiatus (Koch, 1871) (Fig. 3F) and apparently all species of Acusilas Simon, 1895 (Fig. 3D) (Schmidt & Scharff, 2008), also curl leaves in their web, and the behaviour appears in many theridiid species, among others (Eberhard, Agnarsson & Levi, 2008). The web of Araneus dimidiatus can be distinguished from that of Phonognatha as its orb is complete, and the centrally placed leaf curl is not at the hub, but rather that the top of the orb. Others, such as Spilasma Simon, 1897, MicrepeiraSchenkel, 1953 and Nemoscolus Simon, 1895 use granular detritus in retreats placed at the hub. Figure 2. View largeDownload slide Web morphology of Phonognatha and Deliochus. Webs were dusted in cornstarch prior to photography. A, orb web of P. melania in Walpole-Nornalup National Park, Western Australia. Web is typical of Phonognatha, featuring a single coiled leaf retreat integrated in the web, with the broad opening at the hub. The web is complete below the hub, with variable completion above the leaf. Apparent empty areas of the spiral are occupied by the temporary, non-sticky spiral remaining in the finished web (arrow). B, orb web of D. humilis in Barrington Tops National Park, New South Wales. This complete orb-web has a downward displaced hub and adjacent retreat made of silk-bonded leaves. Photos by GH. Figure 2. View largeDownload slide Web morphology of Phonognatha and Deliochus. Webs were dusted in cornstarch prior to photography. A, orb web of P. melania in Walpole-Nornalup National Park, Western Australia. Web is typical of Phonognatha, featuring a single coiled leaf retreat integrated in the web, with the broad opening at the hub. The web is complete below the hub, with variable completion above the leaf. Apparent empty areas of the spiral are occupied by the temporary, non-sticky spiral remaining in the finished web (arrow). B, orb web of D. humilis in Barrington Tops National Park, New South Wales. This complete orb-web has a downward displaced hub and adjacent retreat made of silk-bonded leaves. Photos by GH. Figure 3. View largeDownload slide Leaf retreats and their architects. A, Phonognatha graeffei and web from Lamington National Park, Queensland, Australia; note curled leaf at hub of incomplete orb. Photo by GH. B, Acusilas sp. web from Khao Sok National Park, Thailand; web is similar to Phonognatha, though typically with more of upper web completed. Photo by GH. C, Metepeira labyrinthea web, Chickasaw State Park, Tennessee, USA; web with detritus (sometimes including a leaf) is placed in barrier web adjacent to orb. Photo by J. Ballesteros. D, Spilasma duodecimgutta web, Reserva Florestal Alberto Ducke, Amazonas, Brazil; this unique web is horizontal with a central retreat reinforced with detritus. Photo by GH. E, Araneus marmoreus, New Germany State Park, Maryland, USA; this species makes a rudimentary retreat adjacent to the web by bonding together whatever material is available. Photo by J. Ballesteros. F, Araneus dimidiatus, Yuraygir National Park, New South Wales, Australia; this spider’s leaf curl is at the top of the orb rather than the hub, but its Phonognatha-like colour scheme leads it to be sometimes misidentified. Photo by RJK. Figure 3. View largeDownload slide Leaf retreats and their architects. A, Phonognatha graeffei and web from Lamington National Park, Queensland, Australia; note curled leaf at hub of incomplete orb. Photo by GH. B, Acusilas sp. web from Khao Sok National Park, Thailand; web is similar to Phonognatha, though typically with more of upper web completed. Photo by GH. C, Metepeira labyrinthea web, Chickasaw State Park, Tennessee, USA; web with detritus (sometimes including a leaf) is placed in barrier web adjacent to orb. Photo by J. Ballesteros. D, Spilasma duodecimgutta web, Reserva Florestal Alberto Ducke, Amazonas, Brazil; this unique web is horizontal with a central retreat reinforced with detritus. Photo by GH. E, Araneus marmoreus, New Germany State Park, Maryland, USA; this species makes a rudimentary retreat adjacent to the web by bonding together whatever material is available. Photo by J. Ballesteros. F, Araneus dimidiatus, Yuraygir National Park, New South Wales, Australia; this spider’s leaf curl is at the top of the orb rather than the hub, but its Phonognatha-like colour scheme leads it to be sometimes misidentified. Photo by RJK. After their web is constructed, Phonognatha select a leaf, roll it longitudinally, seal it with silk and place it so the lower opening of the leaf curl is near the orb-web hub. The front legs are often visible, emerging from the lower opening of the rolled leaf on to the web, much in the same way other araneids rest (Fig. 1C). The leaf selection process was examined by Thirunavukarasu et al. (1996), and they determined larger spiders selecting larger leaves and prefering green leaves to brown, probably due to their malleability. The female remains in the leaf curl during the day rather than retreat off the web. A female will curl the leaf laterally when using it for an egg sac. Phonognatha graeffei males have been observed to often cohabit in the leaf curl and defend the web against rival males, remaining in the web while the female reaches adulthood in order to mate with her (Fahey & Elgar, 1997). The male may then be consumed by the female. Deliochus weaves a complete orb-web more akin to a typical araneid (Fig. 2B). Unlike Phonognatha, it removes the temporary spiral in the finished web (Kuntner et al., 2008). It uses green leaves bonded with silk to make an off-web retreat rather than loose leaves, but males and females have been observed cohabiting as in Phonognatha. Without a phylogeny of Phonognatha and close relatives, the dynamic evolution of the leaf retreat cannot be understood in a comparative context. Colour change A number of spiders display body colour change, mainly in two ways: pigments and structure (Oxford, 1997; Oxford & Gillespie, 1998; Umbers et al., 2014). That is, either explicitly coloured chemical molecules provide colour (pigments) or reflection, refraction or other interference of a surface influences perceived colours (structure). Among the spiders recorded to demonstrate reversible colour change is Phonognatha graeffei, first documented by Roberts (1936),who characterized a disappearance of its ‘creamy mottling’ pattern when disturbed from its web. That creamy mottling is a result of guanine crystals stored in guanocytes, which are specialized mid-gut cells located between the cuticle and gut diverticula. These guanocytes store the common spider metabolic product guanine, and as such are found in numerous species. Guanocyte-dependent colour change is sometimes considered a structural colour change that behaves as a pigment, as the whitish colour is reflected from a structure that can be quickly modified (Oxford & Gillespie, 1998). At rest, the guanocytes of Phonognatha are more apparent, leading to a whitish appearance of the abdomen and when disturbed, either the abdomen expands or the guanocytes retract, leading to a darker appearance (Fig. 4). This process takes place in seconds. Possible explanations for this phenomenon include thermoregulation (Robinson & Robinson, 1978), where the lighter pattern reflects solar radiation, though Phonognatha spends much of its time in its leaf curl rather than remain exposed. Crypsis is another explanation, as the more drab colour is more difficult to spot on the ground, though the retreat itself should also serve to protect it from visual hunters. Wunderlin & Kropf (2013) describe muscles surrounding the guanocytes that may cover and expose the shiny structures. It may also be a result of the physiology of the spider going from a passive to an active state, but study on this topic is concentrated on mygalomorphs (Kropf, 2013). This subject requires more research, and the ease of collection of Phonognatha may make it a valuable model for reversible colour change based on guanocytes, given the abudance of P. graeffei in particular in the habitats in which it occurs. Figure 4. View largeDownload slide Colour change in Phonognatha graeffei from Barrington Tops National Park, New South Wales. A, spider at rest, with guanocytes appearing as clear, discrete white patches on abdomen. B, spider is disturbed, with guanocytes appearing small, indiscrete, and drowned in dull surrounding colour. Photos by RJK. Figure 4. View largeDownload slide Colour change in Phonognatha graeffei from Barrington Tops National Park, New South Wales. A, spider at rest, with guanocytes appearing as clear, discrete white patches on abdomen. B, spider is disturbed, with guanocytes appearing small, indiscrete, and drowned in dull surrounding colour. Photos by RJK. Biogeography Previous estimates of the age of Zygiellinae place it at approximately 100 million years old (Dimitrov et al., 2017). Zygiella and Leviellus occur largely in the Nearctic and Palearctic regions, with subsequent introduction to the southern hemisphere, whereas other zygiellines occur in Australia, New Caledonia and Papua New Guinea. Other less well-known putative zygiellines may occupy South-East Asia (e.g. Z. calyptrata), but are poorly understood (D. Court, pers. comm.). The multiple islands dotting the Torres Strait allow a feasible path between Cape York in Queensland and Papua New Guinea. Eastern Australia is where most of these taxa co-occur, spanning the southern, temperate sclerophyll forests in the south to the tropical forests in the north; this climatic difference seems to be biologically important for some species and not others. Specifically, the St. Lawrence Gap, which occurs south of Mackay and north of Gladstone in central coastal Queensland, presents a boundary separating these two zones that has been tested in prior spider studies (Rix & Harvey, 2012). Another such non-oceanic boundary is the Nullarbor Plain, an expansive desert more than 1000 km wide along Australia’s southern coast. Named for its absence of trees, this habitat seems largely inimical to most spider life and has been deemed important for separating populations in more temperate, forested regions of Western Australia from New South Wales and Victoria. Perhaps the most imposing, potentially isolating boundary for Australasian zygiellines is the Coral Sea, which separates New Caledonia from mainland Australia by approximately 1300 km. Biogeographic study with respect to New Caledonia has been informed by the hypothesis that the island has only been habitable for approximately 37 million years, prior to which it was submerged along with much of Zealandia (Grandcolas et al., 2008). That is, there seems to be an earliest possible point for endemics to have colonized New Caledonia. However, studies on other arachnids raised the possibility of small islands remaining above sea level prior to that period (Sharma & Giribet, 2009), although this is disputed as a misunderstanding of the islands’ geology (Grandcolas, 2017). There are two Phonognatha species endemic to New Caledonia: Artifex joannaecomb. nov. (new combination from P. joannae) and P. neocaledonicacomb. nov. (formerly a synonym of P. graeffei; see Results and Taxonomy sections). Similarities between A. joannae and A. melanopyga, in particular, suggest a founding event of the latter developed into the former, while the morphology of P. neocaledonica does not suggest an obvious sister-taxon prior to analysis. A time-calibrated phylogeny with species inhabiting Australia and New Caledonia could indicate the time of colonization of New Caledonia and whether other biogeographic boundaries (namely the St. Lawrence Gap and Nullarbor Plain) pose an appropriately timed biogeographic boundary. In the case of New Caledonia, biogeographic analysis would corroborate one of two hypotheses. The first is colonization of New Caledonia in the last 37 million years, when most of the island would have been above water, according to Grandcolas et al. (2008). The second is colonization prior to the supposed submergence 37 million years ago, supporting the lineages’ survival as relicts on areas that were not submerged, as in the troglosironid opiliones (Sharma & Giribet, 2009). Lord Howe Island, located approximately 585 km from Port Macquarie, New South Wales, is populated by P. graeffei. While only half the distance as from Australia to New Caledonia, this speaks to the dispersion or colonization ability of these taxa across sizeable inhospitable zones. Goals In this study we aim to test the monophyly of Araneidae and the Australasian zygiellines, taxonomically revise the genera Phonognatha and Deliochus, as well as a new genus Artifexgen. nov., and place them in a phylogenetic framework. With this framework in place, we will examine two questions relating to the biology of these spiders: how many times various leaf retreats evolved in Zygiellinae and close relatives, and how Australasian zygiellines colonized the often disparate habitable areas in Australia and New Caledonia. MATERIAL AND METHODS Measurements, imaging and illustrations Specimens were examined using a Leica MZ16A stereomicroscope. Photographs were captured using a Leica DFC 500 camera and the LAS 3.8 imaging suite. Multifocal plane images were then assembled using Helicon Focus 5.1. Illustrations were completed using an Olympus BX51 microscope with camera lucida. Epigyna were transferred to methyl salicylate (Holm, 1979) for examination under the microscope. For scanning electron microscopy (SEM), images were taken using the LEO 1430VP at the Department of Biology of The George Washington University. To prepare the specimens for SEM, we critical pointed dried specimens then sputter-coated them in a gold-palladium alloy and mounted as described in Álvarez-Padilla & Hormiga (2008). Male palp sclerite homologies and nomenclature follow Álvarez-Padilla & Hormiga (2011) and Hormiga et al. (1995). All measurements are presented in millimeters. Taxon sampling Specimens were added to the data matrices of Kuntner et al. (2008) and Álvarez-Padilla et al. (2009). A total of 95 terminals among 89 taxa were examined for the various analyses, summarized in Table 1, which includes accession numbers and whether morphology was coded for that terminal. Of those, 72 are araneids and 26 of those are zygielline araneids. The only previously described and identified Phonognatha or Deliochus in the molecular analyses was P. graeffei; A. melanopyga also appeared in the matrix from Kuntner et al. (2008). We sought to maximize the number of Phonognatha, Deliochus and Artifexgen. nov. representatives, as well as to sample the other main lineages of araneids and related families, for a relatively broad sampling across the Araneidae. This includes coding morphology only in the New Caledonia endemics A. joannae and P. neocaledonica for the biogeographic analysis, and other araneids with unique retreat architectures [e.g. Spilasma duodecimguttata (Keyserling, 1879)]. As part of this study, we sequenced material collected in Australia, as well as material graciously loaned from individuals and museums in Australia. This study includes 14 newly sequenced specimens, eight of which are lineages of Phonognatha, Deliochus or Artifexgen. nov. Non-zygielline araneid lineages include Acusilas dahoneusBarrion & Litsinger, 1995, DolophonesWalckenaer, 1837, Eriophora transmarina (Keyserling, 1865), Paraplectanoides crassipes Keyserling, 1865 and Spilasma duodecimguttata. Other sequences were selected from GenBank (Arnedo et al. 2004; Agnarsson & Blackledge, 2009; Álvarez-Padilla et al., 2009; Blackledge et al., 2009; Kuntner et al., 2009, 2013; Tanikawa et al., 2014; Gregorič et al., 2015; Dimitrov et al., 2017; Jang & Hwang, unpublished data). Table 1. Taxon sampling and GenBank accession numbers. Entries in bold are new for this study Taxon Partition Family Species 12S 16S 18S 28S COI H3 Morphology Araneidae Acanthepeira stellata FJ607443 FJ607477 FJ607516 FJ607551 FJ607590 x Araneidae Acusilas coccineus KR526388 KR526425 KR526466 KR526559 KR526602 x Araneidae Acusilas dahoneus RJKDNA013 MH047479 MH047505 MH047545 MH047519 MH047534 Araneidae Arachnura logio KJ958092 KJ957944 KJ957997 Araneidae Arachnura scorpionoides KJ958094 KJ957946 Araneidae Araneus diadematus FJ607445 FJ607479 FJ607518 FJ607553 FJ607592 x Araneidae Araneus dimidiatus KC848904 KC849109 KC848951 KC848985 KC849065 KC849024 Araneidae Araneus marmoreus EU003230 EU003341 EU003341 EU003341 EU153158 EU003397 EU003397 EU003278 EU003312 Araneidae Araniella yaginumai JN816530 JN816749 JN816957 JN817163 Araneidae Argiope argentata FJ607446 FJ607480 FJ607519 FJ607554 FJ607593 x Araneidae Argiope aurantia FJ525365 FJ525402 FJ525383 FJ525332 FJ525347 x Araneidae Argiope savignyi EU003231 EU003388 EU003388 EU153159 EU003398 EU003398 EU003279 Araneidae Artifex melanopyga RJKDNA025 MH047493 MH047480 MH047506 MH047546 MH047540 x Araneidae Artifex melanopyga RJKDNA026 MH047494 MH047481 MH047507 MH047547 MH047520 MH047541 Araneidae Artifex joannae x Araneidae Caerostris sp. 1230 KM486223 KM486283 KM486426 Araneidae Caerostris sp. 1243 † KM486224 KM486284 KM486133 KM486350 KM486427 Araneidae Caerostris sp. 1248 KM486225 KM486285 KM486351 KM486134 KM486428 Araneidae Chorizopes nipponicus JN816751 JN816959 JN817165 Araneidae Clitaetra episinoides KC848906 KC849111 KC848979 KC848987 KC849067 KC849026 Araneidae Clitaetra thisbe KC848909 KC849114 KC849070 KC849029 Araneidae Cyclosa conica EU003233 EU003254 EU003343 EU153161 EU003401 EU003282 EU003316 Araneidae Cyrtarache nagasakiensis KR259802 KR259802 Araneidae Cyrtophora moluccensis FJ607451 FJ607486 FJ607525 FJ607560 FJ607599 Araneidae Deliochus zelivira RJKDNA017 MH047496 MH047483 MH047509 MH047549 MH047523 MH047537 x Araneidae Deliochus humilis RJKDNA018 MH047495 MH047482 MH047508 MH047548 MH047521 MH047536 x Araneidae Deliochus idoneus EU003234 EU003259 EU003345 EU153164 EU003404 EU003284 Araneidae Deliochus idoneus RJKDNA018 MH047497 MH047484 MH047510 MH047550 MH047522 MH047538 x Araneidae Dolophones sp. RJKDNA032 MH047498 MH047485 MH047511 MH047551 MH047524 MH047543 Araneidae Eriophora ravilla RJKDNA029 MH047499 MH047486 MH047512 MH047552 MH047525 MH047542 Araneidae Eriophora transmarina RJDNA019 MH047500 MH047487 MH047513 MH047553 MH047526 MH047539 Araneidae Eustala sp. FJ525353 FJ525390 FJ525372 FJ525320 FJ525339 Araneidae Herennia multipuncta EU003236 EU003260 EU003384 EU003385 EU003386 EU003432 EU003433 EU003288 EU003320 Araneidae Gasteracantha cancriformis EU003235 EU003256 EU003348 EU003348 EU003348 EU153167 EU003407 EU003407 EU003287 EU003319 x Araneidae Gnolus sp. 1023 KP271558 KP271620 JN010182 KP271756 Araneidae Guizygiella nadleri KR526403 KR526441 KR526484 KR526577 KR526616 Araneidae Hypsosinga pygmaea KR259803 KR259803 Araneidae Larinioides cornutus EU003237 EU003250 EU003349 EU153168 EU003408 EU003289 EU003321 x Araneidae Leviellus inconveniens KR526405 KR526443 KR526486 KR526579 KR526618 Araneidae Levielleus poriensis KR526419 KR526460 KR526503 KR526596 KR526632 Araneidae Levellus stroemi KR526416 KR526456 KR526499 KR526592 KR526628 Araneidae Leviellus thorelli KR526406 KR526444 KR526487 KR526580 KR526619 Araneidae Mangora maculata EU003240 EU003258 EU003351 EU153171 EU003411 EU003411 EU003293 EU003323 x Araneidae Mastorphora phrynosoma FJ607458 FJ607495 FJ607534 FJ607569 FJ607607 Araneidae Mecynogea lemniscata EU003241 EU003352 EU153172 EU003412 EU003294 EU003324 x Araneidae Metepeira labyrinthea EU003242 EU003253 EU003355 EU153175 EU003415 EU003297 EU003327 x Araneidae Micrathena gracilis FJ525359 x Araneidae Milonia sp. H KR526408 KR526446 KR526489 KR526582 KR526621 Araneidae Neoscona arabesca EU003243 EU003252 EU003359 EU003359 EU003359 EU153180 EU003421 EU003421 EU003301 EU003332 Araneidae Neoscona crucifera FJ525360 FJ525397 FJ525378 FJ525327 x Araneidae Nephila clavipes KC848918 KC849124 KC848970 KC848998 KC849081 KC849040 x Araneidae Nephila edulis KC848921 KC849126 KC848972 KC849001 KC849083 KC849042 x Araneidae Nephilengys malabarensis KC848934 KC849140 KC848959 KC849014 KC849099 KC849055 x Araneidae Nephilingis cruentata KC849137 KC848976 KC849011 KC849052 x Araneidae Oarces sp. JN010171 JN010179 JN010193 JN010212 Araneidae Ordgarius hobsoni AB910472 AB910503 AB820882 Araneidae Paraplectana sakaguchii AB910465 AB910496 AB546976 Araneidae Paraplectanoides crassipes MH047501 MH047488 MH047514 MH047527 MH047531 Araneidae Pasilobus hupingensis AB910469 AB910500 AB910443 Araneidae Perilla teres KC848937 KC849058 KC848953 KC849017 Araneidae Phonognatha graeffei EU EU003245 EU003379 EU003380 EU003381 EU153183 EU003426 x Araneidae Phonognatha graeffei FJ FJ607469 FJ607508 FJ607543 FJ607582 FJ607620 Araneidae Phonognatha graeffei KY KY015309 KY015742 KY016323 KY016934 Araneidae Phonognatha graeffei KC KC848938 KC849143 KC848944 KC849018 KC849103 KC849059 Araneidae Phonognatha melania RJKDNA002 MH047502 MH047489 MH047515 MH047554 MH047528 MH047532 x Araneidae Phonognatha melania RJKDNA003 MH047490 MH047516 MH047555 MH047529 MH047533 Araneidae Phonognatha neocaledonica x Araneidae Phonognatha tanyodon RJKDNA015 MH047503 MH047491 MH047517 MH047556 MH047530 MH047535 x Araneidae Plebs astridae JN816542 JN816760 JN816969 JN817176 Araneidae Poltys sp. A KR526415 KR526454 KR526497 KR526590 Araneidae Spilasma duodecimgutta RJKDNA034 MH047504 MH047492 MH047518 MH047557 MH047544 Araneidae Verrucosa arenata FJ525364 FJ525401 FJ525382 FJ525331 FJ525346 Araneidae Yaginumia sia KR526417 KR526457 KR526500 KR526629 Araneidae Zygiella atrica KR526458 KR526501 KR526594 KR526630 Araneidae Zygiella dispar JF886866 Araneidae Zygiella keyserlingi KR526418 KR526459 KR526502 KR526595 KR526631 Araneidae Zygiella montana KR526412 KR526451 KR526494 KR526587 KR526626 Araneidae Zygiella nearctica GU684001 Araneidae Zygiella sp. KR526413 KR526452 KR526495 KR526588 KR526627 Araneidae Zygiella x-notata EU003248 EU003251 EU003367 EU003367 EU003367 EU153187 EU003431 EU003431 EU003311 EU003341 x Arkyidae Arkys cornutus FJ607448 FJ607482 FJ607521 FJ607556 FJ607595 x Arkyidae Archemorus sp. 1242 KM486214 KM486275 KM486127 KM486342 KM486476 Deinopidae Deinopis sp. EU003249 EU003382 EU003383 EU003383 EU153163 EU003403 EU003403 x Linyphiidae Linyphia triangularis EU003239 AY078664 EU003390 EU003390 EU153170 EU003410 EU003410 EU003292 AY078702 x Mimetidae Australomimetus sp. 1115 KP271530 KP271653 KP271728 KP271798 KP271855 Mimetidae Eros sp. 1092 KP271604 KP271663 KP271663 KP271738 KP271804 Mimetidae Gelanor insularis KP271552 KP271678 KP271750 KP271817 KP271881 x Nicodamidae Oncodamus bidens †† EU003274 EU003360 EU003436 EU003335 x Tetragnathidae Leucauge venusta EU003238 FJ525356 EU003350 EU153169 EU003409 EU003290 EU003322 x Tetragnathidae Meta menardi KC849121 EU003354 EU153174 EU003414 EU003296 EU003326 x Tetragnathidae Nanometa sp. 66 EU003391 EU153179 EU003420 EU003331 x Tetragnathidae Tetragnatha versicolor EU003246 EU003394 EU153185 EU003429 EU003429 EU003308 x Theridiidae Steatoda borealis EU003393 EU003393 EU153184 EU003428 EU003428 EU003307 x Theriodiosomatidae Epeirotypus brevipes EU003273 EU003347 EU003347 EU003347 EU153166 EU003406 EU003286 EU003318 x Uloboridae Uloborus glomosus EU003247 EU003366 EU003366 EU003366 EU003437 EU003438 EU003439 EU003310 EU003340 x Taxon Partition Family Species 12S 16S 18S 28S COI H3 Morphology Araneidae Acanthepeira stellata FJ607443 FJ607477 FJ607516 FJ607551 FJ607590 x Araneidae Acusilas coccineus KR526388 KR526425 KR526466 KR526559 KR526602 x Araneidae Acusilas dahoneus RJKDNA013 MH047479 MH047505 MH047545 MH047519 MH047534 Araneidae Arachnura logio KJ958092 KJ957944 KJ957997 Araneidae Arachnura scorpionoides KJ958094 KJ957946 Araneidae Araneus diadematus FJ607445 FJ607479 FJ607518 FJ607553 FJ607592 x Araneidae Araneus dimidiatus KC848904 KC849109 KC848951 KC848985 KC849065 KC849024 Araneidae Araneus marmoreus EU003230 EU003341 EU003341 EU003341 EU153158 EU003397 EU003397 EU003278 EU003312 Araneidae Araniella yaginumai JN816530 JN816749 JN816957 JN817163 Araneidae Argiope argentata FJ607446 FJ607480 FJ607519 FJ607554 FJ607593 x Araneidae Argiope aurantia FJ525365 FJ525402 FJ525383 FJ525332 FJ525347 x Araneidae Argiope savignyi EU003231 EU003388 EU003388 EU153159 EU003398 EU003398 EU003279 Araneidae Artifex melanopyga RJKDNA025 MH047493 MH047480 MH047506 MH047546 MH047540 x Araneidae Artifex melanopyga RJKDNA026 MH047494 MH047481 MH047507 MH047547 MH047520 MH047541 Araneidae Artifex joannae x Araneidae Caerostris sp. 1230 KM486223 KM486283 KM486426 Araneidae Caerostris sp. 1243 † KM486224 KM486284 KM486133 KM486350 KM486427 Araneidae Caerostris sp. 1248 KM486225 KM486285 KM486351 KM486134 KM486428 Araneidae Chorizopes nipponicus JN816751 JN816959 JN817165 Araneidae Clitaetra episinoides KC848906 KC849111 KC848979 KC848987 KC849067 KC849026 Araneidae Clitaetra thisbe KC848909 KC849114 KC849070 KC849029 Araneidae Cyclosa conica EU003233 EU003254 EU003343 EU153161 EU003401 EU003282 EU003316 Araneidae Cyrtarache nagasakiensis KR259802 KR259802 Araneidae Cyrtophora moluccensis FJ607451 FJ607486 FJ607525 FJ607560 FJ607599 Araneidae Deliochus zelivira RJKDNA017 MH047496 MH047483 MH047509 MH047549 MH047523 MH047537 x Araneidae Deliochus humilis RJKDNA018 MH047495 MH047482 MH047508 MH047548 MH047521 MH047536 x Araneidae Deliochus idoneus EU003234 EU003259 EU003345 EU153164 EU003404 EU003284 Araneidae Deliochus idoneus RJKDNA018 MH047497 MH047484 MH047510 MH047550 MH047522 MH047538 x Araneidae Dolophones sp. RJKDNA032 MH047498 MH047485 MH047511 MH047551 MH047524 MH047543 Araneidae Eriophora ravilla RJKDNA029 MH047499 MH047486 MH047512 MH047552 MH047525 MH047542 Araneidae Eriophora transmarina RJDNA019 MH047500 MH047487 MH047513 MH047553 MH047526 MH047539 Araneidae Eustala sp. FJ525353 FJ525390 FJ525372 FJ525320 FJ525339 Araneidae Herennia multipuncta EU003236 EU003260 EU003384 EU003385 EU003386 EU003432 EU003433 EU003288 EU003320 Araneidae Gasteracantha cancriformis EU003235 EU003256 EU003348 EU003348 EU003348 EU153167 EU003407 EU003407 EU003287 EU003319 x Araneidae Gnolus sp. 1023 KP271558 KP271620 JN010182 KP271756 Araneidae Guizygiella nadleri KR526403 KR526441 KR526484 KR526577 KR526616 Araneidae Hypsosinga pygmaea KR259803 KR259803 Araneidae Larinioides cornutus EU003237 EU003250 EU003349 EU153168 EU003408 EU003289 EU003321 x Araneidae Leviellus inconveniens KR526405 KR526443 KR526486 KR526579 KR526618 Araneidae Levielleus poriensis KR526419 KR526460 KR526503 KR526596 KR526632 Araneidae Levellus stroemi KR526416 KR526456 KR526499 KR526592 KR526628 Araneidae Leviellus thorelli KR526406 KR526444 KR526487 KR526580 KR526619 Araneidae Mangora maculata EU003240 EU003258 EU003351 EU153171 EU003411 EU003411 EU003293 EU003323 x Araneidae Mastorphora phrynosoma FJ607458 FJ607495 FJ607534 FJ607569 FJ607607 Araneidae Mecynogea lemniscata EU003241 EU003352 EU153172 EU003412 EU003294 EU003324 x Araneidae Metepeira labyrinthea EU003242 EU003253 EU003355 EU153175 EU003415 EU003297 EU003327 x Araneidae Micrathena gracilis FJ525359 x Araneidae Milonia sp. H KR526408 KR526446 KR526489 KR526582 KR526621 Araneidae Neoscona arabesca EU003243 EU003252 EU003359 EU003359 EU003359 EU153180 EU003421 EU003421 EU003301 EU003332 Araneidae Neoscona crucifera FJ525360 FJ525397 FJ525378 FJ525327 x Araneidae Nephila clavipes KC848918 KC849124 KC848970 KC848998 KC849081 KC849040 x Araneidae Nephila edulis KC848921 KC849126 KC848972 KC849001 KC849083 KC849042 x Araneidae Nephilengys malabarensis KC848934 KC849140 KC848959 KC849014 KC849099 KC849055 x Araneidae Nephilingis cruentata KC849137 KC848976 KC849011 KC849052 x Araneidae Oarces sp. JN010171 JN010179 JN010193 JN010212 Araneidae Ordgarius hobsoni AB910472 AB910503 AB820882 Araneidae Paraplectana sakaguchii AB910465 AB910496 AB546976 Araneidae Paraplectanoides crassipes MH047501 MH047488 MH047514 MH047527 MH047531 Araneidae Pasilobus hupingensis AB910469 AB910500 AB910443 Araneidae Perilla teres KC848937 KC849058 KC848953 KC849017 Araneidae Phonognatha graeffei EU EU003245 EU003379 EU003380 EU003381 EU153183 EU003426 x Araneidae Phonognatha graeffei FJ FJ607469 FJ607508 FJ607543 FJ607582 FJ607620 Araneidae Phonognatha graeffei KY KY015309 KY015742 KY016323 KY016934 Araneidae Phonognatha graeffei KC KC848938 KC849143 KC848944 KC849018 KC849103 KC849059 Araneidae Phonognatha melania RJKDNA002 MH047502 MH047489 MH047515 MH047554 MH047528 MH047532 x Araneidae Phonognatha melania RJKDNA003 MH047490 MH047516 MH047555 MH047529 MH047533 Araneidae Phonognatha neocaledonica x Araneidae Phonognatha tanyodon RJKDNA015 MH047503 MH047491 MH047517 MH047556 MH047530 MH047535 x Araneidae Plebs astridae JN816542 JN816760 JN816969 JN817176 Araneidae Poltys sp. A KR526415 KR526454 KR526497 KR526590 Araneidae Spilasma duodecimgutta RJKDNA034 MH047504 MH047492 MH047518 MH047557 MH047544 Araneidae Verrucosa arenata FJ525364 FJ525401 FJ525382 FJ525331 FJ525346 Araneidae Yaginumia sia KR526417 KR526457 KR526500 KR526629 Araneidae Zygiella atrica KR526458 KR526501 KR526594 KR526630 Araneidae Zygiella dispar JF886866 Araneidae Zygiella keyserlingi KR526418 KR526459 KR526502 KR526595 KR526631 Araneidae Zygiella montana KR526412 KR526451 KR526494 KR526587 KR526626 Araneidae Zygiella nearctica GU684001 Araneidae Zygiella sp. KR526413 KR526452 KR526495 KR526588 KR526627 Araneidae Zygiella x-notata EU003248 EU003251 EU003367 EU003367 EU003367 EU153187 EU003431 EU003431 EU003311 EU003341 x Arkyidae Arkys cornutus FJ607448 FJ607482 FJ607521 FJ607556 FJ607595 x Arkyidae Archemorus sp. 1242 KM486214 KM486275 KM486127 KM486342 KM486476 Deinopidae Deinopis sp. EU003249 EU003382 EU003383 EU003383 EU153163 EU003403 EU003403 x Linyphiidae Linyphia triangularis EU003239 AY078664 EU003390 EU003390 EU153170 EU003410 EU003410 EU003292 AY078702 x Mimetidae Australomimetus sp. 1115 KP271530 KP271653 KP271728 KP271798 KP271855 Mimetidae Eros sp. 1092 KP271604 KP271663 KP271663 KP271738 KP271804 Mimetidae Gelanor insularis KP271552 KP271678 KP271750 KP271817 KP271881 x Nicodamidae Oncodamus bidens †† EU003274 EU003360 EU003436 EU003335 x Tetragnathidae Leucauge venusta EU003238 FJ525356 EU003350 EU153169 EU003409 EU003290 EU003322 x Tetragnathidae Meta menardi KC849121 EU003354 EU153174 EU003414 EU003296 EU003326 x Tetragnathidae Nanometa sp. 66 EU003391 EU153179 EU003420 EU003331 x Tetragnathidae Tetragnatha versicolor EU003246 EU003394 EU153185 EU003429 EU003429 EU003308 x Theridiidae Steatoda borealis EU003393 EU003393 EU153184 EU003428 EU003428 EU003307 x Theriodiosomatidae Epeirotypus brevipes EU003273 EU003347 EU003347 EU003347 EU153166 EU003406 EU003286 EU003318 x Uloboridae Uloborus glomosus EU003247 EU003366 EU003366 EU003366 EU003437 EU003438 EU003439 EU003310 EU003340 x † Caerostris morphology information arbitrarily appended to this taxon for total evidence analysis. †† Morphological coding supplemented by Ambicodamus sp. following Álvarez-Padilla et al. (2009). View Large Table 1. Taxon sampling and GenBank accession numbers. Entries in bold are new for this study Taxon Partition Family Species 12S 16S 18S 28S COI H3 Morphology Araneidae Acanthepeira stellata FJ607443 FJ607477 FJ607516 FJ607551 FJ607590 x Araneidae Acusilas coccineus KR526388 KR526425 KR526466 KR526559 KR526602 x Araneidae Acusilas dahoneus RJKDNA013 MH047479 MH047505 MH047545 MH047519 MH047534 Araneidae Arachnura logio KJ958092 KJ957944 KJ957997 Araneidae Arachnura scorpionoides KJ958094 KJ957946 Araneidae Araneus diadematus FJ607445 FJ607479 FJ607518 FJ607553 FJ607592 x Araneidae Araneus dimidiatus KC848904 KC849109 KC848951 KC848985 KC849065 KC849024 Araneidae Araneus marmoreus EU003230 EU003341 EU003341 EU003341 EU153158 EU003397 EU003397 EU003278 EU003312 Araneidae Araniella yaginumai JN816530 JN816749 JN816957 JN817163 Araneidae Argiope argentata FJ607446 FJ607480 FJ607519 FJ607554 FJ607593 x Araneidae Argiope aurantia FJ525365 FJ525402 FJ525383 FJ525332 FJ525347 x Araneidae Argiope savignyi EU003231 EU003388 EU003388 EU153159 EU003398 EU003398 EU003279 Araneidae Artifex melanopyga RJKDNA025 MH047493 MH047480 MH047506 MH047546 MH047540 x Araneidae Artifex melanopyga RJKDNA026 MH047494 MH047481 MH047507 MH047547 MH047520 MH047541 Araneidae Artifex joannae x Araneidae Caerostris sp. 1230 KM486223 KM486283 KM486426 Araneidae Caerostris sp. 1243 † KM486224 KM486284 KM486133 KM486350 KM486427 Araneidae Caerostris sp. 1248 KM486225 KM486285 KM486351 KM486134 KM486428 Araneidae Chorizopes nipponicus JN816751 JN816959 JN817165 Araneidae Clitaetra episinoides KC848906 KC849111 KC848979 KC848987 KC849067 KC849026 Araneidae Clitaetra thisbe KC848909 KC849114 KC849070 KC849029 Araneidae Cyclosa conica EU003233 EU003254 EU003343 EU153161 EU003401 EU003282 EU003316 Araneidae Cyrtarache nagasakiensis KR259802 KR259802 Araneidae Cyrtophora moluccensis FJ607451 FJ607486 FJ607525 FJ607560 FJ607599 Araneidae Deliochus zelivira RJKDNA017 MH047496 MH047483 MH047509 MH047549 MH047523 MH047537 x Araneidae Deliochus humilis RJKDNA018 MH047495 MH047482 MH047508 MH047548 MH047521 MH047536 x Araneidae Deliochus idoneus EU003234 EU003259 EU003345 EU153164 EU003404 EU003284 Araneidae Deliochus idoneus RJKDNA018 MH047497 MH047484 MH047510 MH047550 MH047522 MH047538 x Araneidae Dolophones sp. RJKDNA032 MH047498 MH047485 MH047511 MH047551 MH047524 MH047543 Araneidae Eriophora ravilla RJKDNA029 MH047499 MH047486 MH047512 MH047552 MH047525 MH047542 Araneidae Eriophora transmarina RJDNA019 MH047500 MH047487 MH047513 MH047553 MH047526 MH047539 Araneidae Eustala sp. FJ525353 FJ525390 FJ525372 FJ525320 FJ525339 Araneidae Herennia multipuncta EU003236 EU003260 EU003384 EU003385 EU003386 EU003432 EU003433 EU003288 EU003320 Araneidae Gasteracantha cancriformis EU003235 EU003256 EU003348 EU003348 EU003348 EU153167 EU003407 EU003407 EU003287 EU003319 x Araneidae Gnolus sp. 1023 KP271558 KP271620 JN010182 KP271756 Araneidae Guizygiella nadleri KR526403 KR526441 KR526484 KR526577 KR526616 Araneidae Hypsosinga pygmaea KR259803 KR259803 Araneidae Larinioides cornutus EU003237 EU003250 EU003349 EU153168 EU003408 EU003289 EU003321 x Araneidae Leviellus inconveniens KR526405 KR526443 KR526486 KR526579 KR526618 Araneidae Levielleus poriensis KR526419 KR526460 KR526503 KR526596 KR526632 Araneidae Levellus stroemi KR526416 KR526456 KR526499 KR526592 KR526628 Araneidae Leviellus thorelli KR526406 KR526444 KR526487 KR526580 KR526619 Araneidae Mangora maculata EU003240 EU003258 EU003351 EU153171 EU003411 EU003411 EU003293 EU003323 x Araneidae Mastorphora phrynosoma FJ607458 FJ607495 FJ607534 FJ607569 FJ607607 Araneidae Mecynogea lemniscata EU003241 EU003352 EU153172 EU003412 EU003294 EU003324 x Araneidae Metepeira labyrinthea EU003242 EU003253 EU003355 EU153175 EU003415 EU003297 EU003327 x Araneidae Micrathena gracilis FJ525359 x Araneidae Milonia sp. H KR526408 KR526446 KR526489 KR526582 KR526621 Araneidae Neoscona arabesca EU003243 EU003252 EU003359 EU003359 EU003359 EU153180 EU003421 EU003421 EU003301 EU003332 Araneidae Neoscona crucifera FJ525360 FJ525397 FJ525378 FJ525327 x Araneidae Nephila clavipes KC848918 KC849124 KC848970 KC848998 KC849081 KC849040 x Araneidae Nephila edulis KC848921 KC849126 KC848972 KC849001 KC849083 KC849042 x Araneidae Nephilengys malabarensis KC848934 KC849140 KC848959 KC849014 KC849099 KC849055 x Araneidae Nephilingis cruentata KC849137 KC848976 KC849011 KC849052 x Araneidae Oarces sp. JN010171 JN010179 JN010193 JN010212 Araneidae Ordgarius hobsoni AB910472 AB910503 AB820882 Araneidae Paraplectana sakaguchii AB910465 AB910496 AB546976 Araneidae Paraplectanoides crassipes MH047501 MH047488 MH047514 MH047527 MH047531 Araneidae Pasilobus hupingensis AB910469 AB910500 AB910443 Araneidae Perilla teres KC848937 KC849058 KC848953 KC849017 Araneidae Phonognatha graeffei EU EU003245 EU003379 EU003380 EU003381 EU153183 EU003426 x Araneidae Phonognatha graeffei FJ FJ607469 FJ607508 FJ607543 FJ607582 FJ607620 Araneidae Phonognatha graeffei KY KY015309 KY015742 KY016323 KY016934 Araneidae Phonognatha graeffei KC KC848938 KC849143 KC848944 KC849018 KC849103 KC849059 Araneidae Phonognatha melania RJKDNA002 MH047502 MH047489 MH047515 MH047554 MH047528 MH047532 x Araneidae Phonognatha melania RJKDNA003 MH047490 MH047516 MH047555 MH047529 MH047533 Araneidae Phonognatha neocaledonica x Araneidae Phonognatha tanyodon RJKDNA015 MH047503 MH047491 MH047517 MH047556 MH047530 MH047535 x Araneidae Plebs astridae JN816542 JN816760 JN816969 JN817176 Araneidae Poltys sp. A KR526415 KR526454 KR526497 KR526590 Araneidae Spilasma duodecimgutta RJKDNA034 MH047504 MH047492 MH047518 MH047557 MH047544 Araneidae Verrucosa arenata FJ525364 FJ525401 FJ525382 FJ525331 FJ525346 Araneidae Yaginumia sia KR526417 KR526457 KR526500 KR526629 Araneidae Zygiella atrica KR526458 KR526501 KR526594 KR526630 Araneidae Zygiella dispar JF886866 Araneidae Zygiella keyserlingi KR526418 KR526459 KR526502 KR526595 KR526631 Araneidae Zygiella montana KR526412 KR526451 KR526494 KR526587 KR526626 Araneidae Zygiella nearctica GU684001 Araneidae Zygiella sp. KR526413 KR526452 KR526495 KR526588 KR526627 Araneidae Zygiella x-notata EU003248 EU003251 EU003367 EU003367 EU003367 EU153187 EU003431 EU003431 EU003311 EU003341 x Arkyidae Arkys cornutus FJ607448 FJ607482 FJ607521 FJ607556 FJ607595 x Arkyidae Archemorus sp. 1242 KM486214 KM486275 KM486127 KM486342 KM486476 Deinopidae Deinopis sp. EU003249 EU003382 EU003383 EU003383 EU153163 EU003403 EU003403 x Linyphiidae Linyphia triangularis EU003239 AY078664 EU003390 EU003390 EU153170 EU003410 EU003410 EU003292 AY078702 x Mimetidae Australomimetus sp. 1115 KP271530 KP271653 KP271728 KP271798 KP271855 Mimetidae Eros sp. 1092 KP271604 KP271663 KP271663 KP271738 KP271804 Mimetidae Gelanor insularis KP271552 KP271678 KP271750 KP271817 KP271881 x Nicodamidae Oncodamus bidens †† EU003274 EU003360 EU003436 EU003335 x Tetragnathidae Leucauge venusta EU003238 FJ525356 EU003350 EU153169 EU003409 EU003290 EU003322 x Tetragnathidae Meta menardi KC849121 EU003354 EU153174 EU003414 EU003296 EU003326 x Tetragnathidae Nanometa sp. 66 EU003391 EU153179 EU003420 EU003331 x Tetragnathidae Tetragnatha versicolor EU003246 EU003394 EU153185 EU003429 EU003429 EU003308 x Theridiidae Steatoda borealis EU003393 EU003393 EU153184 EU003428 EU003428 EU003307 x Theriodiosomatidae Epeirotypus brevipes EU003273 EU003347 EU003347 EU003347 EU153166 EU003406 EU003286 EU003318 x Uloboridae Uloborus glomosus EU003247 EU003366 EU003366 EU003366 EU003437 EU003438 EU003439 EU003310 EU003340 x Taxon Partition Family Species 12S 16S 18S 28S COI H3 Morphology Araneidae Acanthepeira stellata FJ607443 FJ607477 FJ607516 FJ607551 FJ607590 x Araneidae Acusilas coccineus KR526388 KR526425 KR526466 KR526559 KR526602 x Araneidae Acusilas dahoneus RJKDNA013 MH047479 MH047505 MH047545 MH047519 MH047534 Araneidae Arachnura logio KJ958092 KJ957944 KJ957997 Araneidae Arachnura scorpionoides KJ958094 KJ957946 Araneidae Araneus diadematus FJ607445 FJ607479 FJ607518 FJ607553 FJ607592 x Araneidae Araneus dimidiatus KC848904 KC849109 KC848951 KC848985 KC849065 KC849024 Araneidae Araneus marmoreus EU003230 EU003341 EU003341 EU003341 EU153158 EU003397 EU003397 EU003278 EU003312 Araneidae Araniella yaginumai JN816530 JN816749 JN816957 JN817163 Araneidae Argiope argentata FJ607446 FJ607480 FJ607519 FJ607554 FJ607593 x Araneidae Argiope aurantia FJ525365 FJ525402 FJ525383 FJ525332 FJ525347 x Araneidae Argiope savignyi EU003231 EU003388 EU003388 EU153159 EU003398 EU003398 EU003279 Araneidae Artifex melanopyga RJKDNA025 MH047493 MH047480 MH047506 MH047546 MH047540 x Araneidae Artifex melanopyga RJKDNA026 MH047494 MH047481 MH047507 MH047547 MH047520 MH047541 Araneidae Artifex joannae x Araneidae Caerostris sp. 1230 KM486223 KM486283 KM486426 Araneidae Caerostris sp. 1243 † KM486224 KM486284 KM486133 KM486350 KM486427 Araneidae Caerostris sp. 1248 KM486225 KM486285 KM486351 KM486134 KM486428 Araneidae Chorizopes nipponicus JN816751 JN816959 JN817165 Araneidae Clitaetra episinoides KC848906 KC849111 KC848979 KC848987 KC849067 KC849026 Araneidae Clitaetra thisbe KC848909 KC849114 KC849070 KC849029 Araneidae Cyclosa conica EU003233 EU003254 EU003343 EU153161 EU003401 EU003282 EU003316 Araneidae Cyrtarache nagasakiensis KR259802 KR259802 Araneidae Cyrtophora moluccensis FJ607451 FJ607486 FJ607525 FJ607560 FJ607599 Araneidae Deliochus zelivira RJKDNA017 MH047496 MH047483 MH047509 MH047549 MH047523 MH047537 x Araneidae Deliochus humilis RJKDNA018 MH047495 MH047482 MH047508 MH047548 MH047521 MH047536 x Araneidae Deliochus idoneus EU003234 EU003259 EU003345 EU153164 EU003404 EU003284 Araneidae Deliochus idoneus RJKDNA018 MH047497 MH047484 MH047510 MH047550 MH047522 MH047538 x Araneidae Dolophones sp. RJKDNA032 MH047498 MH047485 MH047511 MH047551 MH047524 MH047543 Araneidae Eriophora ravilla RJKDNA029 MH047499 MH047486 MH047512 MH047552 MH047525 MH047542 Araneidae Eriophora transmarina RJDNA019 MH047500 MH047487 MH047513 MH047553 MH047526 MH047539 Araneidae Eustala sp. FJ525353 FJ525390 FJ525372 FJ525320 FJ525339 Araneidae Herennia multipuncta EU003236 EU003260 EU003384 EU003385 EU003386 EU003432 EU003433 EU003288 EU003320 Araneidae Gasteracantha cancriformis EU003235 EU003256 EU003348 EU003348 EU003348 EU153167 EU003407 EU003407 EU003287 EU003319 x Araneidae Gnolus sp. 1023 KP271558 KP271620 JN010182 KP271756 Araneidae Guizygiella nadleri KR526403 KR526441 KR526484 KR526577 KR526616 Araneidae Hypsosinga pygmaea KR259803 KR259803 Araneidae Larinioides cornutus EU003237 EU003250 EU003349 EU153168 EU003408 EU003289 EU003321 x Araneidae Leviellus inconveniens KR526405 KR526443 KR526486 KR526579 KR526618 Araneidae Levielleus poriensis KR526419 KR526460 KR526503 KR526596 KR526632 Araneidae Levellus stroemi KR526416 KR526456 KR526499 KR526592 KR526628 Araneidae Leviellus thorelli KR526406 KR526444 KR526487 KR526580 KR526619 Araneidae Mangora maculata EU003240 EU003258 EU003351 EU153171 EU003411 EU003411 EU003293 EU003323 x Araneidae Mastorphora phrynosoma FJ607458 FJ607495 FJ607534 FJ607569 FJ607607 Araneidae Mecynogea lemniscata EU003241 EU003352 EU153172 EU003412 EU003294 EU003324 x Araneidae Metepeira labyrinthea EU003242 EU003253 EU003355 EU153175 EU003415 EU003297 EU003327 x Araneidae Micrathena gracilis FJ525359 x Araneidae Milonia sp. H KR526408 KR526446 KR526489 KR526582 KR526621 Araneidae Neoscona arabesca EU003243 EU003252 EU003359 EU003359 EU003359 EU153180 EU003421 EU003421 EU003301 EU003332 Araneidae Neoscona crucifera FJ525360 FJ525397 FJ525378 FJ525327 x Araneidae Nephila clavipes KC848918 KC849124 KC848970 KC848998 KC849081 KC849040 x Araneidae Nephila edulis KC848921 KC849126 KC848972 KC849001 KC849083 KC849042 x Araneidae Nephilengys malabarensis KC848934 KC849140 KC848959 KC849014 KC849099 KC849055 x Araneidae Nephilingis cruentata KC849137 KC848976 KC849011 KC849052 x Araneidae Oarces sp. JN010171 JN010179 JN010193 JN010212 Araneidae Ordgarius hobsoni AB910472 AB910503 AB820882 Araneidae Paraplectana sakaguchii AB910465 AB910496 AB546976 Araneidae Paraplectanoides crassipes MH047501 MH047488 MH047514 MH047527 MH047531 Araneidae Pasilobus hupingensis AB910469 AB910500 AB910443 Araneidae Perilla teres KC848937 KC849058 KC848953 KC849017 Araneidae Phonognatha graeffei EU EU003245 EU003379 EU003380 EU003381 EU153183 EU003426 x Araneidae Phonognatha graeffei FJ FJ607469 FJ607508 FJ607543 FJ607582 FJ607620 Araneidae Phonognatha graeffei KY KY015309 KY015742 KY016323 KY016934 Araneidae Phonognatha graeffei KC KC848938 KC849143 KC848944 KC849018 KC849103 KC849059 Araneidae Phonognatha melania RJKDNA002 MH047502 MH047489 MH047515 MH047554 MH047528 MH047532 x Araneidae Phonognatha melania RJKDNA003 MH047490 MH047516 MH047555 MH047529 MH047533 Araneidae Phonognatha neocaledonica x Araneidae Phonognatha tanyodon RJKDNA015 MH047503 MH047491 MH047517 MH047556 MH047530 MH047535 x Araneidae Plebs astridae JN816542 JN816760 JN816969 JN817176 Araneidae Poltys sp. A KR526415 KR526454 KR526497 KR526590 Araneidae Spilasma duodecimgutta RJKDNA034 MH047504 MH047492 MH047518 MH047557 MH047544 Araneidae Verrucosa arenata FJ525364 FJ525401 FJ525382 FJ525331 FJ525346 Araneidae Yaginumia sia KR526417 KR526457 KR526500 KR526629 Araneidae Zygiella atrica KR526458 KR526501 KR526594 KR526630 Araneidae Zygiella dispar JF886866 Araneidae Zygiella keyserlingi KR526418 KR526459 KR526502 KR526595 KR526631 Araneidae Zygiella montana KR526412 KR526451 KR526494 KR526587 KR526626 Araneidae Zygiella nearctica GU684001 Araneidae Zygiella sp. KR526413 KR526452 KR526495 KR526588 KR526627 Araneidae Zygiella x-notata EU003248 EU003251 EU003367 EU003367 EU003367 EU153187 EU003431 EU003431 EU003311 EU003341 x Arkyidae Arkys cornutus FJ607448 FJ607482 FJ607521 FJ607556 FJ607595 x Arkyidae Archemorus sp. 1242 KM486214 KM486275 KM486127 KM486342 KM486476 Deinopidae Deinopis sp. EU003249 EU003382 EU003383 EU003383 EU153163 EU003403 EU003403 x Linyphiidae Linyphia triangularis EU003239 AY078664 EU003390 EU003390 EU153170 EU003410 EU003410 EU003292 AY078702 x Mimetidae Australomimetus sp. 1115 KP271530 KP271653 KP271728 KP271798 KP271855 Mimetidae Eros sp. 1092 KP271604 KP271663 KP271663 KP271738 KP271804 Mimetidae Gelanor insularis KP271552 KP271678 KP271750 KP271817 KP271881 x Nicodamidae Oncodamus bidens †† EU003274 EU003360 EU003436 EU003335 x Tetragnathidae Leucauge venusta EU003238 FJ525356 EU003350 EU153169 EU003409 EU003290 EU003322 x Tetragnathidae Meta menardi KC849121 EU003354 EU153174 EU003414 EU003296 EU003326 x Tetragnathidae Nanometa sp. 66 EU003391 EU153179 EU003420 EU003331 x Tetragnathidae Tetragnatha versicolor EU003246 EU003394 EU153185 EU003429 EU003429 EU003308 x Theridiidae Steatoda borealis EU003393 EU003393 EU153184 EU003428 EU003428 EU003307 x Theriodiosomatidae Epeirotypus brevipes EU003273 EU003347 EU003347 EU003347 EU153166 EU003406 EU003286 EU003318 x Uloboridae Uloborus glomosus EU003247 EU003366 EU003366 EU003366 EU003437 EU003438 EU003439 EU003310 EU003340 x † Caerostris morphology information arbitrarily appended to this taxon for total evidence analysis. †† Morphological coding supplemented by Ambicodamus sp. following Álvarez-Padilla et al. (2009). View Large Parsimony analyses Static homology analyses of morphological data were conducted using TNT (Goloboff, Farris & Nixon, 2008). Traditional and new technology searches were performed on the 42 taxa by 235 characters matrix (coded specimens marked with an ‘x’ in Table 1). These taxa were culled from the studies of Kuntner et al. (2008) and Álvarez-Padilla et al. (2009), with additional morphological coding of members of Phonognatha, Deliochus, Artifexgen. nov. and Zygiella. Multistate characters were treated as non-additive (Fitch, 1971). A summary of morphological characters examined can be found in the Supporting Information (Appendix S1). A total of 1000 Wagner trees were searched for the traditional analysis, with subsequent subtree pruning and regrafting (SPR), and tree bisection and reconnection (TBR) branch rearrangement methods were applied. Bootstrap, jackknife and Bremer support methods of resampling were used to evaluate nodal support. Morphological data for Caerostris from Kuntner et al. (2008) was arbitrarily assigned to sequence data associated with Caerostris sp. 1243; the taxon ‘Nicodamidae’ is a composite following Álvarez-Padilla et al. (2009). One of the conspecific sequenced Phonognatha, Deliochus and Artifexgen. nov., was arbitrarily assigned morphological and behavioural data. Morphological and behavioural character state changes were be mapped on to the total evidence tree using WINCLADA (Nixon, 1999) and ambiguous optimizations were examined using both ACCTRAN and DELTRAN. Model-based analyses Specimens used in this study are presented in the Supporting Information (Appendix S2), including locality and voucher information. Specimens preserved in 95% ethanol were used for DNA extraction using the Qiagen DNEasy kit. Left legs were used for extractions and the remainders are preserved as vouchers. Six markers were amplified for analyses. These are mitochondrial ribosomal markers 12S rRNA (~400 bp) and 16S rRNA (~550 bp), cytoplasmic ribosomal markers 18S rRNA (~1800 bp) and 28S rRNA (~2700 bp), nuclear protein-coding gene histone H3 (~327 bp), and mitochondrial protein-coding gene cytochrome c oxidase subunit I or COI (~800 bp). PCR was completed using the Promega GoTaq kit, using the primers in Table 2. The generalized thermocycle was initial denaturation at 94 °C for 2 minutes, followed by a cycle of denaturation at 94 °C for 30 s, annealing at 40–56 °C for 35 s (see details following) and elongation at 65 °C for 30 s repeated 34 times, with a final elongation step at 72 °C for 3 min, followed by cooldown for 10 °C for 30 min, then held at 4 °C. Annealing temperatures were started at the following temperatures, then modified up or down by 2 °C to achieve clean, thin bands on a 1.5% agarose gel: 12S (46–48 °C), 16S (46–48 °C), 18S (48–52 °), 28S (48–52 °C), COI (40–48 °C) and H3 (53–56 °C). Amplified products were sent to Macrogen USA in Rockville, MD for sequencing. Contigs were formed using GENEIOUS 6.0.6 (http://www.geneious.com;Kearse et al., 2012), then queried against NCBI BLAST nucleotide database to check for contamination. Table 2. Primers used in this study Marker Direction Primer Sequence (5’→3’) Reference 12S forward 12S-ai AAACTAGGATTAGATACCCTATTAT Köcher et al. (1989) 12S reverse 12S-bi AAGAGCGACGGGCGATGTGT Köcher et al. (1989) 16S forward 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 16S reverse 16S-B CTCCGGTTTGAACTCAGATCA Palumbi et al. (1991) 18S1 forward 18S-1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. (1996) 18S1 reverse 18S-5R CTTGGCAAATGCTTTCGC Giribet et al. (1996) 18S2 forward 18S-4F CCAGCAGCCGCGCTAATTC Giribet et al. (1996) 18S2 reverse 18S-7R GCATCACAGACCTGTTATTGC Giribet et al. (1996) 18S3 forward 18S-a2.0 ATGGTTGCAAAGCTGAAA Whiting et al. (1997) 18S3 reverse 18S-9R GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996) 28S1 forward 28S-rd1a CCCSCGTAAYTTAGGCATAT Crandall, Harris & Fetzner Jr. (2000) 28S1 reverse 28S-Rd4b CCTTGGTCCGTGTTTCAAGAC Crandall, Harris & Fetzner Jr. (2000) 28S2 forward 28S-A GACCCGTCTTGAAGCACG Whiting et al. (1997) 28S2 reverse 28S-B TCGGAAGGAACCAGCTACTA Whiting et al. (1997) 28S3 forward 28S-Rd4.8a ACCTATTCTCAAACTTTAAATGG Whiting (2002) 28S3 reverse 28S-Rd7b1 GACTTCCCTTACCTACAT Whiting (2002) COI forward LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COI reverse HCOout CCAGGTAAAATTAAAATATAAACTTC Carpenter & Wheeler (1999) COI forward SL-F CTGCTATAGTTGGAACAGCTATAAG da Silva-Moreira & Hormiga (unpublished) COI reverse SL-R AAATGAGCTACTACATAATAAGTATCATG da Silva-Moreira & Hormiga (unpublished) H3 forward aF ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998) H3 reverse aR ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998) Marker Direction Primer Sequence (5’→3’) Reference 12S forward 12S-ai AAACTAGGATTAGATACCCTATTAT Köcher et al. (1989) 12S reverse 12S-bi AAGAGCGACGGGCGATGTGT Köcher et al. (1989) 16S forward 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 16S reverse 16S-B CTCCGGTTTGAACTCAGATCA Palumbi et al. (1991) 18S1 forward 18S-1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. (1996) 18S1 reverse 18S-5R CTTGGCAAATGCTTTCGC Giribet et al. (1996) 18S2 forward 18S-4F CCAGCAGCCGCGCTAATTC Giribet et al. (1996) 18S2 reverse 18S-7R GCATCACAGACCTGTTATTGC Giribet et al. (1996) 18S3 forward 18S-a2.0 ATGGTTGCAAAGCTGAAA Whiting et al. (1997) 18S3 reverse 18S-9R GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996) 28S1 forward 28S-rd1a CCCSCGTAAYTTAGGCATAT Crandall, Harris & Fetzner Jr. (2000) 28S1 reverse 28S-Rd4b CCTTGGTCCGTGTTTCAAGAC Crandall, Harris & Fetzner Jr. (2000) 28S2 forward 28S-A GACCCGTCTTGAAGCACG Whiting et al. (1997) 28S2 reverse 28S-B TCGGAAGGAACCAGCTACTA Whiting et al. (1997) 28S3 forward 28S-Rd4.8a ACCTATTCTCAAACTTTAAATGG Whiting (2002) 28S3 reverse 28S-Rd7b1 GACTTCCCTTACCTACAT Whiting (2002) COI forward LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COI reverse HCOout CCAGGTAAAATTAAAATATAAACTTC Carpenter & Wheeler (1999) COI forward SL-F CTGCTATAGTTGGAACAGCTATAAG da Silva-Moreira & Hormiga (unpublished) COI reverse SL-R AAATGAGCTACTACATAATAAGTATCATG da Silva-Moreira & Hormiga (unpublished) H3 forward aF ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998) H3 reverse aR ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998) View Large Table 2. Primers used in this study Marker Direction Primer Sequence (5’→3’) Reference 12S forward 12S-ai AAACTAGGATTAGATACCCTATTAT Köcher et al. (1989) 12S reverse 12S-bi AAGAGCGACGGGCGATGTGT Köcher et al. (1989) 16S forward 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 16S reverse 16S-B CTCCGGTTTGAACTCAGATCA Palumbi et al. (1991) 18S1 forward 18S-1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. (1996) 18S1 reverse 18S-5R CTTGGCAAATGCTTTCGC Giribet et al. (1996) 18S2 forward 18S-4F CCAGCAGCCGCGCTAATTC Giribet et al. (1996) 18S2 reverse 18S-7R GCATCACAGACCTGTTATTGC Giribet et al. (1996) 18S3 forward 18S-a2.0 ATGGTTGCAAAGCTGAAA Whiting et al. (1997) 18S3 reverse 18S-9R GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996) 28S1 forward 28S-rd1a CCCSCGTAAYTTAGGCATAT Crandall, Harris & Fetzner Jr. (2000) 28S1 reverse 28S-Rd4b CCTTGGTCCGTGTTTCAAGAC Crandall, Harris & Fetzner Jr. (2000) 28S2 forward 28S-A GACCCGTCTTGAAGCACG Whiting et al. (1997) 28S2 reverse 28S-B TCGGAAGGAACCAGCTACTA Whiting et al. (1997) 28S3 forward 28S-Rd4.8a ACCTATTCTCAAACTTTAAATGG Whiting (2002) 28S3 reverse 28S-Rd7b1 GACTTCCCTTACCTACAT Whiting (2002) COI forward LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COI reverse HCOout CCAGGTAAAATTAAAATATAAACTTC Carpenter & Wheeler (1999) COI forward SL-F CTGCTATAGTTGGAACAGCTATAAG da Silva-Moreira & Hormiga (unpublished) COI reverse SL-R AAATGAGCTACTACATAATAAGTATCATG da Silva-Moreira & Hormiga (unpublished) H3 forward aF ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998) H3 reverse aR ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998) Marker Direction Primer Sequence (5’→3’) Reference 12S forward 12S-ai AAACTAGGATTAGATACCCTATTAT Köcher et al. (1989) 12S reverse 12S-bi AAGAGCGACGGGCGATGTGT Köcher et al. (1989) 16S forward 16S-A CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 16S reverse 16S-B CTCCGGTTTGAACTCAGATCA Palumbi et al. (1991) 18S1 forward 18S-1F TACCTGGTTGATCCTGCCAGTAG Giribet et al. (1996) 18S1 reverse 18S-5R CTTGGCAAATGCTTTCGC Giribet et al. (1996) 18S2 forward 18S-4F CCAGCAGCCGCGCTAATTC Giribet et al. (1996) 18S2 reverse 18S-7R GCATCACAGACCTGTTATTGC Giribet et al. (1996) 18S3 forward 18S-a2.0 ATGGTTGCAAAGCTGAAA Whiting et al. (1997) 18S3 reverse 18S-9R GATCCTTCCGCAGGTTCACCTAC Giribet et al. (1996) 28S1 forward 28S-rd1a CCCSCGTAAYTTAGGCATAT Crandall, Harris & Fetzner Jr. (2000) 28S1 reverse 28S-Rd4b CCTTGGTCCGTGTTTCAAGAC Crandall, Harris & Fetzner Jr. (2000) 28S2 forward 28S-A GACCCGTCTTGAAGCACG Whiting et al. (1997) 28S2 reverse 28S-B TCGGAAGGAACCAGCTACTA Whiting et al. (1997) 28S3 forward 28S-Rd4.8a ACCTATTCTCAAACTTTAAATGG Whiting (2002) 28S3 reverse 28S-Rd7b1 GACTTCCCTTACCTACAT Whiting (2002) COI forward LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COI reverse HCOout CCAGGTAAAATTAAAATATAAACTTC Carpenter & Wheeler (1999) COI forward SL-F CTGCTATAGTTGGAACAGCTATAAG da Silva-Moreira & Hormiga (unpublished) COI reverse SL-R AAATGAGCTACTACATAATAAGTATCATG da Silva-Moreira & Hormiga (unpublished) H3 forward aF ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998) H3 reverse aR ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998) View Large Multiple sequence alignments were completed using MAFFT v.7.017 (Katoh & Standley, 2013). Alignments of 12S and 16S were completed using L-INS-i, ideal for samples with a single conserved domain. For 18S and 28s, the E-INS-i method was used, which is used to account for missing fragments. The protein-coding genes COI and H3 were aligned using MACSE (Ranwez et al., 2011), which can detect frameshifts and stop codons in alignments. To account for missing data and poor alignment, TRIMAL v.1.2 was used with the gappyout setting (Capella-Gutierrez, Silla-Martinez & Gabaldon, 2009). The concatenated molecular sequence matrix consisted of 6028 bp. The maximum likelihood analysis was conducted using RAxML 8.2.8 (Stamatakis, 2014) on CIPRES (Miller, Pfeiffer & Schwartz, 2011). A total of 93 taxa with nucleotide sequence data were included. Partition schemes were tested using PARTITIONFINDER 1.1.1 (Lanfear et al., 2012), with ten possible partitions: four non-protein coding markers (12S, 16S, 18S, 28S) and two protein-coding markers (COI, H3) further partitioned by codon position. The rapid bootstrapping algorithm option to find a single best-scoring tree with the GTRGAMMA model was used. Bootstrap iterations were set to 1000. The root was set as Uloborus glomosus (Walckenaer, 1841) (Uloboridae). Relaxed clock Bayesian analyses were conducted using MRBAYES 3.2.6 (Ronquist & Huelsenbeck, 2003) on the high-performance cluster Colonial One at The George Washington University. A molecular matrix of 93 taxa and a total evidence matrix, including 95 taxa (two additional Phonognatha that could not be sequenced), were analysed. As in the maximum likelihood analysis, PARTITIONFINDER 1.1.1 (Lanfear et al., 2012) was used on the molecular partitions; the morphological partition was analysed using the Mk model (Lewis, 2001). We used the fossilized birth–death prior for under-sampled lineages and the independent gamma rates model with broad speciation priors (exp[10]), extinction (beta[1,1]) and fossilization (beta[1,1]) following Zhang et al. (2015) and Pyron (2017). The tree age prior is set to 175–200 Mya based on analyses by Dimitrov et al. (2017). The clock rate prior is set by log normalizing the estimated substitution rate of cytochrome c oxidase I (Bidegaray-Batista & Arnedo, 2011). A total of 16 chains (4 cold, 12 heated) were run for 100 million generations, with the first 25% discarded as burn-in. Convergence was considered achieved when estimated sample sizes (ESS) were above 100 and traces from log files examined in TRACER v.1.6 (Rambaut et al. 2014) were plateaued. The early fossil record of many orb-weaving spider clades is sparse, and interpreting the fossils described so far is difficult due to the quality of preservation. There are two fossils currently described as early araneids: Mesozygiella dunlopiPenney & Ortuño, 2006 and Olindarachne martinsnetoi (Downen, 2011), both from the late Aptian Age (115–121 Myr). Nevertheless, the placement of these taxa as araneids seems somewhat tenuous, at least in part due to the synapomorphies allowing attribution to Araneidae being very limited (e.g. Coddington, 1986; Dimitrov et al., 2017). Therefore, despite the strengths of additional calibrations, we have opted to calibrate solely based on the substitution rate, rather than introduce uncertainty from incorrect fossil placement. Trees were rooted as in maximum likelihood analyses. Biogeography The R package BIOGEOBEARS was used for ancestral range estimation as it includes a framework for comparison of various models of biogeography (Matzke, 2013). This method allows for modelling using the LAGRANGE DEC model (Ree & Smith, 2008) and maximum-likelihood approximations of DIVA (Ronquist, 1997) and BAYAREALIKE (Landis et al., 2013). These biogeographic models have various strengths and weaknesses: DEC has parameters for dispersal and extinction that may change at cladogenetic events (Ree & Smith, 2008; Matzke, 2014); DIVALIKE approximates the parsimony effects of DIVA (Ronquist, 1997), namely dispersal and vicariance; BAYAREALIKE (Landis et al., 2013), which is suited to broad sympatry. Furthermore, BIOGEOBEARS implements another free parameter, j, which is designed for ‘jump’ speciation, or a founder effect from colonization from a main population. The j parameter can be applied to each of the three biogeographic models, allowing for six possible configurations for comparison that were applied to the time-calibrated total evidence results from MRBAYES. Seven areas were allocated for the 20 zygielline taxa included in this study. These are Palearctic (P), Nearctic (N), Indomalayan (I), New Caledonia (C), Queensland north of the St. Lawrence Gap (Q), eastern Australia south of the St. Lawrence Gap (S) and Western Australia (W). The first three areas represent biogeographic realms, and the latter four are more specific to Australia and New Caledonia, and have been informed by prior studies of biogeography (including spiders) in the area (Crisp et al., 2004; Rix & Harvey, 2012). Queensland north of the St. Lawrence Gap (Q) represents tropical wet forests that sometimes have a distinct fauna from more temperate forests to the south (S) and is thought to be biologically relevant since the early Tertiary Period. The appearance of the Nullarbor Plain is thought to occur during the early Miocene, and could be a viciarance event separating Western Australia (W) from the south-east (S). The 20 zygielline taxa were coded as present or absent for each of these areas based on material examined for the taxonomic revision. Additionally, a dispersal matrix approximating relative probability of movement between two areas was also applied, with intercontinental dispersal coded as less likely (0.1) than intracontinental dispersal (1.0). The nested models (with and without the founding parameter) were compared using likelihood ratio tests. AIC scores were calculated for comparison of the six models. Retreat evolution We coded the 89 unique species in the total evidence data matrix based on the retreat form used by that species. The terminal taxa were coded in one of the following five character states based on our own observations or literature records: no snare web (e.g. arkyids, mimetids), snare web and no retreat (e.g. tetragnathids), web with adjacent retreat (typically composed of leaves modified with silk, e.g. Araneus marmoreus, Fig. 3E), web with integrated leaf retreat [e.g. Phonognatha melania (Fig. 2A), Phonognatha graeffei (Fig. 3A), Acusilas sp. (Fig. 3B)], and web with integrated detritus retreat (e.g. Metepeira labyrinthea and Spilasma duodecimguttata, Fig. 3C, D). This coding is a modification of the analysis of Gregorič et al. (2015), who broadly classified all relatively complex retreats as silk tubes. We divided the ‘silk tube’ class further, and decided to include relatively simple leaf-curling as a retreat adjacent to the web, to more finely examine the variation of retreats within Araneidae. It must be emphasized that retreat type can vary within genera, and the coding is for the specifically sampled taxon, where possible. The ultrametric tree from the total evidence analysis was analysed in R (R Core Team, 2015) using the packages APE (Paradis, Claude & Strimmer, 2004), PHYTOOLS (Revell, 2012) and GEIGER (Harmon et al., 2007). Three discrete character likelihood models were applied: equal transition rates between all states (ER), equal symmetric transition rates between two states that differ from a different relationship between two states (SYM) and different rates for each state, where each rate is parameterized separately (ARD). This was carried out using the rerootingMethod and fitMk functions in phytools, and results were scored using AIC. The best scoring model was used to perform an ancestral state reconstruction on web retreats using stochasti